Intranasal delivery of CD34+ cells for stroke treatment

Intranasal administration of CD34+ cells addresses the limitations of invasive stroke treatments by delivering cells to the brain non-invasively, achieving improvements in neurological function and reducing infarct size and inflammation.

JP2026520825APending Publication Date: 2026-06-25CELLPROTHERA SAS
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
CELLPROTHERA SAS
Filing Date
2024-04-19
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing methods for treating ischemic stroke, particularly invasive and significantly reduces the risk to the patient compared to other administration routes have not effectively address the delivery of CD34+ cells to the brain, and they are not invasive and significantly reduce the risk to the patient compared to other administration routes.

Method used

Intranasal administration of CD34+ cells, which secrete paracrine factors and promote angiogenesis, neurogenesis, and reduce infarct size, cell loss, and inflammation in the brain.

Benefits of technology

Intranasal administration of CD34+ cells effectively delivers cells to the brain, reducing infarct size, cell loss, and inflammation, and promoting neurological recovery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026520825000001_ABST
    Figure 2026520825000001_ABST
Patent Text Reader

Abstract

This disclosure relates to therapeutic methods including intranasal delivery of CD34+ cells and CD34+ cells for use in such methods.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to therapeutic methods including intranasal delivery of CD34+ cells and CD34+ cells for use in such methods. [Background technology]

[0002] CD34 is a cell surface marker used for the identification and isolation of hematopoietic stem / progenitor cells (HSPCs). CD34+ cells can be isolated from blood samples using immunomagnetic techniques. CD34+ cells can differentiate into all types of blood cells as well as endothelial cells.

[0003] CD34+ cells can be collected by leukocyte aspiration. Leukocyte aspiration involves drawing blood from the body, separating the white blood cells, and then returning the blood to the body. When collecting CD34+ cells using leukocyte aspiration, the subject is typically administered hematopoietic growth factors first. Alternatively, CD34+ cells can be grown from whole blood samples. An automated device (StemXpand®) has been developed that enables the proliferation of stem cells after granulocyte colony-stimulating factor (G-CSF) recruitment, and it has been shown that this yields at least the same number of CD34+ cells as collected during leukocyte aspiration (Saucourt et al., 2019). The characteristics of the proliferating cells (CD34+ cell count, purity / impurity profile, and viability) and safety (sterility, pyrogen content, and mycoplasma content) were evaluated, and the functionality of the proliferating cells (eCD34+) was demonstrated in in vivo preclinical trials in rats (Saucourt et al., 2019).

[0004] There are three distinct types of stroke: ischemic stroke, hemorrhagic stroke, and transient ischemic attack (TIA). Ischemic stroke is the most common and is caused by a blockage that cuts off the blood supply to the brain. Hemorrhagic stroke is caused by bleeding within the brain. TIA is a milder stroke with the same symptoms as ischemic stroke, but because the blockage of blood supply is temporary, it lasts only a short time. In ischemic stroke, the blood supply to a part of the brain is disrupted, preventing brain tissue from receiving oxygen and nutrients, and brain cells die within minutes. Damage to brain cells can affect motor and cognitive function. The effects of ischemic stroke depend on the location in the brain where it occurs and the size of the damaged area. Disruption of blood supply to the brain usually occurs when a blood clot blocks blood flow to the brain, or when blood flow to the brain is blocked due to vascular dysfunction. Such blood clots typically form in areas where arteries have narrowed or been blocked over time by fatty deposits known as plaque. There are two types of ischemic stroke: thrombotic stroke and embolic stroke. Thrombotic stroke is caused by a blood clot that forms in an artery supplying blood to the brain, while embolic stroke is caused by a blood clot that forms anywhere in the body and then travels through the bloodstream to the brain.

[0005] The use of CD34+ cells in the treatment of ischemic stroke is being investigated. These studies have examined intra-arterial (Banerjee S et al., 2014), intravenous (Nystedt J et al., 2006), intrathecal (Wang L et al., 2013), and intracerebral (Chen DC et al., 2014) administration routes. Problems associated with intra-arterial and intravenous administration routes include systemic exposure due to their failure to cross the blood-brain barrier, resulting in delivery of only a small percentage of cells to the brain. Intrathecal and intracerebral administration routes deliver cells directly to the periinfarct region, maximizing the probability of engraftment around the target lesion site. However, intrathecal and intracerebral routes are invasive and pose significant additional risks to the patient. Intracerebral routes, in particular, require complex stereotactic fusion surgery, which carries a risk of intracranial hemorrhage. Therefore, there is a need for improved stroke treatment. [Prior art documents]

Patent Documents

[0006]

Patent Document 1

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Summary of the Invention

[0008] The applicant demonstrated that intranasal administration of CD34+ cells results in rapid delivery of cells to the brain. Intranasal administration delivers cells to the brain and spinal cord along the olfactory and trigeminal pathways, including perineurial and perivascular channels, causing dispersed intracellular distribution of cells through the central nervous system. This is advantageous because the intranasal pathway is non-invasive and significantly reduces the risk to the patient compared to other administration routes. Furthermore, the applicant demonstrated that intranasal administration of CD34+ cells induced improvements in motor function and neurological function, reduced infarct size, cell loss, and inflammation, as well as increased angiogenesis and neurogenesis in ischemic stroke situations. Surprisingly, intranasal administration of CD34+ cells yielded similar improvements in motor function and neurological function, reduced infarct size, cell loss, and inflammation, as well as increased angiogenesis and neurogenesis, as with administration of CD34+ cells via intracerebral pathways. [Means for solving the problem]

[0009] Accordingly, the present invention provides a CD34+ cell population for use in a method for treating stroke, wherein the method comprises the step of intranasal administration of the CD34+ cell population.

