Modified liver-specific enhancers and their applications

Abstract

Provided are modified liver-specific enhancers, synthetic promoters containing enhancers, expression vectors containing synthetic promoters, and methods for using the enhancers or expression vectors to address needs in the field, such as the treatment of various hereditary diseases or conditions related to the liver. In some embodiments, the modified enhancer includes one or more DNA binding sites for transcription factors.

Description

Technical Field

[0001] [Cross - References to Related Applications] This application claims the benefit of International Application PCT / CN2023 / 093398, filed on May 11, 2023, and U.S. Application No. 63 / 510993, filed on Jun. 29, 2023, the contents of which are hereby incorporated by reference in their entirety.

[0002] [Field of the Invention] The present invention generally relates to biotechnology, particularly gene expression regulation, gene therapy, and medicine. More specifically, a modified liver - specific enhancer and its uses are disclosed herein.

Background Art

[0003] Recombinant AAV (rAAV) vectors are typically generated by replacing the viral coding sequence of adeno - associated virus (AAV) with a gene of interest (transgene). rAAV vectors are considered to be the most promising viral vectors for the treatment of genetic diseases. However, the cargo capacity of rAAV is limited to less than 5.0 kb. If the size of the transgene of interest is larger than 5.0 kb, the rAAV vector cannot be fully packaged into the AAV capsid, and thus cannot be used for efficient gene therapy.

[0004] An rAAV vector usually consists of a therapeutic gene expression cassette and two ITRs. The expression cassette contains a promoter, a gene of interest (transgene), and a polyA sequence. The shortest currently available polyA sequence is about 50 bp. The two ITRs are located at both ends of the expression cassette. Each ITR is 145 bp long and is a packaging signal that must be incorporated into the rAAV vector. Thus, the space allocated for the therapeutic gene expression cassette is about 4.71 kb long.

[0005] Some DNA fragments encoding therapeutic proteins are too large for the rAAV packaging capacity. Promoter size is crucial to maintaining the expression cassette within the range of efficient packaging. Short promoters are preferable. In addition, to ensure safety and therapeutic efficacy, the promoter needs to be liver-specific and promote robust gene expression, as administration of large amounts of rAAV vectors can induce harmful immune responses. Therefore, there is an urgent need for short, liver-specific, and robust promoters in rAAV gene therapy for hemophilia A (HA).

[0006] In addition, while some DNA fragments encoding therapeutic proteins are small enough for efficient packaging, the activity of the encoded proteins remains low. Therefore, large quantities of rAAV vectors must be injected into patients to produce sufficient therapeutic proteins. However, administering large quantities of rAAV vectors can induce harmful immune responses. Thus, there is an urgent need to develop potent, tissue-specific promoters and enhancers to increase the activity of the encoded therapeutic proteins. [Overview of the project]

[0007] The present invention provides a modified liver-specific enhancer, a synthetic promoter containing the enhancer, an expression vector containing the synthetic promoter, and a method of using the enhancer or its expression vector to address needs in areas such as the treatment of various hereditary diseases or conditions related to the liver.

[0008] In one embodiment, the present invention provides a modified enhancer comprising one or more DNA binding sites for a transcription factor, wherein the transcription factor is selected from the group consisting of HNF-4α, HNF-3β, D-site binding protein (DBP), CCAAT enhancer binding protein α / β (C / EBP-α / β), and hepatocyte nuclear factor 1α / β (HNF-1α / β).

[0009] In some embodiments, the DNA binding sites for the transcription factors HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β each contain nucleic acid sequences of sequence numbers 4 to 8.

[0010] In some embodiments, the modified enhancer includes the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 3, 9, or 12.

[0011] In another aspect, the present invention provides a synthetic promoter comprising a modified enhancer and a core promoter nucleic acid sequence disclosed herein.

[0012] In some embodiments, the core promoter is a liver-specific promoter.

[0013] In some embodiments, the liver-specific promoter is the human α-1 antitrypsin (hAAT) promoter.

[0014] In some embodiments, the human α-1 antitrypsin (hAAT) promoter includes the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 1 or 2.

[0015] In some embodiments, the synthetic promoter includes the nucleic acid sequence of SEQ ID NO: 10, SEQ ID NO: 13, or SEQ ID NO: 14, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 10, 13, or 14.

[0016] In another embodiment, the present invention provides an expression vector comprising a synthetic promoter disclosed herein, which is ligated to act on a gene of interest (transgene).

[0017] In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV).

[0018] In another aspect, the present invention provides a method for treating a genetic disorder or condition in a subject requiring treatment, comprising administering the expression vector disclosed herein to the subject to thereby cause the subject to express a therapeutic protein in the liver of the subject.

[0019] In some embodiments, the subject is a mammal. Preferably, the mammal is a human.

[0020] Examples of hereditary diseases or conditions related to the liver include, but are not limited to, hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, hypertyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, myeloid protoporphyria, Gaucher disease, familial hypercholesterolemia, and ornithine transcarbamylase deficiency.

[0021] In another aspect, the present invention provides the use of a promoter or expression vector disclosed herein for enhancing the expression level of a transgene in hepatocytes, the use comprising a transgene in which a nucleic acid is ligated to the promoter in an actionable manner.

[0022] In another aspect, the present invention provides the use of a promoter, expression vector, or pharmaceutical composition provided herein for the manufacture of a pharmaceutical for a liver-related genetic disease or condition.

[0023] In another aspect, the present invention provides a kit comprising a promoter, an expression vector, or a pharmaceutical composition disclosed herein.

[0024] In some embodiments, the kit further comprises instructions for using the contents of the kit.

[0025] The features, aspects, and advantages of the present invention will be better understood from the following description and the appended claims.

Brief Description of the Drawings

[0026] The present invention will be described below by way of non-limiting examples with reference to the following drawings.

[0027] [Figure 1] FIG. 1 is a diagram of regulatory elements for promoting transgene overexpression in an rAAV vector. Enh is enhancer; Pro is promoter; Int is intron; pA is polyA; HCR is the complementary sequence of the partial coding sequence (CDS) of the liver control region HCR-1; Ex is proximal element X located in the 5'untranslated region (5'UTR) of the human SERPINA1 (encoding human α-1 antitrypsin) genome; HEx is a 66 bp composite enhancer containing HCR and Ex; HLP is a 252 bp positive control synthetic promoter; hAAT is a 219 bp hAAT (human α-1 antitrypsin) promoter; hAATs is a 94 bp hAAT promoter.

[0028] [Figure 2]Figure 2 shows the modified enhancers Es, E2, and Em. The transcription factor binding sites (TFBS)(1)-(5) were obtained from JASPAR. TFBS(1)-(5) refer to the DNA binding sites of the HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β transcription factors, respectively. Es is a 54bp enhancer modified to include the TFBS(1)-(5) combination; Es-2 is a 52bp enhancer modified similarly to Es, but with one thymine and one adenine deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site ((6)); E2 is a 111bp enhancer containing Es and Es-2; Em is another 54bp enhancer modified to include a DNA binding site as shown in the figure, and (7) is similar to (5), but the guanine at the 7th base is changed to cytosine.

[0029] [Figure 3]Figure 3 shows synthetic promoters for promoting FVIII-SQ or luciferase overexpression in rAAV vectors. HCR is the complementary sequence of the partial coding sequence (CDS) of the hepatic regulatory region HCR-1; Ex is the proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (coding human α-1 antitrypsin) genome; HLP is a 252 bp positive control synthetic promoter; HEx is a 66 bp composite enhancer containing HCR and Ex; hAATs is a 94 bp hAAT promoter; HEx-hAATs is a 177 bp synthetic promoter containing a 94 bp hAAT promoter and a 66 bp HEx enhancer; Es is a 54 bp enhancer containing a combination of DNA binding sites for five transcription factors; Es-2 is a 52 bp enhancer similar to Es, but with one thymine and one adenine deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively. Es-hAATs are 164 bp synthetic promoters containing a 94 bp human α-1 antitrypsin short core promoter and a 54 bp enhancer Es; E2-hAATs are 215 bp synthetic promoters containing a 94 bp human α-1 antitrypsin short core promoter, a 54 bp enhancer Es, and a 52 bp enhancer Es-2; Em is another 54 bp enhancer; Em-hAATs are 164 bp synthetic promoters containing a 94 bp human α-1 antitrypsin short core promoter and a 54 bp enhancer Em.

[0030] [Figure 4A]Figures 4A-4B show the activity of liver-specific core promoters. Different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Cell supernatant was collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. HLP is a 252 bp positive control synthetic promoter; HEx is a 66 bp composite enhancer containing HCR and Ex; HCR is the complementary sequence of the partial coding sequence (CDS) of the liver regulatory region HCR-1; Ex is the proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (coding human α-1 antitrypsin) genome; hAAT is a 219 bp hAAT (human α-1 antitrypsin) promoter; hAATs is a 94 bp hAAT promoter; HEx-hAATs is a 177 bp synthetic promoter containing the enhancer HEx. Figure 4A shows the activity of FVIII-SQ in Huh7 cells transfected with different plasmids. [Figure 4B] Figure 4B shows the protein levels of FVIII-SQ in Huh7 cells transfected with different plasmids. *P<0.05, **P<0.01, ***P<0.001, ns indicates no significant difference between HLP and other promoter groups using a two-sided Student's t-test.

