Modified liver-specific core promoters and their applications

Modified liver-specific core promoters and enhancers enhance rAAV vector packaging and liver-specific transgene expression, addressing cargo capacity limitations and immune response issues, achieving efficient therapeutic protein production for genetic disorders.

JP2026517890APending Publication Date: 2026-06-02SICHUAN REAL&BEST BIOTECH CO LTD

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
SICHUAN REAL&BEST BIOTECH CO LTD
Filing Date
2024-05-10
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The cargo capacity of rAAV vectors is limited to less than 5.0 kb, preventing the packaging of larger therapeutic DNA fragments, and existing liver-specific promoters result in low activity or undesirable expression in non-liver tissues, necessitating the development of short, potent, and tissue-specific promoters to enhance therapeutic protein expression safely.

Method used

A modified liver-specific core promoter and enhancer are developed, comprising specific nucleic acid sequences that enhance transgene overexpression, including a 81 bp hAATsh core promoter and a 54 bp enhancer, which are combined to form synthetic promoters up to 244 bp long, optimizing rAAV vector packaging and liver-specific expression.

Benefits of technology

The modified promoters and enhancers significantly increase transgene expression in the liver, reducing the need for large vector doses, minimizing immune responses, and ensuring efficient therapeutic protein production for genetic disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026517890000002
    Figure 2026517890000002
  • Figure 2026517890000003
    Figure 2026517890000003
  • Figure 2026517890000004
    Figure 2026517890000004
Patent Text Reader

Abstract

Provided are a modified liver-specific core promoter, a synthetic promoter (including the modified core promoter and enhancer), an expression vector (including the synthetic promoter), and a method of using the promoter or expression vector to address needs in the field, including the treatment of various hereditary diseases or conditions related to the liver. In some embodiments, the liver-specific promoter includes a continuous or discontinuous genomic sequence derived from the SEPRINAI genome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] [Cross - References to Related Applications] This application claims the benefit of International Application PCT / CN2023 / 093412, filed on May 11, 2023, and U.S. Application No. 63 / 510974, filed on June 29, 2023, the contents of which are hereby incorporated by reference in their entirety.

[0002] [Field of the Invention] The present invention generally relates to biotechnology, particularly gene expression regulation, gene therapy, and medicine. More specifically, a modified liver - specific core promoter and its uses are disclosed herein.

Background Art

[0003] Recombinant AAV (rAAV) vectors are typically generated by replacing the viral coding sequence of adeno - associated virus (AAV) with a transgene of interest. rAAV vectors are considered to be the most promising viral vectors for the treatment of genetic diseases. However, the cargo capacity of rAAV is limited to less than 5.0 kb. If the size of the transgene of interest is larger than 5.0 kb, the rAAV vector cannot be fully packaged into the AAV capsid, and thus cannot be used for efficient gene therapy.

[0004] An rAAV vector usually consists of a therapeutic gene expression cassette and two ITRs. The expression cassette contains a promoter, a gene of interest (transgene), and a polyA sequence. The shortest currently available polyA sequence is about 50 base pairs (bp). The two ITRs are located at both ends of the expression cassette. Each ITR is 145 bp long and is a packaging signal that must be incorporated into the rAAV vector. Thus, the space allocated for the therapeutic gene expression cassette is about 4.71 kb long.

[0005] Some DNA fragments encoding therapeutic proteins are too large for the rAAV packaging capacity. Promoter size is crucial to maintaining the expression cassette within the range of efficient packaging. Short promoters are preferable. In addition, to ensure safety and therapeutic efficacy, the promoter needs to be liver-specific and promote robust gene expression, as administration of large amounts of rAAV vectors can induce harmful immune responses. Therefore, there is an urgent need for short, liver-specific, and robust promoters in rAAV gene therapy for hemophilia A (HA).

[0006] In addition, while some DNA fragments encoding therapeutic proteins are small enough for efficient packaging, the activity of the encoded proteins remains low. Therefore, large quantities of rAAV vectors must be injected into patients to produce sufficient therapeutic proteins. However, administering large quantities of rAAV vectors can induce harmful immune responses. Thus, there is an urgent need to develop potent, tissue-specific promoters and enhancers to increase the activity of the encoded therapeutic proteins. [Overview of the Initiative]

[0007] The present invention provides a modified liver-specific core promoter, a synthetic promoter comprising a modified core promoter and an enhancer, an expression vector comprising a synthetic promoter, and a method of using the promoter or expression vector to address needs in areas such as the treatment of various genetic diseases or conditions.

[0008] In one embodiment, the present invention provides a modified core promoter.

[0009] In some embodiments, the core promoter is a liver-specific promoter.

[0010] In some embodiments, the modified core promoter includes the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence described in SEQ ID NO: 1 or 3.

[0011] The modified core promoter containing the sequence of Sequence ID No. 1 is an 81 bp hAATsh core promoter containing four portions of the complementary genome sequence Chr14:94388570-94388757 (NC_000014.9, 94388743-94388757, 94388709-94388725, 94388644-94388680, 94388570-94388581). As shown in Figure 1, the four portions are 15 bp, 17 bp, 37 bp, and 12 bp long, respectively. The modified core promoter containing the sequence of Sequence ID No. 2 is an 186 bp hAAT1 core promoter containing the complementary genome sequence Chr14:94388560-94388745 (NC_000014.9). The modified core promoter containing sequence number 3 is a 152 bp hAATs2 core promoter containing the complementary genome sequence Chr14:94388594-94388745. See Figure 1.

[0012] In another aspect, the present invention provides a synthetic promoter comprising a modified core promoter and an enhancer nucleic acid sequence disclosed herein.

[0013] In some embodiments, the enhancer is a modified enhancer containing one or more DNA binding sites for a transcription factor. Examples of transcription factors include, but are not limited to, HNF-4α, HNF-3β, D-site binding protein (DBP), CCAAT enhancer-binding protein α / β (C / EBP-α / β), and hepatocyte nuclear factor 1α / β (HNF-1α / β). The sequences of TFBS for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β selected in this invention are shown in SEQ ID NOs: 4-8, respectively.

[0014] In several embodiments, the DNA binding sites (TFBSs) of the above transcription factors were combined and then modified. The ATG triple nucleotide was removed by rearranging the TFBS of the above transcription factor and substituting the 7th base guanine in the HNF-1α / β TFBS sequence with cytosine, forming a 54 bp modified enhancer (Em, SEQ ID NO: 9). Such an enhancer was then added upstream of the core promoter to enhance transgene overexpression.

[0015] In some embodiments, the modified enhancer includes the nucleic acid sequence of SEQ ID NO: 9, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence of SEQ ID NO: 9.

[0016] In some embodiments, the synthetic promoter includes the nucleic acid sequence of SEQ ID NO: 10 or SEQ ID NO: 12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence described in SEQ ID NO: 10 or SEQ ID NO: 12.

[0017] In another embodiment, the present invention provides an expression vector comprising a synthetic promoter disclosed herein, which is ligated to act on a gene of interest (transgene).

[0018] In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV). In preferred embodiments, the expression vector is rAAV.

[0019] In another aspect, the present invention provides a method for treating a genetic disorder or condition in a subject requiring treatment, comprising administering the expression vector disclosed herein to the subject to thereby induce the expression of a therapeutic transgene in the liver of the subject.

[0020] In some embodiments, the subject is a mammal. Preferably, the mammal is a human.

[0021] Examples of genetic diseases or conditions related to the liver include, but are not limited to, hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, tyrosinemia type 1, α1-antitrypsin deficiency, argininosuccinic aciduria, liver cancer, glycogenosis, urea cycle disorders, Crigler-Najjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogenosis type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythropoietic protoporphyria, Gaucher disease, familial hypercholesterolemia, ornithine transcarbamylase deficiency.

[0022] In another aspect, the present invention provides the use of a promoter or expression vector disclosed herein for enhancing the expression level of a transgene in hepatocytes, wherein the nucleic acid comprises a transgene operably linked to the promoter.

[0023] In another aspect, the present invention provides the use of a promoter, or expression vector, or pharmaceutical composition provided herein for the manufacture of a medicament for a genetic disease or condition related to the liver.

[0024] In another aspect, the present invention provides a kit comprising a promoter, or expression vector, or pharmaceutical composition disclosed herein.

[0025] In some embodiments, the kit further comprises instructions for using the kit.

[0026] The features, aspects, and advantages of the present invention will be better understood from the following description and the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be described below by way of non-limiting examples with reference to the following drawings.

