Liver-specific regulatory nucleic acid sequences
Synthetic liver-specific promoters using cis-regulatory elements and promoter elements enhance liver-specific gene expression, addressing off-target issues and payload limitations in gene therapy, ensuring high expression levels and efficient vector use.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ASKLEPIOS BIOPHARMACEUTICAL INC
- Filing Date
- 2024-04-19
- Publication Date
- 2026-05-26
AI Technical Summary
Existing gene therapy methods face challenges in achieving liver-specific gene expression with high specificity and intensity while minimizing off-target effects and overcoming vector payload limitations, particularly for diseases where the coding sequence approaches the capacity limit.
Development of synthetic liver-specific promoters comprising combinations of cis-regulatory elements (CREs) and promoter elements, which are operably linked to enhance liver-specific transcription, along with minimal or proximal promoters, and optionally including UTRs and introns, to create efficient expression constructs and vectors.
The synthetic promoters provide high-level, liver-specific gene expression with reduced off-target effects and accommodate larger therapeutic transgenes by optimizing vector payload utilization.
Smart Images

Figure 2026516710000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application asserts the benefits under 35 U.S. SC § 119(e) of U.S. Provisional Application No. 63 / 497,354, filed on April 20, 2023, the contents of which are incorporated herein by reference in their entirety.
[0002] Sequence List This application includes a sequence listing submitted in XML format through the Patent Center, which is incorporated herein by reference in its entirety. The XML copy created on April 19, 2024, is named 046192-000106WOPT_SL.xml and has a size of 246,627 bytes.
[0003] This invention relates to short, liver-specific regulatory nucleic acid sequences capable of enhancing liver-specific gene expression, particularly short liver-specific cis-regulatory elements, cis-regulatory modules, promoters, and other such nucleic acid sequences. The invention also relates to expression constructs, vectors, and cells comprising such short liver-specific regulatory nucleic acid sequences, as well as methods of using them. While liver-specific regulatory nucleic acid sequences are particularly useful in gene therapy applications, they are also useful in other fields such as bioprocessing and biotechnology. [Background technology]
[0004] The following explanation is provided to help readers understand this disclosure and does not constitute any endorsement of the content or relevance of prior art.
[0005] In many fields, including gene therapy, it is desirable to provide regulatory nucleic acid sequences that can drive gene expression to produce proteins or nucleic acid expression products within desired cells, tissues, or organs.
[0006] Gene expression in the liver is of particular interest because it is involved in a wide range of essential bodily functions, including the synthesis of many proteins involved in metabolism, hemostasis, and protection against infection. Given that many diseases are associated with disruption of gene expression in the liver, there is great interest in developing gene therapy strategies that enable transgene expression in the liver and produce therapeutic expression products. Liver diseases associated with abnormal gene expression include hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, alpha-antitrypsin deficiency, hepatitis virus infections, nonviral hepatitis, liver cancer, and various other liver diseases (non-alcoholic fatty liver disease (NAFLD), alcohol-related liver disease (ARLD), etc.).
[0007] A key challenge in treating liver disease using gene therapy is the ability to provide liver-specific (also known as liver-specific) therapeutic gene expression. Mammalian hepatocytes are known to be targeted by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein. Adenovirus vectors have also been reported to primarily target the liver of mice. However, they also infect other tissues, particularly the lungs and skeletal muscle, resulting in "off-target" effects. Some forms of adeno-associated virus vectors (AAVs) or lentiviral vectors preferentially transduce hepatocytes, but off-target effects again occur.
[0008] Therefore, it is desirable to provide a system that regulates gene expression in a liver-specific manner. Ideally, such a system would be highly specific to the liver (thereby avoiding or minimizing off-target expression in non-target tissues) and potent, i.e., they would drive high expression levels in the liver. To provide both specificity and activity, the use of cis-acting regulatory elements has been proposed. Typically, this relates to cis-regulating enhancer sequences, i.e., nucleic acid sequences that act cis to increase promoter activity. Enhancers typically exhibit activity regardless of their orientation and can act over distances of several kilobases from the promoter in some cases, but typically also act when much closer to the promoter.
[0009] Various enhancer sequences for liver-specific gene expression have been described in the literature. International Publication Nos. 95 / 011308 and 01 / 098482 describe gene therapy vectors containing promoters and hepatocyte-specific apolipoprotein E-hepatocyte regulatory region enhancers linked to the transgene. Other liver-specific constructs have also been proposed in the literature, for example, those having an AAT promoter and an albumin or hepatitis B enhancer, or an alcohol dehydrogenase 6 (ADH6) basal promoter linked to two tandem copies of an apolipoprotein E enhancer element.
[0010] A further challenge in treating liver diseases using gene therapy is the limited effective packaging capacity (payload) of vectors, particularly recombinant adeno-associated virus (rAAV) vectors. rAAV vectors are advantageous in gene therapy because they mediate stable transgene expression without inducing significant inflammatory toxicity. This is a significant limitation for gene therapy in diseases where the length of the coding sequence approaches the payload limit, such as Duchenne muscular dystrophy, hemophilia A, and cystic fibrosis.
[0011] One way to mitigate this challenge is to provide short-length liver-specific regulatory sequences while maintaining the desired specificity and intensity of expression, thereby minimizing the proportion of gene therapy vectors incorporated by the regulatory sequences.
[0012] Short regulatory nucleic acids capable of driving liver-specific gene expression remain in demand in this field. In particular, there is a need for short liver-specific regulatory sequences (e.g., cis-regulatory elements and minimal or proximal promoter elements), as well as short liver-specific cis-regulatory modules and promoters containing such elements that can be incorporated into expression constructs and vectors for liver-specific expression of desired genes (e.g., therapeutic transgenes in the context of gene therapy). Such short liver-specific regulatory sequences would be of particular interest in rAAV gene therapy, where the length of the coding sequence approaches the payload limit. [Prior art documents] [Patent Documents]
[0013] [Patent Document 1] International Publication No. 95 / 011308 [Patent Document 2] International Publication No. 01 / 098482 [Overview of the Initiative] [Means for solving the problem]
[0014] In a first aspect of the present invention, a synthetic liver-specific promoter is provided, comprising, or substantially comprising, one combination of a cis-regulatory element (CRE) or a functional variant thereof operably bound to a promoter element or a functional variant thereof, as shown in Table A. [Table 1]
[0015] CREs may be present in the listed order or may not be present in any order. They may also be contiguous or non - contiguous (i.e., they may be arranged directly adjacent to each other or they may be separated by a spacer or other sequences). CREs are preferably present in the listed order and are preferably adjacent to each other. The promoter element is typically downstream of the CRE and is typically adjacent to the proximal CRE. The promoter element may be contiguous with the adjacent CRE or may be separated by a spacer. The sequences of the CREs are shown in Table 1 of Example 1. The sequences of the promoter elements are shown in Table 2 of Example 1. Table A shows combinations of one or more CREs in combination with specific promoter elements that have been found to provide high - level liver - specific expression. In some preferred embodiments, the various elements (CRE, promoter element, and UTR) of the synthetic promoter are operably linked.
[0016] The elements CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, CRE0056 are CREs. These function in combination with a promoter element to regulate, typically enhance, liver - specific transcription from the promoter they form. Their sequences and functional variants thereof are further described below.
[0017] The elements CRE0059, CRE0070, CRE0071, CRE0054, CRE0073, CRE0099, and CRE0052 are minimal promoters or proximal promoters. These function in combination with a CRE to effect liver - specific transcription from the promoter they form. Their sequences and functional variants thereof are further described below.
[0018] In some embodiments, the synthetic liver - specific promoter is as follows: CRE0051, CRE0042, CRE0059 and 5’UTR; CRE0051, CRE0058 and CRE0070; A combination of one or more CREs (or any functional variant thereof) operably linked to a promoter element (or any functional variant thereof) selected from the group consisting of CRE0051, CRE0058, and CRE0071; CRE0042 and CRE0099; CRE0042 and CRE0073; CRE0051 and CRE0099; CRE0051 and CRE0073; CRE0051, CRE0058, and CRE0054; CRE0094 and CRE0052; CRE0056, CRE0094, and CRE0052; CRE0056, CRE0094, and CRE0059; CRE0048, CRE0056, and CRE0054; CRE0048, CRE0056, and CRE0052; and CRE0048, CRE0056, and CRE0059, or consisting of or essentially consisting of the same.
[0019] In a preferred embodiment, the synthetic liver-specific promoter comprises a combination of CRE0051 and CRE0042, or any functional variant thereof operably linked to the 5'UTR. In one embodiment, the 5'UTR may comprise or consist of SEQ ID NO: 13, or any functional variant thereof. In another embodiment, the 5'UTR may comprise or consist of SEQ ID NO: 119, or any functional variant thereof.
[0020] In yet another preferred embodiment, the synthetic liver-specific promoter comprises a combination of CRE0073 or any functional variant thereof operably linked to CRE0042 or any functional variant thereof.
[0021] In some embodiments of the present invention, the synthetic liver-specific promoter comprises, comprises, or essentially comprises a promoter selected from the group consisting of SP0412_v2, SP0382, SP0383, SP0471, SP0472, SP0473, SP0474, SP0475, SP0476, SP0477, SP0478, SP0479, SP0480, and SP0481, or any functional variant thereof. Preferably, any functional variant of the promoter comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter. Sequences and sequence numbers corresponding to these promoters are shown in Example 1.
[0022] In some embodiments of the present invention, the synthetic liver-specific promoter comprises, consists of, or essentially comprises one of sequence numbers 22-35. Preferably, a functional variant of any of the promoters comprises, consists of, or essentially comprises a sequence that is at least 70% identical to sequence numbers 22-35, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to sequence numbers 22-35.
[0023] In some embodiments of the present invention, the synthetic liver-specific promoter is as follows: The promoter comprises a promoter selected from the group consisting of SP0382, SP0383, SP0471, SP0473, SP0475, and SP0479, or any functional variant thereof. Preferably, any functional variant of the promoter comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter.
[0024] In some embodiments of the present invention, the synthetic liver-specific promoter is as follows: It comprises, and essentially consists of, a promoter selected from the group consisting of SP0477, SP0478, SP0479, SP0480, and SP0481 or any functional variant thereof.
[0025] Appropriately, any functional variant of the promoter comprises, and essentially consists of, a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter.
[0026] In some embodiments of the present invention, the synthetic liver-specific promoter has a length of 350 or fewer nucleotides, preferably 340 or fewer nucleotides, more preferably 330 or fewer nucleotides, and most preferably 320 or fewer nucleotides. In some embodiments of the present invention, the synthetic liver-specific promoter has a length of 310 or fewer nucleotides, preferably 300 or fewer nucleotides, more preferably 290 or fewer nucleotides, and most preferably 280 or fewer nucleotides. In some embodiments of the present invention, the synthetic liver-specific promoter has a length of 270 or fewer nucleotides, preferably 280 or fewer nucleotides, more preferably 260 or fewer nucleotides, and most preferably 250 or fewer nucleotides. In some embodiments of the present invention, the synthetic liver-specific promoter has a length of 240 or fewer nucleotides, preferably 230 or fewer nucleotides, more preferably 220 or fewer nucleotides, and most preferably 210 or fewer nucleotides. In some embodiments of the present invention, the synthetic liver-specific promoter has a length of 200 or fewer nucleotides, preferably 190 or fewer nucleotides, more preferably 180 or fewer nucleotides, and most preferably 170 or fewer nucleotides.
[0027] The synthetic liver-specific promoter may further include a UTR. The UTR may be a 5'UTR. In some embodiments, the 5'UTR may consist of, or essentially consist of, SEQ ID NO: 13 or its functional variant. In some embodiments, the 5'UTR may consist of, or essentially consist of, SEQ ID NO: 119 or its functional variant.
[0028] In some embodiments, it is particularly preferable that the synthetic liver-specific promoter contains, consists of, or is essentially composed of SP0412_v2. SP0412_v2 may be particularly preferred because it contains the 5'UTR of SEQ ID NO: 13. The 5'UTR of SEQ ID NO: 13 can enhance expression compared to a liver-specific promoter that is not operably bound to further regulatory elements, such as a UTR. Generally, it is preferable that the further regulatory elements do not substantially reduce the specificity of the liver-specific promoter.
[0029] In some embodiments, the synthetic liver-specific promoter may further include an intron. In some embodiments, the intron may be the HBB2 intron (SEQ ID NO: 40) or a functional variant thereof, the UBC intron (SEQ ID NO: 41) or a functional variant thereof, the CMV-IE intron (SEQ ID NO: 42), or a functional variant thereof, or another intron. The addition of an intron may increase the activity of the synthetic promoter. A functional variant of a reference intron may be a variant that substantially retains its activity when substituted with the reference promoter.
[0030] The sequences of the introns are shown in Table 7 of Example 1. In some embodiments, the introns include, consist of, or are essentially composed of sequence numbers 40, 41, or 42, or their functional variants.
[0031] In some embodiments, the synthetic liver-specific promoter comprises, consists of, or essentially comprises one of SEQ ID NOs: 22-35 or a functional variant thereof, and an HBB2 intron, a CMV-IE intron, or a UBC intron, or a functional variant thereof. In some embodiments, the synthetic liver-specific promoter comprises, consists of, or essentially comprises one of SEQ ID NOs: 22-35 or a functional variant thereof, and one of SEQ ID NOs: 40, 41, or 42, or a functional variant thereof.
[0032] In some embodiments, the synthetic liver-specific promoter may further include exon and splice donor sequences. The exon and splice donor sequences may support the function of introns such as the HBB2 intron. In some embodiments, the synthetic liver-specific promoter includes, consists of, or is essentially composed of, one of sequence numbers 22-35 or their functional variants, an exon and splice donor, or their functional variants and an intron, or their functional variants. In some embodiments, the synthetic liver-specific promoter includes, consists of, or is essentially composed of, one of sequence numbers 22-35 or their functional variants, an exon and splice donor, and the HBB2 intron. The sequences of the exon and splice donors are shown in Table 8 of Example 1. In some embodiments, the synthetic liver-specific promoter includes, consists of, or is essentially composed of, one of sequence numbers 22-35 or their functional variants, one of sequence numbers 43 and 44, or their functional variants and sequence number 40.
[0033] When an intron is present in a synthetic liver-specific promoter, it may be contiguous with the promoter element. Alternatively, the intron may be discontinuous. For example, the promoter element and the intron may be separated by a spacer. Alternatively, the promoter element and the intron may be separated by an exon and splice donor sequence, such as exon and splice donor_CRE0059 (SEQ ID NO: 43) or exon and splice donor_CRE0052.1 (SEQ ID NO: 44). This embodiment is particularly preferred when the intron is an HBB2 intron, since the HBB2 intron according to SEQ ID NO: 40 lacks a splice donor. In these embodiments, the splice donor is provided by a separate exon and splice donor sequence.
[0034] In further embodiments, the present invention relates to the following: We provide a synthetic liver-specific promoter comprising, consisting of, or substantially comprising one of the promoter elements of CRE0070, CRE0071, CRE0099, and CRE0054, or any functional variant thereof. These are either proximal promoters or minimal promoters. Each of these promoter elements has been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g., as described above). Their sequences and functional variants are further described below.
[0035] In another aspect of the present invention, a promoter element is also provided comprising one of CRE0070, CRE0071, CRE0099, and CRE0054, or a functional variant thereof, wherein the promoter element may have a length of 400 or fewer nucleotides, preferably 350 or fewer nucleotides, more preferably 300 or fewer nucleotides, preferably 250 or fewer nucleotides, preferably 200 or fewer nucleotides, preferably 150 or fewer nucleotides, and preferably 100 or fewer nucleotides. The present invention also provides a promoter element comprising CRE0070, CRE0071, CRE0099, and CRE0054, or a functional variant thereof.
[0036] In a further aspect of the present invention, a liver-specific CRE is provided which comprises, consists of, or substantially comprises CRE0094 or any functional variant thereof. Preferably, any functional variant of the CRE comprises a sequence that is at least 70% identical, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRE. The sequence and sequence number corresponding to this CRE are shown in Example 1.
[0037] In another aspect of the present invention, a liver-specific CRE is provided, selected from the group consisting of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056, or any functional variant thereof, wherein any functional variant of the CRE contains a sequence that is at least 70% identical, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical, to a reference synthetic liver-specific CRE.
[0038] In a further aspect of the present invention, a synthetic liver-specific promoter comprising CRE0094 or any functional variant thereof is provided. In some embodiments, CRE is CRE0094 or a functional variant thereof. CRE can be operably bound to any suitable promoter element. Exemplary but non-limiting promoter elements include CRE0052, CRE0059, CRE0070, CRE0071, CRE0054, CRE0099, and CRE0073, or any functional variant thereof. In some preferred embodiments, CRE0094 is operably bound to promoter element CRE0052 or CRE0059.
[0039] In a further embodiment, a synthetic liver-specific cis-regulatory module (CRM) or synthetic liver-specific promoter is provided, comprising one or more CREs selected from the group consisting of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056, or functional variants thereof, or combinations of the CREs.
[0040] In some embodiments, the CRM is a combination of the following CREs: CRE0051 and CRE0042; CRE0051 and CRE0058; CRE0056 and CRE0094; and CRE0048 and CRE0056, Or it includes, consists of, or essentially consists of one of its functional variants.
[0041] In some preferred embodiments, a synthetic liver-specific cis-regulatory module (CRM) is provided, comprising CRE0056 operably coupled to CRE0094 or CRE0048.
[0042] In a particularly preferred embodiment, the synthetic liver-specific CRM of the present invention is as follows: -CRE0048 and CRE0056; and - Contains, consists of, or essentially consists of, a combination of CRE or its functional variant selected from the group consisting of CRE0056 and CRE0094.
[0043] In any combination of CREs or their functional variants disclosed herein, the enumerated CREs may be present in any order. In some preferred embodiments, the CREs are present in the enumerated order (i.e., from upstream to downstream, with reference to their positions relative to the operably bound promoter element or gene). The CREs may be contiguous or discontinuous (i.e., they may be directly adjacent to one another, or they may be separated by spacers or other sequences). In any combination of CREs or their functional variants disclosed herein, some or all of the enumerated CREs may be appropriately positioned adjacent to one another in the CRM (i.e., without intervening CREs or other regulatory elements). In some embodiments, it is preferable that some or all of the CREs are contiguous. In some preferred embodiments, the CREs or their functional variants are provided in the enumerated order and adjacent to one another. For example, a synthetic liver-specific CRM may include CRE0048 immediately upstream of CRE0056, etc.
[0044] CRMs containing the above combination of CREs have been found to provide significant liver-specific enhancer activity when combined with appropriate promoter elements. Particularly high levels of activity were observed when the CREs were adjacent to each other in the enumerated order. Therefore, these represent several preferred CRE "motifs" that typically correlate with high levels of liver-specific promoter activity.
[0045] In some embodiments of the present invention, the synthetic liver-specific CRM is as follows: The CRM is selected from the group consisting of CRM_SP0412_v2, CRM_SP0382 and SP0383, CRM_SP0471, CRM_SP0473, CRM_SP0475, CRM_SP0477 and SP0478, CRM_SP0479, and CRM_SP0480 and SP0481, or any functional variant thereof. Preferably, any functional variant of the CRM contains a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRM. The sequences and sequence numbers corresponding to these CRMs are shown in Example 1.
[0046] In some embodiments of the present invention, the synthetic liver-specific CRM comprises a CRM selected from the group consisting of CRM_SP0477 and SP0478, CRM_SP0479, and CRM_SP0480 and SP0481, or any functional variant thereof. Preferably, any functional variant of the CRM comprises a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRM. The sequences and sequence numbers corresponding to these CRMs are shown in Example 1.
[0047] In a further aspect of the present invention, a synthetic liver-specific promoter, a) A CRM according to the previous embodiment, preferably comprising CRE0056 operably coupled to CRE0094 or CRE0048, which is operably coupled to a promoter element (preferably a minimal promoter or a liver-specific proximal promoter); or b) At least one of the following CREs or functional variants thereof: CRE0051 or its functional variants; CRE0058 or its functional variants; CRE0042 or its functional variants; CRE0056 or its functional variants; and CRE0048 or its functional variants; CRE or a functional variant thereof, operably bound to a promoter element selected from CRE0070 or its functional variant, CRE0071 or its functional variant, CRE0099 or its functional variant, or CRE0054 or its functional variant.
[0048] a) Promoter elements suitable for use in the group's synthetic liver-specific promoter are discussed herein. As a non-limiting example, promoter elements may be selected from CRE0052, CRE0059, CRE0099, and CRE0054.
[0049] In some embodiments, the synthetic liver-specific promoter of b) comprises at least two of the enumerated cis-regulatory elements or their functional variants, operably bound to a promoter element selected from CRE0070 or a functional variant thereof, CRE0071 or a functional variant thereof, CRE0099 or a functional variant thereof, or CRE0054 or a functional variant thereof.
[0050] In some embodiments, the synthetic liver-specific promoter includes individual CREs, or combinations of CREs, or one of the functional variants, as shown in Table B, operably bound to a promoter element selected from CRE0070 or its functional variant, CRE0071 or its functional variant, CRE0099 or its functional variant, or CRE0054 or its functional variant: [Table 2]
[0051] Here again, the CREs are preferably in the enumerated order and preferably adjacent to one another. They may also be contiguous. Promoter elements are downstream of the CREs and are typically adjacent to proximal CREs. Promoter elements may be contiguous with adjacent CREs or separated by spacers.
[0052] Table B shows various individual CREs or combinations of CREs selected from CRE0051, CRE0058, CRE0042, CRE0056, and CRE0048 (or their functional variants) that can be appropriately provided by being operably coupled to promoter elements CRE0070, CRE0071, CRE0099, or CRE0054 (or their functional variants) according to some embodiments of the present invention.
[0053] In further embodiments of the present invention, an expression cassette is provided comprising a synthetic liver-specific promoter of the present invention operably bound to a sequence encoding an expression product, preferably a gene, such as a transgene. Preferably, in some embodiments, the sequence encoding the expression product is codon-optimized. In some embodiments, the expression product is a blood coagulation protein. In some preferred embodiments, the expression product is an FVIII protein. In some particularly preferred embodiments, the transgene is a codon-optimized FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed and codon-optimized FVIII gene.
