Modified AAV P5 promoter for improved vector titer and purity
Modified P5 promoters and REP nicking sites in AAV vectors reduce DNA contamination and enhance titer, addressing safety and purity issues in AAV vector production for therapeutic use.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ST JUDE CHILDRENS RES HOSPITAL INC
- Filing Date
- 2024-04-29
- Publication Date
- 2026-05-19
AI Technical Summary
Existing AAV vector production systems face challenges with DNA contamination and dose-dependent toxicity, necessitating improved safety and purity in gene delivery tools.
The use of modified P5 promoters, such as P5 homologs from alternative AAV serotypes or altered REP nicking sites, reduces unintended nucleic acid packaging and maintains or enhances rAAV titer and purity by regulating REP protein expression.
This approach significantly decreases DNA contamination and maintains or increases rAAV titer, improving the safety and efficacy of AAV vectors for therapeutic applications.
Smart Images

Figure 2026516003000001_ABST
Abstract
Description
Technical Field
[0001] Introduction This application claims the benefit of U.S. Provisional Patent Application No. 63 / 499,297, filed May 1, 2023, the contents of which are hereby incorporated by reference in their entirety.
[0002] Statement Regarding Electronic Submission of Sequence Listing An XML text format sequence list titled "SJ0110WO_ST26.XML", having a size of 22,796 bytes and generated on April 13, 2024, is provided in lieu of a paper copy, submitted under 37 C.F.R. §§ 1.831 - 1.834. This sequence list is hereby incorporated by reference.
Background Art
[0003] Background The relatively easy production and versatility of recombinant adeno-associated virus (rAAV) have made AAV a popular gene delivery tool, combined with robust transduction of non-dividing cells. Clinical success in the treatment of hemophilia and other monogenic diseases has helped increase interest in gene transfer via AAV as a therapeutic strategy. Although rAAV therapy offers significant clinical benefits, improvement of its safety remains a top priority. Immunogenic reactions after treatment have been observed in multiple studies, and dose-dependent toxicity has been reported in some research models.
[0004] The wild-type AAV genome consists of four duplicated same-frame replication (Rep) genes and three duplicated same-frame capsid (Cap) genes. Further selective reading frame proteins, membrane-associated accessory proteins, and AAV assembly proteins are embedded within the capsid gene region. The expression of these proteins is driven by three promoters: P5, P19, and P40. P5 drives the expression of the large REP proteins REP78 and REP68, P19 drives the expression of the short REP proteins REP52 and REP40, and P40 drives the expression of the capsid genes VP1, VP2, and VP3. This 4.7kb genome is flanked by inverted terminal repeats (ITRs). In rAAV production, the ITRs are flanked by the expression cassette of interest, which is packaged into the rAAV virion. The replication genes and capsid genes are, in most cases, delivered in separate plasmid constructs. The AAV2 P5 promoter is used in most clinical human embryonic kidney 293T-based rAAV production systems. Similar to wild-type AAV, P5 transcribes REP78 and REP68 in rAAV production. P5 achieves this through promoter activity that reads the entire plasmid backbone, either by being positioned at the wild-type location relative to Rep, or immediately downstream of the capsid gene. qPCR analysis of rAAV formulations has demonstrated the presence of upstream contamination sequences of P5 on the REP-CAP-producing plasmid packaged within the rAAV virion, raising safety concerns.
[0005] Previous efforts to eliminate these contaminants have focused on design interventions such as increasing the size of expression cassette backbone plasmids or implementing DNA minicircles in the production process. However, there has been relatively little research into the causes and effects of these DNA impurities.
[0006] Replacing the P5 promoter with the HIV-LTR promoter, or combining the CMV promoter with the metallothionein promoter, has been proposed (US5,658,776 and Allen et al. (2000) Mol. Ther. 1(1):88-95), but no change in the level of DNA contamination has been demonstrated. Similarly, the insertion of a spacer located between the 3' end of the AAV P5 promoter and the 5' end of the rep gene start codon has been shown to regulate REP protein expression (see WO2019 / 217483), but no change in the level of DNA contamination has been demonstrated.
[0007] WO 2021 / 242664 describes the reduction of DNA contamination by inserting an exogenous spacer between the REP binding site and the Ying-Yang 1 (YY1) binding site, which localizes the transcription start site in the P5 promoter. However, there remains a need in the art for alternative AAV vectors that prevent unintended nucleic acid packaging during rAAV production, thereby improving purity and safety. [Overview of the project]
[0008] Summary of the Invention The present invention provides a recombinant adeno-associated virus (AAV) vector having a polynucleotide encoding the AAV2 replication (REP)68 / 78 protein operably ligated to (a) a P5 promoter homolog; (b) a P5 promoter comprising a terminal degradation sequence having a nucleotide sequence, ctccnntttgaag (SEQ ID NO: 18), where "nn" may be any dinucleotide except "at"; or (c) a P5 promoter comprising a terminal degradation sequence having a nucleotide sequence, ctccn1tttn2gaag (SEQ ID NO: 19), where n1 and n2 may each independently be a, c, t, or g, except when n1 is "a" and n2 is not "t".