[0028] [Figure 1] FIG. 1 is a diagram of regulatory elements for promoting transgene overexpression in an rAAV vector. Enh is an enhancer; Pro is a promoter; Int is an intron; pA is polyA; HCR is the complementary sequence of the partial coding sequence (CDS) of the liver control region HCR-1; Ex is the proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (encoding human α-1 antitrypsin) genome; HEx is a 66bp composite enhancer containing HCR and Ex; HLP is a 252bp positive control synthetic promoter; hAATs2 is a 152bp hAAT (human α-1 antitrypsin) core promoter; hAATl is an 186bp core promoter that coincides with the core promoter of the HLP synthetic promoter; hAATsh is an 81bp short core promoter containing four parts of the human SERPINA1 genomic sequence; FRE72 is a 119bp short promoter containing two parts of the human SERPINA1 genomic sequence.

[0029] [Figure 2] FIG. 2 is a diagram of synthetic promoters for promoting transgene overexpression in an rAAV vector. HCR is the complementary sequence of the partial coding sequence (CDS) of the liver control region HCR-1; Ex is the proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (encoding human α-1 antitrypsin) genome; HLP is a 252bp positive control synthetic promoter; Em-hAATs2 is a 210bp synthetic promoter containing a 152bp human α-1 antitrypsin short core promoter and a 54bp enhancer Em; Em-hAATl is a 244bp synthetic promoter containing an 186bp human α-1 antitrypsin short core promoter and a 54bp enhancer Em; Em-hAATsh is a 139bp synthetic promoter containing an 81bp human α-1 antitrypsin short core promoter and a 54bp enhancer Em.

[0030] [Figure 3] Figure 3 shows the activity of liver-specific core promoters in cells. Different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Negative control cells were transfected with pssAAV-CB-EGFP. Cells were collected 24 hours after transfection and luciferase activity was measured. hAATsh is an 81 bp short core promoter derived from the SERPINA1 (human α-1 antitrypsin) genome; hAATl is a 186 bp core promoter matching the core promoter of the HLP chimeric promoter; hAATs2 is a 152 bp core promoter. n=4, *P<0.05, **P<0.01, ns indicates no significant difference between FRE72 and the other promoter groups (or between two other promoter groups) using a two-sided Student's t-test.

[0031] [Figure 4] Figure 4 shows the activity of synthetic promoters in cells. Different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Negative control cells were transfected with pssAAV-CB-EGFP. Cells were collected 24 hours after transfection and luciferase activity was measured. HLP is a 252 bp synthetic promoter and the positive control; Em-hAATsh is a 139 bp synthetic promoter containing an 81 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Em; Em-hAATl is a 244 bp synthetic promoter containing a 186 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Em; Em-hAATs2 is a 210 bp synthetic promoter containing a 152 bp human α-1 antitrypsin short core promoter and enhancer Em. n=4, ***P<0.001, ****P<0.0001, ns indicates no significant difference between HLP and other promoter groups using a two-sided Student's t-test.

[0032] [Figure 5A-5B]Figures 5A and 5B show the activity of synthetic promoters in factor VIII-deficient mice. Factor VIII-deficient mice, approximately 6-8 weeks old, were treated with different rAAVs via tail vein injection. Mouse plasma was collected, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. Em is a 54 bp enhancer; Em-hAATsh is a 139 bp synthetic promoter containing an 81 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Em; Em-hAATl is a 244 bp synthetic promoter containing a 186 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Em; Em-hAATs2 is a 210 bp synthetic promoter containing a 152 bp human α-1 antitrypsin short core promoter and enhancer Em. n=3, *P<0.05, ns indicates no significant difference between the two promoter groups using a two-sided Student's t-test. [Modes for carrying out the invention]

[0033] Specific features of the present invention are referred to in the summary section above, the detailed description section below, and the claims. It should be understood that the disclosure of the present invention in this specification includes all possible combinations of such specific features. For example, where a specific feature is disclosed in the context of a particular aspect or embodiment of the present invention, or in a particular claim, that feature may, to the extent possible, be used in combination with and / or in the context of other aspects and embodiments of the present invention, and in general in the present invention.

[0034] Gene therapy is a promising method for treating genetic diseases. In gene therapy, a target gene (transgene) is introduced into one or more recipient cells, and the expression of the transgene in the recipient cells affects cellular function, resulting in a therapeutic effect on the target. The rAAV vector is considered the most promising viral vector for use in gene therapy. However, the cargo capacity of rAAV is limited to less than 5.0 kb.

[0035] Excluding other necessary elements, the space for the promoter and therapeutic gene length is approximately 4.71 kb. Therefore, the shorter the promoter, the more space is available for the therapeutic gene. Liver-specific promoters are also preferred because they suppress gene expression in organs other than the liver, ensuring the safety of the treatment. In addition, promoters that promote strong gene expression are more effective, thus ensuring therapeutic efficacy.

[0036] In one embodiment, the present invention provides a modified core promoter comprising an 81 bp hAATsh core promoter (SEQ ID NO: 1) or a 152 bp hAATs2 core promoter (SEQ ID NO: 3). The 81 bp hAATsh core promoter comprises four portions (NC_000014.9, 94388743-94388757, 94388709-94388725, 94388644-94388680, 94388570-94388581) of the complementary genome sequence Chr14:94388570-94388757, 94388709-94388725, 94388644-94388680, and 94388570-94388581) of the upstream sequence of the human SERPINA1 genome (encoding human α-1 antitrypsin, hAAT). The 152bp hAATs2 core promoter (SEQ ID NO: 3) contains the complementary genome sequence Chr14:94388594-94388745.

[0037] When used in this context, the modified core promoter (also known as the minimal region) typically contains a TATA box necessary for recruiting RNA polymerase II and the assembly of basal transcription factors to form a pre-start complex. The “modified core promoter” is sometimes also called the “artificial core promoter” or “synthetic core promoter.”

[0038] In some embodiments, the core promoter is a liver-specific promoter.

[0039] In some embodiments, the core promoter includes the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence of SEQ ID NO: 1 or SEQ ID NO: 3. The hAAT1 core promoter containing the nucleic acid sequence of SEQ ID NO: 2 is used as a control in this invention.

[0040] Sequence ID: 1: hAATsh core promoter (81bp) GGCAGCGTAGGCGGGAGTGGACTTAGCCCCTGTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCACTGACCTGGG

[0041] Sequence ID: 2: hAAT1 core promoter (186bp) GGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCCGGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAATC

[0042] Sequence ID 3: hAATs2 core promoter (152 bp) GGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGGACAGGGCCCTGTCTCCTCAGC

[0043] In another aspect, the present invention provides a synthetic promoter comprising a modified core promoter and an enhancer nucleic acid sequence disclosed herein.

[0044] As used herein, a "synthetic promoter" is a stretch of DNA containing a core promoter and a combination of heterogeneous upstream regulatory elements (cis motifs or transcription factor binding sites). Synthetic promoters are sometimes also called "chimeric promoters," "modified promoters," or "artificial promoters." The core promoter typically contains a TATA box necessary for recruiting RNA polymerase II and the assembly of basic transcription factors to form a pre-start complex. A synthetic promoter may contain, for example, regions such as known promoters, regulatory elements, transcription factor binding sites, enhancer elements, and repressor elements.

[0045] In some embodiments, the core promoter is a liver-specific promoter.

[0046] While liver-specific promoters primarily direct transgene expression in the liver, they may also result in lower levels of transgene expression in other tissues or organs. Using liver-specific promoters in expression cassettes can restrict undesirable transgene expression in other tissues and facilitate sustained transgene expression in the liver.

[0047] In this context, an "enhancer" refers to a nucleic acid sequence that increases the transcription rate by enhancing the activity of a promoter. A "modified enhancer" refers to an artificial enhancer that does not exist in nature. A "modified promoter" is sometimes also called an "artificial promoter" or "synthetic promoter."

[0048] Transcription factors are proteins that bind to specific DNA sequences and thereby regulate the transfer (or transcription) of genetic information from DNA to RNA. The term "DNA binding site" here refers to the specific DNA sequence to which the transcription factor binds.

[0049] In some embodiments, the transcription factor is selected from the group consisting of hepatocyte nuclear factor 4α (HNF-4α), hepatocyte nuclear factor 3β (HNF-3β), D-site binding protein (DBP), CCAAT enhancer-binding protein α (C / EBP-α), CCAAT enhancer-binding protein β (C / EBP-β), hepatocyte nuclear factor 1α (HNF-1α), and hepatocyte nuclear factor 1β (HNF-1β).