[0031] [Figure 5A] Figures 5A-5D show the effects of the modified enhancer on the hAATs promoter. Figure 5A shows the activity of FVIII-SQ in Huh7 cells. [Figure 5B]Figure 5B shows the protein levels of FVIII-SQ in Huh7 cells. The transcription factor binding site (TFBS) was obtained from JASPAR. Different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Cell supernatant was collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. HLP is a 252 bp positive control synthetic promoter; E2 is a 111 bp enhancer containing Es and Es-2; Es is a 54 bp enhancer combined with the DNA binding site of the transcription factor; Es-2 is a 52 bp enhancer similar to Es but lacking one thymine and one adenine at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively; hAATs is a 94 bp human α-1 antitrypsin promoter; Es-hAATs is a 164 bp synthetic promoter containing the enhancer Es; E2-hAATs is a 215 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and the enhancers Es and Es-2. [Figure 5C] Figure 5C shows the activity of FVIII-SQ in factor VIII-deficient mice. [Figure 5D] Figure 5D shows the protein levels of FVIII-SQ in factor VIII-deficient mice. Factor VIII-deficient mice, approximately 8-10 weeks old, were injected with different rAAV vector plasmids by hydrodynamic injection. Mouse plasma was collected 48 hours after injection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. *P<0.05, **P<0.01, ***P<0.001, ns indicates no significant difference between HLP and the other promoter group (or between two other promoter groups) using a two-sided Student's t-test.

[0032] [Figure 6]Figure 6 shows the effects of different enhancers on the hAATs promoters. Different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Cells were collected 24 hours post-transfection and luciferase activity was measured. HLP is a 252 bp positive control synthetic promoter; HEx-hAATs are a 177 bp synthetic promoter containing a 66 bp enhancer HEx; Es-hAATs are a 164 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Es; E2-hAATs are a 215 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter, a 54 bp enhancer Es, and a 52 bp Es-2; Em-hAATs are a 164 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and a 54 bp enhancer Em. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns indicate no significant difference between HLP and the other promoter group (or between two other promoter groups) using a two-sided Student's t-test. [Modes for carrying out the invention]

[0033] Specific features of the present invention are referred to in the summary section above, the detailed description section below, and the claims. It should be understood that the disclosure of the present invention in this specification includes all possible combinations of such specific features. For example, where a specific feature is disclosed in the context of a particular aspect or embodiment of the present invention, or in a particular claim, that feature may, to the extent possible, be used in combination with and / or in the context of other particular aspects and embodiments of the present invention, and also in general in the present invention.

[0034] Gene therapy is a promising method for treating genetic diseases. In gene therapy, the target gene is introduced into one or more recipient cells, and the expression of the introduced gene in the recipient cells affects cellular function, resulting in a therapeutic effect. The rAAV vector is considered the most promising viral vector for use in gene therapy. However, the cargo capacity of rAAV is limited to less than 5.0 kb.

[0035] Excluding other necessary elements, the space for the promoter and therapeutic gene length is approximately 4.71 kb. Therefore, the shorter the promoter, the more space is available for the therapeutic gene. Liver-specific promoters are also preferred because they suppress gene expression in organs other than the liver, ensuring the safety of the treatment. In addition, promoters that promote strong gene expression are more effective, thus ensuring therapeutic efficacy.

[0036] In a first aspect, the present invention provides a modified enhancer comprising one or more DNA binding sites for a transcription factor.

[0037] In this context, an "enhancer" refers to a nucleic acid sequence that increases the transcription rate by enhancing the activity of a promoter. A "modified enhancer" refers to an artificial enhancer that does not exist in nature. A "modified promoter" is sometimes also called an "artificial promoter" or "synthetic promoter."

[0038] Transcription factors are proteins that bind to specific DNA sequences and thereby regulate the transfer (or transcription) of genetic information from DNA to RNA. The term "DNA binding site" here refers to the specific DNA sequence to which the transcription factor binds.

[0039] In some embodiments, the transcription factor is selected from the group consisting of hepatocyte nuclear factor 4α (HNF-4α), hepatocyte nuclear factor 3β (HNF-3β), D-site binding protein (DBP), CCAAT enhancer-binding protein α (C / EBP-α), CCAAT enhancer-binding protein β (C / EBP-β), hepatocyte nuclear factor 1α (HNF-1α), and hepatocyte nuclear factor 1β (HNF-1β).

[0040] HNF-4α is a nuclear transcription factor encoded by the HNF4A gene that binds to DNA as a homodimer. It regulates the expression of several genes, including hepatocyte nuclear factor 1α, a transcription factor that modulates the expression of several liver genes.

[0041] HNF-3β is encoded by the FOXA2 gene and is a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators of liver-specific genes such as albumin and transthyretin.

[0042] DBP is a transcription activator that recognizes and binds to the 5'-RTTAYGTAAY-3' sequence found in the promoters of genes such as albumin, CYP2A4, and CYP2A5.

[0043] C / EBP-α contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif within the promoter of target genes. It functions in homodimers and heterodimers with CCAAT / enhancer-binding proteins β and γ. The activity of this protein can regulate the expression of genes involved in cell cycle control and weight homeostasis.

[0044] C / EBP-β is a bZIP transcription factor that can bind as a homodimer to a specific DNA regulatory region. It can also form heterodimers with related proteins C / EBP-α, C / EBP-δ, and C / EBP-γ.

[0045] HNF-1α is a transcription factor encoded by the HNF1A gene, which is highly expressed in the liver and is involved in regulating the expression of several liver-specific genes.

[0046] HNF-1β is encoded by the HNF1B gene and is a protein belonging to the homeobox-containing basic helix-turn-helix family. The HNF1B protein is thought to form a heterodimer with HNF-1α, another member of this transcription factor family.

[0047] In some embodiments, the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β each contain sequences of sequence numbers 4 to 8.

[0048] Sequence ID 4: HNF-4α transcription factor DNA binding site (TFBS) TGGACTTTGCACT

[0049] Sequence ID 5: HNF-3β TFBS TGTAAACA

[0050] Sequence ID 6: DBP TFBS ATTACGTAAC

[0051] Sequence ID 7: C / EBP-α / β TFBS ATTGCACAAT

[0052] Sequence ID 8: HNF-1α / β TFBS GTTAATGATTAAC

[0053] In some embodiments, the modified enhancer includes the sequence of SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 3, SEQ ID NO: 9, or SEQ ID NO: 12.

[0054] Sequence ID: 3: Es Enhancer (54bp) TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAAC

[0055] The Es enhancer is 54 bp long and contains DNA binding sites for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β from its 5' end to its 3' end.

[0056] Sequence ID 9: Em Enhancer TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAACATTACGTAAC

[0057] The Em enhancer is 54 bp long and contains DNA binding sites for HNF-4α, C / EBP-α / β, HNF-3β, HNF-1α / β (with the 7th base guanine converted to cytosine), and DBP, from the 5' end to the 3' end.

[0058] Sequence ID 12: Es-2 Enhancer TGGACTTTGCACTGTAAACATTACGTAACATTGCACAATGTTAATGATTAAC

[0059] The Es-2 enhancer is 52 bp long and similar to the Es enhancer, but it lacks two nucleotides. Specifically, one thymine and one adenine are deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site.

[0060] In another aspect, the present invention provides a synthetic promoter comprising a modified enhancer and a core promoter nucleic acid sequence disclosed herein.

[0061] As used herein, a "synthetic promoter" is a stretch of DNA containing a core promoter and a combination of heterogeneous upstream regulatory elements (cis motifs or transcription factor binding sites). Synthetic promoters are sometimes also called "modified promoters" or "artificial promoters." The core promoter (also known as the minimal region) typically contains a TATA box necessary for recruiting RNA polymerase II and the assembly of basic transcription factors to form a pre-start complex. A synthetic promoter may contain, for example, regions such as known promoters, regulatory elements, transcription factor binding sites, enhancer elements, and repressor elements.

[0062] In some embodiments, the core promoter is a liver-specific promoter.

[0063] While liver-specific promoters primarily direct transgene expression in the liver, they may also result in lower levels of transgene expression in other tissues or organs. Using liver-specific promoters in expression cassettes can restrict undesirable transgene expression in other tissues and facilitate sustained transgene expression in the liver.

[0064] In some embodiments, the liver-specific promoter is the human α-1 antitrypsin (hAAT) promoter.

[0065] In humans, the SERPINA1 gene encodes hAAT, which is produced in the liver and then transported throughout the body via the bloodstream. Therefore, the hAAT promoter is thought to specifically promote gene expression in the liver.

[0066] In some embodiments, the human α-1 antitrypsin (hAAT) promoter includes the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 1 or 2.