[0010] Aspects of the present invention are: (a) A method for treating stroke, comprising intranasal administration of CD34+ cells targeting the stroke, wherein the CD34+ cells secrete paracrine factors into the stroke-affected area, and / or (b) A method for treating stroke, comprising administering CD34+ cells intranasally to treat the stroke by promoting angiogenesis in the stroke-affected area, and / or (c) A method for treating stroke, comprising intranasal administration of CD34+ cells targeting the neurogenesis of the CD34+ cells, and / or (d) Methods for stimulating angiogenesis in a subject, and / or (e) Methods for stimulating neurogenesis in a subject, and / or (f) A method for treating stroke, comprising administering CD34+ cells intranasally, wherein the CD34+ cells promote reduction of infarct size and / or reduce cell loss in the infarct area and / or periinfarct area and / or reduce inflammation in the infarct area and / or periinfarct area, and / or (g) A method for treating stroke, comprising intranasal administration of CD34+ cells, wherein the CD34+ cells promote motor and / or neurological recovery. Further provides a population of CD34+ cells for use in [the specified field].

[0011] CD34+ cells can be isolated from umbilical cord blood or whole blood.

[0012] CD34+ cells can be administered to patients within 1, 2, 3, or 4 days of stroke onset.

[0013] The method disclosed herein is at least 7 × 10 6 The procedure may include administering CD34+ cells.

[0014] CD34+ cells may express one or more paracrine factors and / or VEGF.

[0015] The amount of VEGF expressed by CD34+ cells in the culture medium may be at least approximately 150 pg / ml, or the amount of VEGF expressed by CD34+ cells in the culture medium may be at least approximately 4 pg / cell.

[0016] CD34+ cells may express one or more of the following miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR21, miR199a, miR590, miR133a, miR-24, miR29b, and miR132, or each of them individually.

[0017] The viability of CD34+ cells may be at least about 90%, and / or the purity of CD34+ cells may be at least about 75%.

[0018] CD34+ cells may be cultured and / or grown populations, and / or purified and / or isolated populations.

[0019] The CD34+ cell population is At least approximately 75% of CD34+ cells, and / or (ii) Monocytes of approximately 15% or less, and / or (iii) Granulocytes of approximately 5% or less, and / or (iv) Lymphocytes of approximately 3% or less It may include.

[0020] The number of cells administered per dose is approximately 7 × 10⁶ 6 It is possible.

[0021] The amount of cells administered per nostril may be approximately 1 ml, and / or the total amount administered per dose may be approximately 2 ml.

[0022] CD34+ cells may be provided as a sterile suspension, and / or populations may be provided in the form of a pharmaceutical composition, optionally containing a buffer.

[0023] CD34+ cells may increase the expression of double cortin DCX and / or VEGFR1. [Brief explanation of the drawing]