[0050] HNF-4α is a nuclear transcription factor encoded by the HNF4A gene that binds to DNA as a homodimer. It regulates the expression of several genes, including hepatocyte nuclear factor 1α, a transcription factor that modulates the expression of several liver genes.

[0051] HNF-3β is encoded by the FOXA2 gene and is a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators of liver-specific genes such as albumin and transthyretin.

[0052] DBP is a transcription activator that recognizes and binds to the 5'-RTTAYGTAAY-3' sequence found in the promoters of genes such as albumin, CYP2A4, and CYP2A5.

[0053] C / EBP-α contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif within the promoter of target genes. It functions in homodimers and heterodimers with CCAAT / enhancer-binding proteins β and γ. The activity of this protein can regulate the expression of genes involved in cell cycle control and weight homeostasis.

[0054] C / EBP-β is a bZIP transcription factor that can bind as a homodimer to a specific DNA regulatory region. It can also form heterodimers with related proteins C / EBP-α, C / EBP-δ, and C / EBP-γ.

[0055] HNF-1α is a transcription factor encoded by the HNF1A gene, which is highly expressed in the liver and is involved in regulating the expression of several liver-specific genes.

[0056] HNF-1β is encoded by the HNF1B gene and is a protein belonging to the homeobox-containing basic helix-turn-helix family. The HNF1B protein is thought to form a heterodimer with HNF-1α, another member of this transcription factor family.

[0057] In some embodiments, the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β include the sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0058] Sequence ID 4: HNF-4α transcription factor DNA binding site (TFBS) TGGACTTTGCACT

[0059] Sequence ID 5: HNF-3β TFBS TGTAAACA

[0060] Sequence ID 6: DBP TFBS ATTACGTAAC

[0061] Sequence ID 7: C / EBP-α / β TFBS ATTGCACAAT

[0062] Sequence ID 8: HNF-1α / β TFBS GTTAATGATTAAC

[0063] In some embodiments, the modified enhancer includes the sequence of sequence number 9, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence of sequence number 9.

[0064] Sequence ID 9: Em Enhancer TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAACATTACGTAAC

[0065] The Em enhancer is 54 bp long and contains DNA binding sites for HNF-4α, C / EBP-α / β, HNF-3β, HNF-1α / β (with the 7th base guanine converted to cytosine), and DBP, from the 5' end to the 3' end.

[0066] In some embodiments, the synthetic promoter includes the nucleic acid sequence of SEQ ID NO: 10 or SEQ ID NO: 12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence of SEQ ID NO: 10 or 12. The Em-hAAT1 synthetic promoter containing the nucleic acid sequence of SEQ ID NO: 11 was used as a control in this invention.

[0067] Sequence ID: 10: Em-hAATsh (139 bp, synthetic promoter) TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAACATTACGTAACttaaGGCAGCGTAGGCGGGAGTGGACTTAGCCCCTGTGGTTATAATTCACCAGCAGCTCCCCCGTTGCCCCTCACTGACCTGGG

[0068] The Em-hAATsh synthesis promoter is 139 bp long and contains a 54 bp enhancer Em and an 81 bp core promoter hAATsh, linked at the required enzyme digestion site.

[0069] Sequence ID 11: Em-hAAT1 (244 bp, synthetic promoter) TGGACTTTGCACTATTGCCACAATTGTAAACAGTTAATCATTAACATTACGTAACttaaGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTGGATCCACTGCTTAAATACGGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAATC

[0070] The Em-hAAT1 synthesis promoter is 244 bp long and contains a 54 bp modified enhancer Em and a 186 bp core promoter hAAT1, linked at the required enzymatic digestion site.

[0071] Sequence ID 12: Em-hAATs2 (210 bp, synthetic promoter) TGGACTTTGCACTATTGCCACAATTGTAAACAGTTAATCATTAACATTACGTAACTTAAGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGGACAGGGCCCTGTCTCCTCAGC

[0072] The Em-hAATs2 synthesis promoter is 210 bp long and contains a 54 bp enhancer Em and a 152 bp promoter hAATs2, linked at the required enzyme digestion site.

[0073] In another aspect, the present invention provides an expression vector in which a synthetic promoter disclosed herein is ligated to act on a gene of interest.

[0074] The term "functionally linked" means that the regulatory sequences necessary for the expression of the coding sequence are positioned within the DNA molecule at the appropriate location relative to the coding sequence, thereby resulting in the expression of the coding sequence.

[0075] In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV).

[0076] Human adeno-associated virus (AAV) is a non-pathogenic parvovirus that replicates proliferatively only in cells co-infected with helper viruses, usually adenoviruses or herpesviruses. This virus has a broad host range and can proliferately infect many cell types from various animal species. Nevertheless, AAV is not associated with any human or animal disease.

[0077] AAV binds to cells via the heparan sulfate proteoglycan receptor. Once bound, AAV entry depends on the presence of either the fibroblast growth factor receptor or the αvβ5 integrin molecule as a co-receptor. In infected cells, the invading AAV single-stranded DNA (ssDNA) is converted into a double-stranded transcription template. Cells infected with AAV and helper viruses undergo proliferative replication of AAV prior to cell lysis induced by the helper virus, not AAV. Helper viruses encode transcriptional regulator proteins or RNA transcripts that participate in DNA replication or alter the cellular environment to enable efficient viral production.

[0078] Recombinant AAV (rAAV) vectors are typically produced by substituting the viral coding sequence with the desired transgene. These vectors have been shown to be highly efficient for gene transfer and expression at many different sites, both in vitro and in vivo. They consistently mediate stable expression and have been safe in studies conducted in the respiratory system, central nervous system, skeletal muscle, liver, and eye. The efficiency of rAAV-mediated transduction improved as the titer and purity of the rAAV preparations improved.

[0079] The inverted end sequence (ITR) derived from the AAV genome is the only viral sequence required in cis form to generate the rAAV vector. A recombinant construct containing two ITRs flanking a gene expression cassette of approximately 5 kb is converted into an ssDNA vector genome and packaged into AAV particles in the presence of AAVrep and cap gene products, as well as helper functions. Methods for the production and purification of rAAV are known in the art.

[0080] One of the target genes could be the F8 gene, located on the X chromosome and encoding factor VIII (FVIII). FVIII is one of the major components of the coagulation cascade. Loss-of-function mutations in FVIII cause a genetic disorder called hemophilia A (HA). The incidence of HA is 1 in 5000 in males.

[0081] The common treatment for HA is replacement therapy. Factor VIII concentrate is slowly infused or injected intravenously into the HA patient. These infusions replenish the patient's deficient or low levels of factor VIII. However, this replacement therapy can sometimes lead to the production of inhibitors against the injected or acquired factor VIII, resulting in the failure of the therapy.

[0082] An alternative treatment for hemophilia A is gene therapy based on rAAV vectors. rAAV vectors enable the long-term, stable in vivo expression of transgenes for therapeutic purposes. The coding region of FVIII is 7035 bp long and can be divided into six domains: A1, A2, B, A3, C1, and C2. To efficiently package rAAV vectors into adeno-associated virus (AAV) capsids, the size of the expression cassette containing the therapeutic gene generally needs to not exceed 5 kb.

[0083] Due to limitations in AAV packaging capabilities, the full-length FVIII coding region cannot be efficiently packaged into AAV vectors. To overcome this problem, researchers must reduce the size of the FVIII coding region. Previous studies have shown that the B domain (908aa) of FVIII can be replaced with the SQ domain (14aa), which is not thought to be necessary for FVIII's coagulation activity. This modified FVIII is known as FVIII-SQ and has six domains: A1, A2, SQ, A3, C1, and C2. The A1, A2, and SQ domains form the heavy chain of FVIII-SQ, while A3, C1, and C2 form the light chain. The nucleotide encoding FVIII-SQ is 4374 bp long and can be efficiently inserted into rAAV vectors.

[0084] However, even with an expression cassette of approximately 5kb, many packaged rAAV vectors remain incomplete and defective, and these defective rAAV vectors cannot produce functional FVIII. To address this limitation, it is necessary to inject large amounts of rAAV vector into HA patients to produce sufficient functional FVIII. However, administering large amounts of rAAV vector can induce adverse immune responses.

[0085] To address these limitations, it is essential to keep the size of both the promoter and the poly(A) tail as small as possible. In some embodiments, the synthetic promoters disclosed herein are used to direct the expression of FVIII-SQ or other modified FVIII fragments. Due to the small size of these synthetic promoters, the expression cassette exhibits a higher packaging rate.