[0067] Sequence ID: 1: hAAT promoter (219bp) TGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTACACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC

[0068] Sequence ID: 2: hAATs promoter (94bp) GTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC

[0069] Sequence IDs 1 and 2 each contain upstream sequences of the human SERPINA1 gene. Promoters containing the sequences of Sequence ID 1 and 2 are named hAAT and hAATs, respectively. These promoters are selected for the construction of synthetic promoters in several embodiments.

[0070] In some embodiments, the synthetic promoter includes the nucleic acid sequence of SEQ ID NO: 10, SEQ ID NO: 13, or SEQ ID NO: 14, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 10, 13, or 14.

[0071] Sequence ID:10:Es-hAATs synthesis promoter TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAACTTAAGCGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGACGAGGACAGGGCCCTGTCTCCTCAGC

[0072] The Es-hAATs synthesis promoter is 164 bp long and contains a 54 bp enhancer Es and a 94 bp promoter hAATs, linked by the required enzymatic digestion sites.

[0073] Sequence ID: 13: E2-hAATs synthesis promoter TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAACTTAAGTGGACTTTGCACTGTAAACATTACGTAACATTGCACAATGTTAATGATTAACGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC

[0074] The E2-hAATs synthesis promoter is 215 bp long and contains a 54 bp modified enhancer Es, a 52 bp enhancer Es-2, and a 94 bp promoter hAATs, all linked by the required enzyme digestion sites.

[0075] Sequence ID 14: Em-hAATs synthesis promoter TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAAcATTACGTAACTTAAGCGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGACGAGGACAGGGCCCTGTCTCCTCAGC

[0076] The Em-hAATs synthesis promoter is 164 bp long and contains a 54 bp enhancer Em and a 94 bp promoter hAATs, linked by the required enzyme digestion sites.

[0077] In another aspect, the present invention provides an expression vector in which a synthetic promoter disclosed herein is ligated to act on a gene of interest.

[0078] The term "functionally linked" means that the regulatory sequences necessary for the expression of the coding sequence are positioned within the DNA molecule at the appropriate location relative to the coding sequence, thereby resulting in the expression of the coding sequence.

[0079] In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV). In some preferred embodiments, the expression vector is rAAV.

[0080] Human adeno-associated virus (AAV) is a non-pathogenic parvovirus that replicates proliferatively only in cells co-infected with helper viruses, usually adenoviruses or herpesviruses. This virus has a broad host range and can proliferately infect many cell types from various animal species. Nevertheless, AAV is not associated with any human or animal disease.

[0081] AAV binds to cells via the heparan sulfate proteoglycan receptor. Once bound, AAV entry depends on the presence of either the fibroblast growth factor receptor or the αvβ5 integrin molecule as a co-receptor. In infected cells, the invading AAV single-stranded DNA (ssDNA) is converted into a double-stranded transcription template. Cells infected with AAV and helper viruses undergo proliferative replication of AAV prior to cell lysis induced by the helper virus, not AAV. Helper viruses encode transcriptional regulator proteins or RNA transcripts that participate in DNA replication or alter the cellular environment to enable efficient viral production.

[0082] Recombinant AAV (rAAV) vectors are typically produced by substituting the viral coding sequence with the desired transgene. These vectors have been shown to be highly efficient for gene transfer and expression at many different sites, both in vitro and in vivo. They consistently mediate stable expression and have been safe in studies conducted in the respiratory system, central nervous system, skeletal muscle, liver, and eye. The efficiency of rAAV-mediated transduction improved as the titer and purity of the rAAV preparations improved.

[0083] The inverted end sequence (ITR) derived from the AAV genome is the only viral sequence required in cis form to generate the rAAV vector. A recombinant construct containing two ITRs flanking a gene expression cassette of approximately 5 kb is converted into an ssDNA vector genome and packaged into AAV particles in the presence of AAVrep and cap gene products, as well as helper functions. Methods for the production and purification of rAAV are known in the art.

[0084] One of the target genes could be the FVIII gene, located on the X chromosome and encoding factor VIII (FVIII). FVIII is one of the major components of the coagulation cascade. Loss-of-function mutations in FVIII cause a genetic disorder called hemophilia A (HA). The incidence of HA is 1 in 5000 in males.

[0085] The common treatment for HA is replacement therapy. Factor VIII concentrate is slowly infused or injected intravenously into the HA patient. These infusions replenish the deficient or low levels of factor VIII in the HA patient. However, this replacement therapy can sometimes lead to the production of inhibitors against the injected or acquired factor VIII, resulting in the failure of the therapy.

[0086] An alternative treatment for hemophilia A is gene therapy based on rAAV vectors. rAAV vectors enable the long-term, stable in vivo expression of transgenes for therapeutic purposes. The coding region of FVIII is 7035 bp long and can be divided into six domains: A1, A2, B, A3, C1, and C2. To efficiently package rAAV vectors into adeno-associated virus (AAV) capsids, the size of the expression cassette containing the therapeutic gene generally needs to not exceed 5 kb.

[0087] Due to limitations in AAV packaging capabilities, the full-length FVIII coding region cannot be efficiently packaged into AAV vectors. To overcome this problem, researchers must reduce the size of the FVIII coding region. Previous studies have shown that the B domain (908aa) of FVIII can be replaced with the SQ domain (14aa), which is not thought to be necessary for FVIII's coagulation activity. This modified FVIII is known as FVIII-SQ and has six domains: A1, A2, SQ, A3, C1, and C2. The A1, A2, and SQ domains form the heavy chain of FVIII-SQ, while A3, C1, and C2 form the light chain. The nucleotide encoding FVIII-SQ is 4374 bp long and can be efficiently inserted into rAAV vectors.

[0088] However, even with an expression cassette of approximately 5kb, many packaged rAAV vectors remain incomplete and defective, and these defective rAAV vectors cannot produce functional FVIII. To address this limitation, it is necessary to inject large amounts of rAAV vector into HA patients to produce sufficient functional FVIII. However, administering large amounts of rAAV vector can induce adverse immune responses.

[0089] To address these limitations, it is essential to keep the size of both the promoter and the poly(A) tail as small as possible. In some embodiments, the synthetic promoters disclosed herein are used to direct the expression of FVIII-SQ or other modified FVIII fragments. Due to the small size of these synthetic promoters, the expression cassette exhibits a higher packaging rate.

[0090] In another embodiment, the present invention provides a pharmaceutical composition for delivering the transgenes described herein to subjects including human subjects. In some embodiments, the composition comprises any of the nucleic acids or vectors described herein. In some embodiments, the pharmaceutical composition disclosed herein comprises any of the vectors disclosed herein and one or more pharmaceutically acceptable carriers. In some embodiments, the composition comprises any of the AAV vectors described herein. In some embodiments, the pharmaceutical composition disclosed herein comprises any of the AAV vectors disclosed herein and one or more pharmaceutically acceptable carriers.

[0091] The descriptions of pharmaceutical compositions provided herein, such as AAV vectors, primarily concern pharmaceutical compositions suitable for administration to humans; however, those skilled in the art will understand that such compositions are generally suitable for administration to any other animals, such as non-human animals or non-human mammals. It is well known that pharmaceutical compositions suitable for administration to humans can be modified to suit administration to various animals, and veterinary pharmacologists skilled in the art can design and / or carry out such modifications, if necessary, with only the usual experiments. The subjects to whom the pharmaceutical compositions are intended for administration include, but are not limited to, humans and / or other primates; mammals, including commercially important mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially important birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0092] In some embodiments, the composition will be administered to humans.

[0093] In another aspect, the present invention provides a method for treating a genetic disorder or condition in a subject requiring treatment, comprising administering the expression vector disclosed herein to the subject to thereby cause the subject to express a therapeutic protein in the liver of the subject.

[0094] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0095] Examples of hereditary diseases or conditions related to the liver include, but are not limited to, hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, hypertyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, myeloid protoporphyria, Gaucher disease, familial hypercholesterolemia, and ornithine transcarbamylase deficiency.

[0096] In some embodiments, the methods provided herein, which include administering the expression vector disclosed herein to a subject to thereby express a therapeutic protein in the subject's liver, can be used to treat a genetic disorder or condition in a subject requiring treatment.

[0097] In another embodiment, the present invention provides a variety of kits for conveniently and / or effectively carrying out the methods of the present disclosure. Typically, the kit includes a quantity and / or number of components sufficient for a user to administer multiple treatments and / or conduct multiple experiments on a subject.

[0098] The kit may include either a pharmaceutical composition or a vector of the present disclosure. In some embodiments, the kit may further include reagents and / or instructions for preparing and / or synthesizing the compounds and / or pharmaceutical compositions of the present disclosure. In some embodiments, the kit may also include one or more buffers. In some embodiments, the kit of the present disclosure may include components for preparing protein or nucleic acid arrays or libraries, and thus may include, for example, a solid carrier.