[0024] [Figure 1A]This figure shows behavioral tests. Behavioral tests are shown. (a) Motor activity revealed by the elevated body swing test (EBST) is shown. Middle cerebral artery occlusion (MCAO) rats transplanted with proliferating CD34+ cells (ProtheraCytes®) via intra-arterial / intravascular (IV), intracerebral (IC), and intranasal (IN) administration routes showed significantly lower asymmetry than corresponding solvent-controlled MCAO animals on days 7, 14, and 28 (****p<0.0001) (culture medium). [Figure 1B] This figure shows the behavioral tests. Behavioral tests are shown. (b) Motor activity revealed by cylinder tests is shown. MCAO rats implanted with ProtheraCytes® via IV, IC, and IN administration routes demonstrated significantly greater use of the affected forelimb compared to the corresponding solvent-control MCAO animals (*p<0.05, "p<0.01, ***p<0.001, ****p<0.0001). [Figure 1C] This figure shows the behavioral tests. The behavioral tests are shown. (c) Motor activity revealed by grip strength is shown. MCAO rats implanted with ProtheraCytes® via IV, IC, and IN administration routes showed significantly lower gripping ability of the affected foot compared to the corresponding solvent control MCAO animals (*p<0.05, "p<0.01, ***p<0.001, ****p<0.0001). [Figure 1D] This figure shows the behavioral tests. The behavioral tests are shown. (d) Motor activity revealed by the balance beam is shown. MCAO rats implanted with ProtheraCytes® via the IV, IC, and IN administration routes showed significantly better motor coordination during balance beam walking than the corresponding solvent control MCAO animals (****p<0.0001). [Figure 2]This figure shows the histological examination. It shows the quantitative measurement of the infarct area. The infarct area is shown by Nissl staining of coronary brain sections (black outline). MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes exhibited significantly smaller infarct areas than solvent-controlled MCAO animals (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). [Figure 3] This figure shows a quantitative analysis of cell survival in the periinfarct region. MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes showed significantly more viable cells in the periinfarct region compared to solvent-controlled MCAO animals (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Scale bar = 50 μm. [Figure 4] This figure shows the quantitative analysis of inflammation and cell engraftment. MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes showed reduced inflammation (Iba-1+ cells, black arrowheads) compared to solvent-control MCAO rats (***p<0.001). The survival and engraftment (white arrowheads) of ProtheraCytes® via IV, IC, and IN administration routes in transplanted MCAO rats were demonstrated compared to solvent-control MCAO rats in which ProtheraCytes® was not found (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Scale bar = 50 μm. [Figure 5]This figure shows the quantitative analysis of neurogenesis and cell engraftment. MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes showed significantly higher neurogenesis (double cortin DCX+ cells, black arrowheads) than solvent-controlled MCAO animals (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Engraftment of ProtheraCytes® (white arrowheads) was again demonstrated by all three administration routes (**p<0.01, ***p<0.001, ****p<0.0001). Scale bar = 50 μm. [Figure 6] This figure shows the quantitative analysis of angiogenesis and cell engraftment. In MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes, angiogenesis (vascular endothelial growth factor receptor 1 VEGFR1+ cells, black arrowheads) was increased compared to solvent-controlled MCAO rats (*p<0.05, *p<0.01, ***p<0.001, ****p<0.0001). Engraftment of ProtheraCytes® (white arrowheads) was again demonstrated by all three administration routes, and the increased angiogenesis was observed in close proximity to transplanted human cells, supporting the mechanism of action of CD34+ cells that promote angiogenesis by secreting paracrine factors, such as VEGF (***p<0.001, ****p<0.0001), scale bar = 50 μm. [Figure 7]This figure shows a quantitative analysis of exosome secretion. MCAO rats transplanted with ProtheraCytes® via IV, IC, and IN administration routes had significantly more extracellular vesicles (tetraspanin CD63+, black arrowheads) than solvent-controlled MCAO rats (***p<0.001, ****p<0.0001). Scale bar = 50 μm. This important finding demonstrates that ProtheraCytes® secretes extracellular vesicles in vivo and supports in vitro results showing that CD34+ cells secrete exosomes containing pro-angiogenic and anti-apoptotic miRNAs. This provides further evidence for the mechanism of action of ProtheraCytes®, showing that such cells also promote neurogenesis and angiogenesis by secreting CD63-positive extracellular vesicles. No signs of toxicity or tumors were observed in any of the transplanted animals. [Figure 8A] This figure shows VEGF as an efficacy test. It shows the concentration of vascular endothelial growth factor (VEGF) in the cell culture supernatant 9 days after proliferation of CD34+ cells derived from 4 healthy donors and 16 patients with acute myocardial infarction (EXCELLENT test). No significant difference was observed when comparing VEGF concentrations between patients and healthy donors, but significant differences were observed between patients and the solvent control (StemFeed®) (p=0.0007) and between healthy donors and StemFeed® (p=0.0087). When VEGF concentration was normalized by the number of CD34+ cells, no significant difference was observed between secreted VEGF per cell in healthy donors (4.1 fg / cell) and in AMI patients (4.4 fg / cell) (p=0.6343). [Figure 8B]This figure shows VEGF as an efficacy test. It shows the concentration of vascular endothelial growth factor (VEGF) in the cell culture supernatant 9 days after proliferation of CD34+ cells derived from 4 healthy donors and 16 patients with acute myocardial infarction (EXCELLENT test). No significant difference was observed when comparing VEGF concentrations between patients and healthy donors, but significant differences were observed between patients and the solvent control (StemFeed®) (p=0.0007) and between healthy donors and StemFeed® (p=0.0087). When VEGF concentration was normalized by the number of CD34+ cells, no significant difference was observed between secreted VEGF per cell in healthy donors (4.1 fg / cell) and in AMI patients (4.4 fg / cell) (p=0.6343). [Figure 8C] This figure shows VEGF as an efficacy test. It shows the concentration of vascular endothelial growth factor (VEGF) in the cell culture supernatant 9 days after proliferation of CD34+ cells derived from 4 healthy donors and 16 patients with acute myocardial infarction (EXCELLENT test). No significant difference was observed when comparing VEGF concentrations between patients and healthy donors, but significant differences were observed between patients and the solvent control (StemFeed®) (p=0.0007) and between healthy donors and StemFeed® (p=0.0087). When VEGF concentration was normalized by the number of CD34+ cells, no significant difference was observed between secreted VEGF per cell in healthy donors (4.1 fg / cell) and in AMI patients (4.4 fg / cell) (p=0.6343). [Figure 8D] This figure shows the VEGF concentration and CD34+ cell count after proliferation. A significant correlation is observed between the VEGF concentration and the number of CD34+ cells after proliferation (Pearson correlation coefficient = 0.7484, p-value = 0.0009). [Figure 8E] This figure shows the VEGF concentration and CD34+ cell count after proliferation. A significant correlation is observed between the VEGF concentration and the number of CD34+ cells after proliferation (Pearson correlation coefficient = 0.7484, p-value = 0.0009). [Figure 8F]This figure shows an in vitro tubulation assay. Tube formation was significantly higher in HUVEC cultured with ProtheraCytes® supernatant than in HUVEC cultured with a solvent control (StemFeed®) (t-test, p=0.0082). The figure shows a representative bright-field image of tubulation. Scale bar = 20 μm. [Figure 9A] This figure shows the characterization of exosomes derived from ProtheraCytes®. (A) The average size of exosomes derived from ProtheraCytes® was determined to be 86.7 ± 10.17 nm. [Figure 9B] This figure shows the characterization of exosomes derived from ProtheraCytes®. (B) The number of exosomes secreted by Protheracytes® increased over time from approximately 6,000 extracellular vesicles / cell in 30 minutes to 16,000 extracellular vesicles / cell in 2 hours. [Figure 9C] This figure shows the characterization of exosomes derived from ProtheraCytes®. (C) Exosomes derived from ProtheraCytes® express the unique exosome markers CD63, CD81, and CD9, as well as endothelial cell markers (CD49e, CD44) and stem cell marker (CD133). [Figure 10A] This figure shows the relative expression of pro-angiogenic, anti-apoptotic, anti-fibrotic, and cardiac miRNAs by ProtheraCytes® and the exosomes they secrete. (A) Total RNA from ProtheraCytes® (cells) and their exosomes (exosomes) collected from AMI patients (n=7) was subjected to real-time PCR and normalized to small RNA (let-7a). The miRNA expression of exosomes secreted from ProtheraCytes® was significantly higher than that of ProtheraCytes® (Mann-Whitney test). [Figure 10B]This figure shows the relative expression of pro-angiogenic, anti-apoptotic, anti-fibrotic, and cardiac miRNAs by ProtheraCytes® and the exosomes they secrete. (B) This shows a comparison of changes in exosome-versus-cell expression ratios by indicator miRNAs collected from AMI patients (n=7). [Modes for carrying out the invention]