[0086] In another embodiment, the present invention provides a pharmaceutical composition for delivering the transgenes described herein to subjects including human subjects. In some embodiments, the composition comprises any of the nucleic acids or vectors described herein. In some embodiments, the pharmaceutical composition disclosed herein comprises any of the vectors disclosed herein and one or more pharmaceutically acceptable carriers. In some embodiments, the composition comprises any of the AAV vectors described herein. In some embodiments, the pharmaceutical composition disclosed herein comprises any of the AAV vectors disclosed herein and one or more pharmaceutically acceptable carriers.

[0087] The descriptions of pharmaceutical compositions provided herein, such as AAV vectors, primarily concern pharmaceutical compositions suitable for administration to humans; however, those skilled in the art will understand that such compositions are generally suitable for administration to any other animals, such as non-human animals or non-human mammals. It is well known that pharmaceutical compositions suitable for administration to humans can be modified to suit administration to various animals, and veterinary pharmacologists skilled in the art can design and / or carry out such modifications, if necessary, with only the usual experiments. The subjects to whom the pharmaceutical compositions are intended for administration include, but are not limited to, humans and / or other primates; mammals, including commercially important mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially important birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0088] In some embodiments, the composition will be administered to humans.

[0089] In another aspect, the present invention provides a method for treating a genetic disorder or condition in a subject requiring treatment, comprising administering the expression vector disclosed herein to the subject to thereby cause the subject to express a therapeutic protein in the liver of the subject.

[0090] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0091] Examples of hereditary diseases or conditions related to the liver include, but are not limited to, hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, hypertyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, myeloid protoporphyria, Gaucher disease, familial hypercholesterolemia, and ornithine transcarbamylase deficiency.

[0092] In some embodiments, the methods provided herein, which include administering the expression vector disclosed herein to a subject to thereby express a therapeutic protein in the subject's liver, can be used to treat a genetic disorder or condition in a subject requiring treatment.

[0093] In another embodiment, the present invention provides a variety of kits for conveniently and / or effectively carrying out the methods of the present disclosure. Typically, the kit includes a quantity and / or number of components sufficient for a user to administer multiple treatments and / or conduct multiple experiments on a subject.

[0094] The kit may include either a pharmaceutical composition or a vector of the present disclosure. In some embodiments, the kit may further include reagents and / or instructions for preparing and / or synthesizing the compounds and / or pharmaceutical compositions of the present disclosure. In some embodiments, the kit may also include one or more buffers. In some embodiments, the kit of the present disclosure may include components for preparing protein or nucleic acid arrays or libraries, and thus may include, for example, a solid carrier.

[0095] In some embodiments, kit components may be packaged in either an aqueous medium or in a lyophilized form. The kit container means generally include at least one vial, test tube, flask, bottle, syringe, or other container means in which the components can be placed and appropriately divided. If there are more than one kit component (labeled reagents and labels may be packaged together), the kit may also generally include a second, third, or other additional container in which additional components can be placed separately. In some embodiments, the kit may also include a second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components may be contained in one or more vials. The kits of the present disclosure may also typically include means for containing the compounds and / or pharmaceutical compositions of the present disclosure, e.g., proteins, nucleic acids, and any other reagent containers sealed for commercial sale. Such containers may include injection-molded or blow-molded plastic containers in which the desired vials are held.

[0096] In some embodiments, the kit components are provided as one and / or more liquid solutions. In some embodiments, the liquid solutions are aqueous solutions, and in particular, sterile aqueous solutions are used. In some embodiments, the kit components may be provided as dry powders. When reagents and / or components are provided as dry powders, such powders can be reconstituted by adding an appropriate volume of solvent. In some embodiments, it is assumed that the solvent may also be provided in a separate container.

[0097] In some embodiments, the kit may include instructions for using the kit components together with any other reagents not included in the kit. These instructions may include variations that may be implemented.

[0098] [Definition] The terms used herein are intended solely to illustrate specific cases and are not intended to be limiting. Where used herein, the singular forms "a," "an," and "the" are intended to also include the plural forms unless the context clearly indicates otherwise. Furthermore, where the terms "including," "includes," "having," "has," and "with," or their variations thereof, are used in detailed descriptions and / or claims, they are intended to be as comprehensive as the term "comprising."

[0099] Where used herein, the terms “about” or “approximately” mean a range of tolerance for a particular value as determined by those skilled in the art, and which depends in part on the method by which the value is measured or determined, for example, on the limits of the measuring system. For example, “about” may conventionally mean a range of one standard deviation or more than one standard deviation for a given value. Where a particular value is described in this application and claims, unless otherwise specified, the term “about” should be considered to mean a range of tolerance for that particular value.

[0100] Where used herein, the terms “individual,” “patient,” or “subject” are interchangeable. None of these terms require, or are limited to, a situation characterized by supervision (e.g., constant or intermittent) by a healthcare professional (e.g., physician, registered nurse, nurse practitioner, physician’s assistant, caregiver, or hospice worker).

[0101] 5' and / or 3': Nucleic acid molecules (such as DNA and RNA) are said to have a "5' end" and a "3' end." This is because, when mononucleotides react to form polynucleotides, the 5' phosphate of one mononucleotide pentose ring unidirectionally binds to its adjacent 3' oxygen via a phosphodiester bond. Therefore, one end of a linear polynucleotide is called the "5' end" if its 5' phosphate is not bound to the 3' oxygen of another mononucleotide pentose ring. The other end of a polynucleotide is called the "3' end" if its 3' oxygen is not bound to the 5' phosphate of another mononucleotide pentose ring. It can also be said that an internal nucleic acid sequence has both a 5' end and a 3' end, even if the 5' phosphate of a certain mononucleotide pentose ring is bound to its adjacent 3' oxygen.

[0102] In both linear and cyclic nucleic acid molecules, separate internal elements are referred to as the “downstream” or “upstream” or “5’” of the 3’ element. In the case of DNA, this terminology reflects the fact that transcription proceeds along the DNA strand in a 5’-to-3’ direction. Promoter and enhancer elements, which direct the transcription of linked genes, are generally located at the 5’ or upstream of the coding region. However, enhancer elements can exert their effect even if they are located at the promoter element and the 3’ of the coding region. Transcription termination and polyadenylation signals are located at the 3’ or downstream of the coding region.

[0103] The term "promoter region" or "promoter" refers to a region of DNA that directs / initiates the transcription of nucleic acids (e.g., genes). A promoter contains the necessary nucleic acid sequences near the transcription start site. Typically, a promoter is located near the gene being transcribed. Promoters also optionally include distal enhancer or repressor elements, which can be thousands of base pairs away from the transcription start site. A tissue-specific promoter is a promoter that directs / initiates transcription primarily in a single type of tissue or cell. For example, a liver-specific promoter directs / initiates transcription to a significantly higher degree in liver tissue than in other tissue types.

[0104] The term "enhancer" refers to a nucleic acid sequence that increases the rate of transcription by increasing the activity of the promoter.

[0105] As is well known in the field, most eukaryotic genes contain both exons and introns. The term "exon" refers to nucleic acid sequences found in genomic DNA that are bioinformatically predicted and / or experimentally confirmed to contribute a continuous sequence to the mature mRNA transcript. The term "intron" refers to nucleic acid sequences found in genomic DNA that do not contribute to the mature mRNA transcript, but are instead predicted and / or confirmed to be "spliced ​​out" during transcript processing.

[0106] The term "vector" refers to a small carrier DNA molecule that is introduced into a host cell with an inserted DNA sequence and replicated. An "expression vector" is a specialized vector containing a gene or nucleic acid sequence that has a regulatory region necessary for expression in a host cell.

[0107] The term "functionally linked" means that the regulatory sequences necessary for the expression of the coding sequence are positioned within the DNA molecule at the appropriate location relative to the coding sequence, thereby resulting in the expression of the coding sequence. This same definition may also apply to the arrangement of coding sequences and transcriptional regulatory elements (e.g., promoters, enhancers, termination elements) in expression vectors. Furthermore, this definition may also apply to the arrangement of nucleic acid sequences in the primary and secondary nucleic acid molecules when hybrid nucleic acid molecules are generated.

[0108] Where used herein, the term “identical percentage” is used in reference to comparisons between nucleic acid or amino acid sequences. It is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to those in a given sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum possible sequence identity percentage. Nucleic acid and amino acid sequences are often compared using computer programs that align nucleic acid or amino acid sequences and reveal the differences between them. Comparisons of nucleic acid or amino acid sequences can be performed using various methods within the scope of the art, such as publicly available computer software including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve the maximum possible alignment over the entire length of the sequences being compared.