[0099] In some embodiments, kit components may be packaged in either an aqueous medium or in a lyophilized form. The kit container means generally include at least one vial, test tube, flask, bottle, syringe, or other container means in which the components can be placed and appropriately divided. If there are more than one kit component (labeled reagents and labels may be packaged together), the kit may also generally include a second, third, or other additional container in which additional components can be placed separately. In some embodiments, the kit may also include a second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components may be contained in one or more vials. The kits of the present disclosure may also typically include means for containing the compounds and / or pharmaceutical compositions of the present disclosure, e.g., proteins, nucleic acids, and any other reagent containers sealed for commercial sale. Such containers may include injection-molded or blow-molded plastic containers in which the desired vials are held.

[0100] In some embodiments, the kit components are provided as one and / or more liquid solutions. In some embodiments, the liquid solutions are aqueous solutions, and in particular, sterile aqueous solutions are used. In some embodiments, the kit components may be provided as dry powders. When reagents and / or components are provided as dry powders, such powders can be reconstituted by adding an appropriate volume of solvent. In some embodiments, it is assumed that the solvent may also be provided in a separate container. In some embodiments, the kit may include instructions for using the kit components together with any other reagents not included in the kit. These instructions may include variations that may be implemented.

[0101] [Definition] The terms used herein are intended solely to illustrate specific cases and are not intended to be limiting. Where used herein, the singular forms "a," "an," and "the" are intended to also include the plural forms unless the context clearly indicates otherwise. Furthermore, where the terms "including," "includes," "having," "has," and "with," or their variations thereof, are used in detailed descriptions and / or claims, they are intended to be as comprehensive as the term "comprising."

[0102] Where used herein, the terms “about” or “approximately” mean a range of tolerance for a particular value as determined by those skilled in the art, and which depends in part on the method by which the value is measured or determined, for example, on the limits of the measuring system. For example, “about” may conventionally mean a range of one standard deviation or more than one standard deviation for a given value. Where a particular value is described in this application and claims, unless otherwise specified, the term “about” should be considered to mean a range of tolerance for that particular value.

[0103] Where used herein, the terms “individual,” “patient,” or “subject” are interchangeable. None of these terms require, or are limited to, a situation characterized by supervision (e.g., constant or intermittent) by a healthcare professional (e.g., physician, registered nurse, nurse practitioner, physician’s assistant, caregiver, or hospice worker).

[0104] 5' and / or 3': Nucleic acid molecules (such as DNA and RNA) are said to have a "5' end" and a "3' end." This is because, when mononucleotides react to form polynucleotides, the 5' phosphate of one mononucleotide pentose ring unidirectionally binds to its adjacent 3' oxygen via a phosphodiester bond. Therefore, one end of a linear polynucleotide is called the "5' end" if its 5' phosphate is not bound to the 3' oxygen of another mononucleotide pentose ring. The other end of a polynucleotide is called the "3' end" if its 3' oxygen is not bound to the 5' phosphate of another mononucleotide pentose ring. It can also be said that an internal nucleic acid sequence has both a 5' end and a 3' end, even if the 5' phosphate of a certain mononucleotide pentose ring is bound to its adjacent 3' oxygen.

[0105] In both linear and cyclic nucleic acid molecules, separate internal elements are referred to as the “downstream” or “upstream” or “5’” of the 3’ element. In the case of DNA, this terminology reflects the fact that transcription proceeds along the DNA strand in a 5’-to-3’ direction. Promoter and enhancer elements, which direct the transcription of linked genes, are generally located at the 5’ or upstream of the coding region. However, enhancer elements can exert their effect even if they are located at the promoter element and the 3’ of the coding region. Transcription termination and polyadenylation signals are located at the 3’ or downstream of the coding region.

[0106] The term "promoter region" or "promoter" refers to a region of DNA that directs / initiates the transcription of nucleic acids (e.g., genes). A promoter contains the necessary nucleic acid sequences near the transcription start site. Typically, a promoter is located near the gene being transcribed. Promoters also optionally include distal enhancer or repressor elements, which can be thousands of base pairs away from the transcription start site. A tissue-specific promoter is a promoter that directs / initiates transcription primarily in a single type of tissue or cell. For example, a liver-specific promoter directs / initiates transcription to a significantly higher degree in liver tissue than in other tissue types.

[0107] The term "enhancer" refers to a nucleic acid sequence that increases the rate of transcription by increasing the activity of the promoter.

[0108] As is well known in the field, most eukaryotic genes contain both exons and introns. The term "exon" refers to nucleic acid sequences found in genomic DNA that are bioinformatically predicted and / or experimentally confirmed to contribute a continuous sequence to the mature mRNA transcript. The term "intron" refers to nucleic acid sequences found in genomic DNA that do not contribute to the mature mRNA transcript, but are instead predicted and / or confirmed to be "spliced ​​out" during transcript processing.

[0109] The term "vector" refers to a small carrier DNA molecule that is introduced into a host cell with an inserted DNA sequence and replicated. An "expression vector" is a specialized vector containing a gene or nucleic acid sequence that has a regulatory region necessary for expression in a host cell.

[0110] The term "functionally linked" means that the regulatory sequences necessary for the expression of the coding sequence are positioned within the DNA molecule at the appropriate location relative to the coding sequence, thereby resulting in the expression of the coding sequence. This same definition may also apply to the arrangement of coding sequences and transcriptional regulatory elements (e.g., promoters, enhancers, termination elements) in expression vectors. Furthermore, this definition may also apply to the arrangement of nucleic acid sequences in the primary and secondary nucleic acid molecules when hybrid nucleic acid molecules are generated.

[0111] Where used herein, the term “identical percentage” is used in reference to comparisons between nucleic acid or amino acid sequences. It is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to those in a given sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum possible sequence identity percentage. Nucleic acid and amino acid sequences are often compared using computer programs that align nucleic acid or amino acid sequences and reveal the differences between them. Comparisons of nucleic acid or amino acid sequences can be performed using various methods within the scope of the art, such as publicly available computer software including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve the maximum possible alignment over the entire length of the sequences being compared.

[0112] The term "sequence identity" refers to the identity (i.e., being identical) or similarity between two or more nucleic acid sequences or two or more amino acid sequences, and is expressed as sequence identity or similarity. Sequence identity can be measured as an identity percentage; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured as a similarity percentage (considering conserved amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologues of nucleic acids or amino acid sequences have a relatively high degree of sequence identity / similarity when aligned using standard methods. This homology is more important when orthologous proteins or cDNAs originate from more closely related species (e.g., human and mouse sequences) compared to more distantly related species (e.g., human and nematode sequences).

[0113] The term "nucleotide" as used herein generally refers to a base-sugar-phosphate combination. Nucleotides may include synthetic nucleotides. Nucleotides may include synthetic nucleotide analogs. Nucleotides may be monomeric units of nucleic acid sequences (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates, adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP), and deoxyribonucleoside triphosphates, such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or their derivatives. Such derivatives may include, for example, [αS]dATP, 7-deaza-dGTP, 7-deaza-dATP, and nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing them. The term nucleotide as used herein may refer to dideoxyribonucleoside triphosphate (ddNTP) and its derivatives. Specific examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. Nucleotides may be unlabeled or detected by known techniques. Labeling may also be performed using quantum dots. Detectable labels may include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzymatic labels. Fluorescent labels for nucleotides may include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP; FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP, available from Perkin Elmer (Foster City, Calif); Boehringer Fluorescein-15-dATP, fluorescein-12-dUTP, tetramethylrhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2'-dATP, available from Mannheim (Indianapolis, Ind.); and Molecular Chromosome-labeled nucleotides available from Probes (Eugene, Oreg.) may include BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, Fluorescein-12-UTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP. Nucleotides may also be labeled or marked by chemical modification. A single chemically modified nucleotide can be biotin-dNTP.Some non-limiting examples of biotinylated dNTPs may include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).

[0114] The terms “polynucleotide,” “oligonucleotide,” and “nucleic acid” are used interchangeably to refer to polymeric forms of nucleotides (either deoxyribonucleotides or ribonucleotides) of any length, in single-stranded, double-stranded, or multi-stranded forms, or analogues thereof. Polynucleotides can be exogenous or endogenous to cells. Polynucleotides can exist in a cell-free environment. Polynucleotides can be genes or fragments thereof. Polynucleotides can be DNA. Polynucleotides can be RNA. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Polynucleotides can contain one or more analogues (e.g., modified skeletons, sugars, or nucleic acid bases). If present, modifications to the nucleotide structure can be conferred before or after the construction of the polymer. Some non-limiting examples of analogs include 5-bromouracil, peptide nucleic acids, xeno nucleic acids, morpholino, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordicepin, 7-deaza-GTP, fluorophores (e.g., sugar-bound rhodamine or fluorescein), thiol-containing nucleotides, biotin-bound nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, quosin, and iosin. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, extracellular polynucleotides including extracellular DNA (cfDNA) and extracellular RNA (cfRNA), nucleic acid probes, and primers. Nucleotide sequences can be interrupted by non-nucleotide components.