[0054] In further embodiments of the present invention, an expression cassette is provided comprising a promoter element of the present invention operably bound to a sequence encoding an expression product, preferably a gene, such as a transgene. Preferably, in some embodiments, the sequence encoding the expression product is codon-optimized. In some embodiments, the expression product is a blood coagulation protein. In some preferred embodiments, the expression product is an FVIII protein. In some particularly preferred embodiments, the transgene is a codon-optimized FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed and codon-optimized FVIII gene.
[0055] In a further aspect of the present invention, an expression cassette comprising liver-specific CRE is provided, the liver-specific CRE being selected from the group consisting of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056, or any functional variant thereof operably bound to a sequence encoding the expression product, the sequence encoding the expression product may be codon-optimized. In some embodiments, the expression product is a blood coagulation protein. In some preferred embodiments, the expression product is an FVIII protein. In some particularly preferred embodiments, the transgene is a codon-optimized FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed and codon-optimized FVIII gene. Preferably, in some embodiments, any functional variant of the CRE comprises a sequence that is at least 70% identical, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a reference synthetic liver-specific CRE. Appropriately, in some embodiments, the liver-specific CRE includes CRE0094 or a functional variant thereof.
[0056] According to a further aspect of the present invention, an expression cassette is provided comprising the synthetic liver-specific CRM of the present invention operably bound to a sequence encoding the expression product, the sequence encoding the expression product may optionally be codon-optimized. In some embodiments, the expression product is a blood coagulation protein. In some preferred embodiments, the expression product is an FVIII protein. In some particularly preferred embodiments, the transgene is a codon-optimized FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed FVIII gene. In some particularly preferred embodiments, the transgene is a CpG-removed and codon-optimized FVIII gene.
[0057] In further embodiments, vectors comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, or an expression cassette according to the present invention are provided. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a gene therapy vector, appropriately an AAV vector, an adenovirus vector, a retrovirus vector, or a lentivirus vector. The AAV vector deserves particular attention.
[0058] In a further embodiment, a vector, preferably a virion (viral particle) containing a viral vector, is provided according to the present invention.
[0059] In a further embodiment, a pharmaceutical composition comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, an expression cassette, a vector, or a virion according to the present invention is provided.
[0060] In further embodiments, synthetic liver-specific modulated CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions according to the present invention are provided for use in treatment, i.e., prevention or treatment of a medical condition or disease. Preferably, the condition or disease may be related to abnormal gene expression, abnormal gene expression in the liver. Preferably, the use is for gene therapy, preferably for use in the treatment of a disease involving abnormal gene expression. In some embodiments, the disease is Pompe disease. Preferably, the gene therapy includes the expression of a therapeutic expression product in the liver. In some preferred embodiments, synthetic liver-specific modulated CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions according to the present invention are provided for use in the treatment of hemophilia A.
[0061] In one embodiment, a synthetic liver-specific modulated CRM of any embodiment described herein is provided for therapeutic use. Preferably, in some embodiments, the use is for gene therapy, and preferably for the treatment of diseases involving abnormal gene expression.
[0062] In another embodiment, synthetic liver-specific promoters of any embodiment described herein are provided for therapeutic use. In some embodiments, the use is appropriately for gene therapy, preferably for the treatment of diseases involving abnormal gene expression.
[0063] In another embodiment, an expression cassette of any embodiment described herein is provided for therapeutic use. In some embodiments, the use is for gene therapy, preferably for the treatment of diseases involving abnormal gene expression.
[0064] In another embodiment, vectors of any embodiment described herein are provided for therapeutic use. In some embodiments, the use is appropriately for gene therapy, preferably for the treatment of diseases involving abnormal gene expression.
[0065] In another embodiment, virions of any embodiment described herein are provided for therapeutic use. In some embodiments, the use is appropriately for gene therapy, preferably for the treatment of diseases involving abnormal gene expression.
[0066] In another embodiment, pharmaceutical compositions of any embodiment described herein are provided for therapeutic use. In some embodiments, the use is for gene therapy, preferably for the treatment of diseases involving abnormal gene expression.
[0067] In further embodiments, cells comprising the synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, or virion described herein are provided. In some embodiments, the cells may be eukaryotic cells, optionally mammalian cells, and optionally human cells. Preferably, the cells may be hepatocytes, and the cells may be human hepatocytes. The synthetic liver-specific CRM, synthetic liver-specific promoter, or expression cassette may be contained within the vector or within the cell's genome.
[0068] In further embodiments, synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions described herein are provided for use in the manufacture of pharmaceutical compositions for treating medical conditions or diseases discussed herein. In some embodiments, the disease is Pompe disease. In some preferred embodiments, the synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, virions, or pharmaceutical compositions described herein are for use in the manufacture of pharmaceutical compositions for the treatment of hemophilia A.
[0069] In a further embodiment, a method is provided for producing an expression product, which comprises providing hepatocytes with the synthetic liver-specific expression cassette of the present invention and expressing the genes present in the synthetic liver-specific expression cassette. This method may be in vitro or ex vivo, or may be in vivo. In some embodiments, the method is a bioprocess method. In some preferred embodiments, the expression product is factor VIII protein.
[0070] In further embodiments, a method for expressing a therapeutic transgene in hepatocytes is provided, comprising introducing a synthetic liver-specific expression cassette, vector, or virion described herein into hepatocytes. In some preferred embodiments, the therapeutic transgene is a factor VIII gene.
[0071] In a further embodiment, a method of treating an object requiring it, preferably a human being, -Administering to an expression cassette, vector, virion, or pharmaceutical composition described herein, which includes a sequence encoding a therapeutic product operably bound to a promoter according to the present invention, - To express a therapeutic amount of the therapeutic product in the liver of the subject, This is a treatment method that includes [something].
[0072] In one embodiment, a method of treating an object requiring it, preferably a human being, -Administering to any one of the expression cassettes of the embodiments described herein; and - The objective is to induce the expression of a therapeutic dose of the therapeutic product in the liver of the target organism.
[0073] In one embodiment, a method of treating an object requiring it, preferably a human being, - To administer to any one of the embodiments of the embodiments described herein; and - The objective is to induce the expression of a therapeutic dose of the therapeutic product in the liver of the target organism.
[0074] In one embodiment, a method of treating an object requiring it, preferably a human being, -Administering to any one of the virions described herein; and - The objective is to induce the expression of a therapeutic dose of the therapeutic product in the liver of the target organism.
[0075] In one embodiment, a method of treating an object requiring it, preferably a human being, -Administering to any one of the pharmaceutical compositions of the embodiments described herein; and - The objective is to induce the expression of a therapeutic dose of the therapeutic product in the liver of the target organism.
[0076] In some preferred embodiments, the therapeutic product is factor VIII.
[0077] In some embodiments, this method - Introducing an expression cassette, vector, virion, or pharmaceutical composition described herein, which contains a gene encoding a therapeutic product, into the target liver, - To express a therapeutic amount of the therapeutic product in the liver of the subject, Includes.
[0078] In some preferred embodiments, the therapeutic product is factor VIII.
[0079] Appropriately, this method involves administering a vector, virion, or pharmaceutical composition described herein to a target. In some preferred embodiments, the vector is a viral gene therapy vector, preferably an AAV vector. [Brief explanation of the drawing]
[0080] [Figure 1]These are circulating human FVIII cells at week 2 (day 14) and week 4 (day 28). Two novel promoters (SP0472 and SP0412+UTR(SP0412_v2)) and a state-of-the-art benchmark promoter (HLP) were operably ligated to the FVIII encoding sequence and packaged within an AAV8 capsid. The circulating hFVIII levels after administration of 1 × 10¹⁰ vg / mouse AAV8-FVIII are shown.
[0081] [Figure 2] These are vector copies normalized per diploid genome in the liver of mice 4 weeks after administration of 1 × 10¹⁰ vg / mouse with AAV8-FVIII. Black circles represent individual mice. Bars and lines represent the mean and standard deviation, respectively.
[0082] [Figure 3] This is the normalized circulating hFVIII level per VCN at 4 weeks after administration of 1 × 10¹¹ vg / mouse AAV8-FVIII.
[0083] [Figure 4A] These are circulating human FVIII at week 2 (day 14) and week 4 (day 28). Novel promoter SP0472, state-of-the-art benchmark promoter TTR, and prior art promoters SP0412 and SP0246 were operably conjugated to sequences encoding codon-optimized FVIII and packaged within an AAV8 capsid. Circulating hFVIII levels after administration of AAV8-FVIII at 5e9vg / mouse (Figure 4A) and 1.68e9vg / mouse (Figure 4B) are shown. Circulating levels of FVIII normalized by vector copy number and per VCN are also shown.
[0084] [Figure 4B]These are circulating human FVIII at week 2 (day 14) and week 4 (day 28). Novel promoter SP0472, state-of-the-art benchmark promoter TTR, and prior art promoters SP0412 and SP0246 were operably conjugated to sequences encoding codon-optimized FVIII and packaged within an AAV8 capsid. Circulating hFVIII levels after administration of AAV8-FVIII at 5e9vg / mouse (Figure 4A) and 1.68e9vg / mouse (Figure 4B) are shown. Circulating levels of FVIII normalized by vector copy number and per VCN are also shown.
[0085] [Figure 5] These are the FVIII mRNA expression levels in the indicated organs at terminal sacrifice 28 days after administration. The fold change in FVIII expression in the liver of each animal is shown relative to vector-derived FVIII expression. Each group consists of 5 mice (excluding groups with low-quality RNA samples), and their values are expressed as geometric mean ± SD.
[0086] [Figure 6] This bar graph shows experimental results of circulating hFVIII levels in mice administered a plasmid containing the indicated FVIII nucleic acid via hydrodynamic tail vein injection. Results are presented as hFVIII levels (%) of normal in mice where hydrodynamic injection was successful. Values are expressed as mean ± standard deviation. Values below the limit of quantification of 1.56% of normal hFVIII are shown as 1.56 for illustrative purposes. The vertical dotted line separates experimental rounds 1 and 2 on the graph. *p<0.05 vs. round 2, one-way ANOVA. [Modes for carrying out the invention]
[0087] Examples of CRE and its functional variants: Various CREs that can be used to construct liver-specific promoters are disclosed herein. These CREs generally derive from genomic promoter and enhancer sequences, but are used herein in contexts entirely different from their natural genomic environment. Generally, CREs constitute small parts of much larger genomic regulatory domains that control the expression of genes they are normally associated with. Surprisingly, many of these CREs, being very small, have been found to retain liver-specific regulatory activity when isolated from their normal environment and used to construct various synthetic promoters. This is surprising because the removal of regulatory sequences from genomic complexes and their "three-dimensional" natural contexts often results in a significant loss of activity, so there is no reason to expect a given CRE to retain the activity levels observed after removal from their natural environment. Many combinations of these CREs have been tested and found to be highly effective in enhancing liver-specific promoter activity when combined with minimal and proximal promoters. It should be noted that the sequences of the CREs of the present invention can be modified without causing substantial loss of activity. Therefore, the functional variants of CRE discussed below can be prepared by modifying the sequence of CRE, provided that modifications significantly detrimental to CRE activity are avoided. Given the information provided in this disclosure, modifications of CRE to provide functional variants are straightforward. Furthermore, this disclosure provides a methodology for simply evaluating the functionality of any given CRE variant. Functional variants of CRE are discussed below.
[0088] The relatively small size of certain CREs according to the present invention is advantageous because it allows CREs, more specifically promoters containing them, to be provided within the vector while occupying a minimal amount of the vector's payload. This is particularly important when using CREs in vectors with limited volume, such as AAV-based vectors.
[0089] The CRE of this invention includes specific liver-specific transcription factor binding sites (TFBS). In functional variants of CRE, it is generally desirable that these liver-specific TFBS remain functional. In some cases, it may be preferable that all TFBS (whether liver-specific or not) remain functional. Those skilled in the art are well aware that TFBS sequences can change but retain functionality. With this in mind, the TFBS sequence is typically represented by a consensus sequence in which some mutations are typically present. Further information regarding mutations occurring in TFBS can be represented using a position-weight matrix (PWM), which represents the frequency with which a given nucleotide typically appears at a given position in the consensus sequence. Details of transcription factor (TF) consensus sequences and associated position-weight matrices can be found, for example, in the Jaspar or Transfac databases (jaspar.genereg.net / and gene-regulation.com / pub / databases.html). With this information, those skilled in the art can modify the sequence of any given TFBS of CRE in a manner that retains, and possibly even enhances, CRE function. CRE can be scanned against all PWMs from the JASPAR database to identify / analyze all TFBSs. Those skilled in the art can, of course, find additional guidance in the literature and can further confirm TF binding to putative TFBS in any mutant CRE using routine experiments. Furthermore, analyzing the CRE described herein to identify liver-specific TFBS present within the CRE is routine for those skilled in the art, thereby enabling them to provide mutants of CRE that retain all liver-specific TFBS. It will be apparent that even within TFBSs within CRE, the sequences within the CRE can be significantly altered while retaining their function.
[0090] As an example, consider the TFBS for HNF1 found in CRE0051, as shown below. The TFBS for HNF1 in CRE0051 has the sequence GTTAATTTTTAAA (SEQ ID NO: 101). With this in mind, those skilled in the art will have sufficient guidance on how the TFBS for HNF1 can be modified while maintaining its ability to bind the desired TF. The Jaspar system scores the putative TFBS based, for example, on its similarity to a given PWM. Furthermore, the CRE can be scanned for all PWMs from the JASPAR database to identify / analyze all TFBS. Those skilled in the art will naturally be able to find additional guidance in the literature and, furthermore, can use routine experiments to confirm TF binding to putative TFBS in any mutant CRE. Although HNF1 was described in this example, those skilled in the art can do the same for other TFs and TFBS described herein. It will be clear that even within TFBSs within a CRE, the sequence within the CRE can be significantly altered while retaining its function.
[0091] Functional variants of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056 are regulatory elements that, while different from the reference element, substantially retain the activity of liver-specific CREs. Those skilled in the art will understand that it is possible to alter the sequence of a CRE while retaining its ability to bind to and enhance the expression of the required transcription factor (TF). Functional variants may include substitutions, deletions, and / or insertions compared to the reference CRE, as long as they do not substantially render the CRE non-functional.
[0092] In some embodiments, functional variants of CRE0051 TFBS for the same liver-specific TFs as CRE0051. The liver-specific TFBS present in CRE0051 are listed in the order in which they exist: HNF1, HNF4, HNF3, HNF1, and HNF3. Therefore, functional variants of CRE0051 preferably include all of these TFBS. Preferably, they exist in the same order as they exist in CRE0051, i.e., HNF1, HNF4, HNF3, HNF1, and then HNF3. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may overlap appropriately, provided that they remain functional, i.e., both duplicate sequences can bind to their respective TFs.
[0093] In some embodiments, functional variants of CRE0051 include the following TFBS sequences: GTTATTTTTAAA(HNF1), GTGGCCCTTGG(HNF4), TGTTTGC(HNF3), TGGTAATAATCTCA(HNF1), then ACAAACA(HNF3), complementary sequences, or functional variants of these TFBS sequences that maintain their ability to bind to each of these TFs (see Table 9 for TFBS sequence numbers). These may exist in the same order as CRE0051, i.e., the order described above. Sequence variability is associated with TFBS, and it is well known in the art that for a given TFBS, there is typically a consensus sequence from which some degree of deviation is typical.
[0094] In some embodiments, functional variants of CRE0042 include TFBS for the same liver-specific TFs as CRE0042. The liver-specific TFBS present in CRE0042 are listed in the order in which they exist: HNF3, C / EBP, HNF4, and C / EBP. Therefore, functional variants of CRE0042 preferably include all of these TFBS. Preferably, they exist in the same order as they exist in CRE0042, i.e., HNF3, C / EBP, HNF4, and then C / EBP. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may overlap appropriately, provided that they remain functional, i.e., both overlapping sequences can bind to their respective TFs.
[0095] In some embodiments, functional variants of CRE0042 include the following TFBS sequences: GTTCAAACATG(HNF3), CTAATACTCTG(C / EBP), TGCAAGGGTCAT(HNF4), then TTACTCAACA(C / EBP), complementary sequences, or functional variants of these TFBS sequences that maintain their ability to bind to their respective TFs (see Table 10 for TFBS sequence numbers). These may exist in the same order as CRE0042, i.e., the order described above. It is well known in the art that there is sequence variability associated with TFBS, and for a given TFBS, there is typically a consensus sequence from which some degree of deviation is typical.
[0096] In some embodiments, functional variants of CRE0058 include TFBS for the same liver-specific TFs as CRE0058. The liver-specific TFBS present in CRE0058 are HNF-4 and c / EBP, listed in the order in which they exist. Therefore, functional variants of CRE0058 preferably include all of these TFBS. Preferably, they exist in the same order as they exist in CRE0058, i.e., HNF4 followed by c / EBP. When cis regulatory elements are associated with the promoter and the gene, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may overlap appropriately, provided that they remain functional, i.e., both overlapping sequences can bind to their respective TFs.
[0097] In some embodiments, functional variants of CRE0058 include functional variants of the following TFBS sequences: CGCCCTTTGGACC(HNF4) and GACCTTTTGCAATCCTGG(c / EBP) sequences that are complementary to or maintain their ability to bind to their respective TFs (see Table 11 for TFBS sequence numbers). These may exist in the same order as CRE0058, i.e., the order described above. It is well known in the art that there is sequence variability associated with TFBS, and for a given TFBS, there is typically a consensus sequence from which some degree of deviation is typical.
[0098] In some embodiments, functional variants of CRE0056 include TFBS for the same liver-specific TFs as CRE0056. The liver-specific TFBS present in CRE0056 are listed in the order in which they exist: HNF4, HNF3, and HNF3b. Therefore, functional variants of CRE0056 preferably include all of these TFBS. Preferably, they exist in the same order as they exist in CRE0056, i.e., HNF1, HNF4, HNF3, and then HNF3b. When cis-regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may overlap appropriately, provided they remain functional, i.e., both overlapping sequences can bind to their respective TFs.
[0099] In some embodiments, functional variants of CRE0056 include the following TFBS sequences: ACTGAACCCTTGACCCCTGCCCT(HNF4), CTGTTTGCCCACTCTATTTGCCC(HNF3), then TGCCCACTCTATTTGCCCAGCC(HNF3b), complementary sequences, or functional variants of these TFBS sequences that maintain their ability to bind to their respective TFs (see Table 12 for TFBS sequence numbers). These may exist in the same order as CRE0056, i.e., the order described above. It is well known in the art that there is sequence variability associated with TFBS, and for a given TFBS, there is typically a consensus sequence from which some degree of deviation is typical.
[0100] In some embodiments, functional variants of CRE0094 include TFBS for the same liver-specific TFs as CRE0094. The liver-specific TFBS present in CRE0094 are listed in the order in which they exist: HNF4A, FOXA1, and FOXA1. Therefore, functional variants of CRE0094 preferably include all of these TFBS. Preferably, they exist in the same order as they exist in CRE0094, i.e., HNF4A, FOXA1, and then FOXA1. When cis regulatory elements are associated with promoters and genes, this order is preferably considered to be upstream to downstream (i.e., distal to the transcription start site (TSS) to proximal to the TSS). Spacer sequences may be provided between adjacent TFBS. In some embodiments, TFBS may overlap appropriately, provided that they remain functional, i.e., both overlapping sequences can bind to their respective TFs.
[0101] In some embodiments, functional variants of CRE0094 include the following TFBS sequences: AAGTCCAAAGGTAGA(HNF4A), GAGTCAACATGA(FOXA1), and CAGTCAACATTT(FOXA1), complementary sequences, or functional variants of these TFBS sequences that maintain their ability to bind to their respective TFs (see Table 13 for TFBS sequence numbers). These may exist in the same order as CRE0094, i.e., the order described above. It is well known in the art that there is sequence variability associated with TFBS, and that for a given TFBS, there is typically a consensus sequence from which some degree of deviation is typical.
[0102] Bioinformatics analysis of CRE0048 revealed that it does not contain any known liver-specific TFBS. Nevertheless, the inventors determined that CRE0048 contributes to the liver-specific activity of the promoter. While we do not wish to be bound by theory, this may be due to synergistic interaction with other CREs that contain liver-specific TFBS and enhance their activity.
[0103] In some embodiments, functional variants of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056 can be considered CREs that substantially retain their activity when substituted in place of a reference CRE in a CRM or promoter. For example, a promoter containing functional variants of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056 substituted in place of a reference promoter preferably retains 80% of its activity, more preferably 90%, more preferably 95%, and even more preferably 100% of its activity (compared to a reference promoter containing a reference CRE). For example, considering promoter SP0481, CRE0048 in SP0481 can be replaced with a functional variant of CRE0048, and the promoter substantially retains its activity. Retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of an otherwise identical promoter containing a substituted CRE under equivalent conditions. Preferred assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2, 3, and 4.
[0104] In some embodiments, functional variants of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, or CRE0056 appropriately include sequences that are at least 70% identical to the sequence of the reference CRE, more preferably sequences that are at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of the reference CRE (i.e., any one of sequence numbers 1-6), or functional variants thereof, and fall within the scope of the present invention. Additionally or alternatively, functional variants of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, or CRE0056 appropriately include sequences that hybridize with nucleic acids containing the reference CRE sequence under stringent conditions.
[0105] In some embodiments of the present invention, CRE consists of one of SEQ ID NOs: 1 to 6, or a functional variant thereof.
[0106] It should be noted that CRE or its functional variants can be provided to either strand of a double-stranded polynucleotide and in either orientation. Therefore, complementary and reverse complementary sequences of SEQ ID NOs. 1-6, or their functional variants, fall within the scope of the present invention. Single-stranded nucleic acids containing any one of SEQ ID NOs. 1-6 or their functional variants also fall within the scope of the present invention.
[0107] In some preferred embodiments, CREs are provided that include, consist of, or substantially consist of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, or CRE0056, or functional variants thereof having lengths of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides, 75 or fewer nucleotides, 50 or fewer nucleotides, or 30 or fewer nucleotides.