[0109] The term "sequence identity" refers to the identity or similarity between two or more nucleic acid sequences or two or more amino acid sequences, and is expressed as the identity or similarity between sequences. Sequence identity can be measured as an identity percentage; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured as a similarity percentage (considering conserved amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologues of nucleic acids or amino acid sequences have a relatively high degree of sequence identity / similarity when aligned using standard methods. This homology is more important when orthologous proteins or cDNAs originate from more closely related species (such as human and mouse sequences) compared to more distantly related species (such as human and nematode sequences).

[0110] The term "nucleotide" as used herein generally refers to a base-sugar-phosphate combination. Nucleotides may include synthetic nucleotides. Nucleotides may include synthetic nucleotide analogs. Nucleotides may be monomeric units of nucleic acid sequences (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates, adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP), and deoxyribonucleoside triphosphates, such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or their derivatives. Such derivatives may include, for example, [αS]dATP, 7-deaza-dGTP, 7-deaza-dATP, and nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing them. The term nucleotide as used herein may refer to dideoxyribonucleoside triphosphate (ddNTP) and its derivatives. Specific examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. Nucleotides may be unlabeled or detected by known techniques. Labeling may also be performed using quantum dots. Detectable labels may include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzymatic labels. Fluorescent labels for nucleotides may include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP; FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP, available from Perkin Elmer (Foster City, Calif); Boehringer Fluorescein-15-dATP, fluorescein-12-dUTP, tetramethylrhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2'-dATP, available from Mannheim (Indianapolis, Ind.); and Molecular Chromosome-labeled nucleotides available from Probes (Eugene, Oreg.) may include BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, Fluorescein-12-UTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP. Nucleotides may also be labeled or marked by chemical modification. A single chemically modified nucleotide can be biotin-dNTP.Some non-limiting examples of biotinylated dNTPs may include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).

[0111] The terms “polynucleotide,” “oligonucleotide,” and “nucleic acid” are used interchangeably to refer to polymeric forms of nucleotides (either deoxyribonucleotides or ribonucleotides) of any length, in single-stranded, double-stranded, or multi-stranded forms, or analogues thereof. Polynucleotides can be exogenous or endogenous to cells. Polynucleotides can exist in a cell-free environment. Polynucleotides can be genes or fragments thereof. Polynucleotides can be DNA. Polynucleotides can be RNA. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Polynucleotides can contain one or more analogues (e.g., modified skeletons, sugars, or nucleic acid bases). If present, modifications to the nucleotide structure can be conferred before or after the construction of the polymer. Some non-limiting examples of analogs include 5-bromouracil, peptide nucleic acids, xeno nucleic acids, morpholino, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordicepin, 7-deaza-GTP, fluorophores (e.g., sugar-bound rhodamine or fluorescein), thiol-containing nucleotides, biotin-bound nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, quosin, and iosin. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, extracellular polynucleotides including extracellular DNA (cfDNA) and extracellular RNA (cfRNA), nucleic acid probes, and primers. Nucleotide sequences can be interrupted by non-nucleotide components.

[0112] Recombinant nucleic acid molecules are those that have sequences not found in nature, such as sequences containing one or more nucleic acid substitutions, deletions, or insertions, and / or sequences created by artificial combinations of two isolated sequence segments. These artificial combinations can be achieved by chemical synthesis, or more generally, by artificially manipulating isolated nucleic acid segments, for example, by genetic engineering techniques.

[0113] The term "cDNA (complementary DNA)" refers to a DNA fragment that lacks internal non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells. cDNA may also contain untranslated regions (UTRs) responsible for regulating the translation of the corresponding RNA molecule.

[0114] As used herein, the term “gene” refers to the nucleic acid (e.g., DNA such as genomic DNA and cDNA) and its corresponding nucleotide sequence involved in encoding RNA transcripts. In relation to genomic DNA, the term as used herein includes intervening non-coding and regulatory regions, and may include the 5' and 3' ends. In some usages, the term encompasses the transcription sequence, including the 5' and 3' untranslated regions (5'-UTR and 3'-UTR), exons, and introns. For some genes, the transcription region includes an “open reading frame” that codes for a polypeptide. In some usages of the term, “gene” includes only the coding sequence necessary to code for a polypeptide (e.g., the “open reading frame” or “coding region”). In some cases, a gene does not code for a polypeptide; for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term “gene” also includes the non-transcription region, including upstream and downstream regulatory regions, enhancers, and promoters, as well as the transcribed sequence. A gene may refer to an “endogenous gene” or a native gene located in its natural position within the genome of an organism. The term "gene" may refer to an "exogenous gene" or a non-natural gene. A non-natural gene may refer to a gene that is not normally found in a host organism but has been introduced into the host organism through gene transfer. A non-natural gene may also refer to a gene that is not in its natural location within the genome of an organism. A non-natural gene may also refer to a natural nucleic acid or polypeptide sequence (e.g., a non-natural sequence) that includes mutations, insertions, and / or deletions.

[0115] Transcription factors (TFs) are proteins that bind to specific DNA sequences, thereby regulating the transfer (or transcription) of genetic information from DNA to RNA. TFs perform this function alone or in conjunction with other proteins in a complex by promoting (as activators) or blocking (as repressors) the supplementation of RNA polymerase (the enzyme that transcribes genetic information from DNA to RNA) to specific genes. The specific DNA sequences to which TFs bind are known as response elements (REs) or regulatory elements. Other names include cis-elements and cis-acting transcriptional regulatory elements.

[0116] Gene therapy involves introducing one or more heterologous nucleic acid molecules into recipient cells, where the expression of the heterologous nucleic acid in the recipient cells affects cellular function and produces a therapeutic effect. For example, the heterologous nucleic acid molecule may encode a protein that affects the function of the recipient cell.

[0117] An "inverted end sequence (ITR)" refers to a symmetrical nucleic acid sequence present in the genome of adeno-associated viruses that is necessary for efficient replication. ITR sequences are located at both ends of the AAV DNA genome. ITRs function as the origin of replication for viral DNA synthesis and are essential cis-components for the generation of AAV integration vectors.

[0118] The term "control" used here refers to the standard product.

[0119] Hemophilia is a blood clotting disorder caused by a deficiency in coagulation factor activity, resulting in impaired hemostasis. Severe forms develop when coagulation factor concentrations fall to less than approximately 1% of normal levels in healthy individuals. In some individuals, hemophilia develops due to impaired coagulation factor expression caused by gene mutations. In other cases, hemophilia is an autoimmune disease called acquired hemophilia, in which hemostasis is impaired by antibodies produced against coagulation factors within the individual.

[0120] Hemophilia A is caused by a deficiency of functional clotting factor VIII, and hemophilia B is caused by a deficiency of functional blood clotting factor IX. These conditions, caused by genetic mutations, are induced by a defect gene located on the X chromosome, resulting in a hereditary X-linked recessive trait, and the disease is therefore generally found only in males. The severity of symptoms can vary, with more severe forms manifesting earlier. Bleeding is characteristic of the disease and typically occurs when a male infant is circumcised. Further bleeding becomes more pronounced as the infant begins to move. Mild cases may go unnoticed until they manifest later in life as a reaction to surgery or trauma. Internal bleeding can occur anywhere, but intra-articular bleeding is common.

[0121] As used herein, "factor VIII deficiency" includes deficiencies in coagulation activity caused by defective production of factor VIII, insufficient or absent production of factor VIII, or partial or complete inhibition of factor VIII by inhibitors. Hemophilia A is a type of factor VIII deficiency resulting from a defect in an X-linked gene and the absence or deficiency of the factor VIII protein it encodes.

[0122] The terms “derivative,” “variant,” and “fragment” as used herein with respect to polypeptides refer to polypeptides that are related to the wild-type polypeptide by any of the following: amino acid sequence, structure (e.g., secondary and / or tertiary structure), activity (e.g., enzymatic activity), and / or function. Polypeptide derivatives, variants, and fragments may include one or more amino acid mutations (e.g., mutations, insertions, and deletions), truncations, modifications, or combinations thereof compared to the reference polypeptide.