[0025] definition CD34+ cells include hematopoietic stem / progenitor cells (HSPCs) and endothelial progenitor cells (EPCs). HSPCs can differentiate into any blood cell type, and EPCs can differentiate into endothelial cells. CD34+ cells can be recruited from bone marrow into peripheral blood by administration of granulocyte colony-stimulated growth factor (G-CSF). CD34+ cells can also be obtained from umbilical cord blood. Total CD34+ cells represent approximately 0.5-1% of all bone marrow-derived mononuclear cells. CD34+ cells are grown by suspension culture.

[0026] VEGF (vascular endothelial growth factor) is a potent pro-angiogenic growth factor known to stimulate the formation of new blood vessels.

[0027] "ProtheraCytes®" is a trademark of the applicant for isolated CD34+ cells for use in therapeutic applications. ProtheraCytes® are human autologous CD34+ cells grown according to a GMP automated manufacturing process designed for large-scale clinical production. ProtheraCytes® is registered as ATMP - Advanced Therapeutic Drug - in the classification of tissue-modified formulations by the European Medicines Agency. The process for producing ProtheraCytes® is presented in Example 1.

[0028] "StemXpand®" is a trademark for an incubator system for the automated proliferation of cells, such as CD34+ cells. The StemXpand® system is described in U.S. Patent No. 10676705B2.

[0029] "StemPack" is a trademark for a disposable cell culture kit used for the proliferation of ProtheraCytes® in the StemXpand® system.

[0030] "StemFeed®" is a trademark for the company's proprietary culture medium for growing CD34+ cells, which contains a mixture of IMDM basic medium, human plasma, and cytokines.

[0031] MicroRNAs (miRNAs) are small, non-coding RNAs that influence gene expression.

[0032] Methods of treating stroke The present specification provides a CD34+ cell population for use in a method for treating stroke, wherein the method comprises the step of intranasal administration of the CD34+ cell population.

[0033] In some embodiments, the stroke treated by the method disclosed herein is an ischemic stroke or a transient ischemic attack. In some embodiments, the stroke treated by the method disclosed herein is an ischemic stroke.

[0034] The ischemic stroke treated by the methods disclosed herein may be a thrombotic stroke and / or an embolic stroke.

[0035] Furthermore, this specification provides a method for treating stroke, which includes the step of intranasal administration to a CD34+ cell population described herein.

[0036] As discussed in any part of this specification, CD34+ cells can be obtained from subjects being treated for stroke. That is, treatment may include autologous transplantation of CD34+ cells.

[0037] Preferably, CD34+ cells can be obtained from a source other than the target of treatment, such as umbilical cord blood or human pluripotent stem cells. That is, treatment may include allogeneic transplantation of CD34+ cells. CD34+ cells obtained from umbilical cord blood (or other allogeneic sources) can be cryopreserved and stored, for example, in a clinic, for rapid treatment of future targets. Therefore, allogeneic CD34+ cell transplantation is advantageous because it allows for faster administration of cells after stroke than the use of autologous CD34+ cells.

[0038] CD34+ cell populations may be used in methods for treating stroke in which CD34+ cells increase the expression of doublecortin (DCX). Doublecortin is required for the normal migration of neurons to the cerebral cortex (Gleeson et al.). CD34+ cell populations may be administered intranasally. Doublecortin (DCX) expression may increase in the brain. DCX expression may increase in the infarcted area and / or periinfarcted area.