[0108] Promoter elements and their functional variants: Various promoter elements that can be used to construct synthetic liver-specific promoters are disclosed herein. These promoter elements are either minimal promoters or liver-specific proximal promoters. The CRE and CRM of the present invention can be used in combination with a range of suitable minimal promoters or liver-specific proximal promoters, but some proximal promoters have been found to act synergistically with the CRE or CRM to significantly contribute to the activity of the liver-specific promoter. Furthermore, some liver-specific proximal promoters, such as those disclosed herein, have been found to have high levels of activity even in the absence of further CRE or CRM sequences.
[0109] Functional variants of promoter elements include sequences that differ from the reference promoter element but substantially retain their activity as liver-specific promoter elements. Those skilled in the art will understand that it is possible to alter the sequence of a promoter element while retaining its ability to recruit RNA polymerase II, and, where relevant, to bind to liver-specific transcription factors (TFs) and enhance their expression. Functional variants of promoter elements may include substitutions, deletions, and / or insertions compared to the reference promoter element, as long as the promoter element is not rendered non-functional.
[0110] In some embodiments, a functional variant of a promoter element can be considered a promoter element that substantially retains its activity when substituted for a reference promoter element within the promoter. For example, a liver-specific promoter containing a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90%, more preferably at least 95%, and even more preferably 100% of its activity (compared to a reference promoter containing an unmodified reference promoter element). Suitable assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2, 3, and 4.
[0111] Suitable functional variants of promoter elements retain a significant level of sequence identity with the reference promoter element. A suitably functional variant contains a sequence that is at least 70% identical to the reference promoter element, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical. As described above, functional variants of CRE0059, CRE0070, CRE0071, CRE0099, CRE0073, CRE0054, and CRE0052 substantially retain the ability of the reference promoter element to act as a liver-specific promoter element. For example, if a functional variant of any of the listed promoter elements is replaced with a liver-specific promoter containing the reference promoter element, the modified liver-specific promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of its activity. Appropriately, a functional variant of the promoter element contains a sequence that has at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity with one of sequence numbers 7-12, 36.
[0112] For promoter elements that are proximal promoters, functional variants preferably retain a TFBS for liver-specific TFs that bind to the reference promoter element (the above discussion regarding PWMs also applies here). Preferably, the TFBS is retained in substantially the same order and position as the reference promoter element. It is generally preferred that the sequence of the transcription start site (TSS) remains substantially unchanged in functional variants of the promoter element. In some cases, the promoter element may include a 5' untranslated region. It is preferred that such a 5'UTR be retained in the functional variant, but in some cases it can be removed or its sequence modified if adequate activity is retained.
[0113] The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of an otherwise identical promoter, including a substituted promoter element, under equivalent conditions. Preferred assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2, 3, and 4.
[0114] The promoter elements used in the present invention may be natural (i.e., obtained from or derived from naturally occurring gene promoters) or synthetic (i.e., not naturally occurring).
[0115] Other promoter elements: Other liver-specific proximal promoters that can be used in the present invention include, but are not limited to, the ApoA-I promoter, ApoA-II promoter, ApoA-IV promoter, ApoB promoter, ApoC-1 promoter, ApoC-II promoter, ApoC-III promoter, ApoE promoter, albumin promoter, α-fetoprotein promoter, phosphoenolpyruvate carboxykinase (PCK1) promoter, phosphoenolpyruvate carboxykinase 2 (PCK2) promoter, transthyretin (TTR) promoter, α-antitrypsin (AAT or SERPINA1) promoter, TK (thymidine kinase) promoter, hemopexin promoter, alcohol dehydrogenase 6 promoter, cholesterol 7α-25 hydroxylase promoter, factor IX promoter, and microglobulin promoter. Of course, minimal promoters derived from these promoters can also be used.
[0116] Synthetic liver-specific CRM and its functional variants: Various synthetic liver-specific CRMs that can be used to construct synthetic liver-specific promoters are disclosed herein. The CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or liver-specific proximal promoters, as described above.
[0117] Functional variants of the CRM contain sequences that differ from the reference CRM element but substantially retain activity as a liver-specific CRM. It will be understood by those skilled in the art that it is possible to alter the CRM sequence while retaining its ability to recruit appropriate liver-specific transcription factors (TFs) and thereby enhance their expression. Functional variants of the CRM may contain substitutions, deletions, and / or insertions compared to the reference CRM, as long as the CRM is not substantially rendered non-functional. Reference synthetic liver-specific CRMs include CRM_SP0412_v2, CRM_SP0382, CRM_SP0383, CRM_SP0471, CRM_SP0473, CRM_SP0475, CRM_SP0477, CRM_SP0478, CRM_SP0479, and CRM_SP0480.
[0118] In some embodiments, a functional variant of a CRM can be considered a CRM that substantially retains its activity when substituted for a reference CRM within a promoter. For example, a liver-specific promoter containing a given functional variant of a CRM preferably retains at least 80%, more preferably at least 90%, more preferably at least 95%, and even more preferably 100% of its activity (compared to a reference promoter containing an unmodified CRM).
[0119] Ideally, a functional variant of the CRM retains a significant level of sequence identity with the reference CRM. A properly functional variant contains a sequence that is at least 70% identical to the reference CRM, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference CRM.
[0120] The retention of activity can be evaluated by comparing the expression of a suitable reporter under the control of a reference promoter with that of an otherwise identical promoter, including a substituted CRM, under equivalent conditions. Preferred assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2, 3, and 4.
[0121] A given functional variant of CRM may, in some embodiments, include one or more functional variants of CRE present in the reference CRM. For example, a given functional variant of CRM may include one or two functional variants of CRE present in the reference CRM. Functional variants of CRE are discussed above.
[0122] A given functional variant of a CRM may, in some embodiments, include the same combination of CREs as the reference CRM, although the CREs may be in a different order than those in the reference CRM. Typically, it is preferable that the CREs be in the same order as those in the reference CRM (therefore, a functional variant of a CRM appropriately includes the same permutations of CREs as described in the reference CRM).
[0123] A given functional variant of a CRM may, in some embodiments, include one or more additional CREs compared to those present in a reference CRM. These additional CREs may be provided upstream of, downstream of, and / or between the CREs present in the reference CRM. The additional CREs may be any of the CREs disclosed herein or other CREs. Generally, it is preferable that a given functional variant of a CRM includes the same CREs (or their functional variants) and does not include additional CREs.
[0124] A functional variant of a given CRM may include one or more additional regulatory elements compared to the reference CRM. For example, these may include inductive or repressive elements, boundary regulatory elements, insulators, locus regulatory regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the CRM non-functional.
[0125] A functional variant of a given CRM may include additional spacers between adjacent CREs, or, if one or more spacers are present in the reference CRM, these one or more spacers may be longer or shorter than the reference CRM. Spacers present in the reference CRM may also be removed in the functional variant.
[0126] It will be apparent that the CRM or functional variants thereof disclosed herein can be combined with any suitable promoter element to provide the synthetic liver-specific promoter according to the present invention.
[0127] In many cases, shorter promoter sequences are preferred, especially when the volume of the vector (e.g., viral vectors such as AAV) is limited. Therefore, in some embodiments, the synthetic liver-specific CRM has a length of 200, 150, 100, 75, 60, 50 or fewer nucleotides.
[0128] In some cases, CRE and / or CRM with a low CpG dinucleotide content is preferred. A CpG dinucleotide represents cytosine 5' relative to guanine, linked by a phosphodiester bond. Preferably, in some embodiments, the CRE or CRM of the present invention is preferably low in CpG dinucleotide content. Low CpG content means fewer CpG dinucleotides compared to a reference CRE or CRM. Preferably, in some embodiments, low CpG dinucleotide content is less than 5%, less than 2%, less than 1%, less than 0.75%, less than 0.5%, less than 0.25%, less than 0.1%, or less than 0.01% of the total dinucleotide content. Preferably, in some embodiments, the synthetic liver-specific CRE is de-CpG. Preferably, in some embodiments, the synthetic liver-specific CRM is de-CpG.
[0129] Synthetic liver-specific promoters and their functional variants: Various synthetic liver-specific promoters are disclosed herein.
[0130] Functional variants of the reference synthetic liver-specific promoter are promoters that differ from the reference synthetic liver-specific promoter but contain sequences that substantially retain liver-specific promoter activity. Those skilled in the art will understand that it is possible to alter the sequence of the synthetic liver-specific promoter while retaining the ability to recruit appropriate liver-specific transcription factors (TFs) and RNA polymerase II to provide liver-specific expression of operablely bound sequences (e.g., open reading frames). Functional variants of the synthetic liver-specific promoter may include substitutions, deletions, and / or insertions compared to the reference promoter, as long as they do not render the synthetic liver-specific promoter substantially non-functional compared to the reference promoter. Examples of reference synthetic liver-specific promoters include SP0412_v2, SP0382, SP0383, SP0471, SP0472, SP0473, SP0474, SP0475, SP0476, SP0477, SP0478, SP0479, SP0480, and SP0481. Sequences corresponding to these promoters (SEQ ID NOs. 22-35) are shown in Example 1.
[0131] Therefore, in some embodiments, a functional variant of a synthetic liver-specific promoter can be considered a variant that substantially retains the liver-specific promoter activity of the reference promoter. For example, a functional variant of a synthetic liver-specific promoter preferably retains at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and even more preferably at least 100% of the activity of the reference promoter.
[0132] Functional variants of synthetic liver-specific promoters often retain a significant level of sequence similarity to the reference synthetic liver-specific promoter. In some embodiments, the functional variant contains a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter. The reference sequences of the above promoters are sequence numbers 22-35 shown in Table 1.
[0133] The activity of functional mutants can be evaluated by comparing the expression of a suitable reporter under the control of a reference synthetic liver-specific promoter with that of the putative functional mutant under equivalent conditions. Preferred assays for evaluating liver-specific promoter activity are disclosed herein, for example, in Examples 2, 3, and 4.
[0134] A given functional variant of a synthetic liver-specific promoter may include one or more functional variants of CRE present in a reference synthetic liver-specific promoter. For example, a given functional variant of a synthetic liver-specific promoter may include one or two CRE present in a reference synthetic liver-specific promoter. Functional variants of CRE are discussed above.
[0135] A given functional variant of a synthetic liver-specific promoter may include functional variants of the promoter element, or different promoter elements compared to a reference synthetic liver-specific promoter.
[0136] A functional variant of a given synthetic liver-specific promoter may contain the same CRE as the reference synthetic liver-specific promoter, but the CRE may be present in a different order than that of the reference synthetic liver-specific promoter.
[0137] A given functional variant of a synthetic liver-specific promoter may contain one or more additional CREs compared to those present in the reference synthetic liver-specific promoter. Additional CREs can be provided upstream of the CRE present in the reference CRM, downstream of the CRE present in the reference synthetic liver-specific promoter, and / or between the CRE present in the reference synthetic liver-specific promoter. The additional CREs may be any of the CREs disclosed herein or other CREs.
[0138] A functional variant of a given synthetic liver-specific promoter may contain one or more additional regulatory elements compared to a reference synthetic liver-specific promoter. For example, these may include inductive elements, intron elements, boundary regulatory elements, insulators, locus regulatory regions, response elements, binding sites, terminal repeat segments, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the promoter non-functional. Functional variants may also include 5'UTR sequences.
[0139] A given functional variant of a synthetic liver-specific promoter may include additional spacers between adjacent CREs and promoter elements, or, if one or more spacers are present in the reference synthetic liver-specific promoter, these one or more spacers may be longer or shorter than those in the reference synthetic liver-specific promoter. Spacers present in the reference liver-specific promoter may also be removed in the functional variant.
[0140] It will be apparent that the synthetic liver-specific promoter of the present invention may include the CRM and further regulatory sequences of the present invention. For example, they may include one or more additional CRMs, inductive or repressive elements, boundary control elements, insulators, locus control regions, response elements, binding sites, segments of terminal repeats, response sites, stabilizing elements, destabilizing elements, and splicing elements, as long as they do not substantially render the promoter non-functional.
[0141] Preferred synthetic liver-specific promoters of the present invention exhibit liver-specific promoter activity at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter. In some embodiments, the synthetic liver-specific promoter of the present invention is suitable for promoting liver-specific transgene expression at at least 100% of the activity of the LP1 promoter, preferably at 150%, 200%, 300%, or 500% of the activity of the LP1 promoter. In some embodiments, the synthetic liver-specific promoter of the present invention is suitable for promoting liver-specific transgene expression at at least 70%, 80%, 90%, or 100% of the activity of the HLP promoter, preferably at 150%, 200%, 300%, or 500% of the activity of the HLP promoter. In many cases, higher levels of promoter activity are preferred, but this is not always the case. Therefore, in some cases, moderate levels of expression may be preferred. In some cases, moderate levels of expression may be preferred, for example, to prevent protein toxicity or accumulation. The activity of a given synthetic liver-specific promoter of the present invention compared to TBG can be evaluated when the two promoters are provided in otherwise equivalent expression constructs and under equivalent conditions by comparing the liver-specific expression of the reporter gene under the control of the synthetic liver-specific promoter with the expression of the same reporter under the control of the TBG promoter. The same applies to LP1 and HLP.
[0142] In some embodiments, the synthetic liver-specific promoter of the present invention can increase the expression of a gene (e.g., a therapeutic gene or target gene) in the liver or liver cells of interest by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000%, or more compared to a known liver-specific promoter, preferably the LP-1 promoter.
[0143] The preferred synthetic liver-specific promoters of the present invention exhibit activity of 50% or less, preferably 25% or less or less than CMV-IE, more preferably 10% or less or less than CMV-IE, and possibly 5% or less or less than CMV-IE, or 1% or less, compared to CMV-IE in non-hepatocytes (e.g., HEK293 cells). In some embodiments, the promoter is liver-specific if it is more active in the liver than in non-hepatocytes or tissues.
[0144] In many cases, shorter promoter sequences are preferred, especially when the volume of the vector (e.g., viral vectors such as AAV) is limited. Therefore, in some embodiments, the synthetic liver-specific promoter has a length of 350, preferably 300, more preferably 250, and most preferably 200 or fewer nucleotides.
[0145] Particularly preferred synthetic liver-specific promoters are those that are short and exhibit high levels of activity.
[0146] In some cases, promoter sequences with a low CpG dinucleotide content are preferred. The CpG dinucleotide represents cytosine 5' relative to guanine, linked by a phosphodiester bond.
[0147] Preferably, in some embodiments, the synthetic liver-specific promoter of the present invention has a low CpG dinucleotide content. A low CpG content means fewer CpG dinucleotides compared to the reference promoter. Preferably, in some embodiments, the low CpG dinucleotide content is less than 5%, less than 2%, less than 1%, less than 0.75%, less than 0.5%, less than 0.25%, less than 0.1%, or less than 0.01% of the total dinucleotide content. Preferably, in some embodiments, the synthetic liver-specific promoter has CpG removed. The CpG dinucleotide content of the above promoters (SEQ ID NOs. 22-35) is illustrated in Table 5. Appropriately, in some embodiments, the synthetic liver-specific promoter of the present invention has fewer than 25, fewer than 24, fewer than 23, fewer than 22, fewer than 21, fewer than 20, fewer than 19, fewer than 18, fewer than 17, fewer than 16, fewer than 15, fewer than 14, fewer than 13, fewer than 12, fewer than 11, fewer than 10, fewer than 9, fewer than 8, fewer than 7, fewer than 6, fewer than 5, fewer than 4, fewer than 3, fewer than 2, or less than 1 CpG dinucleotide.
[0148] Synthetic liver-specific expression cassette: The present invention also provides a synthetic liver-specific expression cassette comprising the synthetic liver-specific promoter of the present invention operably bound to a sequence encoding an expression product, preferably a gene (e.g., a transgene). The gene typically encodes a desired gene expression product, such as a polypeptide (protein) or RNA. The gene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or mutant thereof having at least some desired biological activity.
[0149] When a gene codes for a protein, it can be essentially any type of protein. Non-limiting examples include enzymes, antibodies or antibody fragments (e.g., monoclonal antibodies), viral proteins (e.g., REP-CAP, REV, VSV-G, or RD114), therapeutic proteins (e.g., FVIII), or toxic proteins (e.g., caspases 3, 8, or 9).
[0150] In some embodiments, the gene is human factor VIII (FVIII). The native human factor VIII (FVIII) gene has been characterized (gene ID: 2157; Ensembl: ENSG00000185010 MIM: 300841; AllianceGenome: HGNC: 3546; UniProtKB-P00451). GenBank accession numbers NM_000132.3 and NP_000123.1 provide examples of nucleotide and amino acid sequences of wild-type native human FVIII. The factor VIII gene produces a selectively spliced transcript. Transcript variant 1 encodes a large glycoprotein (sometimes called isoform a) synthesized as a 2351 amino acid single-chain polypeptide. The 19-amino acid signal peptide is cleaved by a protease immediately after synthesis, resulting in circulating plasma factor VIII being heterodimer. This circulates in plasma and associates with von Willebrand factor in a non-covalent complex. This is considered the standard isoform. An example of the protein sequence of isoform a is shown in Table 15 as SEQ ID NO: 95. This protein undergoes multiple cleavage events. Other transcription variants encode smaller proteins, one example being isoform b, which is primarily derived from the phospholipid-binding domain of factor VIIIc. This binding domain is essential for coagulation activity. An example of the protein sequence of isoform b is shown in Table 15 as SEQ ID NO: 96.
[0151] In some preferred embodiments of the present invention, the gene encodes a therapeutic expression product, preferably a therapeutic polypeptide suitable for use in treating a disease or condition associated with abnormal gene expression, optionally in the liver. The therapeutic expression product may be a protein, e.g., a secreted protein, e.g., a coagulation factor (e.g., factor IX or factor VIII), a cytokine, a growth factor, an antibody or nanobody, a chemokine, a plasma factor, insulin, erythropoietin, lipoprotein lipase, or a toxic protein. Alternatively, the therapeutic expression product may be RNA, such as siRNA or miRNA.A non-exclusive list of therapeutic expression products (and encoding sequences) intended for use in this invention includes: Factor VIII, Factor IX, Factor VII, Factor X, von Willebrand factor, erythropoietin (EPO), interferon-a, interferon-B, interferon-y, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), This product contains interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), interleukin-12 (IL-12), chemokine (CXC motif) ligand 5 (CXCL5), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), stem cell factor (SCF), keratinocyte growth factor (KGF), monocyte chemotactic protein-1 (MCP-1), and tumor necrosis factor (TNF). Afamine (AFM), Acid Alpha-Glucosidase (GAA), α1-Antitrypsin, α-Galactosidase A, α-L-Izuronidase, ATP7b, Ornithine Transcarbamoylase, Phenylalanine Hydroxylase, Lipoprotein Lipase, Aromatic Amino Acid Decarboxylase (AADC), ATPase Sarcoplasmic Reticulum Ca2+ Transport 2 (ATP2A2), Cystic Fibrosis Membrane Conductance Regulator (CTFR), Glutamate Decarboxylase 65kDa Protein (GAD65), Glutamate Decarboxylase 67kDa Protein (GAD6) 7) These include lipoprotein lipase (LPL), nerve growth factor (NGF), notelin (NTN), porphobilinogen deaminase (PBGD), sarcoglycan alpha (SGCA), soluble fms-like tyrosine kinase 1 (sFLT-1), apoliprotein, low-density lipoprotein receptor (LDL-R), albumin, glucose-6-phosphatase, antibodies, nanobodies, aptamers, antiviral dominant-negative proteins, and their functional fragments, subunits, or mutants.Preferably, the protein is a primate protein, more preferably a human protein. In some embodiments, the protein is α-glucosidase (GAA).
[0152] In some embodiments, the therapeutic expression product is a human FVIII polypeptide. Appropriately, in some embodiments, the human FVIII polypeptide is deleted in relation to the B domain (also known as B-domain deleted FVIII, and hereafter referred to herein as BDD FVIII, FVIIIAB, or FVIIIdeltaB). The term “B-domain deleted FVIII” includes, but is not limited to, FVIII polypeptides in which all or part of the B domain is deleted and FVIII mutants in which the B domain is replaced by a linker. Non-exclusive examples of B-domain deleted FVIII are described in Ward et al. (2011) (see Figure 1) and International Publication No. 2011 / 005968 (see pp. 7, line 20 to pp. 10, line 20, and Figures 5 and 8), which are incorporated herein by reference.
[0153] In a preferred embodiment, the FVIII polypeptide has a deletion of the B domain and no further domain substitution.
[0154] In some embodiments, amino acid substitutions are introduced at two known FVIII APC cleavage sites, Arg355 and Arg581 (amino acid numbering refers to the sequence containing the signal peptide) to generate FVIII polypeptides resistant to APC cleavage. In some embodiments, specific amino acid substitutions of Q for R at these sites (FVIII-R355Q / R581Q [FVIII-QQ]) are reflected in the FVIII polypeptide sequence of SEQ ID NO: 60. Consistent with APC, which has a significant in vivo role in FVIIIa regulation, FVIII-QQ demonstrates superior hemostatic efficacy compared to wild-type FVIII in an APC-dependent manner. In some embodiments, functional variants of the human FVIII polypeptide described herein include those resulting from amino acid substitutions in the amino acid sequence of SEQ ID NO: 60. It is expected that different amino acids can be substituted at positions 355 and / or 581 to generate functional variants of the human FVIII polypeptide described herein. This includes arginine substitutions to return to the wild-type sequence at one or more of these sites. In one embodiment, FVIII includes a substitution at position 355 that is not Gln(Q). In one embodiment, the amino acid at position 355 is substituted with Lys(K), Asp(D), Glu(E), or Asn(N). In one embodiment, the amino acid at position 355 is substituted with Asn(N).
[0155] In one embodiment, FVIII includes a substitution at position 581 that is not Gln(Q). In one embodiment, the amino acid at position 581 is substituted with Lys(K), Asp(D), Glu(E), or Asn(N). In one embodiment, the amino acid at position 581 is substituted with Asn(N).
[0156] It has been further shown that FVIII polypeptides possessing only one of the R355Q or R581Q substitutions, as reflected in SEQ ID NO: 60, also exhibit excellent hemostatic efficacy. Further functional variants of human FVIII that possess either one of the R355Q or R581Q substitutions, or are substituted with Lys(K), Asp(D), Glu(E), or Asn(N), are conceivable as such.