[0123] As used herein, “diluent” refers to a component in a pharmaceutical composition that lacks pharmacological activity but may be pharmacokinetically necessary or desirable. For example, a diluent may be used to increase the volume of a potent drug whose mass is too small for manufacture and / or administration. A diluent may also be a liquid used to dissolve a drug administered by injection, ingestion, or inhalation. Common forms of diluents in the art are buffered aqueous solutions, such as, but are not limited to, phosphate-buffered saline that mimics the composition of human blood.

[0124] The term "pharmaceutical composition" refers to a mixture of the expression vector or rAAV vector disclosed herein with other chemical components such as diluents or carriers. Pharmaceutical compositions facilitate the administration of compounds to living organisms. Pharmaceutical compositions are generally formulated to suit a specific intended route of administration. Pharmaceutical compositions are suitable for human and / or animal use.

[0125] The pharmaceutical compositions described herein may be administered to human patients either directly or as a mixture with other active ingredients, carriers, diluents, additives, or combinations thereof, as in combination therapy. The appropriate formulation depends on the chosen route of administration.

[0126] In this context, "additive" refers to an inert substance added to a pharmaceutical composition that provides the composition with, but is not limited to, volume, consistency, stability, binding ability, lubricity, or disintegration ability. "Diluent" is a type of additive.

[0127] As used herein, the terms “treatment” and “treating” refer to an approach to obtain beneficial or desired outcomes, including, but not limited to, therapeutic and / or preventive benefits. For example, treatment may include administering the systems or cell populations disclosed herein. Therapeutic benefits may refer to a therapeutically appropriate improvement or effect on one or more diseases, conditions, or symptoms during treatment. Preventive benefits may refer to administering the composition to subjects at risk of developing a particular disease, condition, or symptom, or to subjects reporting one or more physiological symptoms of a disease, condition, or symptom, even if the disease, condition, or symptom has not yet manifested.

[0128] The terms “effective dose” or “therapeutically effective dose” refer to an amount of a composition, for example, a composition containing an rAAV vector, that is sufficient to produce the desired activity when administered to a subject requiring it. The term “therapeutically effective” may refer to an amount of a composition sufficient to delay the onset, halt the progression, alleviate or reduce the onset of at least one symptom of the disorder treated by the method of the present disclosure.

[0129] A “therapeutic effect” may occur if there is a change in the treated condition. This change may be positive or negative. For example, a “positive effect” may correspond to an increase in the number of activated T cells in the subject. In another example, a “negative effect” may correspond to a decrease in the volume or size of a tumor in the subject. A “change” in the treated condition may refer to a change of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 25%, 50%, 75%, or 100% in the condition. The change may be based on an improvement in the severity of the treated condition in an individual, or a difference in the frequency of improvement in the condition in a population of individuals with or without the administration of the therapeutic agent. Similarly, the methods of this disclosure may include administering a predetermined number of cells that are “therapeutic.” The term “therapeutic” should be understood to have a definition corresponding to “having a therapeutic effect.”

[0130] The following examples are presented to those skilled in the art to provide a complete disclosure and explanation of the methods of manufacture and use of the present invention, and are not intended to limit the scope of what the inventors consider to be the invention, nor to indicate that the following experiments represent all or only the experiments performed. While efforts have been made to ensure accuracy with respect to the numerical values ​​used (e.g., quantity, temperature, etc.), some degree of experimental error and deviation should be taken into consideration. Unless otherwise specified, parts are by weight, molecular weight is weight-average molecular weight, temperature is in degrees Celsius, and pressure is atmospheric pressure or near atmospheric pressure. [Examples]

[0131] Example 1. Design and acquisition of a liver-specific core promoter and testing of its effects. This example describes how liver-specific core promoters were designed and obtained, and how their promoter activity was tested. Specifically, synthetic promoters consisting of a short core promoter and a modified enhancer were used to promote the expression of B-domain-deficient FVIII (FVIII-SQ) in mice, or luciferase overexpression in Huh7 cells. The activity and protein levels of FVIII-SQ, as well as luciferase activity, were measured, and the activity of synthetic promoters with different core promoter and enhancer combinations was compared. The results showed that the synthetic promoters exhibited significantly higher promoter activity than the 252 bp HLP liver-specific promoter and the 252 bp HLP liver-specific promoter.

[0132] [method] [Design of liver-specific core promoters] In this invention, the sequence conservation between Homo sapiens and mice (Mus musculus), and the location of the TATA box related to the transcription start site (TSS), were taken into consideration in the selection of the promoter.

[0133] The 81bp hAATsh core promoter (SEQ ID NO: 1) contains four portions of the complementary genome sequence of Chr14:94388570-94388757 (NC_000014.9, 94388743-94388757, 94388709-94388725, 94388644-94388680, 94388570-94388581), which is the upstream sequence of the human SERPINA1 genome (encoding human α-1 antitrypsin, hAAT). The 186bp hAAT1 core promoter (SEQ ID NO: 2) contains the complementary genome sequence Chr14:94388560-94388745 (NC_000014.9), and the 152bp hAATs2 core promoter (SEQ ID NO: 3) contains the complementary genome sequence Chr14:94388594-94388745.

[0134] In accordance with patent application WO2021 / 084277A2, a short, liver-specific FRE72 promoter was selected as the positive control core promoter. In accordance with reference (Blood. 2013 Apr25;121(17):3335-3344.), a liver-specific HLP promoter was selected as the positive control synthetic promoter.

[0135] [Designing specific enhancers] In this invention, several transcription factors were selected and used, including hepatocyte nuclear factor 1α / β (HNF-1α / β), HNF-3β, HNF-4α, CCAAT enhancer-binding protein α / β (C / EBP-α / β), and D-site-binding protein (DBP).

[0136] In this invention, a 54 bp modified enhancer (Em, SEQ ID NO: 9) was formed by combining and arranging the DNA binding sites of the above transcription factor (TFBS), and this was then added upstream of the core promoter to enhance transgene overexpression. The sequences of the TFBS selected in this invention for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β are shown in SEQ ID NOs: 4 to 8, respectively. Em contains the DNA binding sites for HNF-4α, C / EBP-α / β, HNF-3β, HNF-1α / β (with the 7th base guanine converted to cytosine), and DBP from the 5' end to the 3' end.

[0137] [Construction of rAAV vector plasmid] The HLP, FRE72, and hAATsh promoters were synthesized by GENERAL BIOSYSTEMS (Anhui, China) and cloned into the pUC-HLP plasmid.

[0138] After digesting the vector pssAAV-HLP-FVIII-SQ with MluI and NheI bienzymes, the HLP fragment was cloned into the pssAAV-MSP-luciferase-A vector skeleton, followed by digestion with HindIII and SpeI to obtain pssAAV-HLP-luciferase-A. pssAAV-MSP-luciferase-A is a plasmid expression vector containing the MSP promoter, introns, luciferase coding sequence, and BGH polyA tail, and was selected using ampicillin.

[0139] The HLP fragment obtained from the pssAAV-HLP-luciferase-A plasmid was cloned into the pssAAV-MSP-luciferase-K vector skeleton by dual enzymatic digestion with PacI and StuI to obtain pssAAV-HLP-luciferase-K. pssAAV-MSP-luciferase-K is a plasmid expression vector containing the MSP promoter, introns, luciferase coding sequence, and BGH poly(A) tail, and kanamycin was used for selection.

[0140] Fragments of the FRE72 promoter were amplified by polymerase chain reaction (PCR) using the pUC-FRE72 plasmid as a template. Fragments of the hAATsh promoter were amplified by PCR using the pUC-hAATsh plasmid as a template. Fragments of the hAATl and hAATs2 promoters were obtained by PCR using the pUC-HLP plasmid as a template. Digested fragments of the FRE72, hAATsh, hAATl, or hAATs2 promoters were inserted into the pssAAV-HLP2-luciferase-K plasmid vector backbone digested with AflII and SpeI enzymes to obtain pssAAV-FRE72-luciferase-K, pssAAV-hAATsh-luciferase-K, pssAAV-hAATl-luciferase-K, and pssAAV-hAATs2-luciferase-K. The sequences of the three core promoters, hAATsh, hAATl, and hAATs2, are shown in SEQ ID NOs: 1-3.

[0141] Three plasmid vectors containing pssAAV-hAATsh-luciferase-K, pssAAV-hAATl-luciferase-K, and pssAAV-hAATs2-luciferase-K were digested with HindIII and AflII double enzymes, and used to insert the enhancer Em to construct pssAAV-Em-hAATsh-luciferase-K, pssAAV-Em-hAATl-luciferase-K, and pssAAV-Em-hAATs2-luciferase-K. The sequences of the three synthetic promoters, Em-hAATsh, Em-hAATl, and Em-hAATs2, are shown in SEQ ID NOs: 10-12.