[0115] Recombinant nucleic acid molecules are those that have sequences not found in nature, such as sequences containing one or more nucleic acid substitutions, deletions, or insertions, and / or sequences created by artificial combinations of two isolated sequence segments. These artificial combinations can be achieved by chemical synthesis, or more generally, by artificially manipulating isolated nucleic acid segments, for example, by genetic engineering techniques.

[0116] The term "cDNA (complementary DNA)" refers to a DNA fragment that lacks internal non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells. cDNA may also contain untranslated regions (UTRs) responsible for regulating the translation of the corresponding RNA molecule.

[0117] As used herein, the term “gene” refers to the nucleic acid (e.g., DNA such as genomic DNA and cDNA) and its corresponding nucleotide sequence involved in encoding RNA transcripts. In relation to genomic DNA, the term as used herein includes intervening non-coding and regulatory regions, and may include the 5' and 3' ends. In some usages, the term encompasses the transcription sequence, including the 5' and 3' untranslated regions (5'-UTR and 3'-UTR), exons, and introns. For some genes, the transcription region includes an “open reading frame” that codes for a polypeptide. In some usages of the term, “gene” includes only the coding sequence necessary to code for a polypeptide (e.g., the “open reading frame” or “coding region”). In some cases, a gene does not code for a polypeptide; for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term “gene” also includes the non-transcription region, including upstream and downstream regulatory regions, enhancers, and promoters, as well as the transcribed sequence. A gene may refer to an “endogenous gene” or a native gene located in its natural position within the genome of an organism. The term "gene" may refer to an "exogenous gene" or a non-natural gene. A non-natural gene may refer to a gene that is not normally found in a host organism but has been introduced into the host organism through gene transfer. A non-natural gene may also refer to a gene that is not in its natural location within the genome of an organism. A non-natural gene may also refer to a natural nucleic acid or polypeptide sequence (e.g., a non-natural sequence) that includes mutations, insertions, and / or deletions.

[0118] Transcription factors (TFs) are proteins that bind to specific DNA sequences and thereby regulate the transfer (or transcription) of genetic information from DNA to RNA. TFs perform this function alone or in conjunction with other proteins in a complex by promoting (as activators) or blocking (as repressors) the supplementation of RNA polymerase (the enzyme that transcribes genetic information from DNA to RNA) to specific genes. The specific DNA sequences to which TFs bind are known as response elements (REs) or regulatory elements. Other names include cis-elements and cis-acting transcriptional regulatory elements.

[0119] Gene therapy involves introducing one or more heterologous nucleic acid molecules into recipient cells, where the expression of the heterologous nucleic acid in the recipient cells affects cellular function and produces a therapeutic effect. For example, the heterologous nucleic acid molecule may encode a protein that affects the function of the recipient cell.

[0120] An inverted end sequence (ITR) is a symmetrical nucleic acid sequence present in the genome of adeno-associated viruses that is necessary for efficient replication. ITR sequences are located at both ends of the AAV DNA genome. ITRs function as the origin of replication for viral DNA synthesis and are essential cis-components for the generation of AAV integration vectors.

[0121] The term "control" used here refers to the standard product.

[0122] Hemophilia is a blood clotting disorder caused by a deficiency in coagulation factor activity, resulting in impaired hemostasis. Severe forms develop when coagulation factor concentrations fall to less than approximately 1% of normal levels in healthy individuals. In some individuals, hemophilia develops due to impaired coagulation factor expression caused by gene mutations. In other cases, hemophilia is an autoimmune disease called acquired hemophilia, in which hemostasis is impaired by antibodies produced against coagulation factors within the individual.

[0123] Hemophilia A is caused by a deficiency of functional clotting factor VIII, and hemophilia B is caused by a deficiency of functional blood clotting factor IX. These conditions, caused by genetic mutations, are induced by a defect gene located on the X chromosome, resulting in a hereditary X-linked recessive trait, and the disease is therefore generally found only in males. The severity of symptoms can vary, with more severe forms manifesting earlier. Bleeding is characteristic of the disease and typically occurs when a male infant is circumcised. Further bleeding becomes more pronounced as the infant begins to move. Mild cases may go unnoticed until they manifest later in life as a reaction to surgery or trauma. Internal bleeding can occur anywhere, but intra-articular bleeding is common.

[0124] As used herein, "factor VIII deficiency" includes deficiencies in coagulation activity caused by defective production of factor VIII, insufficient or absent production of factor VIII, or partial or complete inhibition of factor VIII by inhibitors. Hemophilia A is a type of factor VIII deficiency resulting from a defect in an X-linked gene and the absence or deficiency of the factor VIII protein it encodes.

[0125] The terms “derivative,” “variant,” and “fragment” as used herein with respect to polypeptides refer to polypeptides that are related to the wild-type polypeptide by any of the following: amino acid sequence, structure (e.g., secondary and / or tertiary structure), activity (e.g., enzymatic activity), and / or function. Polypeptide derivatives, variants, and fragments may include one or more amino acid mutations (e.g., mutations, insertions, and deletions), truncations, modifications, or combinations thereof compared to the reference polypeptide.

[0126] As used herein, “diluent” refers to a component in a pharmaceutical composition that lacks pharmacological activity but may be pharmacokinetically necessary or desirable. For example, a diluent may be used to increase the volume of a potent drug whose mass is too small for manufacture and / or administration. A diluent may also be a liquid used to dissolve a drug administered by injection, ingestion, or inhalation. Common forms of diluents in the art are buffered aqueous solutions, such as, but are not limited to, phosphate-buffered saline that mimics the composition of human blood.

[0127] The term "pharmaceutical composition" refers to a mixture of the expression vector or rAAV vector disclosed herein with other chemical components such as diluents or carriers. Pharmaceutical compositions facilitate the administration of compounds to living organisms. Pharmaceutical compositions are generally formulated to suit a specific intended route of administration. Pharmaceutical compositions are suitable for human and / or animal use.

[0128] The pharmaceutical compositions described herein may be administered to human patients either directly or as a mixture with other active ingredients, carriers, diluents, additives, or combinations thereof, as in combination therapy. The appropriate formulation depends on the chosen route of administration.

[0129] In this context, "additive" refers to an inert substance added to a pharmaceutical composition that provides the composition with, but is not limited to, volume, consistency, stability, binding ability, lubricity, or disintegration ability. "Diluent" is a type of additive.

[0130] As used herein, the terms “treatment” and “treating” refer to an approach to obtain beneficial or desired outcomes, including, but not limited to, therapeutic and / or preventive benefits. For example, treatment may include administering the systems or cell populations disclosed herein. Therapeutic benefits may refer to a therapeutically appropriate improvement or effect on one or more diseases, conditions, or symptoms during treatment. Preventive benefits may refer to administering the composition to subjects at risk of developing a particular disease, condition, or symptom, or to subjects reporting one or more physiological symptoms of a disease, condition, or symptom, even if the disease, condition, or symptom has not yet manifested.

[0131] The terms “effective dose” or “therapeutically effective dose” refer to an amount of a composition, for example, a composition containing an rAAV vector, that is sufficient to produce the desired activity when administered to a subject requiring it. The term “therapeutically effective” may refer to an amount of a composition sufficient to delay the onset, halt the progression, alleviate or reduce the onset of at least one symptom of the disorder treated by the method of the present disclosure.

[0132] A “therapeutic effect” may occur if there is a change in the treated condition. This change may be positive or negative. For example, a “positive effect” may correspond to an increase in the number of activated T cells in the subject. In another example, a “negative effect” may correspond to a decrease in the volume or size of a tumor in the subject. A “change” in the treated condition may refer to a change of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 25%, 50%, 75%, or 100% in the condition. The change may be based on an improvement in the severity of the treated condition in an individual, or a difference in the frequency of improvement in the condition in a population of individuals with or without the administration of the therapeutic agent. Similarly, the methods of this disclosure may include administering a predetermined number of cells that are “therapeutic.” The term “therapeutic” should be understood to have a definition corresponding to “having a therapeutic effect.”

[0133] The following examples are presented to those skilled in the art to provide a complete disclosure and explanation of the methods of manufacture and use of the present invention, and are not intended to limit the scope of what the inventors consider to be the invention, nor to indicate that the following experiments represent all or only the experiments performed. While efforts have been made to ensure accuracy with respect to the numerical values ​​used (e.g., quantity, temperature, etc.), some degree of experimental error and deviation should be taken into consideration. Unless otherwise specified, parts are by weight, molecular weight is weight-average molecular weight, temperature is in degrees Celsius, and pressure is atmospheric pressure or near atmospheric pressure.

[0134] Example 1. Design and acquisition of a liver-specific enhancer and testing of its effect on promoters. This example describes how liver-specific enhancers were designed and obtained, and how their effects on promoters were tested. Specifically, synthetic promoters consisting of a short-core promoter and a modified enhancer were used to promote the expression of B-domain-deficient FVIII (FVIII-SQ) in Huh7 cells and mice, or to promote luciferase overexpression in Huh7 cells. The activity and protein levels of FVIII-SQ, as well as luciferase activity, were measured, and the activity of synthetic promoters with different core promoter and enhancer combinations was compared. The results showed that although the synthetic promoters were shorter than the 252 bp HLP liver-specific promoter, they had significantly higher promoter activity.