[0157] In some embodiments, the first 19 amino acids of the human FVIII polypeptide (e.g., underlined in SEQ ID NO: 60) are an N-terminal secretory signal sequence (also called a signal sequence or signal peptide) having the amino acid sequence MQIELSTCFFLCLLRFCFS (SEQ ID NO: 80). In one embodiment, the FVIII polypeptide sequence does not contain an N-terminal signal sequence. In one embodiment, the FVIII polypeptide has a different secretory signal sequence. For example, one or more amino acids are modified (substituted, deleted, or inserted) to create a functional variant, or the entire sequence is replaced by different amino acids that act as a secretory sequence. In one embodiment, the FVIII polypeptide completely lacks a signal sequence. In such embodiments, the codon-optimized nucleic acid has one nucleotide sequence from SEQ ID NOs: 61-78 and further lacks the first 19 codons (the 57 nucleotides closest to the 5' end) that encode the N-terminal signal sequence. In one embodiment, the human FVIII polypeptide further includes a heterologous signal sequence that promotes secretion from the liver instead of the native signal sequence. In one embodiment, the heterologous secreted signal peptide is a signal peptide having the amino acid sequence described in Table 15, or a functional variant thereof. Non-limiting examples of heterologous signal peptides are disclosed herein, including but not limited to signal peptides containing any of the amino acid sequences of SEQ ID NOs: 81-94 or any signal sequence shown in Table 16. Nucleotide coding sequences of such signal peptides are shown in Table 16. In such embodiments, the codon-optimized nucleic acid lacks the 57 nucleotides at the very end of the 5' that code for the native N-terminal signal sequence, and instead has a nucleotide sequence that codes for the heterologous signal sequence. Nucleotide sequences that code for such signal peptides are shown in Table 16 and are discussed further herein.
[0158] In some embodiments, the sequence encoding the expression product is a codon-optimized nucleic acid encoding the human FVIII polypeptide. In some embodiments, the codon-optimized nucleic acid comprises or consists of one of 18 specifically identified codon-optimized nucleic acids encoding the human FVIII polypeptide, referred to herein as F8QQ1-F8QQ18, as shown in Table 15 (SEQ ID NOs. 61-78). Surprisingly, there was variation in activity among the 18 codon-optimized sequences (see, for example, Figure 6). In one embodiment, the codon-optimized FVIII sequence has the nucleotide sequence described in one of SEQ ID NOs. 61-78. In one embodiment, the codon-optimized FVIII sequence has the nucleotide sequence described in any of SEQ ID NOs. 61, 62, 64, 65, 67-69, 71-75, or 78. In one embodiment, the codon-optimized FVIII sequence has the nucleotide sequence described in any of SEQ ID NOs. 64, 65, 67, 72-75, or 78. In one embodiment, the codon-optimized FVIII sequence has the nucleotide sequence described in any of SEQ ID NOs: 64, 65, 73, or 75. In one embodiment, the codon-optimized FVIII sequence has the nucleotide sequence described in any of SEQ ID NOs: 64 or 65. Minor changes in the nucleotide sequence are not expected to significantly alter the activity of the identified nucleic acid. Such sequence changes may be silent changes (not resulting in amino acid changes in the encoded protein) or they may result in amino acid substitutions and thus encode variants of the human FVIII polypeptide of SEQ ID NO: 60. Non-limiting examples of such polypeptide variants are described herein.
[0159] In some embodiments of the compositions and methods disclosed herein, the codon-optimized nucleic acid has a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more similar to the sequence shown in one of SEQ ID NOs.
[0160] In some embodiments of the compositions and methods described herein, the human FVIII polypeptide has the amino acid sequence described below (SEQ ID NO: 60) or is identical thereto by at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
[0161] As described above, in some situations, it may be desirable for the nucleic acid, and appropriately FVIII, to be codon-optimized. While we do not wish to be bound by theory, it is thought that codon optimization may improve gene expression and increase gene translation efficiency. Appropriately, in some embodiments, increased expression refers to exogenous FVIII expression at least 25% higher in codon-optimized FVIII nucleic acid compared to the expression level resulting from the native FVIII nucleic acid sequence. In some embodiments, increased expression means that, compared to the exogenous factor VIII expression level of the original FVIII-coding nucleic acid, the expression level using the nucleic acid with the optimized codon encoding FVIII is at least 50%, at least 75%, at least 100%, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 125 times, at least 150 times, at least 175 times, at least 200 times, at least 225 times, or at least 250 times greater, using nucleic acid with the optimized codon encoding FVIII.
[0162] Appropriately, administration of a vector, virion, or pharmaceutical composition containing the codon-optimized nucleic acid described herein may result in increased expression of the FVIII polypeptide in a subject compared to the expression resulting from administration of an otherwise identical expression vector containing a codon-unoptimized (natural) nucleic acid encoding the same FVIII polypeptide. Such expression can be measured by the amount of the expressed polypeptide or the polypeptide's activity. In some embodiments, increased expression refers to at least 25% higher levels of exogenous FVIII polypeptide or activity in the blood of an animal administered the codon-optimized FVIII nucleic acid compared to levels resulting from a natural FVIII nucleic acid sequence. In some embodiments, increased expression means that the level of exogenous factor VIII polypeptide or activity in the blood of animals administered with a nucleic acid encoding a codon-optimized FVIII polypeptide is at least 50%, at least 75%, at least 100%, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 125 times, at least 150 times, at least 175 times, at least 200 times, at least 225 times, or at least 250 times greater than the level of exogenous factor VIII polypeptide or activity in the blood of animals administered with a native FVIII-coding nucleic acid.
[0163] As described above, a low CpG content is sometimes desirable. Appropriately, in some embodiments, the synthetic liver-specific expression cassette of the present invention has a low CpG dinucleotide content. A low CpG content means fewer CpG dinucleotides compared to a reference expression cassette. Appropriately, in some embodiments, the low CpG dinucleotide content is less than 5%, less than 2%, less than 1%, less than 0.75%, less than 0.5%, less than 0.25%, less than 0.1%, or less than 0.01% of the total dinucleotide content. Appropriately, in some embodiments, the synthetic liver-specific expression cassette is decontaminated.
[0164] In some embodiments of the present invention, the synthetic liver-specific expression cassette includes a gene encoding a site-specific nuclease useful for gene editing, such as a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector-based nuclease (TALEN), or clustered and regularly arranged short palindromic repeat systems (CRISPR-Cas). Preferably, the site-specific nuclease is adapted to edit a desired target genomic locus by performing a cleavage (typically a site-specific double-strand break), which is then repaired by non-homologous end joining (NHEJ) or homology-dependent repair (HDR) to achieve the desired editing. The editing may be partial or complete repair of a dysfunctional gene, or knockdown or knockout of a functional gene.
[0165] Suitablely, the synthetic liver-specific expression cassette includes a sequence that provides or codes for one or more, preferably all, of the following: a ribosome binding site, a start codon, a stop codon, and a transcription termination sequence. Suitablely, the expression cassette includes a nucleic acid encoding a post-transcriptional regulatory element. Suitablely, the expression cassette includes a nucleic acid encoding a poly(A) element.
[0166] Vectors and viral particles: The present invention further provides a vector comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, or an expression cassette according to the present invention.
[0167] In some embodiments of the present invention, the vector is a plasmid. Such a plasmid may contain a variety of other functional nucleic acid sequences, such as one or more selection markers, one or more origins of replication, and multiple cloning sites. In some embodiments of the present invention, the vector is a viral vector.
[0168] In some embodiments of the present invention, the vector is an expression vector for expression in eukaryotic cells. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl, and pSG available from Stratagene; pSVK3, pBPV, pMSG, and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, and pCMV-EGFP available from Clontech. Many other vectors are known and commercially available. In the case of adenovirus vectors for mammalian cells, the pSV and pCMV series of vectors are particularly well known but non-limiting examples. There are many well known yeast expression vectors, including, but not limited to, yeast integration plasmids (YIp) and yeast replication plasmids (YRp). In the case of plants, the Agrobacterium Ti plasmid is an exemplary expression vector, and plant viruses also provide suitable expression vectors, such as tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.
[0169] In some preferred embodiments, the vector is a gene therapy vector. Various gene therapy vectors are well known in the art, and include AAV vectors, adenovirus vectors, retrovirus vectors, and lentivirus vectors. When the vector is a gene therapy vector, the vector preferably comprises a nucleic acid sequence operably bound to the synthetic liver-specific promoter of the present invention, which appropriately encodes a therapeutic product, a therapeutic protein. The therapeutic protein may be a secreted protein. Non-limiting examples of secreted proteins are discussed above, and exemplary secreted therapeutic proteins include coagulation factors, e.g., factor VIII or factor IX, insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors, and toxic proteins. In some preferred embodiments, the therapeutic protein is FVIII.
[0170] In some embodiments of the present invention, the vector is a viral vector, such as a retrovirus, lentivirus, adenovirus, or adeno-associated virus (AAV) vector. In some preferred embodiments, the vector is an AAV vector. In some preferred embodiments, the AAV has a serotype suitable for hepatic transduction. In some embodiments, the AAV is selected from the group consisting of AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, or derivatives thereof. The AAV vector is preferably used as a self-complementary double-stranded AAV vector (scAAV) to overcome one of the limiting steps of AAV transduction (i.e., single-stranded to double-stranded AAV conversion), although the use of a single-stranded AAV vector (ssAAV) is also encompassed herein. In some embodiments of the present invention, the AAV vector is a chimeric vector, meaning that it contains components derived from at least two AAV serotypes, such as the ITR of AAV2 and the capsid protein of AAV5. In some embodiments, the AAV is AAV8 or a derivative thereof.
[0171] In some embodiments, the vectors of the present invention have a low CpG dinucleotide content. Low CpG content means fewer CpG dinucleotides compared to a reference vector. Preferably, in some embodiments, the low CpG dinucleotide content is less than 5%, less than 2%, less than 1%, less than 0.75%, less than 0.5%, less than 0.25%, less than 0.1%, or less than 0.01% of the total dinucleotide content. Preferably, in some embodiments, the vectors are de-CpG.
[0172] The present invention further provides recombinant virions (viral particles) containing the above-mentioned vector.
[0173] Pharmaceutical composition: The vector or virion of the present invention can be formulated into a pharmaceutical composition comprising pharmaceutically acceptable excipients, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition may be provided in the form of a kit.
[0174] Therefore, a further aspect of the present invention provides a pharmaceutical composition comprising an expression cassette, vector, or virion as described herein.
[0175] Treatment and other methods and uses: The present invention also provides synthetic liver-specific CRMs, synthetic liver-specific promoters, UTRs, expression cassettes, vectors, virions, or pharmaceutical compositions according to various embodiments of the present invention for use in the treatment of diseases, preferably diseases associated with abnormal gene expression, and optionally the liver (e.g., hereditary liver diseases). Various diseases associated with abnormal gene expression in the liver have been discussed above, and these include, but are not limited to, hemophilia (including hemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, phenylketonuria, ornithine transcarbamylase deficiency, glycogen storage disorders (e.g., Pompe disease), α1-antitrypsin deficiency, hereditary hemochromatosis, tyrosinemia type 1, argininosuccinateuria, hepatitis virus infection, nonviral hepatitis, liver cancer, hereditary cholestasis, Wilson's disease, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD), alcohol-related liver disease (ARLD), and lysosomal storage disorders). Use for the treatment of hemophilia A or B represents a preferred embodiment of the present invention. Use for the treatment of hemophilia A represents a particularly preferred embodiment of the present invention. In some preferred embodiments, the disease is Pompe disease.
[0176] The present invention also provides synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, or virions according to various embodiments of the present invention for use in the manufacture of pharmaceutical compositions for treating any of the conditions or diseases described herein. In some preferred embodiments, synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, or virions according to various embodiments of the present invention for use in the manufacture of pharmaceutical compositions for treating hemophilia A.
[0177] The present invention further provides cells comprising synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, and virion according to various embodiments of the present invention. Preferably, the cells are eukaryotic cells. Eukaryotic cells may preferably be fungal cells (e.g., yeast cells), animal (metazoan) cells (e.g., mammalian cells), or plant cells. Alternatively, the cells may be prokaryotic cells.
[0178] In some embodiments of the present invention, the cells are ex vivo, for example, in cell culture. In other embodiments of the present invention, the cells may be part of a tissue or a multicellular organism.
[0179] In a preferred embodiment, the cells are hepatocytes, which may be ex vivo or in vivo. The hepatocytes may be primary hepatocytes or cells from a liver-derived cell line, such as an immortalized cell line. The cells may be present in a liver tissue environment (e.g., within an animal's liver) or isolated from liver tissue, for example, in a cell culture. Preferably, the cells are human cells.
[0180] The liver-specific CRM, synthetic liver-specific promoter, expression cassette, or vector according to the present invention may be inserted into the genome of a cell, or it may be present in an episome (for example, in an episomal vector).
[0181] In a further embodiment, the present invention provides a method for producing an expression product, comprising providing a synthetic liver-specific expression cassette according to the present invention to cells, preferably hepatocytes (preferably in a vector as described above), and expressing a gene present in the synthetic liver-specific expression cassette. The method preferably includes maintaining the hepatocytes under conditions suitable for gene expression. During culture, this may include incubating the cells or tissue containing cells under appropriate culture conditions. Expression may, of course, occur in vivo, for example, in one or more cells in the liver of the subject. In some preferred embodiments, the expression product is an FVIII protein.
[0182] Appropriately, the method includes the step of introducing a synthetic liver-specific expression cassette into hepatocytes. A wide range of methods for transfecting hepatocytes are well known in the art. A preferred method for transfecting hepatocytes is to transduce the cells with a viral vector containing a synthetic liver-specific expression cassette, such as an AAV vector.
[0183] It will be apparent to those skilled in the art that synthetic liver-specific CRMs, synthetic liver-specific promoters, expression cassettes, vectors, or virions according to various embodiments of the present invention can be used in gene therapy. Therefore, the use of such nucleic acid constructs in gene therapy forms part of the present invention.
[0184] Accordingly, the present invention provides, in some embodiments, expression cassettes, vectors, or virions according to the present invention for use in gene therapy in a subject, preferably by liver-specific expression of a therapeutic gene. The therapy may include the treatment of a disease by secretion of therapeutic products from hepatocytes, and appropriately, a disease involving abnormal gene expression in the liver (e.g., hemophilia A or B). In some preferred embodiments, the therapy includes the treatment of hemophilia A. In some embodiments, the therapy includes the treatment of Pompe disease.
[0185] The present invention also provides a method for expressing a therapeutic transgene in hepatocytes, comprising introducing an expression cassette or vector according to the present invention into hepatocytes. The hepatocytes may be in vivo or ex vivo. In some preferred embodiments, the therapeutic transgene is FVIII.
[0186] The present invention also provides a gene therapy method for a subject requiring it, preferably a human, and this method is as follows: The present invention includes administering (preferably introducing into the target liver) a synthetic liver-specific expression cassette, vector, virion, or pharmaceutical composition containing a gene encoding a therapeutic product.
[0187] In some preferred embodiments, the therapeutic product is the FVIII protein.
[0188] This method appropriately includes expressing a therapeutic dose of the therapeutic product from the genes of the liver of the subject.
[0189] Genes encoding appropriate therapeutic products have been mentioned above. However, specific examples include therapeutic proteins such as factor VIII and factor IX for the treatment of hemophilia.
[0190] This method appropriately includes administering the vector or virion according to the present invention to a target. Preferably, the vector is a viral gene therapy vector, such as an AAV vector.
[0191] In some embodiments, the method includes systemic administration of a viral gene therapy vector. Systemic administration may be enteral (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred injection routes include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.
[0192] In some embodiments, the viral gene therapy vector may be administered simultaneously or sequentially with one or more additional therapeutic agents or one or more saturators designed to prevent vector clearance by the reticular endothelial system.
[0193] If the vector is an AAV vector, the dose of the vector is 1 × 10⁻⁶ 10 gc / kg ~ 1 × 10 15 gc / kg or higher, preferably 1 × 10⁻⁶ 12 gc / kg ~ 1 × 10 14 gc / kg, appropriately 5 × 10 12 gc / kg ~ 5 × 10 13 It could be gc / kg.
[0194] Generally, the subjects requiring it are mammals, preferably primates, and more preferably humans. Typically, the subjects requiring it exhibit symptoms characteristic of a disease. This method typically involves alleviating the symptoms exhibited by the subjects requiring it by expressing a therapeutic dose of the therapeutic product.
[0195] Gene therapy protocols for therapeutic gene expression in target cells in vitro and in vivo are well known in the art and will not be discussed in detail here. Briefly, they include intramuscular injection, interstitial injection, respiratory drip, endothelial application, intrahepatic injection, and intravenous or intra-arterial injection (e.g., hepatic arterial injection, hepatic venous injection) of plasmid DNA vectors (naked or in liposomes) or viral vectors. Various devices have been developed to enhance the availability of DNA to target cells. Simple approaches involve physically contacting target cells with a catheter or implantable material containing the relevant vector, while more complex approaches may utilize jet propulsion devices, etc. Gene transfer into mammalian hepatocytes is performed using both ex vivo and in vivo procedures. Ex vivo approaches typically require harvesting of hepatocytes, in vitro transduction with a suitable expression vector, and subsequent reintroduction of transduced hepatocytes into the liver. In vivo gene transfer is achieved by injecting DNA or viral vectors into the hepatic parenchyma, hepatic artery, or portal vein.
[0196] According to several preferred embodiments, the above method can be used to treat a subject having hemophilia, for example, hemophilia A or B. Therefore, the present invention provides a method for treating a subject having hemophilia A or B, the method comprising the following steps: The synthetic liver-specific expression cassette, vector, virion, or pharmaceutical composition of the present invention, which contains a gene encoding a suitable coagulation factor (particularly factor VIII in the case of hemophilia A or factor IX in the case of hemophilia B), is administered to the target (preferably introduced into the target liver), To express a therapeutic amount of coagulation factor in the liver of the subject, Includes.
[0197] In some cases, synthetic liver-specific expression cassettes are provided in gene therapy vectors, preferably AAV vectors.
[0198] Preferably, the method includes expressing an appropriate amount of the relevant coagulation factor in the target liver to alleviate or improve the symptoms of hemophilia A or B. In some preferred embodiments, the method includes expressing an appropriate amount of factor IX in the target liver to alleviate or improve the symptoms of hemophilia B. In some preferred embodiments, the method includes expressing an appropriate amount of factor VIII in the target liver to alleviate or improve the symptoms of hemophilia A.
[0199] In further embodiments, a UTR is provided. In some embodiments, the UTR is a 5'UTR. In some embodiments, the UTR includes or consists of SEQ ID NO: 13 or a functional variant thereof. In some embodiments, the 5'UTR includes or consists of SEQ ID NO: 13 or a functional variant thereof. Preferably, any functional variant of the UTR includes a sequence that is at least 70% identical to the reference UTR sequence, more preferably a sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference UTR sequence. In some embodiments, the UTR includes or consists of SEQ ID NO: 119 or a functional variant thereof. In some embodiments, the 5'UTR includes or consists of SEQ ID NO: 119 or a functional variant thereof. Preferably, any functional variant of the UTR includes a sequence that is at least 70% identical to the reference UTR sequence, more preferably a sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the reference UTR sequence.
[0200] In a further embodiment, a synthetic liver-specific promoter is provided that includes or comprises a UTR comprising SEQ ID NO: 13 or a functional variant thereof.
[0201] In a further embodiment, a synthetic liver-specific promoter is provided that includes or comprises a UTR containing SEQ ID NO: 119 or a functional variant thereof.
[0202] FVIII and Hemophilia A Factor VIII, as found in nature, is central to coagulation activity, and mutations in the FVIII gene result in hemophilia A, the most common form of hemophilia. Full-length FVIII is a large 280 kDa protein expressed primarily in hepatic sinusoidal endothelial cells (LSECs) and extrahepatic endothelial cells (Fahs et al., Blood (2014) 123:3706-3713; Everett, et al., Blood (2014) 123:3697-3705). Natural FVIII circulates mainly as a heavy- and light-chain heterodimer linked via non-covalent metal-dependent interactions (Lenting et al., Blood (1998) 92:3983-3996). Natural factor VIII contains several domains and is 2332 amino acid long (mature without a signal peptide). Generally, the domains are called A1-A2-B-A3-C1-C2. The FVIII gene is translated into a single peptide chain with the domain structure Al-al-A2-a2-B-a3-A3-Cl-C2. Proteolytic cleavage of FVIII at R-1313 and / or R-1648 by trans-Golgi proteasephrin results in heterodimerization. The FVIII heavy chain (A1-a1-A2-a2-B) and light chain (a3-A3-Cl-C2) remain bound via a non-covalent metal ion-dependent interaction between the Al domain and the A3 domain. Initially, FVIII is in an inactive form bound to von Willebrand factor (vWF). FVIII is activated by cleavage by thrombin (factor Ila) and release of the B domain. Activated FVIII (FVIIIa) separates from vWF and interacts with coagulation factor IXa, leading to thrombus formation via the coagulation cascade. During coagulation, the single-stranded or heterodimer FVIII is activated to its heterotrimeric cofactor form by thrombin-mediated cleavage at R-372, R-740, and R-1689. A2 remains associated with Al-al via non-covalent interactions. Inactivation of FVIIIa occurs at R-336 and R-562, primarily by activated protein C, via spontaneous A2 dissociation and / or proteolytic cleavage.
[0203] Specific alterations in the amino acid sequence of native FVIII are known to be associated with enhanced activity (e.g., via protein resistance to proteolytic inactivation). The FVIII B domain has been found to be non-essential for procoagulant activity. Consequently, FVIII constructs lacking the B domain are typically used for gene transfer purposes because their smaller size makes them more readily incorporated into vectors. Furthermore, deletion of the B domain has been shown to result in a 17-fold increase in mRNA and primary translation product. FVIII with deleted and substituted B domains (e.g., short amino acid linkers, e.g., 14a.a. linkers) are currently used clinically for protein replacement therapy.