[0142] Three fragments (Em-hAATsh, Em-hAATl, and Em-hAATsh) digested by double restriction enzyme digestion with PacI and SpeI were cloned into the pssAAV-Es-hAATs2-FVIII-SQ vector skeleton. Subsequently, recombinant vectors pssAAV-Em-hAATsh-FVIII-SQ, pssAAV-Em-hAATl-FVIII-SQ, and pssAAV-Em-hAATs2-FVIII-SQ were obtained by PacI and NheI enzyme digestion.

[0143] All primers used in vector plasmid construction are listed in Table 1 (SEQ ID NOs: 13-20). TIFF2026517890000001.tif100170

[0144] Figure 1 shows a diagram of the core promoter, and Figure 2 shows a diagram of a synthetic promoter for promoting luciferase or FVIII-SQ expression in the rAAV vector.

[0145] [Cell culture and transfection] Huh7 cells were obtained from ATCC and cultured in DMEM (Dulbecco's Modified Eagle Medium) containing 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin. The cells were incubated at 37°C and 5% CO2.

[0146] Transfection was performed in 12-well plates. Briefly, Huh7 cells were cultured overnight until the concentration density reached approximately 80%, and then a mixture of 0.5 μg of a plasmid expressing luciferase or EGFP (highly sensitive green fluorescent protein) and 1.5 μL of PEIpro (Polyplus transfection, Illkirch) was added to each well according to the manufacturer's protocol. Cells were transfected with quadruples of each plasmid. The pssAAV-CB-EGFP plasmid, a negative control for luciferase expression, was also transfected. After 6–8 hours, the medium containing the transfection reagents and plasmids was removed, and fresh DMEM containing FBS and penicillin-streptomycin was added to the 12-well plates. Cells were collected 24 hours after transfection for measurement of luciferase activity.

[0147] [Luciferase assay] Transfected cells on a 12-well plate were gently rinsed with DPBS after removal of DMEM, then the DPBS was removed, and 100 μL of cell lysis buffer from the Firefly Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai) was added to each well. After 5 minutes at room temperature, the samples were transferred to Eppendorf tubes. After centrifugation at 4°C and 12000 rpm for 2 minutes, the supernatant was transferred to a new tube. 30 μL of substrate from the Firefly Luciferase Receptor Gene Assay Kit was added to 30 μL of each sample on a 96-well white assay plate (Corning, New York), and the mixture was used for detection of luciferase activity using a Synergy H1 hybrid multimode microplate reader (BioTek, Winooski).

[0148] [Packaging and purification of rAAV vectors] Three rAAV vectors, ssAAV8-Em-hAATsh-FVIII-SQ (Em-hAATsh), ssAAV8-Em-hAATl-FVIII-SQ (Em-hAATl), and ssAAV8-Em-hAATs2-FVIII-SQ (Em-hAATs2), were packaged into HEK293 cells using triple plasmid transfection and purified by two cesium chloride ultracentrifugations. The titers of the rAAV vectors were quantified by qPCR using forward primer FVIII-SQ-qPCR-F (SEQ ID NO: 21) and reverse primer FVIII-SQ-qPCR-R (SEQ ID NO: 22).

[0149] [animal] Factor VIII-deficient mice, approximately 6-8 weeks old, were injected via tail vein with either a different rAAV vector or PBS buffer. Three mice were treated in each group. The injection volume was 4 × 10⁶ per mouse. 11The sample was a genome copy. Mouse plasma was collected from the posterior orbital venous plexus of mice before injection and 4 weeks after injection by adding the blood sample to a 1.5 mL tube pre-filled with the anticoagulant sodium citrate (final concentration 3.8%). After centrifugation at 2500 g for 15 minutes, the supernatant, i.e., mouse plasma, was transferred to a new tube. Plasma samples diluted to appropriate proportions were used for measurement of FVIII-SQ activity and protein levels by APTT and ELISA.

[0150] [APTT (One-Step Activated Partial Thromboplastin Coagulation Time)] ReFacto (Genetics Institute, Cambridge, MA) was serially diluted from 1 U / mL (200 ng / mL) to 1 / 2 to 1 / 64 dilutions with factor VIII-deficient plasma and used as a standard. ReFacto is recombinant FVIII and can be used as a standard for APTT and ELISA. 50 μL of STA-PTT reagent (Diagnostica Stago, Asnieres, France) was added to a sufficient number of strips of STAGO cuvettes containing magnetic beads in each well. Then, each diluted standard protein and each diluted plasma sample were added to different wells of STAGO cuvettes, all pre-filled with STA-PTT reagent. The mixtures were incubated at 37°C for 170 seconds. Then, 50 μL of 25 mM CaCl2 was added using a STAGO instrument (Diagnostica Stago, Asnieres, France) to initiate coagulation time, which was then measured. FVIII-SQ activity was calculated according to a standard curve.

[0151] [ELISA (Enzyme-linked immunosorbent assay)] In a 96-well plate, each well was coated overnight at 4°C with 100 μL of 2.5 ng / μL of capture antibody PAH-FVIII-S (Haematologic Technologies, Essex) in a coating buffer (containing 0.1 M sodium bicarbonate and sodium carbonate, pH 9.6). The plate was washed three times for 5 minutes each time with 300 μL of PBST buffer (140 mM NaCl, 2.5 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, 0.05% Tween-20, pH 8.4), and then the wells were blocked at room temperature for 2 hours with 300 μL of PBST buffer containing 3% BSA. After washing the wells three times with PBST buffer, 100 μL of standard material or sample was added and incubated at room temperature for 1.5 hours. ReFacto serial dilutions (12.5 ng / mL serially diluted 2-fold to 0.1953 ng / mL) were used as the standard material. After washing the wells three times with PBST buffer, 100 μL of 0.5 ng / μL biotin-labeled detection antibody GMA-8021 (Green Mountain Antibodies, Burlington) was added. The plate was incubated at room temperature for 1 hour. After three washes, 100 μL of 200-fold dilution of streptavidin-HRP (CST, Boston) in PBST buffer containing 0.1% BSA was added to each well and incubated in the dark for 1 hour. Next, the plate was washed three times with PBST buffer and colored using 100 μL of KPL SureBlue TMB1-Component Microwell Peroxidase Substrate (Seracare, Milford). Color development was carried out in the dark at room temperature for 1-10 minutes, and stopped by adding 100 μL of 0.5 M H2SO4. OD values ​​were quantified at 450 nm and 630 nm using a spectrophotometer. The amount of FVIII-SQ in the culture medium was calculated according to a standard curve.

[0152] [Data Analysis] A schematic diagram was created using Adobe Illustrator 2021. Statistical analysis of the data was performed using GraphPad Prism 9.0.0. All data were reported as mean ± SD. Significant differences in luciferase activity between the FRE72 promoter or HLP promoter and other promoter groups (or between two other promoter groups) were calculated using a two-sided Student's t-test. Significant differences in luciferase activity between two promoter groups were also calculated using a two-sided Student's t-test.

[0153] [result] [Activation of modified liver-specific core promoters] The cargo capacity of rAAV vectors is limited, and expression cassettes containing therapeutic FVIII-SQ for the treatment of hemophilia A(HA) are too large to fit with a standard-sized promoter. Therefore, there is an urgent need for a smaller promoter that can effectively promote the overexpression of FVIII-SQ. A sufficiently short promoter with a compact regulatory element, FRE72 (WO2021 / 084277A2, 119 bp), has been invented by other researchers, and in this invention, the FRE72 promoter was used as a positive control core promoter. Here, we obtained shorter liver-specific core promoters and constructed several other promoters for use in comparison (Figure 1).

[0154] As shown in Figure 3, in Huh7 cells, luciferase activity promoted by the three modified core promoters (hAATsh, hAATl, and hAATs2) and the positive control core promoter FRE72 was significantly increased compared to the negative control group. Interestingly, the 81 bp short core promoter hAATsh (SEQ ID NO: 1) was more potent than the 119 bp FRE72 promoter in promoting luciferase expression in Huh7 cells, despite being shorter (P=0.0249). In addition, the hAATl core promoter (SEQ ID NO: 2) showed significantly enhanced activity in promoting luciferase expression compared to the FRE72 core promoter (P=0.0011), while the luciferase activity of the hAATs2 core promoter (SEQ ID NO: 3) was only slightly increased compared to the FRE72 short core promoter (P=0.083). Furthermore, the activity of the hAATl core promoter was higher than that of the hAATsh (P=0.0481) and hAATs2 core promoter (P=0.0038), but there was no significant difference in luciferase activity between the hAATsh and hAATs2 core promoter groups (P=0.2308).