[0009] The present invention also provides a P5 promoter comprising a terminal decomposition sequence having ctccnntttgaag (SEQ ID NO: 18), where "nn" may be any dinucleotide except "at"; or ctccn1tttn2gaag (SEQ ID NO: 19), where n1 and n2 may each independently be a, c, t, or g, except when n1 is "a" and n2 is not "t".
[0010] Host cells containing AAV vectors as described herein are also provided as a method for increasing the titer and / or purity of recombinant adeno-associated virus (rAAV). [Brief explanation of the drawing]
[0011] [Figure 1] Figure 1 illustrates the structures of the AAV2 P5 promoter, the AAV2 P5 promoter with an exogenous spacer between the REP binding site and the YY1 binding site (P5-HS system), and the AAV2 P5 promoter with a terminal degradation sequence (TRS) loop sequence derived from AAV5 (P5 promoter-AAV5 loop).
[0012] [Figure 2] Figure 2 shows the level of contaminating DNA (top panel) and the titer of FIX when the P5 promoter (CR21) of the AAV2 construct contains the following: a spacer between the YY1 box and the P5 REP binding site (CR21+HS5), a TRS loop sequence derived from AAV5 (AAV2 P5+AAV5 TRS loop), or a TRS loop sequence containing GC (TRS dinucleotide GC), GT (TRS dinucleotide GT), TT (TRS dinucleotide TT), AA (TRS dinucleotide AA), or CA (TRS dinucleotide CA) dinucleotides.
[0013] [Figure 3] Figure 3 shows the design of a green fluorescent protein (GFP) reporter assay for quantifying the effects of promoter modification.
[0014] [Figure 4] Figure 4 shows that the TRS change that significantly reduces contamination also affects the promoter function.
[0015] [Figure 5] Figure 5 shows that changing the REP start codon from ACG to ATG improves the virus titer.
[0016] [Figure 6] Figure 6 shows that changing the REP start codon from ACG to ATG does not change the level of DNA contamination.
[0017] [Figure 7] Figure 7 shows that replacing the AAV2 P5 promoter with the P5 homolog can reduce contamination outside the P5 promoter and outside the inverted terminal repeat (ITR). *, P = 0.0127; **, P = 0.0414; ***, P = 0.0376.
[0018] [Figure 8] Figure 8 shows that replacing the AAV2 P5 promoter with the P5 homolog can improve the virus titer compared to AAV2 P5. *, P = 0.0332; **, P = 0.0042; ***, P = 0.0007.
[0019] [Figure 9] Figure 9 shows that the AAV13 P5 homolog (P13) does not tolerate TRS modifications such as the GC dinucleotide TRS loop (GC di), the AA dinucleotide TRS loop (AA di), or the AAV5 TRS loop (AAV5 TRS).
[0020] [Figure 10]Figure 10 shows the Western blot analysis of the expression of large REP and small REP. Protein levels were determined in the lysates at 12 hours (upper panel) and 48 hours (lower panel) after transfection.
[0021] [Figure 11] Figure 11 shows that when the vector was prepared on a large scale, in the modified construct of TRS, DNA contamination was reduced from 2% to 0.05%.
[0022] [Figure 12] Figures 12A - 12B provide data showing that the P5 modification reduces promoter activity during AAV production. Figure 12A, schematic diagram of the construct showing that green fluorescent protein (GFP) is embedded in REP - CAP and separated from REP78 by the self - cleaving peptide p2a. Figure 12B, fluorescence was monitored during AAV production using the IncuCyte® Live - Cell Analysis System.
[0023] [Figure 13] Figures 13A - 13D show that increasing the REP - CAP plasmid ratio boosts the titer but does not boost the contamination in a 6 - well plate. Figure 13A, schematic diagram of the construct used in this analysis. Figure 13B, titer. Figures 13C - 13D, contamination outside the P5 promoter and outside the ITR, respectively.
[0024] [Figure 14] Figures 14A - 14B show that increasing the REP - CAP plasmid ratio boosts the titer but does not boost the contamination in a 15 - cm plate. Figure 14A, titer. Figure 14B, Western blot analysis of REP expression.
[0025] [Figure 15]Figures 15A–15C show the effect of the modified P5 promoter on the titer of the vector produced (Figure 15A), and the effect of contamination (Figures 15B–15C) on ssAAV8 HLP vector production when the transgene (FVIIIv3) is present. In Figure 15A, the titer of the modified P5 was approximately 75% of that of wild-type P5 in a 10-layer cell stack. In Figures 15B–15C, purity was maintained using 1X (Figure 15B) or 3X (Figure 15C) REP-CAP plasmids with the modified P5.