[0204] Similarly, FVIII polypeptides encoded in gene therapy are typically engineered to be single-stranded polypeptides. Single-stranded factor VIII polypeptides may have their native cleavage sites removed, their B domains omitted, cleaved, or replaced with alternative sequences. Consequently, they do not mature by cleavage (other than cleavage of the signal and / or leader peptide) and are active as single-stranded polypeptides. Non-exclusive examples of single-stranded factor VIII polypeptides are described by Zollner et al. (Thromb Res, 134(1):125-31 (2014)) (see, e.g., page 126, column 1, paragraph 2) and Donath et al. (Biochem J., 312(1):49-55 (1995)) (see, e.g., page 50, column 1, paragraph 1), the contents of which are incorporated herein by reference. Gene therapy using AAV vectors can only utilize truncated FVIII molecules such as BDD-FVIII due to the limited packaging capacity of AAV (4.7Kb) and other vector systems (Lind et al. (1995) Eur.J. Biochem., 232(1):19-27). In some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably conjugated to a nucleic acid sequence encoding a single-stranded factor VIII polypeptide as described herein. The B domain accounts for 40% (908 amino acids) of the native protein and is not required for procoagulant activity (Brinkhous, et al., Proc. Natl. Acad. Sci. (1985) 82:8752-8756). Functional variants of the human FVIII polypeptide described herein include various repeats of B domain deletion and may also include linker substitutions. The most common B-domain deletion (BDD) FVIII contains 14 original amino acid residues (SFSQNPPVLKRHQR (SEQ ID NO: 79)) as a linker (Lind, et al. (1995) Eur. J. Biochem., 232(1):19-27). This BDD FVIII is typically called BDD-SQ or hFVIII-SQ.Short peptide linkers substituted in the B-domain (e.g., 25 or fewer amino acids, 20 or fewer amino acids, 15 or fewer amino acids, or 10 or fewer amino acids) can also be used in FVIII polypeptide variants (Lind, et al. (1995) Eur. J. Biochem., 232(1):19-27; Pittman, et al., Blood (1993) 81:2925-2935; Toole, et al., Proc. Natl. Acad. Sci. (1986) 83:5939-5942). In some variants, the peptide linker contains basic amino acids (e.g., Arg, His, or Lys) at positions -1 and -4 relative to Glul649. This BDD FVIII type is commonly used in the production of recombinant BDD-FVIII (~4.4Kb) for gene therapy. (Bemtorp, E., Semin. Hematol. (2001) 38(2 Suppl 4):1-3; Gouw, et al., N. Engl. J. Med. (2013) 368:231-239; Xi, et al., J. Thromb. Haemost. (2013) 11:1655-1662; Recht, et al., Haemophilia (2009) 15:869-880; Sabatino, et al., Mol. Ther. (2011) 19:442-449; Scallan, et al., Blood (2003) 102:2031-2037). U.S. Patent No. 8,816,054, incorporated herein by reference, also provides BDD FVIII molecules having linkers of different lengths and sequences. In some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably conjugated to a nucleic acid sequence encoding a single-stranded factor VIII polypeptide as described herein.
[0205] Deletion of the entire B domain results in a 17-fold increase in mRNA and primary translation product; however, the increase in secreted protein levels is only 30%, suggesting that the rate of ER-Golgi transport is actually reduced (Pittman DD, et al. Blood. 1994;84(12):4214-4225). Efficient FVIII secretion requires carbohydrate-facilitated transport mediated by lectin-mannose-1 (LMAN1), which is post-translationally bound to the B domain by an N-linked oligosaccharide mannose residue. To construct the advantages of BDD-FVIII while supporting LMAN1-mediated transport, a short B domain sequence, optimally 226 amino acids, and six retaining sites for N-linked glycosylation (N6) were added to BDD-FVIII. This resulted in a tenfold increase in secretion from transfected COS-1 cells in vitro and a fivefold increase in vivo after hydrodynamic liver gene delivery (Miao HZ, et al. Blood. 2004;103(9):3412-3419; Ward et al, Blood 2011 Jan 20;117(3):798-807). Appropriately, in some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably conjugated to a nucleic acid sequence encoding a factor VIII-BDD polypeptide to which the 226 amino acid sequence of FVIII described herein has been added. F309S modification and the addition of up to six glycosylation sites in the B domain have been shown to improve FVIII secretion by nearly 20 times (Pipe SW, Semin Thromb Hemost. 2004;30:227-237). Substitution of Phe(F) with Ser(S) at position 309 in the A1 domain reduces the affinity for the ER chaperone BiP and its dependence on adenosine triphosphate (Chen et al, Molecular Therapy, Volume 15, issue 10, pp. 1856-1862, October 2007) for secretion.Appropriately, in some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably conjugated to a nucleic acid sequence encoding a factor VIII polypeptide comprising six glycosylation sites of the B domain and further comprising the F309S modification described herein.
[0206] Coagulation factor VIII (FVIII) is secreted as a heterodimer consisting of a heavy chain (HC) and a light chain (LC), which can be expressed independently and recombined to restore biological activity. Due to the size limitations of adeno-associated virus (AAV) vectors, strategies have been developed to deliver HC and LC separately. However, FVIII HC is secreted with 10 to 100 times lower efficiency than LC. The F309S mutation and enhanced B-domain glycosylation alone were not sufficient to improve FVIII HC secretion, suggesting a role for FVIII LC in regulating HC secretion. In vitro, ligation of LC to HC and hydrodynamic injection of FVIII intein plasmid into hemophilia A mice significantly increased HC secretion. Furthermore, similar enhancement of HC secretion can be observed even when LC is supplied trans, which is likely due to spontaneous association of HC and LC in the secretory pathway. Similarly, single point mutations in LC may also disrupt FVIII folding and secretion. Point mutations from the human hemophilia A mutation database support this hypothesis, as point mutations, e.g., L1756V, G1760R, A1779P, S1888R, R1941Stop, and many other mutations are distributed almost evenly throughout the FVIII LC, resulting in detection of less than 1% of FVIII antigens in patients. In summary, a suitable LC is essential for efficient FVIII secretion (Chen et al., Molecular Therapy, Volume 15, issue 10, pp. 1856-1862, October 2007). Appropriately, in some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably conjugated to a nucleic acid sequence encoding a factor VIII-HC polypeptide linked to the LC polypeptide described herein.In some embodiments of the present invention, two plasmids are co-transfected into an animal or subject having hemophilia A, one plasmid comprising the synthetic liver-specific promoter of the present invention operably conjugated to a nucleic acid sequence encoding factor VIII-HC polypeptide, and the other plasmid comprising the synthetic liver-specific promoter of the present invention operably conjugated to a nucleic acid sequence encoding factor VIII-LC polypeptide as described herein.
[0207] In some embodiments of the present invention, the synthetic liver-specific promoter of the present invention is operably bound to a nucleic acid optimized for a codon encoding a human factor VIII (FVIII) polypeptide, the encoded FVIII polypeptide lacking a B domain and containing amino acid substitutions of glutamine (R355Q) for arginine at position 355 and glutamine (R581Q) for arginine at position 581, or represented as a codon-optimized FVIII QQ sequence. In some examples, the codon-optimized FVIII QQ nucleic acid sequence is described in any one of sequence numbers 1, 2, 4, 5, 7-9, 11-15 or 18, or a nucleic acid having at least 90% sequence identity thereto, as described in Table 3, pages 134-146 of the published international application PCT / US 2023 / 019211 (publication number: International Publication 2023205300), which is incorporated by reference, or a nucleic acid having at least 90% sequence identity thereto. International publication PCT / US No. 2023 / 019211 (publication number: International Publication No. 2023205300) is incorporated herein by reference in its entirety.
[0208] Additional notes: In some embodiments, the CRM or synthetic liver-specific promoter does not contain both CRE0077 (or its functional variant) and CRE0078 (or its functional variant). In some embodiments of the present invention, the CRE, CRM or synthetic liver-specific promoter contains either CRE0077 or CRE0078 (or its functional variant), but it does not contain any further CRE selected from the group consisting of CRE0077 (or its functional variant) and CRE0078 (or its functional variant). In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not contain two or more CRE selected from the group consisting of CRE0077 (or its functional variant) or CRE0078 (or its functional variant).
[0209] In some embodiments of the present invention, the CRE, CRM, or synthetic liver-specific promoter does not include CRE0077 or its functional variant or CRE0078 or its functional variant.
[0210] CRE0077(V1)-AAGCAAATATTTGTGGTTATGGATTAACTCGAACTGTTTGCCCACTCTATTTGCCCTGTACC(Sequence ID 118) CRE0078(V2)-GGCGCCCTTTGGACCTTTTGCAATCCTGGAGCAAACAGCAAACACTGTACC(Sequence ID 37) In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not contain the sequence GGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCA (SEQ ID NO: 38), or GCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCA (SEQ ID NO: 39), or any functional variant thereof. These sequences are part of the SEPRINA1 promoter.
[0211] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter includes either CRE0077 or CRE0078 (or a functional variant thereof), and it does not include SEQ ID NO: 38 or SEQ ID NO: 39 (or a functional variant thereof). Therefore, in some embodiments, the CRM or synthetic liver-specific promoter does not include one or more of sequences V1, V2, SEQ ID NO: 38, and SEQ ID NO: 39.
[0212] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter comprises two or fewer of the following elements: LVR_CRE0080_PROC, LVR_CRE0081_APOA1, LVR_CRE0061_APOB, LVR_CRE0082_APOC4, SEQ ID NO: 38 and SEQ ID NO: 39, or any functional variant thereof. In some embodiments of the present invention, the CRM or synthetic liver-specific promoter comprises one or fewer of the above elements, or any functional variant thereof. In some embodiments of the present invention, the CRM or synthetic liver-specific promoter comprises none of the above elements, or any functional variant thereof. LVR_CRE0080_PROC and LVR_CRE0081_APOA1 are components of CRE0077, and LVR_CRE0061_APOB and LVR_CRE0082_APOC4 are components of CRE0078. The sequences of these elements are as follows: LVR_CRE0080_PROC-AAGCAAATATTTGTGGTTATGGATTAACTCGAA (Sequence ID 97).
[0213] LVR_CRE0081_APOA1-CTGTTTGCCCACTCTATTTGCCC (Sequence ID 98).
[0214] LVR_CRE0061_APOB-GGCGCCCTTTGGACCTTTTGCAATCCTGG (Sequence ID 99).
[0215] LVR_CRE0082_APOC4-AGCAAACAGCAAACAC (Sequence ID 100).
[0216] In some embodiments of the present invention, the synthetic liver-specific promoter does not include the CRE0052 minimal promoter or its functional variants.
[0217] In some embodiments of the present invention, the CRM or synthetic liver-specific promoter does not include the sequence disclosed in European Patent Application No. 18207027.6.
[0218] Any functional variant of the sequences in the exclusion and embodiment discussed above may have sequences that are, for example, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any of the reference sequences.
[0219] Definitions and general points: While various embodiments of the present invention will be described in detail below for the preparation and use of each, it should be understood that the present invention provides many applicable inventive concepts that can be implemented in a wide variety of specific situations. The specific embodiments discussed herein are merely examples of specific methods for preparing and using the present invention and do not limit the scope of the invention.
[0220] The background discussion of the invention in this specification is included to illustrate the context of the invention. This should not be construed as an admission that any of the materials referred to are publicly available, known, or part of the common general knowledge in any country as of the priority date of any of the claims.
[0221] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by specific citations. All documents referenced herein are incorporated herein by reference in their entirety. In particular, any teachings or sections of such documents specifically mentioned herein are incorporated by reference.
[0222] Unless otherwise indicated, the implementation of this invention will utilize conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the scope of the art of those skilled in the art. Such techniques are well described in the literature. For example, Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJGait ed.,1984);USPat.No.4,683,195;Nucleic Acid Hybridization(Harries and Higgins eds.1984);Transcription and Translation(Hames and Higgins eds.1984);Culture of Animal Cells(Freshney,Alan R.Liss,Inc.,1987);Immobilized Cells and Enzymes(IRL Press,1986);Perbal,A Practical Guide to Molecular Cloning(1984);the series,Methods in Enzymology(Abelson and Gene Transfer Vectors For Mammalian Cells (Miller and Calos eds.,1987,Cold Spring Harbor Laboratory);Immunochemical Methods in Cell and Molecular Biology(Mayer and Walker,eds.,Academic Press,London,1987);Handbook of Experimental Immunology,Vols.I-IV(Weir and Blackwell,eds.,1986);and Manipulating the Mouse Embryo,(Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY, 1986). .
[0223] To facilitate understanding of the present invention, several terms are defined below. Terms as defined herein have meanings that are generally understood by those skilled in the art relating to the present invention. Terms such as “a,” “an,” and “the” are not intended to refer to only a single entity, but include general classes from which specific examples can be used for illustrative purposes. Terms herein are used to describe specific embodiments of the present invention, but their use is not intended to limit the invention except as outlined in the claims.
[0224] The terms “cis-regulatory element” or “CRE” are well known to those skilled in the art and refer to nucleic acid sequences such as enhancers, promoters, insulators, or silencers that can regulate or modulate the transcription of an adjacent gene (i.e., cis). CREs are found near the gene they regulate. CREs typically include TFs (transfer factor bloc structures), i.e., TFs. A single TF can bind to many CREs and thus control the expression of many genes (pleomorphism). CREs are usually, but not always, located upstream of the transcription start site (TSS) of the gene they regulate. “Enhancers” are CREs that enhance (i.e., upregulate) the transcription of a functionally related gene and can be found upstream, downstream, or even within introns of the gene they regulate. Multiple enhancers can work in coordination to regulate the transcription of a single gene. In this context, “silencers” refer to CREs that bind to TFs called repressors, which act to prevent or downregulate the transcription of a gene. The term “silencer” can also refer to a region within the 3' untranslated region of a messenger RNA that binds to a protein that suppresses the translation of that mRNA molecule, but this usage differs from its use in the description of CRE. Generally, the CRE of the present invention is a liver-specific enhancer element (often called liver-specific CRE, or liver-specific CRE enhancer, etc.). In this context, the CRE is preferably located 1500 or fewer nucleotides from the transcription start site (TSS), more preferably 1000 or fewer nucleotides from the TSS, more preferably 500 or fewer nucleotides from the TSS, and appropriately 250, 200, 150, 100, 80, 60, or 50 or fewer nucleotides from the TSS. The CRE of the present invention is preferably relatively short in length, preferably 200 or fewer nucleotides, and may be, for example, 175, 150, 90, 80, 70, 60, 50, or 40 or fewer nucleotides. The CRE of the present invention is typically provided in combination with an operably bound promoter element, which may be a minimal promoter or a proximal promoter.The CRE of the present invention enhances the liver-specific activity of the promoter element.
[0225] The terms “cis-regulatory module” or “CRM” typically refer to a functional regulatory nucleic acid module containing two or more CREs. In this invention, CREs are typically liver-specific enhancers, and therefore CRMs are synthetic liver-specific regulatory nucleic acids. Accordingly, in this application, CRMs typically contain multiple liver-specific CREs. Typically, multiple CREs within a CRM act together (e.g., additively or synergistically) to enhance the transcription of genes operably associated with the promoter containing the CRM. There is a considerable range of shuffling (i.e., rearranging), inversion (i.e., reversing), and alteration of the spacing of CREs within a CRM. Accordingly, functional variants of the CRMs of this invention include, among other things, variants of the referenced CRM in which the CREs within are shuffled and / or inverted, and / or the spacing between CREs is altered.
[0226] As used herein, the expression “promoter” refers to a region of DNA generally located upstream of the nucleic acid sequence to be transcribed, which is necessary for transcription to occur, i.e., to initiate transcription. Promoters enable the appropriate activation or repression of transcription of coding sequences under their control. Promoters typically include a specific sequence that is recognized and bound by multiple TFs. TFs bind to the promoter sequence, resulting in the recruitment of RNA polymerase, the enzyme that synthesizes RNA from the coding region of a gene. Many diverse promoters are well known in the art.
[0227] As used herein, the term “synthetic promoter” refers to a promoter that does not exist in nature. In this context, it typically includes the CRE and / or CRM of the present invention operably bound to a minimal (or core) promoter or a liver-specific proximal promoter (promoter element). The CRE and / or CRM of the present invention helps to enhance liver-specific transcription of a gene operably bound to a synthetic promoter. While some synthetic promoters may exist in nature (e.g., one or more CREs in a minimal promoter or promoter), a synthetic promoter as a complete entity does not exist in nature.
[0228] As used herein, a “minimal promoter” (also known as a “core promoter”) refers to a short DNA segment that is inactive or largely inactive on its own but can mediate transcription when combined with other transcriptional regulatory elements. Minimal promoter sequences can originate from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters discussed above include the dopamine β-hydroxylase gene minimal promoter, the cytomegalovirus (CMV) immediate-type early gene minimal promoter (CMV-MP), and the herpesthymidine kinase minimal promoter (MinTK). Minimal promoters typically include a transcription start site (TSS) and immediately upstream elements, an RNA polymerase II binding site, and a common transcription factor binding site (often a TATA box). Minimal promoters may also include several elements downstream of the TSS, which typically have little functionality and lack further regulatory elements.
[0229] As used herein, “proximal promoter” refers to a proximal sequence upstream of a gene that tends to contain primary regulatory elements in addition to the minimal promoter. It often extends about 250 base pairs upstream of the TSS and contains a specific TFBS. The proximal promoter may also contain one or more regulatory elements downstream of the TSS, such as an UTR or intron. In this case, the proximal promoter may be a naturally occurring liver-specific proximal promoter that can be appropriately combined with one or more CREs or CRMs of the present invention. However, the proximal promoter may be synthetic.
[0230] As used herein, “promoter element” refers to either a minimal promoter or a proximal promoter as defined above. In connection with the present invention, the promoter element is typically combined with one or more CREs or one or more CRMs to provide the synthetic liver-specific promoter of the present invention.
[0231] In the context of the present invention, a “functional variant” of a CRE, CRM, promoter element, synthetic promoter, or other nucleic acid construct is a variant of a reference sequence that retains the ability to function in the same manner as the reference sequence, for example, as a liver-specific CRE, liver-specific CRM, or liver-specific synthetic promoter. Alternative terms for such a functional variant include “bioequivalence” or “equivalent.”
[0232] It will be understood that the ability of a given CRE to function as a liver-specific enhancer is primarily determined by the ability of the sequence to bind to the same liver-specific TF that binds to the reference sequence. Therefore, in most cases, functional variants of a CRE or CRM contain TFBSs for almost all of the same TFs as the reference CRE or CRM. It is preferable, but not essential, that the TFBS of a functional variant be in the same relative position (i.e., order and general position) as the reference CRE or CRM. It is also preferable, but not essential, that the TFBS of a functional variant be in the same orientation as the reference sequence (note that in some cases, the TFBS may be in the opposite orientation, for example, as a reverse complementary sequence to the sequence in the reference sequence). It is also preferable, but not essential, that the TFBS of a functional variant be on the same strand as the reference sequence. Therefore, in a preferred embodiment, the functional variant contains TFBS for the same TF in the same order, position, orientation and on the same strand as the reference sequence. It will also be understood that sequences between TFBSs (sometimes called spacer sequences, etc.) do not significantly affect the function of the CRE or CRM. Such sequences can typically be altered considerably, and their lengths can be changed. However, in preferred embodiments, the spacing (i.e., the distance between adjacent TFBSs) is substantially the same as that of the reference sequence in the functional variant form (e.g., no change by more than 20%, preferably no change by 10% or less, and more preferably nearly the same). It will be apparent that in some cases, functional variants of CRE may exist in reverse, for example, they may be the reverse complementary sequence or a variant thereof of the above-mentioned CRE.
[0233] The level of sequence identity between the functional variant and the reference sequence can also serve as an indicator of whether functionality is preserved. High levels of sequence identity in CRE TFBSs are generally more important than sequence identity in spacer sequences (when there is little or no demand for sequence conservation). However, given that the sequences in functional TFBSs do not need to exactly match the consensus sequence, it is understandable that a considerable degree of sequence variation can be accommodated even within TFBSs.
[0234] The ability of one or more TFs to bind to TFBS in a given functional variant can be determined by any relevant means known in the art, including but not limited to electrical mobility shift assays (EMSA), binding assays, chromatin immunoprecipitation (ChIP), and ChIP sequencing (ChIP-seq). In a preferred embodiment, the ability of one or more TFs to bind to a given functional variant is determined by EMSA. Methods for performing EMSA are well known in the art. A suitable approach is described by Sambrook et al., cited above. Numerous related articles describing this procedure are available, e.g., Hellman and Fried, Nat Protoc. 2007;2(8):1849-1861.
[0235] "Liver-specific" or "liver-specific expression" refers to the ability of a cis-regulatory element, cis-regulatory module, or promoter to enhance or drive gene expression in the liver (or liver-derived cells) in a preferential or dominant manner compared to other tissues (e.g., spleen, muscle, heart, lung, and brain). Gene expression may be in the form of mRNA or protein. In preferred embodiments, liver-specific expression is such that expression in other (i.e., non-liver) tissues or cells is negligible, i.e., the expression is highly liver-specific.
[0236] The ability of a CRE, CRM, or synthetic promoter to function as a liver-specific CRE, CRM, or synthetic promoter can be readily assessed by those skilled in the art. Therefore, it is readily possible for those skilled in the art to determine whether any variant of the particular CRE, CRM, or synthetic promoter described above remains functional (i.e., it is a functional variant as defined above). For example, any given CRM to be evaluated can be operably bound to a minimal promoter (e.g., located upstream of CMV-MP) to measure the ability of the cis-regulatory element to drive liver-specific expression of a gene (typically a reporter gene). Alternatively, a variant of a CRE can be substituted for a synthetic liver-specific promoter in place of the reference CRE, and the effect on liver-specific expression driven by the modified promoter can be determined and compared to the unmodified form. Similarly, the ability of a CRM or promoter to drive liver-specific expression can be readily assessed by those skilled in the art (e.g., as described in the following examples). The expression level of a gene driven by a variant of a reference promoter can be compared to the expression level driven by the reference sequence. In some embodiments, a mutant can be considered functional if the liver-specific expression level driven by the mutant promoter is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression level driven by the reference promoter. Appropriate nucleic acid constructs and reporter assays for evaluating liver-specific enhancement can be readily constructed, and the examples shown below provide a suitable methodology (e.g., Examples 2, 3, and 4).