[0039] Furthermore, a population of CD34+ cells is provided for use in a method of treating stroke, in which CD34+ cells are administered intranasally to treat stroke by secreting paracrine factors into the stroke-affected area. The paracrine factors may include one or more pro-angiogenic miRNAs (e.g., miRNA 126, 130a, 378, and / or 26a), anti-apoptotic miRNAs (e.g., miRNA 21 and / or 146a), anti-fibrotic miRNAs (133a, 24, 29b, 132), and growth factors, e.g., VEGF. The paracrine factors may be secreted into the brain by the CD34+ cell population. The paracrine factors may be secreted into exosomes.

[0040] Furthermore, a CD34+ cell population for use in a method of treating stroke is provided, which involves intranasal administration of CD34+ cells, thereby treating stroke by promoting angiogenesis in the stroke-affected area. Angiogenesis may be stimulated in the brain. Angiogenesis may be stimulated in the infarcted area and / or the periinfarcted area.

[0041] Furthermore, a population of CD34+ cells is provided for use in a method for stimulating angiogenesis in a subject. The method may include the step of intranasal administration of CD34+ cells to the subject. CD34+ cells may be administered to a subject requiring treatment for stroke. Angiogenesis may be stimulated in the brain. Angiogenesis may be stimulated in the infarcted area and / or periinfarcted area.

[0042] Furthermore, a CD34+ cell population is provided for use in a method of treating stroke, in which CD34+ cells are administered intranasally to the target population, and the CD34+ cells promote neurogenesis. The promotion of neurogenesis may correlate with the upregulation of double cortin (DCX). Neuronalogenesis may be promoted in the brain. Neuronalogenesis may be promoted in the infarcted area and / or the periinfarcted area.

[0043] Furthermore, a population of CD34+ cells is provided for use in a method for promoting neurogenesis in subjects. The method may include the step of intranasal administration of CD34+ cells to the subject. Promotion of neurogenesis may correlate with upregulation of double cortin (DCX). Neuronalogenesis may be promoted in the brain. Neuronalogenesis may be promoted in the infarcted area and / or periinfarcted area.

[0044] Furthermore, the present invention provides a population of CD34+ cells for use in a method of treating stroke, in which CD34+ cells are administered intranasally, and the CD34+ cells promote reduction of infarct size and / or reduce cell loss in the infarct area and / or periinfarct area and / or reduce inflammation in the infarct area and / or periinfarct area.

[0045] Furthermore, the present invention provides a population of CD34+ cells for use in a method of treating stroke, wherein CD34+ cells are administered intranasally to target the stroke, and the CD34+ cells treat the stroke by promoting motor and / or neurological recovery.

[0046] Any of the treatments disclosed herein may achieve one or more of the following: - Reduction in infarct injury - Reduction in cell loss in the infarcted area and / or periinfarcted area - Reduction in the presence of inflammatory cells in the ischemic area of ​​the target. - Reduction of inflammation in the infarcted area and / or periinfarcted area - Promotion of neurogenesis in the target population. Neuronal regeneration may correlate with upregulation of double cortin (DCX). - Promotion of angiogenesis in the subject. Angiogenesis may be promoted by the secretion of paracrine factors, such as VEGF and / or exosomes and / or any miRNAs disclosed herein. Angiogenesis may also correlate with the upregulation of vascular endothelial growth factor receptor 1 (VEGFR-1). - Reduction of functional impairments in motor, cognitive, language, visual, olfactory, somatosensory, behavioral, memory, and any combination thereof, or acceleration of recovery from stroke-induced lesions.

[0047] CD34+ cells may secrete extracellular vesicles (exosomes) that may contain the paracrine factors described herein, for example, into the brain. These vesicles may be CD63+ extracellular vesicles / exosomes.

[0048] When using autologous CD34+ cells, any of the methods disclosed herein may include one or more of the following steps: - A process for administering hematopoietic growth factors, such as G-CSF. - The process of collecting peripheral blood samples from the subject, - A step of isolating and / or growing CD34+ cells from a blood sample to obtain a CD34+ cell population, and / or - A process of administering the drug to CD34+ cells.

[0049] The CD34+ cell population for use in the present invention may be an isolated and / or purified and / or cultured and / or grown CD34+ cell population (eCD34+).

[0050] CD34+ cells may be administered to the subject within 3 hours, 6 hours, 12 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days after the onset of stroke. Preferably, CD34+ cells may be administered to the subject within 3 days or 4 days after the onset of stroke.

[0051] patient group The CD34+ cell population for use in the methods disclosed herein is administered to a subject. The subject may be in a condition requiring treatment for stroke. The subject may be a mammalian subject, such as a human, horse, dog, or cat. The subject may be a human.

[0052] Isolation of CD34+ cells CD34+ cells may be autologous or allogeneic CD34+ cells. Preferably, the CD34+ cells are allogeneic CD34+ cells obtained from umbilical cord blood.

[0053] After signing informed consent, fresh or frozen umbilical cord blood samples can be obtained from the umbilical cord blood bank.

[0054] After granulocyte colony-stimulating factor (G-CSF) recruitment, a whole blood sample can be obtained. The whole blood sample can then be subjected to erythrocyte sedimentation.