[0026] [Figure 16] Figures 16A–16C show the improvement in purity due to competitive inhibition. AAV-producing plasmids were mixed with modified oligonucleotides (containing the RBE sequence) annealed at molar ratios of 5%, 10%, 25%, 50%, and 100% relative to the amount of REP-CAP plasmid. Analysis of the pellet on day 2 is shown. Figure 16A, FIX titer. Figure 16B, P5 signal. Figure 16C, vector purity.
[0027] [Figure 17] Figure 17 shows in vivo expression demonstrating that vectors produced from REP-CAP with a modified p5 promoter exhibited equivalent transgene expression. [Modes for carrying out the invention]
[0028] Detailed Description of the Invention Provided herein is the use of P5 homologs derived from AAV serotypes other than AAV2, or direct modification of the REP nicking site of the AAV2 P5 promoter, for eliminating the incorporation of active contaminants from the REP-CAP plasmid while maintaining or improving rAAV titer. Accordingly, AAV vectors (e.g., rAAV vectors or plasmids) possessing a P5 promoter containing a P5 promoter homolog or a modified REP nicking site, as well as their use in methods for increasing rAAV titer and / or purity, are provided. The AAV vectors and methods described herein are found to have applications in the production of rAAV in commercial and / or research settings, e.g., via the REP-CAP plasmid, as well as in several recombinant bocavirus production systems using AAV REP proteins.
[0029] As used herein, the term “vector” refers to a polynucleotide capable of transporting another polynucleotide to which it is linked. Vectors include, but are not limited to, polynucleotide molecules that are single-stranded, double-stranded, or partially double-stranded; polynucleotide molecules containing one or more free ends, or those without free ends (e.g., circular); polynucleotide molecules containing DNA, RNA, or both; and various other polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted by standard molecular cloning techniques, for example. Another type of vector is a viral vector, in which a viral DNA or RNA sequence is present in the vector for packaging into a virus (e.g., adeno-associated virus). Viral vectors also include polynucleotides carried by the virus for transduction into host cells.
[0030] "Recombinant" nucleic acids or polynucleotides refer to nucleotide sequences created by molecular biological techniques (e.g., cloning, enzyme restriction, and / or ligation steps) and / or chemical synthesis.
[0031] The terms “adeno-associated virus” or “AAV,” “recombinant AAV” or “rAAV” encompass, unless otherwise specified, serotypes AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, avian AAV, bovine AAV, canine AAV, equine AAV, sheep AAV, and recombinant-generated capsids prepared by methods such as directed evolution and peptide display. Typically, AAVs can infect both dividing and non-dividing cells and can exist extrachromosomally without being integrated into the host cell's genome. AAVs also include codon-optimized AAVs.
[0032] As used herein, “polynucleotides encoding AAV2 replication (REP)68 / 78 proteins” refers to polynucleotides encoding REP78 and REP68 proteins produced from unspliced and spliced transcripts, respectively, from the P5 promoter. REP78 and REP68 are multifunctional proteins with functions that largely overlap at almost every stage of the AAV life cycle, including site-directed DNA binding, helicase activity, and / or site-directed endonuclease activity. REP78 and / or REP68 are required in trans for AAV replication and / or excision from the host genome (US5,658,776;US5,837,484;WO98 / 27207;US5,658,785;US7,785,888). The polynucleotides encoding AAV2 REP68 / 78 proteins as used herein are well known in the art. For example, the genome sequence of AAV2 is available under GENBANK accession numbers J01901, AF043303, and NC_001401.2.
[0033] As is well known in the art, the AAV2 P5 promoter is a regulator that controls the expression of AAV2 REP68 and REP78 proteins. In the absence of helper viruses, P5 is repressed by YY1 and has minimal activity. In the presence of helper viruses, expression increases and REP is produced. Low levels of REP expression repress transcription from the P5 promoter. REP-mediated repression is due to REP binding to a REP-binding element (RBE) located between the TATA and YY1+1 sites of the P5 promoter. Downstream of the P5 RBE is the sequence of a terminal degradation sequence (ctccattttgaag; SEQ ID NO: 1) located within the YY1+1 site of the P5 element. When combined with the RBE and TATA elements, P5 TRS can undergo REP-dependent nicking and DNA amplification. While we don't want to be constrained by theory, it's conceivable that by using a P5 homolog or modifying the REP nicking site in the AAV2 P5 promoter, we could efficiently bind the REP protein to DNA without nicking it. This would allow us to maintain autoregulation of REP68 / 78 expression, albeit at a lower overall level. Thus, efficient vector production would be maintained while preventing unintended replication initiated outside the P5 promoter.
[0034] Therefore, in one respect, a recombinant AAV vector is provided in which the wild-type AAV2P5 promoter is replaced with a P5 promoter homolog. When referring to a sequence (e.g., one introduced into a cell and / or virus), “wild-type,” “wt,” or “wild-type” refers to the sequence that occurs in nature (e.g., in cells and / or viruses). Given that almost all loci exist in various allele forms and their frequencies vary across the geographical range of a species, the “wild-type” sequence may refer to the sequence that occurs most frequently in nature. As an example, the wild-type AAV2 P5 promoter may have the following nucleotide sequence: gaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgctgggtatttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaa (SEQ ID NO: 12) (For example, see Pereira et al. (1997) J. Virol. 71(2):1079-88).