[0135] [method] [Designing specific enhancers] In this invention, several transcription factors were selected and used, including hepatocyte nuclear factor 1α / β (HNF-1α / β), HNF-3β, HNF-4α, CCAAT enhancer-binding protein α / β (C / EBP-α / β), and D-site-binding protein (DBP).

[0136] In this invention, a 54 bp modified enhancer (Es, SEQ ID NO: 3) was formed by combining and arranging the DNA binding sites of the above transcription factor (TFBS), and this was then added upstream of the core promoter to enhance transgene overexpression. The sequences of the TFBS for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β selected in this invention are shown in SEQ ID NOs: 4 to 8, respectively.

[0137] Another 54bp modified enhancer (Em, SEQ ID NO: 9) was designed to remove the ATG triple nucleotide by rearranging the TFBS of the above transcription factor and substituting the 7th base guanine in the TFBS sequence of HNF-1α / β with cytosine.

[0138] The third design enhancer, Es-2 (SEQ ID NO: 12), is 52 bp long and similar to the Es enhancer, but with two nucleotides deleted from it. Specifically, one thymine and one adenine were deleted from the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively.

[0139] [Obtaining liver-specific core promoters] In this invention, the sequence conservation between Homo sapiens and mice (Mus musculus), and the location of the TATA box related to the transcription start site (TSS), were taken into consideration in the selection of the promoter.

[0140] Two core promoters, called the 219bp hAAT promoter and the 94bp hAATs promoter, which are upstream sequences of the human SERPINA1 gene (encoding human α-1 antitrypsin (hAAT)), were selected for the in vitro construction of the synthetic promoter. The 219bp hAAT promoter (SEQ ID NO: 1) contains the complementary genome sequence Chr14:94388594-94388812 (NC_000014.9). The 94bp hAATs promoter (SEQ ID NO: 2) contains the complementary genome sequence Chr14:94388594-94388687.

[0141] [Construction of rAAV vector plasmid] In accordance with the literature (Blood. 2013 Apr 25;121(17):3335-3344.) and patent EP2698163B1, a liver-specific HLP promoter was selected as a positive control promoter. The HLP promoter was synthesized by GENERAL BIOSYSTEMS (Anhui, China) and cloned into the pUC-HLP plasmid.

[0142] Promoter hAAT and hAATs were obtained by polymerase chain reaction (PCR) using genomic DNA derived from Huh7 cells as a template. Promoter HLP was obtained by PCR using the pUC-HLP plasmid as a template. After digestion with MluI and NheI double restriction enzymes, these promoters were cloned into the rAAV vector scaffold pssAAV-TTR-FVIII-SQ, and recombinant vectors containing pssAAV-hAAT-FVIII-SQ, pssAAV-hAATs-FVIII-SQ, and pssAAV-HLP-FVIII-SQ were constructed. pssAAV-TTR-FVIII-SQ is a plasmid expression vector containing the TTR promoter, introns, FVIII-SQ coding sequence, and poly(A) tail.

[0143] A single-chain oligonucleotide containing a 54 bp modified enhancer (Es) and several enzymatic cleavage sites of less than 90 nucleotides was synthesized by GENEWIZ (Suzhou, China). Its complementary oligonucleotide was also synthesized by GENEWIZ. These two oligonucleotides were conjugated to form a DNA fragment with sticky ends of MluI enzymatic digestion sites at both ends. This DNA fragment was then cloned into the pssAAV-hAATs-FVIII-SQ vector to obtain the pssAAV-Es-hAATs-FVIII-SQ vector. The sequence of the Es-hAATs synthesis promoter is shown in SEQ ID NO: 10 and contains a 54 bp modified enhancer (Es) and a 94 bp hAATs promoter.

[0144] Similarly, a fragment containing a 34 bp HCR (hepatic regulatory region) and a 32 bp proximal enhancer element derived from the HLP promoter was cloned into the pssAAV-Es-hAATs-FVIII-SQ vector after HindIII and AflII bienzyme digestion to construct the pssAAV-HEx-hAATs-FVIII-SQ vector. The sequence of the HEx-hAATs synthesis promoter is shown in Sequence ID No. 11 below and contains a 34 bp HCR (hepatic regulatory region), a 32 bp proximal enhancer element derived from the HLP promoter, and a 94 bp hAATs promoter.

[0145] SEQ ID NO: 11-HEx-hAATs synthesis promoter TGTTTGCTGCTTGCAATGTTTGCCCATTTTAGGGTGGACACAGGACGCTGTGGTTTCTGAGCCAGGcttaagcgtcgacacgcGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC

[0146] A DNA fragment of the modified enhancer Es-2 (SEQ ID NO: 12, similar to Es but lacking one thymine and one adenine at the 5' and 3' ends of the HNF-3β transcription factor binding site) was formed from two complementary oligonucleotides synthesized by GENEWIZ. Subsequently, Es-2 was cloned into the pssAAV-Es-hAATs-FVIII-SQ vector skeleton after AflII and SalI bienzyme digestion to construct the pssAAV-E2-hAATs-FVIII-SQ vector. The sequence of the E2-hAATs synthesis promoter is shown in SEQ ID NO: 13 and contains the modified enhancer Es, the modified enhancer Es-2, and a 94 bp hAATs promoter.

[0147] The vector pssAAV-HLP-FVIII-SQ was digested with MluI and NheI bienzymes, and the HLP fragment was then cloned into the pssAAV-MSP-luciferase vector skeleton. Subsequently, pssAAV-HLP-luciferase was obtained by digestion with HindIII and SpeI. pssAAV-MSP-luciferase is a plasmid expression vector containing the MSP promoter, introns, luciferase coding sequence, and BGH poly(A) tail. Similarly, fragments of HEx-hAATs, Es-hAATs, and E2-hAATs obtained from pssAAV-HEx-hAATs-FVIII-SQ, pssAAV-Es-hAATs-FVIII-SQ, and pssAAV-E2-hAATs-FVIII-SQ by HindIII and NheI double enzyme digestion were cloned into the pssAAV-MSP-luciferase vector skeleton, followed by HindIII and SpeI digestion to obtain pssAAV-HEx-hAATs-luciferase, pssAAV-Es-hAATs-luciferase, and pssAAV-E2-hAATs-luciferase vectors, respectively.

[0148] The DNA fragment of the modified enhancer Em (SEQ ID NO: 9) was formed from two complementary oligonucleotides synthesized by GENEWIZ. Em was then cloned into a pssAAV-Es-hAATs-luciferase vector skeleton obtained by digesting with HindIII and AflII bienzymes to obtain the pssAAV-Em-hAATs-luciferase vector. The sequence of the Em-hAATs synthesis promoter is shown in SEQ ID NO: 14 and contains the modified enhancer Em and a 94 bp hAATs promoter.

[0149] All primers used in vector plasmid construction are listed in Table 1 (SEQ ID NOs: 15-27). TIFF2026519440000001.tif178170

[0150] Figure 1 shows the positive control liver-specific promoter HLP (Blood. 2013 Apr 25;121(17):3335-3344) and the core promoters hAAT and hAATs that promote FVIII-SQ overexpression in the rAAV vector plasmid. Figure 2 shows the modified enhancers Es, E2, and Em. Figure 3 shows the HLP promoter and several synthetic promoters.

[0151] [Cell culture and transfection] Huh7 cells were obtained from ATCC and cultured in DMEM (Dulbecco's Modified Eagle Medium) containing 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin. The cells were incubated at 37°C and 5% CO2.

[0152] Transfection was performed in 12-well plates. Briefly, Huh7 cells were cultured overnight until the concentration reached approximately 80%, and then a mixture of 0.5 μg of plasmid expressing FVIII-SQ or EGFP (highly sensitive green fluorescent protein) and 1.5 μL of PolyJet (SignaGen Laboratories, Maryland) was added to each well according to the manufacturer's protocol. Cells were transfected twice with each plasmid constructed above. After 6–8 hours, the cells were gently washed with DPBS (Dulbecco's phosphate-buffered saline) and cultured in F12 medium. After 48 hours of transfection, the supernatant was collected, and FVIII-SQ activity and protein levels were measured by APTT and ELISA, as described below.

[0153] Similarly, Huh7 cells were cultured overnight in 12-well plates and transfected with plasmids containing different promoters and luciferase coding sequences. Cells were triple-transfected with each plasmid. After 6–8 hours, the medium containing the transfection reagents and plasmids was removed, and fresh DMEM containing FBS and penicillin-streptomycin was added to the 12-well plates. Cells were collected 24 hours after transfection for measurement of luciferase activity.