[0155] [Comparison of synthetic promoter activity in Huh7 cells] To further enhance the activity of the 81 bp hAATsh promoter, an Em enhancer was added to the 5' end of the hAATsh promoter to obtain a 139 bp Em-hAATsh (SEQ ID NO: 10) synthetic promoter (Figure 2). Similarly, by adding Em enhancers to the 5' ends of the hAATl promoter and hAATs2 promoter, respectively, 244 bp Em-hAATl (SEQ ID NO: 11) and 210 bp Em-hAATs2 (SEQ ID NO: 12) synthetic promoters were constructed (Figure 2). A synthetic liver-specific HLP promoter (252 bp) was selected as a positive control synthetic promoter based on a scientific paper (Blood. 2013 Apr25;121(17):3335-3344.). The activity of the Em-hAATsh, Em-hAATl, Em-hAATs2, and HLP promoters was compared in relation to luciferase expression in Huh7 cells.

[0156] As shown in Figure 4, luciferase activity was approximately 10 times higher under the control of all three synthetic promoters (Em-hAATsh, Em-hAATl, and Em-hAATs2) than under the control of the HLP promoter (P<0.0001, P=0.0003, P=0.0005). In addition, the three synthetic promoters showed almost equivalent activity for luciferase overexpression in Huh7 cells.

[0157] [Comparison of synthetic promoter activity in factor VIII-deficient mice] Based on the positive results of the three synthetic promoters in Huh7 cells, it was hypothesized that all of them could efficiently promote FVIII-SQ overexpression in factor VIII-deficient mice. Therefore, rAAV vectors containing FVIII-SQ expression cassettes promoted by these three synthetic promoters (Em-hAATsh, Em-hAATl, and Em-hAATs2) were packaged and injected into factor VIII-deficient mice. Mouse plasma was collected both before injection and 4 weeks after injection, and the activity and protein levels of FVIII-SQ promoted by different promoters were compared.

[0158] As shown in Figure 5B, the protein levels of FVIII-SQ promoted by the Em-hAATsh (SEQ ID NO: 10) and Em-hAATl (SEQ ID NO: 11) synthetic promoters were both slightly higher than those promoted by the Em-hAATs2 (SEQ ID NO: 12) promoter, but there were no significant differences among these three synthetic promoter groups. As shown in Figure 5A, there were no significant differences in FVIII-SQ activity between the Em-hAATl and Em-hAATs2 groups. Interestingly, however, in mice, the activity of FVIII-SQ promoted by the Em-hAATsh promoter was significantly higher than that promoted by the Em-hAATl promoter (P=0.0235) and the Em-hAATs2 promoter (P=0.0253), but in Huh7 cells, there were no notable differences among the activities of these same three synthetic promoters (compare Figure 5A with Figure 4). rAAV has limited cargo capacity, and both Em-hAATsh and Em-hAATs2 are shorter than the Em-hAATl synthesis promoter, with Em-hAATsh being particularly short at only 81 bp. One explanation for the different activities of these three synthesis promoters observed in mice is that an intact rAAV vector containing the entire FVIII-SQ expression cassette promoted by Em-hAATsh and Em-hAATs2 may be more packaged and delivered to mice than an rAAV vector containing the Em-hAATl synthesis promoter.

[0159] Overall, Em-hAATsh and Em-hAATs2 were both short, sufficiently strong, and suitable synthetic promoters for FVIII-SQ overexpression in rAAV vectors. The Em-hAATsh or Em-hAATs2 synthetic promoters were beneficial for efficient factor VIII therapy for hemophilia A using rAAV vectors.

[0160] Example 2. Treatment of patients with genetic disorders Human patients are tested for genetic disorders.

[0161] An expression vector is constructed containing the synthetic promoter disclosed herein, which is ligated to act on a therapeutic transgene. The efficacy and safety of the expression vector are tested in in vitro cell cultures and in vivo animal models before it is used to treat human patients.

[0162] Example 3. Treatment of human hemophilia A patients using an rAAV expression vector. This example illustrates an exemplary method for the clinical use of an rAAV vector encoding FVIII-SQ for the treatment of hemophilia A.

[0163] An expression vector is constructed containing the synthetic promoter disclosed herein, which is ligated to act on FVIII-SQ. The efficacy and safety of the expression vector are tested in in vitro cell cultures and in vivo animal models before it is used to treat human patients.

[0164] Patients diagnosed with hemophilia A are selected for treatment. A therapeutically effective dose of rAAV is administered to the patient. rAAV can be administered intravenously. The appropriate therapeutic dose can be selected by the physician.

[0165] In some cases, the effective therapeutic dose is 1 × 10⁻⁶ 11 ~1 × 10 14 The range is virus particles (vp) / kg, for example, about 1 × 10⁻⁶ 11 The dosage is vp / kg. In most cases, a single dose is administered to the patient. The patient's health status can be monitored over time to determine the effectiveness of the treatment.

Claims

1. A modified core promoter comprising a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence described in Sequence ID No. 1 or Sequence ID No.

3.

2. A synthetic promoter comprising the modified core promoter and enhancer described in claim 1.

3. The synthetic promoter according to claim 2, wherein the enhancer is a modified enhancer.

4. The synthetic promoter according to claim 3, wherein the modified enhancer comprises one or more DNA binding sites for a transcription factor, and each transcription factor is selected from the group consisting of HNF-4α, HNF-3β, D-site binding protein (DBP), CCAAT enhancer binding protein α / β (C / EBP-α / β), and hepatocyte nuclear factor 1α / β (HNF-1α / β).

5. The synthetic promoter according to claim 4, wherein the DNA binding sites for the transcription factors HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β each contain the nucleic acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

6. The synthetic promoter according to claim 4 or 5, wherein the modified enhancer comprises a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence described in Sequence ID No.

9.

7. A synthetic promoter according to any one of claims 2 to 6, comprising a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with the sequence described in SEQ ID NO: 10 or SEQ ID NO:

12.

8. An expression vector comprising the modified core promoter described in claim 1 or the synthetic promoter described in any one of claims 2 to 7.

9. The expression vector according to claim 8, further comprising a transgene responsively linked to the modified core promoter according to claim 1 or the synthetic promoter according to any one of claims 2 to 7.

10. The expression vector according to claim 9, wherein the transgene encodes a therapeutic protein for the treatment of a liver-related genetic disorder or condition.

11. The expression vector according to claim 10, wherein the therapeutic protein is factor VIII protein or a functional fragment thereof.

12. An expression vector according to any one of claims 8 to 11, which is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV).

13. The expression vector according to claim 12, which is an rAAV vector.

14. A pharmaceutical composition comprising a modified core promoter according to claim 1, a synthetic promoter according to any one of claims 2 to 7, or an expression vector according to any one of claims 8 to 13, and a pharmaceutically acceptable carrier.

15. A method for treating a hereditary disease or condition related to the liver, comprising administering a therapeutically effective amount of an expression vector according to any one of claims 8 to 13 or a pharmaceutical composition according to claim 14 to a subject in need of treatment.

16. The method according to claim 15, wherein the subject is a mammal.

17. The method according to claim 16, wherein the mammal is a human.

18. The method according to any one of claims 15 to 17, wherein the hereditary disease or condition related to the liver is selected from the group consisting of hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, hypertyrosinemia type 1, α1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, myeloid protoporphyria, Gaucher disease, familial hypercholesterolemia, and ornithine transcarbamylase deficiency.

19. Use of the modified core promoter according to claim 1, or the synthetic promoter according to any one of claims 2 to 7, for enhancing the expression level of a transgene in hepatocytes, wherein the transgene is ligated to act on the modified core promoter according to claim 1, or the synthetic promoter according to any one of claims 2 to 7.

20. Use of the modified core promoter according to claim 1, or the synthetic promoter according to any one of claims 2 to 7, or the expression vector according to any one of claims 8 to 13, or the pharmaceutical composition according to claim 14, for the manufacture of a pharmaceutical for treating a hereditary disease or condition related to the liver.

21. A kit comprising the modified core promoter described in claim 1, the synthetic promoter described in any one of claims 2 to 7, the expression vector described in any one of claims 8 to 13, or the pharmaceutical composition described in claim 14.

22. The kit according to claim 21, further comprising instructions for using the contents of the kit.