[0035] The promoters described herein may include at least 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or 160 nucleotides adjacent to (or upstream of) the transcription start sites of large REP proteins (i.e., REP78 and REP68) in the AAV genome, or sequences having at least 90%, 91%, 92%, 93%, 95%, 96%, 97%, 98% or more sequence identity with them.
[0036] A "P5 promoter homolog" or "AAV2 P5 promoter homolog" refers to a promoter region derived from an AAV serotype other than AAV2 that functions in a manner similar to the AAV2 P5 promoter. In some embodiments, P5 promoter homologs are derived, obtained, or isolated from serotypes AAV1, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or their synthetic variant promoters. In other embodiments, P5 promoter homologs have the nucleotide sequences of SEQ ID NOs. 13–17.
[0037] In another aspect, a recombinant P5 promoter and an AAV vector containing the same are provided, wherein the REP nickeling site of the wild-type P5 promoter (e.g., AAV2 P5 promoter) is modified. In one aspect, the REP nickeling site located in the terminal decomposition sequence (TRS) is modified. In several aspects, the wild-type P5 TRS sequence (e.g., ctccattttgaag (SEQ ID NO: 1)) is replaced with a TRS having the nucleotide sequence ctccctttggaag (SEQ ID NO: 2), ctccgctttgaag (SEQ ID NO: 3), ctccgttttgaag (SEQ ID NO: 4), ctcctttttgaag (SEQ ID NO: 5), ctccaatttgaag (SEQ ID NO: 6), or ctcccatttgaag (SEQ ID NO: 7). In other aspects, a wild-type P5 TRS sequence (e.g., ctccattttgaag (SEQ ID NO: 1)) is replaced by a TRS having the nucleotide sequence ctccnnttttgaag (SEQ ID NO: 18), where the "nn" dinucleotide may be any dinucleotide except "at," for example, "nn" may be "aa," "ac," "ag," "ca," "cc," "ct," "ct," "ta," "tc," "tt," "tg," "ga," "gc," "gt," or "gg." In some aspects, a wild-type P5 TRS sequence (e.g., ctccattttgaag (SEQ ID NO: 1)) is replaced by a TRS having the nucleotide sequence ctccn1tttn2gaag (SEQ ID NO: 19), where n1 and n2 may independently be a, c, t, or g, except that when n1 is "a," n2 cannot be "t."
[0038] When operably ligated to a polynucleotide encoding the REP68 / 78 protein, the modified P5 promoter or P5 promoter homolog described herein provides efficient vector production while reducing or removing contaminating DNA. As used herein, the term “operably ligated” means ligating a sequence so that the sequence performs its intended function. For example, operably ligating a promoter sequence to a polynucleotide sequence of interest means ligating the promoter sequence to the polynucleotide sequence of interest in such a way that the promoter sequence can direct the transcription of the polynucleotide sequence of interest and / or the synthesis of the polypeptide encoded by the polynucleotide sequence of interest.
[0039] In some aspects, when the promoter disclosed herein is operably ligated to the nucleic acid encoding the AAV2 REP68 / 78 protein, the REP68 / 78 start codon has the nucleotide sequence ATG. As is known in the art, “codon” refers to a specific sequence of three adjacent nucleotides on a DNA or RNA strand that specifies the genetic code information for synthesizing a particular amino acid. “Start codon” is the first codon of an RNA transcript. In some aspects, the start codon may be ACG or ATG.
[0040] The P5 promoters described herein may be provided alone as isolated polynucleotides, or as part of a longer polynucleotide containing other nucleotide sequences. Therefore, some embodiments also provide isolated polynucleotides containing the promoters described herein. As will be readily apparent to those skilled in the art, the isolated polynucleotides may further contain one or more additional elements or sequences, such as any of those described herein or those known in the art.
[0041] In some aspects, vectors possessing the modified P5 promoter described herein are also provided. The modified P5 promoter of this disclosure can be incorporated into any suitable vector to control or drive the transcription of large REP proteins, namely REP78 and REP68, or to upregulate the expression of small REP proteins, namely REP52 and REP40. In some aspects, the vector is a viral vector. Ideally, the vector is an AAV vector.
[0042] In some respects, AAV vectors may be episomal vectors, i.e., vectors that do not integrate into the host cell genome. In other respects, AAV vectors may be vectors that integrate into the host cell genome. Vector systems using the AAV2 REP and AAV2 P5 promoters may include the modified promoters described herein. For example, a feedback loop between the P5 promoter and the AAV2 REP gene is used for the production of recombinant bocavirus (Yan, et al. (2013) Mol. Ther. 21:2181-2194).