[0154] [APTT (One-Step Activated Partial Thromboplastin Coagulation Time)] In the in vitro assay, ReFacto (Genetics Institute, Cambridge, MA) was used as a standard, serially diluted from 1 U / mL (200 ng / mL) to 1 / 2 to 1 / 64 dilutions in F12 medium. ReFacto is recombinant FVIII and can be used as a standard for APTT and ELISA. Culture F12 medium was collected from the above 12-well plate and centrifuged at 13000 rpm for 5 minutes. The supernatant was then used as the sample. 50 μL of STA-PTT reagent (Diagnostica Stago, Asnieres, France) was added to a sufficient number of strips of STAGO cuvettes containing magnetic beads in each well. Then, each diluted standard protein and each sample were added to different wells of STAGO cuvettes, all pre-filled with STA-PTT reagent. The mixtures were incubated at 37°C for 170 seconds. Subsequently, 50 μL of 25 mM CaCl2 was added using a STAGO instrument (Diagnostica Stago, Asnieres, France) to initiate coagulation time, and measurements were taken. FVIII-SQ activity was calculated according to a standard curve.

[0155] In the in vivo assay, plasma was collected from the posterior orbital venous plexus of mice by adding a blood sample to a 1.5 mL tube pre-filled with the anticoagulant sodium citrate (final concentration 3.8%). After centrifugation at 2500 g for 15 minutes, the supernatant, i.e., mouse plasma, was transferred to a new tube. Plasma samples diluted to appropriate proportions were used for measurement of FVIII-SQ activity and protein levels by APTT and ELISA.

[0156] [ELISA (Enzyme-linked immunosorbent assay)] In a 96-well plate, each well was coated overnight at 4°C with 100 μL of 2.5 ng / μL of capture antibody PAH-FVIII-S (Haematologic Technologies, Essex) in a coating buffer (containing 0.1 M sodium bicarbonate and sodium carbonate, pH 9.6). The plate was washed three times for 5 minutes each time with 300 μL of PBST buffer (140 mM NaCl, 2.5 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, 0.05% Tween-20, pH 8.4), and then the wells were blocked at room temperature for 2 hours with 300 μL of PBST buffer containing 3% BSA. After washing the wells three times with PBST buffer, 100 μL of standard material or sample was added and incubated at room temperature for 1.5 hours. ReFacto serial dilutions (12.5 ng / mL serially diluted 2-fold to 0.1953 ng / mL) were used as the standard material. After washing the wells three times with PBST buffer, 100 μL of 0.5 ng / μL biotin-labeled detection antibody GMA-8021 (Green Mountain Antibodies, Burlington) was added. The plate was incubated at room temperature for 1 hour. After three washes, 100 μL of 200-fold dilution of streptavidin-HRP (CST, Boston) in PBST buffer containing 0.1% BSA was added to each well and incubated in the dark for 1 hour. Next, the plate was washed three times with PBST buffer and colored using 100 μL of KPL SureBlue TMB1-Component Microwell Peroxidase Substrate (Seracare, Milford). Color development was carried out in the dark at room temperature for 1-10 minutes, and stopped by adding 100 μL of 0.5 M H2SO4. OD values ​​were quantified at 450 nm and 630 nm using a spectrophotometer. The amount of FVIII-SQ in the culture medium was calculated according to a standard curve.

[0157] [Hydrodynamic injection] Factor VIII-deficient mice, approximately 8-10 weeks old, were injected with different rAAV vector plasmids via hydrodynamic injection. Briefly, each mouse was gently injected into the tail vein with a 2 mL mixture of PBS and 100 μg of plasmid at a constant rate. Three mice were treated in each group. Mouse plasma was collected 48 hours after injection for measurement of FVIII-SQ activity and protein levels by APTT and ELISA.

[0158] [Luciferase assay] Transfected cells on a 12-well plate were gently rinsed with DPBS after removal of DMEM, then the DPBS was removed, and 100 μL of cell lysis buffer from the Firefly Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai) was added to each well. After 5 minutes at room temperature, the samples were transferred to Eppendorf tubes. After centrifugation at 4°C and 12000 rpm for 2 minutes, the supernatant was transferred to a new tube. 30 μL of substrate from the Firefly Luciferase Receptor Gene Assay Kit was added to 30 μL of each sample on a 96-well white assay plate (Corning, New York), and the mixture was used for detection of luciferase activity using a Synergy H1 hybrid multimode microplate reader (BioTek, Winooski).

[0159] [Data Analysis] A schematic diagram was created using Adobe Illustrator CS5. Statistical analysis of the data was performed using GraphPad Prism 8.0.1. All data were reported as mean ± SD. Significant differences in FVIII-SQ activity and protein levels between the HLP promoter group and other promoter groups (or between two other promoter groups) were calculated using a two-sided Student's t-test. Significant differences in luciferase activity between the two promoter groups were also calculated using a two-sided Student's t-test.

[0160] [result] [Selection of liver-specific core promoters] The cargo capacity of rAAV vectors is limited, and expression cassettes containing conventional promoters and therapeutic FVIII-SQ for hemophilia A(HA) treatment are too large to fit. Therefore, there is an urgent need for a small promoter that can effectively promote FVIII-SQ overexpression. Core promoters are generally known to be insufficiently specific or too weak to promote transgene overexpression. Here, we first obtained a short liver-specific core promoter that maintains steady-state activity for transgene overexpression. Next, we constructed a synthetic promoter that promotes potent gene expression by combining this short liver-specific core promoter with various small enhancers.

[0161] To obtain a small, effective, and liver-specific promoter, we selected a 219 bp hAAT promoter (hAAT, SEQ ID NO: 1) and a 94 bp hAATs promoter (hAATs, SEQ ID NO: 2) from the human SERPINA1 genome (encoding human α-1 antitrypsin, hAAT). These two promoters were cloned into the pssAAV-TTR-FVIII-SQ rAAV vector plasmid to obtain pssAAV-hAAT-FVIII-SQ and pssAAV-hAATs-FVIII-SQ, respectively. A 252 bp hybrid liver-specific HLP promoter containing regulatory elements derived from the HCR (hepatic regulatory region) and sequences from the human SERPINA1 genome was selected as a positive control promoter based on the literature (Blood. 2013 Apr 25;121(17):3335-3344.) and patent EP2698163A1. To investigate whether the activity of the hAATs promoter can be enhanced by an enhancer, we constructed pssAAV-HEx-hAATs-FVIII-SQ containing the HEx-hAATs promoter (SEQ ID NO: 11). Here, HEx is a 66 bp long hybrid enhancer derived from the HLP promoter (see Figure 1, panel showing HLP).

[0162] To investigate the activity of hAAT, hAATs, and HEx-hAATs, different rAAV vector plasmids were constructed to place the FVIII-SQ gene under the control of hAAT, hAATs, HEx-hAATs, and HLP, respectively. These vectors were then transfected into Huh7 cells on 12-well plates. Cell supernatant was collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured using APTT and ELISA. The data are shown in Figure 4.

[0163] As shown in Figure 4, the activity of FVIII-SQ under the control of the hAAT promoter was reduced compared to that under the control of the liver-specific HLP promoter (P=0.0392). However, in Huh7 cells, the protein level of FVIII-SQ under the control of the hAAT promoter was comparable to that under the control of the liver-specific HLP promoter (P=0.3572). On the other hand, the activity (P=0.0009) and protein level (P=0.0034) of FVIII-SQ under the control of the hAATs promoter were considerably lower than those under the control of the liver-specific HLP promoter in Huh7 cells. Nevertheless, the data indicate that the hAATs promoter maintained steady activity to promote FVIII-SQ expression. Interestingly, as shown in Figure 4, the activity of the hAATs promoter was restored by the addition of HEx, suggesting that the effect of synthetic enhancers can be investigated using the hAATs promoter.

[0164] [Effects of synthetic enhancers on hAATs promoters] Several transcription factors, including HNF-1α / β, HNF-3β, DBP, HNF-4α, and C / EBP-α / β, have been reported to be transcription activators that regulate the expression of many liver-specific genes, such as albumin (ALB), transthyretin (TTR), and α-1 antitrypsin (AAT) genes. To investigate whether a synthetic enhancer formed by randomly combining the transcription factor binding sites (TFBS) of HNF-1α / β, HNF-3β, DBP, HNF-4α, and C / EBP-α / β can enhance the activity of the hAATs promoter, we designed and synthesized a 54 bp enhancer Es containing the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β from 5' to 3' (Es, SEQ ID NO: 3) (see Figure 2, top panel). Another 111bp enhancer E2 was designed by adding a 52bp enhancer Es-2 (similar to Es, but with one thymine and one adenine deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively) to the end of Es (see Figure 2, center panel).

[0165] Next, Es-hAATs synthesis promoters and E2-hAATs synthesis promoters were constructed, and their sequences are shown in SEQ ID NOs: 10 and 13, respectively. Different rAAV vector plasmids were constructed to place the FVIII-SQ gene under the control of the Es-hAATs promoter, the E2-hAATs promoter, or the HLP promoter. The different rAAV vector plasmids were transfected into Huh7 cells on 12-well plates. Cell supernatant was collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. The data are shown in Figures 5A and 5B.