[0237] Liver-specific expression of a gene (e.g., a therapeutic gene or reporter gene) can be identified, where it occurs preferentially or predominantly in liver-derived cells. Preferential or dominant expression can be defined, for example, when the expression level is significantly higher in liver-derived cells than in other types of cells (i.e., non-liver-derived cells). For example, expression in liver-derived cells is appropriately at least 5 times higher than in non-liver cells, preferably at least 10 times higher, and may be 50 times or more higher in some cases. For convenience, liver-specific expression can be appropriately demonstrated by comparing the expression levels in hepatocyte lines (e.g., liver-derived cell lines such as Huh7 and / or HepG2 cells) or primary liver cells with the expression levels in kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa), and / or lung-derived cell lines (e.g., A549).
[0238] The synthetic liver-specific promoter of the present invention preferably exhibits reduced expression in non-liver-derived cells, preferably HEK-293, HeLa, and / or A549 cells, compared to non-tissue-specific promoters such as CMV-IE. The synthetic liver-specific promoter of the present invention preferably has an activity of 50% or less, preferably 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 1% or less, of the CMV-IE promoter in non-liver-derived cells (preferably HEK-293 cells, HeLa cells, and / or A549 cells). Generally, it is preferable to minimize expression in non-liver-derived cells, but this may not be necessary in some cases. In some embodiments, the synthetic liver-specific promoter of the present invention is suitable for promoting gene expression at a level of 50% or less of the LP1 promoter in non-liver-derived cells (e.g., HEK-293, HeLa, and / or A549 cells).
[0239] The synthetic liver-specific promoters of the present invention are preferably suitable for promoting the liver-specific expression of, for example, transgenes, preferably therapeutic transgenes, that are expressed in the liver of a target. Preferred synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression and have at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter in hepatocytes. In some embodiments, the synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression at at least 100% of the activity of the LP1 promoter, preferably at 150%, 200%, 300%, or 500% of the activity of the LP1 promoter. Such liver-specific expression can be appropriately measured in liver-derived cells, such as Huh7 and / or HepG2 cells or primary hepatocytes (preferably primary human hepatocytes).
[0240] The synthetic liver-specific promoter of the present invention can also promote liver-specific gene expression at a level of at least 150% compared to CMV-IE in liver-derived cells (e.g., Huh7 and / or HepG2 cells), and preferably at a level of at least 200% compared to the CMV-IE promoter in liver-derived cells.
[0241] As used herein, terms such as "SP0412 v2," "SP0412v2," "SP0412_v2," "412 v2," "SP0412+UTR," "SP0412+UTR," "412UTR," and "412-UTR" are synonymous and are used interchangeably in this specification and the accompanying drawings.
[0242] As used herein, the term “nucleic acid” typically refers to oligomers or polymers of any length (preferably linear polymers) that are essentially composed of nucleotides. A nucleotide unit generally includes a heterocyclic base, a sugar group, and at least one, e.g., one, two, or three phosphate groups, including modified or substituted phosphate groups. Heterocyclic bases may include, among others, purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely present in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), unnatural, or derivatized bases. Sugar groups may include pentose (pentofuranose) groups, e.g., ribose and / or 2-deoxyribose, which are common in naturally occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, and modified or substituted sugar groups. Nucleic acids as used herein may include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides may include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Modifications of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or any other useful properties. The term “nucleic acid” more preferably encompasses DNA, RNA, and DNARNA hybrid molecules, including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNARNA hybrids. Nucleic acids may be naturally occurring, for example, naturally occurring or isolated from nature, or they may not be naturally occurring, for example, recombinants, i.e., those produced by recombinant DNA technology, and / or partially or completely chemically or biochemically synthesized. “Nucleic acids” may be double-stranded, partially double-stranded, or single-stranded. In the case of single-stranded nucleic acids, the nucleic acid may be a sense strand or an antisense strand. Furthermore, nucleic acids may be cyclic or linear.
[0243] Terms such as "identity" and "sameness" refer to sequence similarity between two polymer molecules, for example, between two nucleic acid molecules, or for example, between two DNA molecules. Sequence alignment and sequence identity can be determined using, for example, the Basic Local Alignment Search Tool (BLAST), first described by Altschul et al. in 1990 (J Mol Biol 215:403-10), or the "Blast 2 sequences" algorithm described by, for example, Tatusova and Madden in 1999 (FEMS Microbiol Lett 174:247-250).
[0244] Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are available, for example, from Smith and Waterman (1981) Adv.Appl.Math.2:482; Needleman and Wunsch (1970) J.Mol.Biol.48:443; Pearson and Lipman (1988) Proc.Natl.Acad.Sci.USA85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res.16:10881-90; Huang et al. (1992) Comp.Appl.Biosci.8:155-65; Pearson et al. (1994) Methods This is described in Mol.Biol.24:307-31 and Tatiana et al.(1999)FEMS Microbiol.Lett.174:247-50. Detailed discussions on sequence alignment methods and homology calculations are described, for example, in Altschul et al.(1990)J.Mol.Biol.215:403-10.
[0245] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST®; Altschul et al (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD), and can be used in conjunction with several sequence analysis programs on the internet. Instructions on how to determine sequence identity using this program are available online under the "Support" section of BLAST®. For comparing nucleic acid sequences, the "Blast2 Sequence" function of the BLAST® (Blastn; Align Sequence Nucleotide BLAST) program can be used with default parameters. Nucleic acid sequences with greater similarity to a reference sequence will show an increased percentage of identity when evaluated by this method. Typically, the percentage of sequence identity is calculated over the entire length of the sequence.
[0246] For example, the Needleman-Wunsch algorithm can appropriately find the optimal overall alignment using the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extension 2. The percentage of identity of the obtained optimal overall alignment is appropriately calculated by multiplying the ratio of the number of aligned bases to the total length of the alignment (the alignment length includes both matches and mismatches) by 100.
[0247] The term "hybridization" refers to the annealing of two at least partially complementary nucleotide sequences in a hybridization process. To allow hybridization to occur, complementary nucleic acid molecules are generally denatured thermally or chemically to melt the double strands into two single strands and / or to remove hairpins or other secondary structures from the single-stranded nucleic acids. The stringency of hybridization is influenced by conditions such as temperature, salt concentration, and hybridization buffer composition. Conventional hybridization conditions are described, for example, in Sambrook (2001) Molecular Cloning: A Laboratory Manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York, but those skilled in the art will understand that a number of different hybridization conditions can be designed depending on the known or expected homology and / or length of the nucleic acid sequences. High-stringency conditions for hybridization include high temperature and / or low sodium / salt concentration (salts include sodium in, for example, NaCl and sodium citrate) and / or inclusion of formamide in the hybridization buffer and / or reduced concentration of compounds such as SDS (sodium dodecyl sulfate detergent) in the hybridization buffer and / or exclusion of compounds such as dextran sulfate or polyethylene glycol (which promote molecular densification) from the hybridization buffer. As a non-limiting example, typical salt and temperature conditions for stringent hybridization are 1×SSC, 0.5% SDS at 65°C. The abbreviation SSC refers to the buffer used in nucleic acid hybridization solutions. One liter of 20× (20-fold concentrate) stock SSC buffer (pH 7.0) contains 175.3 g of sodium chloride and 88.2 g of sodium citrate. A typical time to achieve hybridization is 12 hours.
[0248] The term “transcription factor binding site” (TFBS) is well known in the art. Various specific TFBS sequences are disclosed herein. It will be apparent to those skilled in the art that alternative TFBS sequences may be used if they are bound by the intended TF. The consensus sequences of the various TFBS disclosed herein are known in the art, and those skilled in the art can readily use this information to determine alternative TFBS. Furthermore, the ability of a TF to bind to a given putative sequence can readily be determined experimentally by those skilled in the art (e.g., by EMSA and other approaches well known in the art and discussed herein).
[0249] The meaning of "consensus sequence" is well known in the art. In this application, unless otherwise indicated by the context, the following notation is used for consensus sequences. Consider the following exemplary DNA sequence: A[CT]N{A}YR A means that A is always present at that position. [CT] represents either C or T at that position. N represents any base at that position. {A} means that any base other than A can be found at that position. Y represents any pyrimidine, and R represents any purine.
[0250] In this application, "synthetic" means nucleic acid molecules that do not exist in nature. The synthetic nucleic acid expression constructs of the present invention are typically artificially produced by recombinant techniques. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but these are present in circumstances not found in nature. For example, a synthetic gene (or part of a gene) typically contains one or more nucleic acid sequences that are not naturally contiguous (chimeric sequences) and / or may include substitutions, insertions, deletions, and combinations thereof.
[0251] As used herein, “complementary” or “complementarity” refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, sequence 5'-AGT-3' binds to the complementary sequence 3'-TCA-5'. Complementarity between two nucleic acid sequences can be “partial,” where only some of the bases bind to their complementary bases, or it can be complete, such as when all the bases in a sequence bind to their complementary bases. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands.
[0252] In this application, “transfection” broadly refers to any process of intentionally introducing nucleic acids into cells, encompassing the introduction of viral and non-viral vectors, and including transformation, transduction, and similar terms and processes. Examples include, but are not limited to, transfection by viral vectors; transformation by plasmid vectors; electroporation (Fromm et al. (1986) Nature 319:791-3); lipofection (Feigner et al. (1987) Proc.Natl.Acad.Sci.USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated introduction (Fraley et al. (1983) Proc.Natl.Acad.Sci.USA 80:4803-7); direct incorporation of DNA; transformation via whiskers; and transfection by microprojectile bombardment (Klein et al. (1987) Nature 327:70).
[0253] As used herein, the term "transgene" refers to an exogenous nucleic acid sequence. In one example, the transgene is a gene that codes for an industrially or pharmaceutically useful compound, or a gene that codes for a desirable trait. In yet another example, the transgene codes for an antisense nucleic acid sequence, and the expression of the antisense nucleic acid sequence inhibits the expression of the target nucleic acid sequence. The transgene preferably codes for a therapeutic product, such as a protein.
[0254] The term “vector” is well known in the art and, as used herein, refers to a nucleic acid molecule, such as double-stranded DNA, which may have a nucleic acid sequence inserted according to the present invention. A vector is appropriately used to transport the inserted nucleic acid molecule to a suitable host cell. A vector typically contains all the elements necessary to transcribe the inserted nucleic acid molecule, and preferably to translate the transcript into a polypeptide. A vector typically contains all the elements necessary so that, when the vector is in a host cell, the vector can replicate independently of or simultaneously with the host chromosomal DNA. Several copies of the vector and the inserted nucleic acid molecule may be produced. The vectors of the present invention may be episomal vectors (i.e., not integrated into the host cell genome) or vectors that are integrated into the host cell genome. This definition includes both non-viral vectors and viral vectors. Non-viral vectors include, but are not limited to, plasmid vectors (e.g., pMA-RQ, pUC vectors, BlueScript (pBS) vectors, and pBR322, or their derivatives excluding bacterial sequences (minicircles)) and transposon-based vectors (e.g., PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors). Larger vectors, such as artificial chromosomes (bacteria (BAC), yeast (YAC), human (HAC)), can be used to accommodate larger inserts. Viral vectors are derived from viruses and include, but are not limited to, retroviral vectors, lentiviral vectors, adeno-associated virus vectors, adenovirus vectors, herpesvirus vectors, and hepatitis virus vectors. Typically, but not always, viral vectors are replication-deficient because viral genes essential for replication have been removed, thus losing the ability to replicate in a given cell. However, some viral vectors can be adapted to replicate specifically in a given cell, such as cancer cells, and are typically used to induce (cancer) cell-specific lysis (tumor breakdown).Virosoms are a non-limiting example of vectors containing both viral and non-viral elements, particularly liposomes combined with inactivated HIV or influenza virus (Yamada et al., 2003). Another example involves viral vectors mixed with cationic lipids.
[0255] As used herein, the terms “operatably bound,” “operatably connected,” or equivalent expressions refer to the arrangement of various nucleic acid elements relative to each other such that each element is functionally connected and can interact with one another in the intended manner. Such elements may include, but are not limited to, promoters, CREs (e.g., enhancers or other regulatory elements), promoter elements, polyadenylated sequences, one or more introns and / or exons, and parts or all of the coding sequence of a gene intended to be expressed. When nucleic acid sequence elements are properly oriented or operatably bound, they may interact with each other to modulate each other's activity and ultimately affect the expression level of the expression product. Modulation means increasing, decreasing, or maintaining the activity level of a particular element. The position of each element relative to other elements may be expressed with respect to the 5' and 3' ends of each element, or their positions upstream or downstream of another element or position (such as a TSS or promoter element), and the distance between any particular elements may be referred to by the number of nucleotides or base pairs interposed between the elements. As those skilled in the art will understand, operably coupled means functional activity and is not necessarily related to natural positional linkage. In fact, when used in nucleic acid expression cassettes, CREs are typically located immediately upstream of the promoter element (this is generally the case, but should not be interpreted as a limitation or exclusion of location within the nucleic acid expression cassette), but this does not have to be the case in vivo. For example, a regulatory element sequence that naturally occurs downstream of a gene affecting transcription can function similarly if it is located upstream of the promoter. Thus, according to certain embodiments, the regulatory or enhancing effect of a regulatory element may be position-independent.
[0256] As used herein, “spacer sequence” or “spacer” is a nucleic acid sequence that separates two functional nucleic acid sequences (e.g., TFBS, CRE, CRM, promoter element, etc.). It can be essentially any sequence, as long as it does not interfere with the functional nucleic acid sequence (e.g., a cis-regulatory element) functioning as desired (for example, this may occur if it contains a silencer sequence, which would interfere with the binding of the desired transcription factor). Typically, it is non-functional, existing solely to separate adjacent functional nucleic acid sequences from each other. In some embodiments, the spacer may have a length of 75, 50, 40, 30, 30, or 10 nucleotides or less.
[0257] As used herein, the term “pharmaceutically acceptable” means consistent with the Art, compatible with other components of a pharmaceutical composition, and not harmful to its recipient.
[0258] "Therapeutic dose" and similar terms mean the dose or plasma concentration in a subject that produces a specific desired pharmacological effect, such as expressing a therapeutic gene in the liver. A therapeutic dose is not always effective in treating the conditions described herein, even if such a dose is considered therapeutic by those skilled in the art. The therapeutic dose may vary based on the route of administration and dosage form, the age and weight of the subject, and / or the disease or condition being treated.
[0259] The terms “treatment” or “to treat” refer to reducing, improving, or eliminating one or more signs, symptoms, or effects of a disease or condition.
[0260] "Administration" of a drug to a subject includes any route through which the drug is introduced or delivered to the subject in order to perform its intended function. Administration may be carried out by any appropriate route, including orally, intranasally, intraocularly, intraocularly, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and administration by another person.
[0261] The terms "individual," "subject," and "patient" are used interchangeably and refer to any individual subject having a disease or condition that requires treatment. For purposes of the present disclosure, a subject can be a primate, preferably a human, or another mammal such as a dog, cat, horse, pig, goat, or cow.
[0262] As used herein, the term "comprising" means that other elements can be present in addition to the recited defined elements. Use of "comprising" indicates inclusion rather than limitation.
[0263] The term "consisting of" refers to the compositions, methods, and their respective components described herein that exclude elements not recited in the description of that embodiment.
[0264] As used herein, the term "consisting essentially of" refers to the elements necessary for a given embodiment. This term allows for the presence of additional elements that do not substantially affect the basic and novel or functional one or more characteristics of that embodiment of the invention.
[0265] All patents and other publications; documents, issued patents, published patent applications, and co-pending patent applications, for example, those described in such publications that may be used in connection with the technology described herein, are hereby expressly incorporated by reference into this specification for the purpose of describing and disclosing the methodologies described therein. These publications are provided only for their disclosure prior to the filing date of this application. Nothing in this regard shall be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or otherwise. All statements as to the date or content of these documents are based on the information available to the applicant and constitute no admission as to the accuracy of the date or content of these documents.
[0266] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: 1. A synthetic liver-specific promoter, which is: -CRE0051, CRE0042, CRE0059 and 5'UTR, -CRE0051, CRE0058 and CRE0070, -CRE0051, CRE0058 and CRE0071, -CRE0042 and CRE0099, -CRE0042 and CRE0073, -CRE0051 and CRE0099, -CRE0051 and CRE0073, -CRE0051, CRE0058 and CRE0054, -CRE0094 and CRE0052, -CRE0056, CRE0094 and CRE0052, -CRE0056, CRE0094 and CRE0059, -CRE0048, CRE0056 and CRE0054, -CRE0048, CRE0056 and CRE0052, and A synthetic liver-specific promoter comprising one or more cis-regulatory elements (CREs) or a combination of any of their functional variants operably bound to a promoter element (or any of its functional variants) selected from the group consisting of CRE0048, CRE0056, and CRE0059.
[0267] 2. A synthetic liver-specific promoter as described in paragraph 1, comprising a promoter selected from the group consisting of SP0412_v2, SP0382, SP0383, SP0471, SP0472, SP0473, SP0474, SP0475, SP0476, SP0477, SP0478, SP0479, SP0480, and SP0481, or any functional variant thereof, wherein the functional variant of any of the promoters comprises a sequence that is at least 70% identical to, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to, a reference synthetic liver-specific promoter.
[0268] 3. A synthetic liver-specific promoter according to paragraph 1 or 2, comprising a sequence selected from the group consisting of SEQ ID NOs. 22 to 35, or a functional variant thereof, wherein the functional variant of any of the promoters comprises a sequence that is at least 70% identical to a reference synthetic liver-specific promoter sequence, more preferably 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter sequence.
[0269] 4. A synthetic liver-specific promoter described in any of paragraphs 1 to 3, having a length of 350 or fewer nucleotides, or 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, or 220 or fewer nucleotides.
[0270] 5. A synthetic liver-specific promoter comprising one of the following promoter elements: CRE0059, CRE0070, CRE0071, CRE0054, CRE0073, CRE0099, and CRE0052, or a functional variant thereof.
[0271] 6. The synthetic liver-specific promoter described in paragraph 5, comprising one of the following promoter elements: CRE0070, CRE0071, CRE0099, and CRE0054 or their functional variants.
[0272] A synthetic liver-specific promoter as described in paragraph 5 or 6, having a length of 7,350 or fewer nucleotides, or 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, or 220 or fewer nucleotides.
[0273] 8. A promoter element comprising one of CRE0059, CRE0070, CRE0071, CRE0054, CRE0073, CRE0099, and CRE0052, or a functional variant thereof.
[0274] 9. The promoter element described in paragraph 8, comprising one of CRE0070, CRE0071, CRE0099, and CRE0054 or a functional variant thereof.
[0275] 10. The promoter element according to paragraph 8 or 9, wherein the promoter element has a length of 200 or fewer nucleotides, or 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, or 80 nucleotides or less.
[0276] 11. A liver-specific CRE selected from the group consisting of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056, or any functional variant thereof, wherein the functional variant of any of the CREs contains a sequence that is at least 70% identical to a reference synthetic liver-specific CRE, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRE.
[0277] 12. The liver-specific CRE described in paragraph 11, wherein the CRE comprises CRE0094 or a functional variant thereof.
[0278] 13. A synthetic liver-specific cis-regulatory module (CRM) or a synthetic liver-specific promoter comprising one or more of the liver-specific CREs described in paragraph 11 or a functional variant thereof.
[0279] 14. The following combinations of CREs: - CRE0051 and CRE0042, - CRE0051 and CRE0058, - CRE0056 and CRE0094, and - CRE0048 and CRE0056, or any functional variant thereof, of the synthetic liver-specific CRM described in paragraph 13.
[0280] 15. The following combinations of CREs: - CRE0048 and CRE0056, or - CRE0056 and CRE0094, or any functional variant thereof, of the synthetic liver-specific CRM described in paragraph 14.
[0281] 16. The CRM is selected from the group consisting of CRM_SP0412_v2, CRM_SP0382 and SP0383, CRM_SP0471, CRM_SP0473, CRM_SP0475, CRM_SP0477 and SP0478, CRM_SP0479 and CRM_SP0480 and SP0481, or any functional variant thereof, and the functional variant of any of the CRMs comprises a sequence that is at least 70% identical to a reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to the reference synthetic liver-specific CRM, of the synthetic liver-specific CRM described in paragraph 14.
[0282] 17. The synthetic liver-specific CRM according to paragraph 15, wherein the CRM is selected from the group consisting of CRM_SP0477 and SP0478, CRM_SP0479, and CRM_SP0480 and SP0481, or any functional variant thereof, and any of the functional variants of the CRM contains a sequence that is at least 70% identical to a reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRM.
[0283] 18. A synthetic liver-specific promoter comprising at least one liver-specific CRE described in paragraph 11, operably coupled to a promoter element.
[0284] 19. The synthetic liver-specific promoter described in paragraph 18, wherein the promoter element is selected from the group consisting of CRE0054, CRE0099, CRE0070, and CRE0071 or their functional variants.
[0285] 20. An expression cassette comprising a synthetic liver-specific promoter according to any one of paragraphs 1-7, 18-19, or a promoter element according to any one of paragraphs 8-10, a CRE according to any one of paragraphs 11-12, or a CRM according to any one of paragraphs 13-17, operably bound to a sequence encoding an expression product, wherein the sequence encoding the expression product may have optimized codons.
[0286] 21. A vector comprising a synthetic liver-specific promoter as described in any one of paragraphs 1-7 or 18-19, a promoter element as described in any one of paragraphs 8-10, a CRE as described in any one of paragraphs 11-12, or a CRM as described in any one of paragraphs 13-17, or an expression cassette as described in paragraph 20.
[0287] 22. A vector described in paragraph 21 that is a viral vector.
[0288] 23. The vector described in paragraph 22, in which the viral vector is an AAV vector.
[0289] 24. A billion containing the vectors described in any one of paragraphs 22-23.