[0043] In some respects, the modified P5 promoter and AAV rep and cap genes are present in the plasmid. The AAV2 rep gene may be combined with cap genes from any AAV serotype, including but not limited to AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9, and their synthetic variants.
[0044] Vectors suitable for use in mammalian cells are widely described and well known in the art. Those skilled in the art will understand that the vectors herein, including the promoters described herein, also include additional sequences and elements useful for vector replication, vector selection, and sequence expression in prokaryotic and / or eukaryotic cells. For example, the vectors of this disclosure may include prokaryotic replicons (i.e., sequences capable of directing autonomous extrachromosomal replication and maintenance of the vector in prokaryotic host cells, such as bacterial host cells). Such replicons are well known in the art. In some embodiments, the vector may include shuttle elements that make the vector suitable for replication and integration in both prokaryotes and eukaryotes. In addition, the vector may also include genes whose expression confers detectable markers, such as drug resistance genes, enabling host cell selection and maintenance. The vector may also have reportable markers, such as genes encoding fluorescent or other detectable proteins.
[0045] Vectors may also include transcription enhancers, translation signals, and transcription and translation termination signals. Examples of transcription termination signals include, but are not limited to, polyadenylation signal sequences such as bovine growth hormone (BGH) poly(A), SV40 late poly(A), rabbit betaglobin (RBG) poly(A), thymidine kinase (TK) poly(A) sequences, and any variants thereof.
[0046] Recombinant virions, including recombinant AAV virions produced using the viral vectors described herein, are also provided. Most typically, recombinant virions contain heterologous coding sequences operably ligated to a promoter. As will be understood by those skilled in the art, in most cases not all nucleotides of a viral vector are packaged into the recombinant virus. For example, in AAV vector packaging, only the ITR and nucleotides adjacent to the ITR (including the promoter and other sequences downstream of the promoter and upstream of the 3'ITR, such as heterologous coding sequences) are packaged into the recombinant AAV. Recombinant virions can be used to deliver heterologous coding sequences to host cells for expression in those cells.
[0047] Methods for packaging viral vectors to produce recombinant virions are well known in the art, and any of these methods can be used to produce recombinant virions. For example, a method for producing recombinant AAV includes introducing an AAV vector encoding a heterologous coding sequence, helper functions for generating productive AAV infection, and AAV cap and rep genes (the latter including a modified P5 promoter as described herein) into a packaging cell line; and recovering recombinant AAV from the supernatant of the packaging cell line. Various types of cells can be used as packaging cell lines. For example, usable packaging cell lines include, but are not limited to, HEK293 cells, HeLa cells, and Vero cells, such as those disclosed in US2011 / 0201088.
[0048] Helper function may be provided by one or more helper plasmids or helper viruses possessing adenovirus helper genes. Non-limiting examples of adenovirus helper genes include E1A, E1B, E2A, E4, and VA, which can provide helper function to AAV packaging. Helper viruses for AAV are known in the art and include, for example, viruses of the Adenoviridae and Herpesviridae families. Examples of AAV helper viruses include, but are not limited to, the SAdV-13 helper virus and SAdV-13-like helper virus described in US2011 / 0201088, and the helper vector pHELP (Applied Viromics). Those skilled in the art will naturally understand that any AAV helper virus or helper plasmid capable of providing appropriate helper function to AAV may be used herein.
[0049] In some cases, recombinant AAV is produced by using a cell line that stably expresses some of the components necessary for AAV virion production. For example, a plasmid (or multiple plasmids) containing a modified P5 promoter, AAV rep and cap genes, and a selectable marker such as a neomycin resistance gene can be integrated into the genome of a cell (packaging cell). The packaging cell line can then be co-infected with a helper virus (e.g., an adenovirus providing helper function) and an AAV vector for expressing the heterologous gene of interest. The advantage of this method is that the cells are selectable and it is suitable for large-scale production of recombinant AAV. In another non-limiting example, an adenovirus or baculovirus, rather than a plasmid, may be used to introduce the rep and cap genes into the packaging cell. In yet another non-limiting example, both the AAV vector for expressing the heterologous gene of interest and the rep-cap gene (including the modified P5 promoter) can be stably integrated into the DNA of the producing cell, and recombinant AAV can be produced by providing helper function with a wild-type adenovirus.
[0050] As will be readily apparent to those skilled in the art, any method suitable for the purification of AAV can be used in the embodiments described herein for the purification of recombinant AAV, and such methods are well known in the art. For example, recombinant AAV can be isolated and purified from packaging cells and / or the supernatant of packaging cells. In some aspects, AAV is purified by separation methods using a CsCl gradient. In other aspects, AAV is purified using a solid support containing a matrix on which an artificial receptor or receptor-like molecule that mediates AAV adhesion is immobilized, as described in US2002 / 0136710.