[0166] As shown in Figure 5A, the activity of FVIII-SQ promoted by the Es-hAATs promoter was significantly higher than that promoted by the hAATs promoter (P=0.0016). Similarly, the protein level of FVIII-SQ promoted by the Es-hAATs promoter was also significantly higher than that promoted by the hAATs promoter (P=0.0004, Figure 5B). These data suggest that enhancer Es was able to significantly enhance the activity of the hAATs promoter. Furthermore, under the control of the Es-hAATs synthesis promoter (SEQ ID NO: 10), both the activity (P=0.0067) and protein level (P=0.0009) of FVIII-SQ were approximately twice as high as under the control of the HLP promoter, demonstrating the potent gene expression enhancing ability of enhancer Es.

[0167] As seen in Figures 5A and 5B, both the activity and protein levels of FVIII-SQ promoted by the E2-hAATs promoter were significantly higher than those promoted by the hAATs promoter. Comparing FVIII-SQ activity and protein levels, the E2-hAATs promoter also showed stronger promoter activity than the HLP promoter. However, the data showed no significant difference between the activity of FVIII-SQ promoted by the Es-hAATs promoter and the E2-hAATs promoter, and the protein levels of FVIII-SQ promoted by the E2-hAATs promoter were significantly lower than those promoted by the Es-hAATs promoter (P=0.0382, Figure 5B). This observation is surprising. As seen in the central panel of Figure 2, the E2 enhancer contains more transcription factor binding sites (TFBSs) than the Es enhancer. The data in Figure 5A suggest that adding further TFBSs did not enhance the promoter activity of the E2 enhancer compared to the Es enhancer. In fact, when using the E2-hAATs promoter, a negative effect on FVIII-SQ protein levels was observed compared to when using the Es-hAATs promoter (Figure 5B).

[0168] Furthermore, in vivo validation was performed in factor VIII-deficient mice. An rAAV vector plasmid containing the FVIII-SQ gene under the control of either the Es-hAATs promoter or the HLP promoter was injected into 8-10 week old FVIII-deficient mice. Mouse plasma was collected 48 hours after injection, and FVIII-SQ activity and protein levels were measured using APTT and ELISA. The data are shown in Figures 5C and 5D.

[0169] As shown in Figures 5C and 5D, in factor VIII-deficient mice, the activity and protein levels of FVIII-SQ promoted by the Es-hAATs synthesis promoter were both higher than those of FVIII-SQ promoted by the HLP promoter (P=0.013 and P=0.0385). The results in mice were consistent with the results in Huh7 cells shown in Figures 5A and 5B.

[0170] [Comparison of the activity of different enhancers against the hAATs promoter] The ITR in the rAAV vector may act as a weak promoter (J Biol Chem. 1993 Feb 15;268(5):3781-90.), and therefore, the ATG triple nucleotide in the enhancer or promoter sequence may disrupt the translation of the target protein. Accordingly, we designed another 54 bp modified enhancer (Em, SEQ ID NO: 9) that removes the ATG triple nucleotide by altering the TFBS combination and substituting the 7th base guanine in the TFBS sequence of HNF-1α / β with cytosine (see lower panel of Figure 2).

[0171] To investigate the enhancing effects of different enhancers, synthetic promoters containing the hAATs promoter and the enhancers HEx, Es, E2, or Em were constructed (see Figure 3). Different rAAV vector plasmids were created to place the luciferase gene under the control of HEx-hAATs, Es-hAATs, E2-hAATs, Em-hAATs, and HLP, respectively. These vectors were then transfected into Huh7 cells on 12-well plates. Cells were collected 24 hours after transfection, and luciferase activity was measured. The data are shown in Figure 6.

[0172] As shown in Figure 6, the luciferase activity driven by Es-hAATs and Em-hAATs was similar (P=0.0652), suggesting that the Em enhancer has similar enhancing activity to the Es enhancer in terms of luciferase expression enhancement. Another observation was that the luciferase activity promoted by the three synthetic promoters (Es-hAATs, E2-hAATs, and Em-hAATs) was significantly stronger than that of the HEx-hAATs promoter and the HLP promoter (P<0.0001), suggesting that the Es, E2, and Em enhancers were able to significantly enhance the promoter activity of the hAATs promoter.

[0173] Example 2. Treatment of patients with genetic disorders Human patients are tested for genetic disorders.

[0174] An expression vector is constructed containing the synthetic promoter disclosed herein, which is ligated to act on a therapeutic transgene. The efficacy and safety of the expression vector are tested in in vitro cell cultures and in vivo animal models before it is used to treat human patients.

[0175] Example 3. Treatment of human hemophilia A patients using an rAAV expression vector. This example illustrates an exemplary method for the clinical use of an rAAV vector encoding FVIII-SQ for the treatment of hemophilia A.

[0176] An expression vector is constructed containing the synthetic promoter disclosed herein, which is ligated to act on FVIII-SQ. The efficacy and safety of the expression vector are tested in in vitro cell cultures and in vivo animal models before it is used to treat human patients.

[0177] Patients diagnosed with hemophilia A are selected for treatment. The patient is administered a therapeutically effective dose of rAAV. rAAV can be administered intravenously. The appropriate therapeutic dose can be selected by the physician.

[0178] In some cases, the effective therapeutic dose is 1 × 10⁻⁶ 11 ~1 × 10 14 The range is virus particles (vp) / kg, for example, about 1 × 10⁻⁶ 11 The dosage is vp / kg. In most cases, a single dose is administered to the patient. The patient's health status can be monitored over time to determine the effectiveness of the treatment.

Claims

1. A modified enhancer comprising one or more DNA binding sites for a transcription factor, wherein each transcription factor is selected from the group consisting of HNF-4α, HNF-3β, D-site binding protein (DBP), CCAAT enhancer binding protein α / β (C / EBP-α / β), and hepatocyte nuclear factor 1α / β (HNF-1α / β).

2. The modified enhancer according to claim 1, wherein the DNA binding sites for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β each contain the nucleic acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

3. A modified enhancer according to claim 1 or 2, comprising a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 3, SEQ ID NO: 9, or SEQ ID NO:

12.

4. A synthetic promoter comprising a modified enhancer according to any one of claims 1 to 3 and a nucleic acid sequence of a core promoter.

5. The synthetic promoter according to claim 4, wherein the core promoter is a liver-specific promoter.

6. The synthetic promoter according to claim 5, wherein the liver-specific promoter is the human α-1 antitrypsin (hAAT) promoter.

7. The synthetic promoter according to claim 6, wherein the human α-1 antitrypsin (hAAT) promoter comprises a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 1 or SEQ ID NO:

2.

8. A synthetic promoter according to any one of claims 4 to 7, comprising a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with SEQ ID NO: 10, SEQ ID NO: 13, or SEQ ID NO:

14.

9. An expression vector comprising the synthetic promoter according to any one of claims 4 to 8.

10. The expression vector according to claim 9, further comprising a transgene responsively linked to a synthetic promoter according to any one of claims 4 to 8.

11. The expression vector according to claim 10, wherein the transgene encodes a therapeutic protein for the treatment of a liver-related genetic disorder or condition.

12. The expression vector according to claim 11, wherein the therapeutic protein is factor VIII protein or a functional fragment thereof.

13. An expression vector according to any one of claims 9 to 12, which is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenovirus vector, or a recombinant adeno-associated virus vector (rAAV).

14. The expression vector according to claim 13, which is an rAAV vector.

15. A pharmaceutical composition comprising an enhancer according to any one of claims 1 to 3, a synthetic promoter according to any one of claims 4 to 8, or an expression vector according to any one of claims 9 to 14, and a pharmaceutically acceptable carrier.

16. A method for treating a liver-related genetic disorder or condition in a subject requiring treatment, comprising administering a therapeutically effective amount of the expression vector according to any one of claims 9 to 14 or the pharmaceutical composition according to claim 15 to the subject.

17. The method according to claim 16, wherein the subject is a mammal.

18. The method according to claim 17, wherein the mammal is a human.

19. The method according to claim 16, wherein the hereditary disease or condition related to the liver is selected from the group consisting of hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, hypertyrosinemia type 1, α1 antitrypsin deficiency, argininosuccinateuria, liver cancer, glycogen storage disease, urea cycle disorders, Crigler-Nadjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome type 1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation disorders, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, myeloid protoporphyria, Gaucher disease, familial hypercholesterolemia, and ornithine transcarbamylase deficiency.

20. Use of an enhancer according to any one of claims 1 to 3, a synthetic promoter according to any one of claims 4 to 8, or an expression vector according to any one of claims 9 to 14 for enhancing the expression level of a transgene in hepatocytes, wherein the transgene is ligated to the promoter in a manner that allows it to act.

21. Use of an enhancer according to any one of claims 1 to 3, a synthetic promoter according to any one of claims 4 to 8, an expression vector according to any one of claims 9 to 14, or a pharmaceutical composition according to claim 15 for the manufacture of a pharmaceutical for treating a hereditary disease or condition related to the liver.

22. A kit comprising a promoter according to any one of claims 4 to 8, an expression vector according to any one of claims 9 to 14, or a pharmaceutical composition according to claim 15.

23. The kit according to claim 22, further comprising instructions for using the contents of the kit.

Images