[0055] Blood samples can be used for whole-nucleus cell isolation. Whole-nucleus cell isolation can be performed according to the gelatin method or an alternative method using centrifugation without gelatin. In the gelatin method, the blood sample is mixed with a gelatin solution and suspended for a certain period to facilitate erythrocyte sedimentation. The erythrocytes remaining in the precipitate can be mixed with gelatin and suspended for a second period. After sedimentation, the supernatant can be centrifuged to precipitate whole-nucleus cells. After centrifugation, CD34+ cells can be purified by immunoselection. Immunoselection can be performed by any known method, for example, using the CliniMACS system (magnetically activated cell sorting).

[0056] In the present invention, when allogeneic CD34+ cells are used, the cells may be genetically modified to reduce, minimize, or avoid host rejection. For example, cells may be modified with techniques and tools known in the art, such as CRISPR-based systems, TALENs, or ZFNs, to inhibit the expression of proteins involved in transplant rejection, such as HLA / MHC and related proteins. CD34+ cells may be genetically modified to express genes that promote neurogenesis and / or angiogenesis.

[0057] In the present invention, when allogeneic CD34+ cells are used, further therapeutic substances may be administered in combination with the CD34+ cells. For example, CD34+ cells may be administered together with an immunosuppressant, such as cyclosporine A.

[0058] Culture or proliferation of CD34+ cells Purified CD34+ cells can be cultured and / or grown. CD34+ cells can be cultured and / or grown for 5 to 12 days. CD34+ cells can be cultured and / or grown for 5, 6, 7, 8, 9, 10, 11, or 12 days. CD34+ cells can be cultured and / or grown for 8 to 9 days. CD34+ cells can be cultured and / or grown at 37°C. CD34+ cells can be cultured and / or grown under a controlled atmosphere of 5% CO2. CD34+ cells can be cultured and / or grown in culture media containing various concentrations of cytokines, e.g., interleukin-6 (IL-6), interleukin-3 (IL-3), stem cell factors, thrombopoietin, and Fms-like tyrosine kinase 3 ligand. Cells can be cultured and / or grown at any suitable concentration, e.g., 2.5 × 10⁻⁶. 5 It can be cultured at a cell / mL concentration.

[0059] The present invention can be carried out using human autologous or allogeneic CD34+ cells, such as ProtheraCytes®, grown according to a GMP automated manufacturing process designed for large-scale clinical production.

[0060] CD34+ cells for use in the present invention may be cultured and / or grown cell populations. Cultured or grown CD34+ cell populations may be produced by the methods disclosed herein.

[0061] Further processing steps After culturing or growing CD34+ cells as described above, the CD34+ cells can be subjected to further processing steps, such as purification and / or immunoselection.

[0062] CD34+ cells can be immunoselected, for example, using magnetically activated cell sorting. The immunoselected CD34+ cells can then be resuspended in a buffer, for example, 15 mL. The buffer may contain albumin and / or saline and / or PBS. The buffer may contain or consist of 2%, 3%, 4%, or 5% albumin in saline. In one embodiment, the buffer is 4% albumin in saline. The buffer may be phosphate-buffered saline (PBS) / 2' / 0 human serum albumin (HSA). The cells can be resuspended in 1–15 mL of PBS / 2' / 0 HAS. The cell suspension can be conditioned in a 4–5 mL syringe. A CD34+ cell population for use according to the present invention can be provided as a cell population suspended in a buffer. A CD34+ cell population for use according to the present invention can be provided, for example, as a suspension in PBS / 2' / 0 human serum albumin.

[0063] This process may be for the purpose of forming a formulation suitable for use in the present invention. For example, ProtheraCytes® is CD34+ cells processed to form a formulation suitable for use in therapeutic methods. ProtheraCytes® is registered as an ATMP (Advanced Therapeutic Drug) in the classification of tissue-modified formulations by the European Medicines Agency. The process for producing ProtheraCytes® is presented in Example 1.

[0064] CD34+ cells can be cryopreserved using a cryoprotective agent or solution, such as CryoStor CS10, by a rate-controlled freezing process (1°C / min). The cells to be cryopreserved can be centrifuged to obtain a cell precipitate. The supernatant is then removed, and cold (2–8°C) CryoStor medium is added to the cell precipitate, followed by 0.5–10 × 10⁶ cells. 6 Cell concentrations in the range of cells / ml may be obtained. The cell suspension can then be incubated at 2-8°C for 10 minutes. The sample temperature can then be reduced to -80°C using a rate-controlled freezer (-1°C / min), and then transferred to liquid nitrogen temperature (below -130°C).

[0065] Alternatively, cells can be frozen using a stepwise freezing procedure. An example of a stepwise freezing procedure is as follows: 2 hours at -20°C followed by 2 hours at -80°C, or 3-4 hours at -80°C in an isopropanol freezing container. The isopropanol container may be pre-cooled to 2-8°C. Mechanical agitation (flick or tap) of the sample container may be performed at -80°C after 15-20 minutes. The sample should be maintained at -80°C for at least 10 hours. Finally, the sample can be stored at liquid nitrogen temperature (below -130°C).

[0066] CD34+ cell population for use in the present invention The CD34+ cell population for use in this invention can be isolated from a blood sample. The blood sample may be an umbilical cord blood sample or a whole blood sample. Preferably, the blood sample is an umbilical cord blood sample. The CD34+ cell population isolated from the blood sample may be called an "isolated CD34+ cell population".

[0067] The CD34+ cell population for use in the present invention may be a cultured and / or grown and / or purified CD34+ cell population. Methods for culturing, growing, and purifying CD34+ cells are disclosed herein.