[0051] This specification also provides host cells harboring the AAV vector or virion of this disclosure. In some cases, the host cell is used to amplify, replicate, package, and / or purify the vector or virion. In other examples, the host cell is used to express a heterologous coding sequence under the control of a suitable promoter. In some aspects, the method may be in vitro, ex vivo, or in vivo.
[0052] Exemplary host cells include prokaryotic and eukaryotic cells. In some cases, the host cells are mammalian host cells. Where cells are used to package the viral vectors described herein, the cells may also be transfected with one or more plasmids or infected with one or more viruses that provide the helper and accessory molecules necessary for packaging. In further examples, the host cells may stably express one or more helper and accessory molecules, such as from the genome. Selecting appropriate host cells for amplification, replication, packaging and / or purification of the vectors or recombinant virions described herein is well within the skill of those skilled in the art. Exemplary mammalian host cells include, but are not limited to, HEK-293 cells, HeLa cells, Vero cells, HUH7 cells, and HepG2 cells.
[0053] A method for increasing the titer and / or purity of rAAV is also provided, by operably ligating a nucleic acid encoding the AAV2 REP68 / 78 protein to a P5 promoter homolog or a P5 promoter containing a TRS having the nucleotide sequence of SEQ ID NOs. 2–7. As demonstrated herein, P5 promoter homologs and P5 promoters containing modified REP nicking sites result in the production of higher quality clinical-grade AAV products while maintaining or increasing titer compared to conventional production systems. In some aspects of this method, rAAV titer and / or purity increases by approximately 10%, 20%, 30%, 40%, 50%, 60%, and 70% or more compared to rAAV without the P5 promoter homolog or modified P5 promoter described herein, e.g., rAAV containing a wild-type P5 promoter. rAAV purity can be assessed by the presence / level of encapsulated DNA contamination, as described herein.
[0054] An advantage of the present invention is that AAV can be produced in a cell transfection system without incorporating contaminating DNA upstream of the P5 promoter. The level of contaminating DNA is the release criterion for AAV gene therapy trials, and reducing the level of contaminating DNA can improve both the purity of the vector and the likelihood of the vector being approved for trial.
[0055] Therefore, the rAAVs described herein are found to be particularly useful in the treatment of subjects requiring them, for example, in the treatment of hemophilia and other monogenic disorders. In such uses, the rAAV may be provided as a pharmaceutical composition comprising an rAAV vector in a mixture with pharmaceutically acceptable excipients, diluents, or carriers. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate-buffered saline, water, emulsions such as oil / water emulsions, various wetting agents, sterile solutions, and so on. Such carriers can be formulated by conventional methods and administered to the subject in a therapeutically effective amount.
[0056] The following non-limiting examples are provided to further illustrate the present invention.
[0057] Example 1: Modification of the AAV2 P5 promoter An exogenous spacer (HS5) between the REP binding site and the transcription start site localization Ying-Yang 1 (YY1) binding site has been demonstrated to reduce DNA contamination without accompanying a reduction in viral titer (WO 2021 / 242664). Therefore, it was hypothesized that the packaging of contaminated plasmid sequences is related to the P5 promoter structure and rep gene expression during production. Thus, capsidation of contaminated sequences can be reduced by manipulating key elements of the P5 promoter and regulating rep expression.
[0058] In one aspect, we determined whether modifying the REP-nicking site of the AAV2 P5 promoter affected the titer and packaging of the contaminated plasmid sequence. Therefore, a series of rationally designed end-degradation sequence (TRS) loop modifications were generated (Table 1; Example 1). Table 1 [Table 1]
[0059] The results of this analysis suggest that, similar to introducing a spacer between the REP binding site and the YY1 binding site, using a rationally designed TRS loop modification to the P5 promoter can reduce the capsidation of nearby DNA by approximately 10 to 100 times (Figure 2).
[0060] To quantify the effects of AAV5 (Table 1, Example 3), GC dinucleotide (Table 1, Example 4), and AA dinucleotide (Table 1, Example 7) TRS loop modifications, a green fluorescent protein reporter assay was developed (Figure 3). This assay suggested that TRS changes that significantly reduced contamination also affected promoter function (Figure 4). Subsequently, it was determined whether this observed reduction in promoter activity could be compensated for by modifying the REP start codon from ACG to ATG. This analysis suggested that when AAV5 (Table 1, Example 3) or GC dinucleotide (Table 1, Example 4) TRS loops were used in the P5 promoter, changing the start codon compensated for the loss of viral titer (Figure 5) and did not alter contamination capsidation (Figure 6).