[0290] 25. A pharmaceutical composition comprising a synthetic liver-specific promoter as described in any one of paragraphs 1-7 or 18-19, a promoter element as described in any one of paragraphs 8-10, a CRE as described in any one of paragraphs 11-12, or a CRM as described in any one of paragraphs 13-17, or an expression cassette as described in paragraph 20, a vector as described in any one of paragraphs 22-23, or a virion as described in paragraph 24.
[0291] 26. A synthetic liver-specific promoter described in any one of paragraphs 1-7 or 18-19, a promoter element described in any one of paragraphs 8-10, a CRE described in any one of paragraphs 11-12, or a CRM described in any one of paragraphs 13-17, or an expression cassette described in paragraph 20, a vector described in any one of paragraphs 22-23, a virion described in paragraph 24, or a pharmaceutical composition described in paragraph 25, for use in treatment.
[0292] 27. The composition for use according to paragraph 26, wherein the use is for gene therapy, and the gene therapy appropriately comprises the expression of a therapeutic expression product in the liver.
[0293] 28. A composition for use as described in any one of paragraphs 26-27, wherein the use is for gene therapy for hemophilia A or hemophilia B.
[0294] 29. An expression cassette for use in gene therapy for hemophilia A or hemophilia B, the expression cassette described in paragraph 20, the expression vector described in any one of paragraphs 22-23, the expression virion described in paragraph 24, or the expression composition described in paragraph 25, wherein the expression product is factor VIII or factor IX.
[0295] 30. The composition for use according to paragraph 29, wherein the expression product is factor VIII, for use in gene therapy for hemophilia A.
[0296] 31. The composition for use described in paragraph 30, wherein the expression product is codon-optimized factor VIII.
[0297] Cells containing a synthetic liver-specific promoter as described in any one of sections 32.1-7 or 18-19, a promoter element as described in any one of paragraphs 8-10, a CRE as described in any one of paragraphs 11-12, or a CRM as described in any one of paragraphs 13-17, or an expression cassette as described in section 20, a vector as described in any one of paragraphs 22-23, or a virion as described in paragraph 24.
[0298] 33. The cells described in paragraph 32, wherein the cells may be hepatocytes or human hepatocytes.
[0299] 34. A synthetic liver-specific promoter according to any one of paragraphs 1 to 7 or 18 to 19, a promoter element according to any one of paragraphs 8 to 10, a CRE according to any one of paragraphs 11 to 12, or a CRM according to any one of paragraphs 13 to 17, or an expression cassette according to paragraph 20, a vector according to any one of paragraphs 22 to 23, a virion according to paragraph 24, or a pharmaceutical composition according to paragraph 25, for use in the manufacture of a pharmaceutical composition for treating a medical condition or disease.
[0300] 35. A method for producing an expression product, the method comprising supplying a synthetic liver-specific expression cassette described in paragraph 20 to hepatocytes and expressing the gene present in the synthetic liver-specific expression cassette.
[0301] 36. A method for expressing a therapeutic transgene in hepatocytes, the method comprising introducing a synthetic liver-specific expression cassette described in paragraph 20, a vector described in any one of paragraphs 21 to 23, or a virion described in paragraph 24 into the hepatocytes.
[0302] 37. A treatment method for a subject requiring treatment, preferably a human being, -Administering to the subject an expression cassette according to paragraph 20, a vector according to any one of paragraphs 22-23, a virion according to paragraph 24, or a pharmaceutical composition according to paragraph 25, which includes a sequence encoding a therapeutic product operably bound to the synthetic liver-specific promoter. - Expressing a therapeutic amount of the therapeutic product in the liver of the subject, Methods that include...
[0303] 38. The method according to paragraph 37, wherein the therapeutic product is FVIII and the subject has hemophilia A.
[0304] 39. The method according to any one of paragraphs 37 to 38, comprising administering a vector described in any one of paragraphs 22 to 23, a virion described in paragraph 24, or a pharmaceutical composition described in paragraph 25.
[0305] The techniques described herein are further illustrated by the following examples, which should not be construed as further limitations.
[0306] [Examples] Example 1 - Array The following sequence is relevant to this disclosure. [Table 3]
[0307] Table 4
[0308] Table 5
[0309] Table 6
[0310] Table 7 TIFF2026516710000009.tif235159TIFF2026516710000010.tif10160
[0311] Table 8
[0312] Table 9
[0313] Table 10
[0314] Table 11
[0315] Table 12
[0316] Table 13
[0317] [Table 14]
[0318] [Table 15]
[0319] Human FVIII polypeptide [ka]
[0320] [Table 16] TIFF2026516710000021.tif234153TIFF2026516710000022.tif233153TIFF2026516710000023.tif233154TIFF2026516710000024.tif232153TIFF2026516710000025.tif233153TIFF2026516710000026.tif234152TIFF2026516710000027.tif232152TIFF2026516710000028.tif233153TIFF2026516710000029.tif233152TIFF2026516710000030.tif234152TIFF2026516710000031.tif234153TIFF2026516710000032.tif234153TIFF2026516710000033.tif233153TIFF2026516710000034.tif232153TIFF2026516710000035.tif232153TIFF2026516710000036.tif232152TIFF2026516710000037.tif233152TIFF2026516710000038.tif232152TIFF2026516710000039.tif234152TIFF2026516710000040.tif233154TIFF2026516710000041.tif233153TIFF2026516710000042.tif234153TIFF2026516710000043.tif233153TIFF2026516710000044.tif234152TIFF2026516710000045.tif233154TIFF2026516710000046.tif234153TIFF2026516710000047.tif234153TIFF2026516710000048.tif232153TIFF2026516710000049.tif234153TIFF2026516710000050.tif233153TIFF2026516710000051.tif234153TIFF2026516710000052.tif234153TIFF2026516710000053.tif233153TIFF2026516710000054.tif234153TIFF2026516710000055.tif194153.
[0321] [Table 17]
[0322] Example 2 - In vivo study 1 Introduction The objective was to create an expression cassette containing the coding sequence (CDS) encoding hFVIII under the control of a liver-specific promoter. Here, the efficacy of the liver-specific promoter driving FVIII expression was evaluated in an in vivo study in mice.
[0323] method Two novel promoters (SP0472 and SP0412+UTR(SP0412_v2)) and a state-of-the-art benchmark promoter (HLP) were placed upstream of the coding sequence encoding the FVIII sequence (referred to herein as F8-SQ00) and packaged within the AAV8 capsid. The AAV vectors were intravenously injected into C57BL / 6J mice over a 4-week period, and their potency was analyzed. Table 17 summarizes the study design. [Table 18]
[0324] AAV production AAV was prepared by triple transfection in high-density Pro10 cells. Helper plasmid xx680 and RepCap plasmid GSK2 / 8 were used. Cells were harvested on day 3 and lysed by sonication. The lysate was purified by iodixanol gradient and concentrated in an Amicon filtration unit. The generated AAV was quantified by a PCR-based method as described below, and its purity was confirmed by silver staining.
[0325] AAV titration AAV was titrated by ITR droplet digital PCR (ddPCR). To extract DNA from the AAV preparation, the vector was first treated with DNase and then with proteinase K. Subsequently, AAV DNA was quantified by ddPCR targeting the ITR region of the vector (using forward primer: 5'-GGAACCCCTAGTGATGGAGTT-3' (SEQ ID NO: 45); reverse primer: 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO: 46); probe: 5'-FAM-CACTCCCTCTCTGCGCGCTCG-BHQ1-3' (SEQ ID NO: 47) and appropriate diluents).
[0326] AAV administration The AAV vector was administered via tail vein injection to 8-12 week old male C57BL / 6JOlaHsd mice (n=5 mice / vector) in a volume of 200 μL of phosphate-buffered saline / 0.001% Pluronic®.
[0327] Sample collection Blood samples were obtained by lateral vein venotomy two weeks after AAV injection. Four weeks after injection, blood was collected via terminal cardiac puncture. This was performed under anesthesia using isoflurane. 3.8% sodium citrate was added to a sterile low-protein-bound 1.5 mL tube to 1 / 10 of its final volume. Blood was then added, gently mixed, and maintained at 4°C until processing. The samples were immediately centrifuged at 10,000 G for 10 minutes at 4°C, after which the plasma was collected and stored at -80°C for further analysis. After sacrifice at 4 weeks, the following tissues were collected: liver, heart, kidney, lung, brain, spleen, inguinal lymph nodes, adrenal glands, colon, testes, quadriceps, and gallbladder. For tissue collection, each tissue was divided into two parts, one portion held in a tube containing RNAlater® and the other held directly in an empty 1.5 mL tube. Both tubes were frozen in liquid nitrogen and stored at -80°C for further analysis.
[0328] Human Coagulation Factor VIII ELISA The quantification of hFVIII was performed based on an ELISA assay using a commercially available anti-hFVIII kit (F8C-EIA, Affinity). An ELISA plate (442404, ThermoFisher) was coated with capture antibody diluted 1 / 100 in carbonate buffer and incubated at room temperature for 2 hours. Blocking was not required under the described conditions. The capture antibody was removed by washing three times with wash buffer (PBS tween; 0.1% v / v). Standards and samples were diluted with the manufacturer's provided green sample diluent and placed in the appropriate wells. The plate was incubated at room temperature for 2 hours. After incubation, the plate was washed three times with wash buffer, and the pre-diluted detection antibody was added to each well. The plate was incubated at room temperature for 60 minutes. After incubation, the plate was washed three times with wash buffer, and the plate was developed by adding TMB (A: 51-2606 KC; B: 51-2607 KC; BD). After incubation at room temperature for 20 minutes, the reaction was stopped with 1 M H2SO4. Absorbance was measured at a wavelength of 450 nm using a microplate reader.
[0329] The hFVIII concentrations of the samples were determined by interpolating their optical densities (ODs) on a curve generated by a simple nonlinear regression analysis (sigmoid, 4PL, X is concentration) relating the ODs of standard dilutions to their concentrations.
[0330] DNA extraction Following the manufacturer's instructions, the Maxwell® RSC Tissue DNA Kit (Promega AS1610) was used for DNA extraction. Briefly, a liver fragment (approximately 20 mg) was placed in a 1.5 mL tube, 80 mL of TE buffer was added, the sample was broken down, and homogenized using a pestle. The sample was added to the first position of the cartridge, and the plunger was placed on well 8. An empty elution tube was placed in the elution tube position, and 100 μl of elution buffer was added to the bottom of each elution tube. The tissue DNA method was performed, and after the extraction process was complete, the elution tubes containing DNA were stored at -20°C until the presence of vector DNA in the sample could be analyzed.
[0331] Liver vector copy number quantification (VCN) VCNs were determined by qPCR using hF8co as the target (Gapdh was used for normalization). Plasmid DNA concentrations were obtained by interpolating their Ct values on a standard curve created by simple linear regression. The primers and probes used for VCN measurement are listed below. [Table 19]
[0332] RNA extraction The Maxwell® RSC Tissue RNA Kit (#AS1340, Promega) was used for tissue RNA extraction according to the manufacturer's instructions. Briefly, tissue samples were placed in 1.5 mL tubes, 200 μL of chilled 1-thioglycerol / homogenized solution was added, and the samples were disrupted and homogenized using TissueLyser II (Qiagen). 200 μL of lysis buffer was added to the homogenate and vortexed for 15 seconds. The lysate was transferred to a cartridge, 10 μL of DNase I was added, and RNA was purified according to the Maxwell® RSC simplyRNA method. The RNA was eluted in 50 μL of nuclease-free water (NFW) and stored at -80°C until the samples were quantified and analyzed.
[0333] For tissues with low RNA extraction yields, such as muscle, TRIzol (#15596026, ThermoFisher) was used. Briefly, tissue samples were homogenized in 500 μL of TRIzol using a TissueLyser. After adding 500 μL of TRIzol, the samples were centrifuged at 4°C and 12000 g for 10 minutes, and then incubated at room temperature for 5 minutes. The supernatant was transferred to a fresh Eppendorf filter, 200 μL of chloroform was added, and the mixture was incubated at room temperature for 2 minutes. The uncolored aqueous phase was mixed with 500 μL of isopropanol and incubated at room temperature for 10 minutes, followed by centrifugation at 4°C and 12000 g for 10 minutes for RNA precipitation. Finally, the pellet was washed with 75% EtOH, dried at room temperature, and resuspended in 50 μL of NFW after a final incubation at 56°C for 2 minutes.
[0334] Reverse transcription Using the High Capacity cDNA Reverse Transcription Kit (#4368813, ThermoFisher) according to the manufacturer's instructions, 1 μg of RNA was reverse transcribed into its complementary DNA (cDNA).
[0335] Gene expression determination To determine gene expression, quantitative polymerase chain reaction (qPCR) was performed using the TaqMan gene expression assay on the Applied Biosystems® QuantStudio® 5 system. The primers and probes used were specific to the hFVIII-SQ sequence common to all plasmids, and are listed in Table 19. [Table 20]
[0336] The mRNA level of the target gene was normalized to the Rplp0 mRNA level as an endogenous control, and the liver of each animal was used as the reference sample for the ΔΔCt method (2 -ΔΔCtRelative expression was obtained using ) and the reduction factor in liver function was determined. Samples were analyzed in triplicates, and reverse transcriptase RNA was not used as a negative control for each sample.
[0337] statistical analysis GraphPad Prism version 9.3.1 was used for the analysis. Unless otherwise specified, data are presented as mean ± standard deviation.
[0338] result Two novel liver-specific promoters were constructed and positioned upstream of the sequence encoding FVIII. The efficacy of these promoters in driving FVIII expression was benchmarked against the previously published promoter (McIntosh et al., 2013), HLP, and evaluated after IV administration of the AAV8 vector. In summary, the vector containing 472 induced circulating human FVIII levels above baseline (Figure 1).
[0339] Two different doses of vectors containing a benchmark promoter (HLP) were used to obtain the same FVIII / VCN ratio (only the high-dose HLP is shown). This was to demonstrate that VCN can be effectively used as a normalizing agent at the dose used. For in vivo evaluation of promoter efficacy, mice (N=5 per group) were intravenously administered one of the different vectors. Two and four weeks after administration, citrate plasma samples were collected and analyzed for the presence of circulating hFVIII as measured by ELISA (Figure 1).
[0340] Example 3 - Quality control after AAV administration Introduction To rule out that the differences between promoters shown in Figure 1 may be due to technical artifacts such as mistitration of the viral preparation by qPCR, suboptimal dilution of the test, or slightly different injection volumes, tissue was collected for further analysis after sacrificing at 4 weeks post-AAV administration.
[0341] First, the vector copy number was evaluated in the liver, as shown in Figure 2. Next, the potency of each promoter was normalized using the liver vector copy number (Figure 3). After normalization to the vector copy number in each individual animal, both HLP groups showed the same expression levels regardless of vector dose (only high doses are shown), suggesting that normalization to the VCN is a useful tool for normalizing expression relative to the vector load at the dose used. As shown in Figure 3 and summarized in Table 20 below, all promoters tested showed increased potency relative to the HLP benchmark. [Table 21]
[0342] Example 4 - In vivo study 2 Introduction The objective was to create an expression cassette containing a coding sequence (CDS) encoding codon-optimized hFVIII under the control of a liver-specific promoter. Here, the efficacy of the liver-specific promoter SP0472 in driving the expression of codon-optimized factor VIII was compared with promoters SP0412, SP0246, and TTR in an in vivo study in mice. [Table 22]
[0343] method The methods for producing AAV expressing the constructs listed in Table 21 and for administering AAV were completed as described in Example 2.
[0344] The AAV vector described in this example of this specification was administered via tail vein injection to 8-12 week old male C57BL / 6JOlaHsd mice (n=5 mice / vector) in a volume of 200 μL of phosphate-buffered saline / 0.001% Pluronic®. Two different doses were injected into the mice: one group received 5 e9 vg / mouse and the other received 1.68 e9 vg / mouse. The mice were sacrificed after 4 weeks.
[0345] The AAV vector described in this example of this specification was titrated by ITR droplet digital PCR (ddPCR). To extract DNA from the AAV preparation, the vector was first treated with DNase and then with proteinase K. The AAV DNA was then quantified by ddPCR targeting the ITR region of the vector (using forward primer: 5'-GGAACCCCTAGTGATGGAGTT-3' (SEQ ID NO: 45); reverse primer: 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO: 46); probe: 5'-FAM-CACTCCCTCTCTGCGCGCTCG-BHQ1-3' (SEQ ID NO: 47) and an appropriate diluent).
[0346] Sample collection was performed as described in Example 2. Furthermore, all diagnostic assays performed, such as human coagulation factor VIII ELISA, DNA extraction, and liver vector copy number (VCN) determination, were carried out as described in Example 2. The primers and probes used for VCN measurement are listed in Table 22.
[0347] Statistical analysis was performed using GraphPad Prism version 9.3.1. Unless otherwise specified, data are presented as mean ± standard deviation.
[0348] result Liver-specific promoters SP0246 (SEQ ID NO: 124), SP0412 (SEQ ID NO: 123), and SP0472 (SEQ ID NO: 26) were placed upstream of the nucleic acid sequences encoding codon-optimized FVIIIF8-QQ04 (SEQ ID NO: 64) or F8-QQ05 (SEQ ID NO: 65). The efficacy of these promoters in driving codon-optimized FVIII expression was benchmarked against TTR as described above and evaluated after IV administration of the AAV8 vector. In summary, all candidate vectors induced circulating human FVIII levels above baseline (see, e.g., Figures 4A and 4B).
[0349] Using two different doses of vector, we obtained results for 5e9vg / mouse (Figure 4A) and 1.68e9vg / mouse (Figure 4B). The results showed similar FVIII / VCN ratios. For in vivo evaluation of vector potency, mice (N=5 per group) were intravenously administered one of the different vectors. Two and four weeks after administration, citrate plasma samples were collected and analyzed for the presence of circulating hFVIII as measured by ELISA (Figures 4A and 4B).
[0350] After sacrificing the animals four weeks after AAV administration, the vector copy number was evaluated in the liver and is shown in Figures 4A and 4B.
[0351] To rule out the possibility that some of the apparent differences between vectors were due to technical artifacts such as mistitration of the viral preparation by ddPCR, suboptimal dilution of the test, or slightly different injection volumes, we normalized the potency of each promoter using liver vector copy number (Figures 4A and 4B). [Table 23]
[0352] Example 5 - Liver specificity of promoter Introduction To evaluate the liver specificity of the promoter described herein, FVIII mRNA expression was assessed in liver and 11 non-liver tissues obtained 4 weeks after sacrificial.
[0353] method Expression analysis based on PCR was performed to measure vector-derived FVIII mRNA against the expression of the endogenous reference gene.
[0354] result As expected, the liver was the organ with the highest levels of FVIII mRNA, followed by the gallbladder, where the levels were approximately 100 times lower than in the liver, depending on the promoter. Very low levels of FVIII mRNA were observed in the adrenal gland with SP0412+UTR, where the levels were approximately 1000 times lower than in the liver (Figure 5). All other tissues were 10 times lower compared to the liver. -5 They had FVIII mRNA levels less than twice the normal level. Importantly, vector-derived expression in the brain and testes was more than 1 million times lower compared to the liver (Figure 5). These data suggest that all promoters evaluated in the study are essentially liver-specific.
[0355] overview In summary, the preclinical studies presented herein demonstrate that the inventors have developed liver-specific promoters, some of which are substantially more potent in driving FVIII expression in mice than benchmark promoters currently used in clinical trials for the treatment of hemophilia A. In particular, the synthetic promoter SP0472 is substantially more potent in driving FVIII expression than the control. Similarly, when normalized, SP0412+UTR is also substantially more potent in driving FVIII expression in the liver than the control.
[0356] Example 6 - In vitro study The synthetic promoter to be tested is cloned upstream of the luciferase reporter gene, and then the SV40 late PolyA signaling pathway is cloned into a vector having a scaffold essentially identical to that of pUC19. The DNA preparations are transfected into either Huh7 (hepatocellular carcinoma cell line), HeLa (immortal cell line derived from cervical cancer), or HEK293 (human fetal kidney cells), and transcriptional activity is evaluated. Huh-7 cells are supplied from the JCRB cell bank (JCRB0403), and HeLa and HEK293 are supplied from the ECACC cell bank. All cell lines are grown and maintained according to the recommendations of the cell banks.
[0357] Transfection was performed in triplicate in a 48-well plate using FuGene HD transfection reagent (Promega#E2311) at a DNA:FuGene HD ratio of 1:1.1. Luciferase activity was measured 24 hours after transfection. Cells were washed with phosphate-buffered saline (PBS), dissolved in 100 μl of Passive Lysis Buffer (Promega#E194A), and stored overnight at -80°C. Luciferase activity was quantified using a Luciferase Reporter 1000 assay system (Promega#E4550) in 10 μl of lysate using a 96-well flat-bottom solid white Microplate FluoroNunc plate (ThermoFisher#236105) according to the manufacturer's guidelines, and luminescence was quantified using a FLUOstar Omega plate reader (BMG Labtech).
[0358] Synthetic promoters that exhibit high activity in Huh7 cells (e.g., higher than reference promoters such as LP1, CMV-IE, and TBG) but low activity in HeLa and / or HEK293 cells (e.g., lower than reference promoters such as LP1, CMV-IE, and TBG) may be of particular interest.
[0359] Example 7 Introduction To improve the in vivo expression of therapeutic human factor (FVIII) delivered by AAV vectors, we pursued codon optimization of the nucleic acid encoding a functional variant of native human FVIII. The functional variant was a B-domain deletion APC-resistant variant (FVIII-R355Q / R581Q) that showed approximately a 5-fold increase in procoagulant function compared to the deleted wild-type B-domain in an FVIII injury model of hemophilia A (HA) mice (Wilhelm et al., 2021). This polypeptide is referred to as BDD-FVIII-QQ or FVIII-QQ for simplification. The amino acid sequence of the polypeptide is shown in SEQ ID NO: 60. A series of nucleic acids encoding FVIII-QQ were generated from a codon optimization process. The codon optimization process involved the removal of all CpGs, minimization of alternative open reading frames, and maximization of sequence diversity. Eighteen coding sequences encoding FVIII-QQ (also referred to herein as human FVIII polypeptide) were analyzed and their potency was evaluated in in vivo assays. Next, these nucleic acids were tested for the expression of the encoded proteins for their potential use in the context of AAV-mediated gene therapy.