[0068] A CD34+ cell population for use in the present invention may have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% CD34+ cell viability. In a preferred embodiment, a CD34+ cell population for use in the method of the present invention has at least about 90% CD34+ cell viability.

[0069] The CD34+ cell population for use in the present invention may have a CD34+ cell purity of at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In a preferred embodiment, the CD34+ cell population for use in the method of the present invention has a CD34+ cell purity of at least about 75%.

[0070] The CD34+ cell population for use in the present invention may contain about 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, or 1% or less of monocytes. In a preferred embodiment, the CD34+ cell population for use in the method of the present invention contains about 15% or less of monocytes.

[0071] The CD34+ cell population for use in the present invention may contain about 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, or 1% or less of granulocytes. In a preferred embodiment, the CD34+ cell population for use in the present invention contains about 5% or less of granulocytes.

[0072] The CD34+ cell population for use in the present invention may contain about 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 3%, 2%, or 1% or less of lymphocytes. In a preferred embodiment, the CD34+ cell population for use in the present invention contains about 3% or less of lymphocytes.

[0073] The CD34+ cell population for use in this invention is at least about 2 × 10⁶ 6 CD34+ cells, at least approximately 3 × 10⁶ 6 CD34+ cells, at least approximately 4 × 10⁶ 6 CD34+ cells, at least approximately 5 × 10⁶6 CD34+ cells of the cells, at least about 6×10 6 CD34+ cells of the cells, at least about 7×10 6 CD34+ cells of the cells, at least about 8×10 6 CD34+ cells of the cells, at least about 9×10 6 CD34+ cells of the cells or at least about 10×10 6 may contain CD34+ cells of the cells. Preferably, the CD34+ cell population for use in the present invention is at least about 7×10 6 contains CD34+ cells of the cells.

[0074] The CD34+ cell population for use in the present invention is about 2×10 6 CD34+ cells of the cells, about 3×10 6 CD34+ cells of the cells, about 4×10 6 CD34+ cells of the cells, about 5×10 6 CD34+ cells of the cells, about 6×10 6 CD34+ cells of the cells, about 7×10 6 CD34+ cells of the cells, at least about 8×10 6 CD34+ cells of the cells, about 9×10 6 CD34+ cells of the cells or about 10×10 6 may contain CD34+ cells of the cells. Preferably, the CD34+ cell population for use in the present invention is about 7×10 6 contains CD34+ cells of the cells.

[0075] In certain embodiments, the CD34+ cell population for use in the present invention has one or more or all of the following characteristics. (i) at least about 75% CD34+ cells, and / or (ii) about 15% or less monocytes, and / or (iii) about 5% or less granulocytes, and / or (iv) about 3% or less lymphocytes

[0076] In certain embodiments, the CD34+ cell population for use in the present invention has one or more of the following characteristics. (a) about 7×106 CD34+ cells, (b) at least approximately 90% CD34+ cell viability, (c) CD34+ cell purity of at least approximately 75%, (d) Approximately 15% or less of monocytes, (e) Granulocytes of approximately 5% or less, and (f) Lymphocytes of approximately 3% or less

[0077] In one embodiment, the CD34+ cell population for use in the present invention has all of the features (a) to (f) listed above.

[0078] The viability and purity of CD34+ cells can be determined by any suitable method known in the art. For example, cell viability and purity can be determined by flow cytometry. Kits capable of reliable counting of CD34+ stem cells are commercially available, such as the BD® Stem Cell Enumeration Kit (BD Biosciences). Cell counting can be performed at any stage of the manufacturing process, for example, against WB, before the first round of immunoselection, before proliferation, before the second round of immunoselection, at the end of the process as an in-process control, or in any combination thereof. Cell counting can be performed using the Stem Cell Enumeration Kit and the Stem Cell Control Kit (both from BD Biosciences, San Jose, CA) and analyzed using a fluorescence-activated cell sorting (FACS) Canto II analyzer (BD Biosciences) and FACS DIVA software according to the manufacturer's instructions and ISHAGE guidelines (Gratama et al.). The proportion of immature CD34+ cells can be determined by analyzing the co-expression of CD133+ as described by Saucourt et al. The proportion of cellular impurities can be determined as described by Saucourt et al.

[0079] Expression characteristics of CD34+ cell populations CD34+ cell populations for use in the present invention may express amounts of VEGF in the culture medium that exhibit the biological and / or therapeutic activity or efficacy described below. CD34+ cells for use in the method of the present invention may express miRNAs that exhibit the biological and / or therapeutic activity described below. CD34+ cells for use in the method of the present invention may express amounts of VEGF in the culture medium that exhibit the biological and / or therapeutic activity or efficacy, as well as miRNAs that exhibit biological and / or therapeutic activity, as described below.

[0080] The CD34+ cell population for use in this invention may express CD44.