[0061] Subsequently, it was determined whether the entire P5 promoter could be replaced. Thus, the use of P5 homologs from alternative serotypes was investigated as a replacement for the P5 promoter in rAAV production. In particular, the following P5 homologs were analyzed: AAV1 P5 homolog, AAV4 P5 homolog, AAV8 P5 homolog, AAV12 P5 homolog, and AAV13 P5 homolog (Table 2). The AAV1, AAV4, and AAV8 P5 homologs were as described in the literature, i.e., unmodified. Nucleotide sequences for the AAV12 and AAV13 P5 promoter homologs were obtained from GENBANK. However, the 5' sequence was missing from these two promoters. Therefore, the first 5' nucleotide was grafted from the 5' region of the AAV2 P5 promoter. Table 2 [Table 2]
[0062] Replacing the standard AAV2 P5 promoter with an alternative homolog reduced the frequency of contamination capsidation from distant hotspots by more than 20% (Figure 7). Subsets of these alternative promoters also improved viral titers by 30–40% during small-scale rAAV production in a transgene-independent manner (Figure 8). However, while AAV2 P5 was tolerant of the TRS modification (Figure 2), similar modifications in the surrogate promoter were not tolerant (Figure 9), suggesting differential promoter regulation.
[0063] To further investigate the involvement of promoter modifications in promoter function, REP Western blot analysis was performed (Figure 10). These analyses suggested that the modifications that improved purity and had the most detrimental effect on viral titer had the strongest effect on promoter activity. Specifically, a decrease in large REP expression and an increase in small REP expression were observed (Figure 10). These data suggest that Rep binds more strongly or for a longer period to mutant P5, resulting in enhanced transactivation of P19. Notably, replacing the P5 promoter with an unrelated viral promoter (HPV P5) resulted in abnormal REP expression, low titer, and high contamination. Furthermore, the use of ATG significantly increased Rep78 expression after 48 hours (Figure 10).
[0064] Scaling up the vector preparation further demonstrated a quantitative reduction in DNA contamination. As shown in Figure 11, there was a two-log reduction in contamination (center panel). Expressed as a percentage of titer, the contamination was reduced from 2%, to 0.2% with spacers, and to less than 0.05% with the modified TRS construct (Figure 11, right panel).
[0065] The results of these analyses suggest that mutations in the REP78 nick site on the AAV2 P5 promoter effectively block replication originating from this site. The nick site modification reduces the basal level of REP78 expression and increases the expression of small REPs. However, compensating for the loss of large REP expression rescues the vector titer, thereby enabling efficient rAAV production. In addition, the use of the P5 homolog can reduce contamination outside the ITR by reducing the expression of large REPs. Therefore, the modified promoter described above offers a promising alternative to the standard AAV2 P5 routinely used in rAAV production.
[0066] The plasmid was designed to co-express Rep78 and green fluorescent protein (GFP) during AAV production (Figure 12A). Promoter activity was quantified every 2 hours using the IncuCyte® Live-Cell Analysis System. Different versions of this construct were generated, including all of the various P5 modifications that exhibited the desired activity. Consistent with Western blot analysis, live-cell imaging showed that P5 activity was reduced with all P5 modifications (Figure 12B).
[0067] For efficient production, the ratio of the transgene / adenovirus helper plasmid to the REP-CAP plasmid was optimized to approximately 1:1. Larger amounts of REP-CAP plasmid were used to determine whether the reduced expression observed by Western blotting and live imaging analysis was associated with decreased titer, and whether improving expression improved titer. In this analysis, the amount of transgene / adenovirus helper plasmid was kept constant, while the amount of REP-CAP plasmid was increased to 1X, 2X, 3X, and 4X, resulting in ratios of 1:1, 1:2, 1:3, and 1:4, respectively. The results of this analysis suggested improved titer (Figure 13B) and maintained purity (Figures 13A, 13C-3D). The initial experiments were performed in 6-well plates with well diameters of approximately 2-3 cm. Similar results were obtained when scaled up to 15 cm plates. Of note is that the 4X dose of REP-CAP plasmid resulted in a decrease in titer, likely due to excessive REP expression or because the amount of transfection reagent (polyethyleneamine) required to transfect the elevated levels of DNA was toxic. Additional experiments were conducted to reduce the plasmid ratio to 1:0.75, 1:0.5, and 1:0.25. This analysis resulted in a decrease in titer.
[0068] Most notably, the P5 signal (contamination signal) significantly increased when more wild-type P5 was added, but not when mutant P5 was added (Figures 13A, 13C). In addition, the presence of another contaminant (outside the ITR; Figures 13A, 13D) was also similarly reduced. While not bound by theory, this is thought to be due to competitive inhibition. By increasing the amount of RBE that cannot be efficiently packaged, excess REP is sequestrated, thereby preventing the packaging of contaminating DNA. To demonstrate competitive inhibition (Figures 16A-16C), HEK cells were transfected to initiate AAV production and included double-stranded oligonucleotides that sequester excess REP. The oligonucleotides contained GCTC repeats with 5' and 3' chemical modifications to prevent incorporation into the vector and extension by polymerase, which are the sequences of the RBE. Two oligonucleotides ( / 5InvddT / GCTCGCTCGCTCGCTCGCTCGCTC / 3InvdT / , SEQ ID NO: 20; and / 5InvddT / GAGCGAGCGAGCGAGCGAGCGAGC / 3InvdT / , SEQ ID NO: 21) were mixed, annealed, and then mixed into the AAV-producing plasmid at molar ratios of 5%, 10%, 25%, 50%, or 100% relative to the amount of REP-CAP plasmid used for production.