[0360] Materials and methods Test sample. The nucleic acid sequence encoding the B-domain deletion mutant of FVIII was adapted by modifying two codons (355 and 581) to encode Q instead of R(R355Q / R581Q), resulting in the nucleic acid sequence encoding the B-domain deletion FVIII-QQ mutant. This nucleic acid sequence (referred to as FVIII-QQ00) served as a benchmark for the codon optimization process. Eighteen coding sequences encoding FVIII-QQ were generated using a proprietary pipeline. These sequences are referenced sequentially from FVIII-QQ01 to QQ18. The nucleotide sequences are shown in Table 15, corresponding to the sequences described in SEQ ID NOs. 61-78, respectively. Nucleic acids with each sequence and the baseline sequence were synthesized using GeneWiz and inserted into AAV-based expression plasmids under the control of a liver-specific promoter (McIntosh et al, 2013), thereby creating a total of 19 different plasmids. These plasmids were identical except for the inserted FVIII-QQ coding nucleic acid.
[0361] Plasmids. AAV-based plasmids were constructed from 18 novel and benchmark sequences. Nucleic acid sequences were operably conjugated to a liver-specific promoter (McIntosh et al.), SEQ ID NO: 127, and a poly(A) signal (Levitt et al.). SEQ ID NO: 128 provides a plasmid sequence containing an exemplary codon-optimized sequence.
[0362] Hydrodynamic tail vein injection (HTVi administration) of plasmid DNA. Eight-week-old B6N-Tyrc-Brd / BrdCrCrl male mice (N=5 per group) were used for the hydrodynamic injection experiment. Before plasmid administration, the animals were weighed to determine the exact injection volume. The administered volume was proportional to the animal's body weight and adjusted to 100 ml / kg. For example, for a 20 g mouse, the injection volume was 2 ml. The administered plasmid dose was 2 mg / kg and adjusted to a final concentration of 20 μg / ml solution. For maximum transduction efficacy, the reagent was injected as quickly as possible (5-7 seconds). 24 hours after administration, citrate plasma samples were collected and analyzed for the presence of circulating hFVIII as measured by ELISA.
[0363] Sample collection. In the case of HTVi, blood was collected from the posterior orbit 24 hours after plasmid administration. 3.8% sodium citrate was added to a sterile low-protein-bound 1.5 mL tube to 1 / 10 of its final volume. Blood was then added and gently mixed, and the tube was kept at 4°C until processing. The sample was immediately centrifuged at 10,000 G for 10 minutes at 4°C, after which the plasma was collected and stored at -80°C for further analysis. For tissue sampling, the liver was cut into two pieces of approximately 10 mg each, and the remaining liver was collected in a separate tube. The sample was rapidly frozen in liquid nitrogen and stored at -80°C for further analysis.
[0364] Human coagulation factor VIII ELISA. Quantification of hFVIII was based on an ELISA assay using the commercially available kit Anti-hFVIII (F8C-EIA, Affinity Biologicals). ELISA plates (442404, Thermo Fisher Scientific) were coated with capture antibody diluted 1 / 100 in carbonate buffer and incubated at room temperature for 2 hours. Blocking was not required under the described conditions. The capture antibody was removed by washing three times with wash buffer (PBS tween; 0.1% v / v). Standards and samples were diluted with the manufacturer's provided green sample diluent and placed in appropriate wells. Plates were incubated at room temperature for 2 hours. After incubation, plates were washed three times with wash buffer, and pre-diluted detection antibody was added to each well. Plates were incubated at room temperature for 60 minutes. After incubation, the plate was washed three times with washing buffer and developed with TMB (A: 51-2606 KC; B: 51-2607 KC; BD). After incubation at room temperature for 20 minutes, the reaction was stopped with H2SO4IM. Absorbance was measured at a wavelength of 450 nm using a microplate reader.
[0365] The hFVIII concentrations of the samples were determined by interpolating their optical densities (ODs) on a curve generated by a simple nonlinear regression analysis (sigmoid, 4PL, X is concentration) relating the ODs of standard dilutions to their concentrations. [Table 24]
[0366] Statistical analysis. GraphPad Prism version 9.3.1 was used for the analysis. Unless otherwise specified, data are presented as mean ± standard deviation.
[0367] result Eighteen modified coding sequences encoding FVIII-QQ were generated using a proprietary pipeline. These sequences, sequentially named FVIII-QQ01 to QQ18, were inserted into AAV-based expression plasmids under the control of liver-specific promoters. Each plasmid was then used for sequence analysis for in vivo system expression.
[0368] In vivo analysis of FVIII-QQ expression - Hydrodynamic tail vein injection of plasmid Mice (N=5 per group) were administered either a different FVIII-QQ plasmid or an empty plasmid via hydrodynamic tail vein injection. 24 hours after administration, citrate plasma samples were collected and analyzed for the presence of circulating hFVIII, as measured by ELISA.
[0369] Preliminary analysis of the results revealed unexpected variability in detection levels within each plasmid group. This prompted the inventors to further test mice for proper plasmid delivery. Most hFVIII expression plasmids resulted in plasma hVIII levels above background levels, while QQ16 and QQ18 were at minimally detectable levels.
[0370] Gate expression levels have been shown to decrease significantly with increasing injection time (Liu, Song, & Liu, 1999). Therefore, it was hypothesized that the observed intragroup variability in circulating hFVIII levels could be due to some animals receiving suboptimal hydrodynamic tail vein injection. To ensure successful administration to mice, DNA was isolated from the liver after final sacrifice, and the amount of hFVIII plasmid in the liver was quantified by qPCR. The results showed that some mice had plasmid DNA levels in the liver suggestive of misinjection. These mice had levels similar to those of animals injected with the carrier, but orders of magnitude lower than expected. Mice with plasmid copy number <10,000 / liver sample were considered misinjected and excluded from subsequent hFVIII analysis.
[0371] The results are shown in Figure 6. Animals injected with empty plasmids (carriers) showed no evidence of human hFVIII in circulation. Most mice administered with plasmids showed above-background hFVIII levels, but no statistically significant difference was observed between the QQ01-QQ15 groups when comparing circulating hFVIII levels to the benchmark QQ00 plasmid group (Figure 6). Notably, cassettes QQ16, QQ17, and QQ18 induced extremely low levels of hFVIII that could not be attributed to plasmid injection failure. All animals that received plasmids successfully showed above-background circulating hFVIII levels.
[0372] In summary, with the exception of mice in groups QQ16, QQ17, and QQ18, all animals successfully administered the FVIII coding plasmid by hydrodynamic tail vein injection had circulating levels of human FVIII above background levels.
[0373] Example 8 The suitability of the synthetic promoter of the present invention in gene therapy scenarios that drive the expression of different target genes is confirmed as follows. In particular, the suitability of the synthetic promoter of the present invention for driving the expression of genes encoding secretory proteins is tested.
[0374] Preclinical animal studies of FVIII, FIX, and GAA The synthetic liver-specific promoter of the present invention is administered to animals via hydrodynamic tail vein injection in an expression cassette, which is then tested in combination with the transgenes FVIII, FIX, and GAA in preclinical animal models using AAV serotypes AAV XL32.1 and AAV8 in a gene therapy setting. AAV3 has also been tested.
[0375] Materials and methods In vivo analysis of FVIII, FIX, and GAA expression - Hydrodynamic tail vein injection of plasmids Expression cassette constructs are generated containing a synthetic liver-specific promoter (e.g., SP0472 or SP0412 v2) and nucleic acid sequences encoding FVIII, FIX, or GAA operably bound to a poly(A) signal. These cassettes, in the form of plasmid DNA, are injected by hydrodynamic tail vein injection, and the circulating concentration of FVIII or FIX, or the enzymatic activity of GAA, is determined in plasma samples 24 hours after injection. Mice (N=5 in each group) are administered by hydrodynamic tail vein injection with the plasmids detailed in Table 15 or a negative control plasmid. Plasma samples are collected 24 hours after administration and analyzed for the presence of circulating human FVIII or FIX, as measured by ELISA or specific GAA activity. [Table 25] TIFF2026516710000065.tif81148
[0376] In vivo analysis of FVIII, FIX, and GAA expression - by injection of AAV particles Promising candidates from hydrodynamic tail vein experiments showing increased expression of circulating FVIII, FIX, or GAA activity will be evaluated in vivo when packaged in AAV particles AAV8 and AAVXL32.1. These candidates will also be tested with the AAV3 capsid.
[0377] AAV production. Subsequently, candidate candidates selected from Table 15 are packaged into various capsids (AAV XL32.1, AAV3, and AAV8). AAV vectors are prepared by triple transfection in high-density Pro10 cells using helper plasmid xx680 and repcap plasmid GSK2 / 8. Cells are harvested on day 3 and lysed by sonication.
[0378] On the third day, the cells are harvested and lysed by sonication. Different AAV8 or AAVXL32.1 - FVIII, FIX or GAA vectors are administered to C57 / Bl6 mice by tail vein injection. C57 / Bl6 mice are also administered AAV3 - FVIII, FIX or GAA vectors by tail vein injection. Circulating FVIII or FIX antigen levels or GAA activity are measured at 2 weeks (day 14) and 4 weeks (day 28) after vector administration.
[0379] These studies indicate that the synthetic liver - specific promoter of the present invention can drive the expression of different genes in the context of gene therapy with various different AAV plasmids. Herein, SP0412v2 (SP0412 + UTR) is considered to be able to provide more expression of therapeutic transgenes, such as FVIII, FIX and GAA, in the liver compared to the promoter SP0412.
[0380] Human FVIII Clinical Trials To evaluate the synthetic liver - specific promoter of the present invention in the context of human gene therapy, a hemophilia A clinical trial is conducted using FVIII replacement therapy that administers FVIII expression gene therapy in the case of breakthrough bleeding episodes.
[0381] Twenty adult patients (over 18 years old) with hemophilia A are enrolled into four dose cohorts for each AAV serotype; the lowest dose cohort is administered 5×10 11 vector genomes / kg (vg / kg), and the highest dose cohort is administered 2×10 12 vg / kg of AAV8 or AAVXL32.1 - derived capsids (e.g., SP0472 or SP0412 v2) having the liver - specific promoter of the present invention and codon - optimized FVIII cDNA encoding FVIII. AAV3 - derived capsids having the liver - specific promoter and codon - optimized FVIII cDNA encoding FVIII of the present invention are also tested. Glucocorticoids are administered if an immune response is suspected.
[0382] The primary clinical outcome is the change from baseline in FVIII activity levels after a single outpatient administration of the capsid-containing composition as described above. Circulating human FVIII levels in plasma are measured using the chromogenix FVIII assay.
[0383] The circulating levels of FVIII will be assessed at 1, 2, and 5-year intervals following the first dose of gene therapy.
[0384] These results demonstrate that administration of a composition comprising a capsid derived from AAV8 or AAVXL32.1, the liver-specific promoter of the present invention (e.g., SP0472 or SP0412 v2), and FVIII cDNA optimized for the codon encoding FVIII results in sustained elevated levels of FVIII at 1, 2, and 5 years post-treatment. Similar results would be observed for AAV3-derived capsids. These results support the suitability of the promoters described herein for use in gene therapy.
[0385] Human FIX Clinical Trial To evaluate the synthetic liver-specific promoter of the present invention in relation to human gene therapy, a hemophilia B clinical trial will be conducted using FIX replacement therapy.
[0386] Twenty adult patients with hemophilia B (over 18 years old) with baseline FIX coagulation activity (FIX:C) <2 IU / dL, no FIX inhibitors, and low titer of neutralizing antibody against vector capsid (≤1:4) will be enrolled in four dose cohorts for each AAV serotype. Participants will be given a composition containing a capsid derived from AAV8 or AAVXL32.1 with the liver-specific promoter of the present invention (e.g., SP0472 or SP0412 v2) and FIX cDNA with optimized codons encoding FIX, administered in 2x10⁻¹⁶ doses after one week of prophylactic prednisolone treatment (1 mg / kg / day). 11 , 1x10 12 , 3x10 12 or 5x10 12The drug is administered intravenously at a dose of vg / kg. A capsid derived from AAV3, which has a liver-specific promoter and encodes a codon-optimized FIX cDNA, will also be tested.
[0387] The primary clinical outcome is the change in FIX levels after a single dose of a composition containing a capsid derived from AAV8 or AAVXL32.1, the liver-specific promoter of the present invention (e.g., SP0472 or SP0412 v2), and FIX cDNA with optimized codons encoding FIX. A capsid derived from AAV3, having a liver-specific promoter and encoding codon-optimized FIX cDNA, will also be tested. Output readings are measured by the circulating level of FIX in the blood using human FIX ELISA.
[0388] The circulating level of FIX will be assessed at one-year intervals following the first dose of gene therapy.
[0389] These results demonstrate that administration of a gene therapy capsid derived from AAV8 or AAVXL32.1 using the liver-specific promoter of the present invention (e.g., SP0472 or SP0412 v2) and FIX cDNA optimized for the codon encoding FIX results in sustained elevated levels of FIX at one year post-treatment. Similar results would likely be observed with an AAV3-derived capsid. These results support the suitability of the promoters described herein for use in gene therapy.
[0390] The clinical trial is being conducted using a clinical protocol similar to that described in the Human FIX Clinical Trial mentioned above. Patients enrolled in the GAA study are Pompe patients, and GAA enzyme activity is measured at one-year intervals after the first dose of gene therapy. These results support the suitability of the promoter described herein for use in gene therapy.
[0391] References Ward NJ,Buckley SM,Waddington SN,Vandendriessche T,Chuah MK,Nathwani AC,McIntosh J,Tuddenham EG,Kinnon C,Thrasher AJ,McVey JH.Codon optimization of human factor VIII cDNAs leads to high-level expression.Blood.2011 Jan 20;117(3):798-807.doi:10.1182 / blood-2010-05-282707.Epub 2010 Nov 1.PMID:21041718.
Claims
1. A synthetic liver-specific promoter: -CRE0051, CRE0042, CRE0059 and 5'UTR, -CRE0051, CRE0058 and CRE0070, -CRE0051, CRE0058 and CRE0071, -CRE0042 and CRE0099, -CRE0042 and CRE0073, -CRE0051 and CRE0099, -CRE0051 and CRE0073, -CRE0051, CRE0058 and CRE0054, -CRE0094 and CRE0052, -CRE0056, CRE0094 and CRE0052, -CRE0056, CRE0094 and CRE0059, -CRE0048, CRE0056 and CRE0054, -CRE0048, CRE0056 and CRE0052, and A synthetic liver-specific promoter comprising one or more cis-regulatory elements (CREs) or a combination of any of their functional variants operably bound to a promoter element (or any of its functional variants) selected from the group consisting of CRE0048, CRE0056, and CRE0059.
2. A synthetic liver-specific promoter according to claim 1, comprising a promoter selected from the group consisting of SP0412_v2, SP0382, SP0383, SP0471, SP0472, SP0473, SP0474, SP0475, SP0476, SP0477, SP0478, SP0479, SP0480, and SP0481, or any functional variant thereof, wherein any of the functional variants of the promoter comprises a sequence that is at least 70% identical to a reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter.
3. A synthetic liver-specific promoter according to claim 1 or 2, comprising a sequence selected from the group consisting of SEQ ID NOs. 22 to 35, or a functional variant thereof, wherein the functional variant of any of the promoters comprises a sequence that is at least 70% identical to a reference synthetic liver-specific promoter sequence, more preferably a sequence that is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific promoter sequence.
4. A synthetic liver-specific promoter according to any one of claims 1 to 3, having a length of 350 or fewer nucleotides, or 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, or 220 or fewer nucleotides.
5. A synthetic liver-specific promoter comprising one of the following promoter elements: CRE0059, CRE0070, CRE0071, CRE0054, CRE0073, CRE0099, and CRE0052 or their functional variants.
6. The synthetic liver-specific promoter according to claim 5, comprising one of the following promoter elements: CRE0070, CRE0071, CRE0099, and CRE0054 or their functional variants.
7. A synthetic liver-specific promoter according to claim 5 or 6, having a length of 350 or fewer nucleotides, or 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, or 220 or fewer nucleotides.
8. A promoter element comprising one of CRE0059, CRE0070, CRE0071, CRE0054, CRE0073, CRE0099, and CRE0052, or a functional variant thereof.
9. The promoter element according to claim 8, comprising one of CRE0070, CRE0071, CRE0099, and CRE0054 or a functional variant thereof.
10. The promoter element according to claim 8 or 9, wherein the promoter element has a length of 200 or fewer nucleotides, or 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, or 80 or fewer nucleotides.
11. A liver-specific CRE selected from the group consisting of CRE0051, CRE0042, CRE0058, CRE0048, CRE0094, and CRE0056, or any functional variant thereof, wherein any functional variant of the CRE contains a sequence that is at least 70% identical to a reference synthetic liver-specific CRE, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a reference synthetic liver-specific CRE.
12. The liver-specific CRE according to claim 11, wherein the CRE comprises CRE0094 or a functional variant thereof.
13. A synthetic liver-specific cis-regulatory module (CRM) or synthetic liver-specific promoter comprising one or more liver-specific CREs according to claim 11, or a functional variant thereof.
14. The following CRE combinations: -CRE0051 and CRE0042, -CRE0051 and CRE0058, -CRE0056 and CRE0094, and - The synthetic liver-specific CRM according to claim 13, comprising either CRE0048 and CRE0056, or a functional variant thereof.
15. The following CRE combinations: -CRE0048 and CRE0056, or - The synthetic liver-specific CRM according to claim 14, comprising either CRE0056 and CRE0094, or a functional variant thereof.
16. The synthetic liver-specific CRM according to claim 14, wherein the CRM is selected from the group consisting of CRM_SP0412_v2, CRM_SP0382 and SP0383, CRM_SP0471, CRM_SP0473, CRM_SP0475, CRM_SP0477 and SP0478, CRM_SP0479 and CRM_SP0480 and SP0481, or any functional variant thereof, and any of the functional variants of the CRM includes a sequence that is at least 70% identical to a reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRM.
17. The synthetic liver-specific CRM according to claim 15, wherein the CRM is selected from the group consisting of CRM_SP0477 and SP0478, CRM_SP0479, and CRM_SP0480 and SP0481, or any functional variant thereof, and any of the functional variants of the CRM includes a sequence that is at least 70% identical to a reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the reference synthetic liver-specific CRM.
18. A synthetic liver-specific promoter comprising at least one liver-specific CRE according to claim 11, operably coupled to a promoter element.
19. The synthetic liver-specific promoter according to claim 18, wherein the promoter element is selected from the group consisting of CRE0054, CRE0099, CRE0070, and CRE0071 or functional variants thereof.
20. An expression cassette comprising a synthetic liver-specific promoter according to any one of claims 1 to 7, 18 to 19, or a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, operably bound to a sequence encoding an expression product, wherein the sequence encoding the expression product may have optimized codons.
21. A vector comprising a synthetic liver-specific promoter according to any one of claims 1 to 7 or 18 to 19, a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, or an expression cassette according to claim 20.
22. The vector according to claim 21, which is a viral vector.
23. The vector according to claim 22, wherein the viral vector is an AAV vector.
24. A vilion comprising the vector according to any one of claims 22 to 23.
25. A pharmaceutical composition comprising a synthetic liver-specific promoter according to any one of claims 1 to 7 or 18 to 19, a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, or an expression cassette according to claim 20, a vector according to any one of claims 22 to 23, or a virion according to claim 24.
26. A synthetic liver-specific promoter according to any one of claims 1 to 7 or 18 to 19, a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, or an expression cassette according to claim 20, a vector according to any one of claims 22 to 23, a virion according to claim 24, or a pharmaceutical composition according to claim 25, for use in treatment.
27. The composition for use according to claim 26, wherein the use is for gene therapy, and the gene therapy appropriately includes the expression of a therapeutic expression product in the liver.
28. The composition for use according to any one of claims 26 to 27, wherein the use is for gene therapy for hemophilia A or hemophilia B.
29. An expression cassette according to claim 20, a vector according to any one of claims 22 to 23, a virion according to claim 24, or a pharmaceutical composition according to claim 25, for use in gene therapy for hemophilia A or hemophilia B, wherein the expression product is factor VIII or factor IX.
30. The composition for use according to claim 29, wherein the expression product is factor VIII, and the use is for gene therapy of hemophilia A.
31. The composition for use according to claim 30, wherein the expression product is a codon-optimized factor VIII.
32. A cell comprising a synthetic liver-specific promoter according to any one of claims 1 to 7 or 18 to 19, a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, or an expression cassette according to claim 20, a vector according to any one of claims 22 to 23, or a virion according to claim 24.
33. The cell according to claim 32, wherein the cell may be a hepatocyte or a human hepatocyte.
34. A synthetic liver-specific promoter according to any one of claims 1 to 7 or 18 to 19, a promoter element according to any one of claims 8 to 10, a CRE according to any one of claims 11 to 12, or a CRM according to any one of claims 13 to 17, or an expression cassette according to claim 20, a vector according to any one of claims 22 to 23, a virion according to claim 24, or a pharmaceutical composition according to claim 25, for use in the manufacture of a pharmaceutical composition for treating a medical condition or disease.
35. A method for producing an expression product, the method comprising supplying a synthetic liver-specific expression cassette described in claim 20 to hepatocytes and expressing the gene present in the synthetic liver-specific expression cassette.
36. A method for expressing a therapeutic transgene in hepatocytes, the method comprising introducing a synthetic liver-specific expression cassette according to claim 20, a vector according to any one of claims 21 to 23, or a virion according to claim 24 into the hepatocytes.
37. A treatment method for a target that requires it, preferably a human being, - Administering to the subject an expression cassette according to claim 20, a vector according to any one of claims 22 to 23, a virion according to claim 24, or a pharmaceutical composition according to claim 25, which comprises a sequence encoding a therapeutic product operably bound to the synthetic liver-specific promoter. - To express a therapeutic amount of the therapeutic product in the liver of the subject, Methods that include...
38. The method according to claim 37, wherein the therapeutic product is FVIII and the subject has hemophilia A.
39. The method according to any one of claims 37 to 38, comprising administering the vector according to any one of claims 22 to 23, the virion according to claim 24, or the pharmaceutical composition according to claim 25.