[0069] Western blot analysis was performed to evaluate REP expression in samples prepared on 15 cm plates. This analysis suggested that as the amount of transfected REP-CAP plasmid increased, so did the titer (Figure 14A) and REP expression (Figure 14B). It was surprising how much REP expression was required to achieve a comparable titer when the P5 promoter was mutated. It was also surprising that excessive REP expression did not lead to more contamination.
[0070] Expression cassettes were prepared to assess whether the inclusion of the transgene affected contamination. FVIII was chosen as the transgene because previous studies have shown that its large size results in a higher contamination rate than that of the standard FIX transgene. This analysis showed that using modified P5 yielded approximately 75% of the AAV8 titer compared to wild-type P5 (Figure 15A). Notably, the improvement in purity was maintained when using either a 1:1 (1X, Figure 15B) or 1:3 (3X, Figure 15B) transgene / adenovirus helper plasmid:REP-CAP plasmid ratio.
[0071] The FIX and FVIII vectors, described in Figures 11 and 15 and summarized in Table 3, were sequenced via Illumina sequencing to obtain an unbiased, holistic description of the packaged contents, instead of qPCR snapshots. Table 4 provides data demonstrating improved overall vector purity, indicated by the percentage of reads aligned to the transgene. Table 3 [Table 3] Table 4 [Table 4]
[0072] To evaluate expression in vivo, C57bl6 mice were administered 2e10vg of ssAAV8 HLP FVIII vector (as shown in Tables 3 and 4 and Figures 15A-15C). Plasma was collected 7 days after vector administration and analyzed for human FVIII expression. The average expression trend was higher, but there were no significant differences between samples (Figure 17).
Claims
1. (a) P5 promoter homolog; or (b) A P5 promoter containing a terminal decomposition sequence having the nucleotide sequence ctccnntttgaag (SEQ ID NO: 18), where "nn" is any dinucleotide other than "at"; or (c)ctccn 1 tttn 2 In gaag (sequence number 19), here, n 1 and n 2 Each of them is independently a, c, t, or g, except n 1 When n is "a", 2 The P5 promoter contains a terminal degradation sequence that has a nucleotide sequence, not "t". A recombinant adeno-associated virus (AAV) vector containing polynucleotides encoding AAV2 replication (REP)68 / 78 proteins operably linked to a vector.
2. The AAV vector according to claim 1, wherein the P5 promoter homolog comprises the nucleotide sequences of SEQ ID NOs: 13-17.
3. The AAV vector according to claim 1, wherein the polynucleotide encoding the AAV2 REP68 / 78 protein includes a start codon having an ATG or ACG nucleotide sequence.
4. A host cell comprising the AAV vector described in claim 1.
5. (a) ctccnntttgaag (SEQ ID NO: 18), where "nn" is any dinucleotide other than "at"; or (b)ctccn 1 tttn 2 gaag (SEQ ID NO: 19), wherein n 1 and n 2 each independently is a, c, t, or g, provided that when n 1 is "a", n 2 is not "t". A recombinant P5 promoter containing a terminal degradation sequence having a nucleotide sequence.
6. An adeno-associated virus (AAV) vector comprising a recombinant P5 promoter as described in claim 1.
7. The AAV vector according to claim 6, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and composite variants thereof.
8. The AAV vector according to claim 6, further comprising a polynucleotide encoding an AAV2 replication (REP) 68 / 78 protein operably ligated to a recombinant P5 promoter.
9. The AAV vector according to claim 8, wherein the REP68 / 78 start codon has a nucleotide sequence of ATG or ACG.
10. A host cell comprising the recombinant P5 promoter described in claim 5.
11. A host cell comprising the AAV vector described in claim 6.
12. A method for increasing the titer and / or purity of recombinant adeno-associated virus (rAAV), wherein the polynucleotide encoding the AAV2 replication (REP) 68 / 78 protein is: (a) P5 promoter homolog; or (b) A P5 promoter containing a terminal decomposition sequence having the nucleotide sequence ctccnntttgaag (SEQ ID NO: 18), where "nn" is any dinucleotide other than "at"; or (c)ctccn 1 tttn 2 In gaag (sequence number 19), here, n 1 and n 2 Each of them is independently a, c, t, or g, except n 1 When n is "a", 2 The P5 promoter contains a terminal degradation sequence that has a nucleotide sequence, not "t". This includes making it operable to connect to The method for thereby increasing the titer and / or purity of recombinant adeno-associated virus (rAAV).
13. The method according to claim 12, wherein the P5 promoter homolog comprises the nucleotide sequences of SEQ ID NOs: 13-17.
14. The method according to claim 12, wherein the polynucleotide encoding the AAV2 REP68 / 78 protein comprises a start codon having an ATG or ACG nucleotide sequence.