[0081] Determination of VEGF expression The CD34+ cell population of the present invention can be quantified to determine the VEGF expression level. The amount of VEGF expressed by the CD34+ cell population can be determined by any known means, such as Western blotting, enzyme-linked immunosorbent assay (ELISA), fluorescence-linked immunosorbent assay (FLISA), competitive assay, radioimmunoassay, lateral flow immunoassay, flow-through immunoassay, electrochemiluminescence assay, nephelometry-based assay, turbidimetry-based assay, or fluorescence-activated cell sorting (FACS)-based assay. The amount of VEGF can be determined by mass spectrometry. The amount of VEGF can be determined by radioimmunoassay. Preferably, the amount of VEGF can be determined by ELISA. For example, determining the amount of VEGF expressed by the CD34+ cell population may include one or more of the following: - Steps to collect supernatant from CD34+ cell cultures - Process of selecting the supernatant - A process of measuring VEGF using an ELISA kit, such as the QuantiGlo ELISA Kit (R&D Systems, MN, USA), according to the manufacturer's instructions, and using, for example, SpectraMax L (Molecular Devices, San Jose, CA, USA).

[0082] A negative control, such as a culture medium, such as StemFeed® medium, may be used. A positive control, such as Immunoassay Control Set 732 for Human VEGF (R&D Systems), may be used. The amount of VEGF expressed by a CD34+ cell population can be determined by measuring the concentration of VEGF released by the cells into the cell culture medium. The amount of VEGF expressed by a CD34+ cell population can also be determined by measuring the concentration of VEGF contained in CD34+ cell-derived exosomes. The CD34+ cell culture or a portion thereof can be centrifuged to determine the concentration of VEGF present in the supernatant. For example, approximately 50 mL of supernatant can be obtained and frozen in small, fixed volumes. Typically, 50 μL of sample per well may be used in an ELISA assay.

[0083] VEGF expression in CD34+ cells CD34+ cell populations for use in the methods of the present invention may express amounts of VEGF in the culture medium that exhibit biological and / or therapeutic activity or efficacy. For example, CD34+ cells for use in the methods of the present invention may express amounts of VEGF of about 1, 5, 10, 20, 25, 50, 75, 100, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 pg / ml in the culture medium or the supernatant of the CD34+ cell culture. CD34+ cells for use in the methods of the present invention may express amounts of VEGF of at least 25 pg / ml in the culture medium or the supernatant of the CD34+ cell culture. CD34+ cells for use in the methods of the present invention may express amounts of VEGF of at least 50 pg / ml in the culture medium or the supernatant of the CD34+ cell culture. CD34+ cells for use in the method of the present invention may express at least 150 pg / ml of VEGF in the culture medium or the supernatant of the CD34+ cell culture. When measuring the concentration of VEGF contained in CD34+ cell-derived exosomes, CD34+ cells may express any threshold of VEGF disclosed herein in their exosomes.

[0084] The amount of VEGF expressed by a CD34+ cell population can be determined by measuring the amount of expressed VEGF per cell. The amount of VEGF present in the supernatant can be determined by centrifugation of the CD34+ cell culture or a portion thereof. The number of CD34+ cells may be counted by any known method, for example, flow cytometry, and the amount of VEGF can be expressed as an amount per cell. CD34+ cells for use in this invention contain at least about 4 fg (fg = femtogram 10⁻¹⁰) per cell. -15 g) The cells may express at least about 10 fg, at least about 15 fg, at least about 20 fg, at least about 25 fg, or at least about 30 fg of VEGF. CD34+ cells for use in the present invention may express at least about 4 fg of VEGF per cell.

[0085] Detection of miRNA expression The CD34+ cell population of the present invention can be quantified to determine miRNA expression. miRNA expression in the CD34+ cell population can be detected by measuring miRNA expression in CD34+ cells and / or CD34+ cell-derived exosomes. miRNA can be isolated and measured from exosomes and / or cells.

[0086] Exosomes can be purified by centrifugation of CD34+ cells to remove cells and cellular debris. The resulting supernatant can then be centrifuged again to precipitate the exosomes. For example, 50 mL of culture supernatant may be collected, or it may be frozen into small, fixed volumes. Using a small amount of sample, for example 200 μL, miRNA can be extracted from the exosomes. Then, miRNA can be extracted from the exosomes by any known method, for example, using a commercially available miRNA extraction kit. miRNA can be extracted from CD34+ cells by any known method, for example, using a commercially available miRNA extraction kit. An example of a commercially available miRNA extraction kit is the Qiagen® miRNeasy® kit.

[0087] miRNAs can be detected and / or quantified by any known method. For example, miRNAs can be detected and quantified by quantitative real-time PCR (RT-qPCR), digital PCR, microarrays, and / or high-throughput small RNA sequencing. An example of a commercially available kit for miRNA detection and quantification is the Qiagen® miRCURY LNA miRNA PCR kit. Suitable primers available from Qiagen® include YP00204230 (miR-21-5p), YP00206023 (miR-26a-5p), YP00204227 (miR-126-3p), YP002046658 (miR-130a-3p), YP00204788 (miR-133a-3p), YP00204688 (miR146a-5p), YP00204536 (miR-199a-3p), YP00205946 (miR-378a-3p), and YP00205448 (miR-590-3p). qPCR data can be normalized to the miR-let7a-5p (YP00205727) value. Relative miRNA expression is 2 -'8"8.ct It can be calculated using the method.

[0088] The miRNAs disclosed herein can be detected, for example, by detecting 3p miRNA strands and / or 5p miRNA strands. For example, the miRNAs disclosed herein can be detected by any of the following strands: miR126-3p UCGUACCGUGAGUAAUAAUGCG (Sequence ID 1) miR126-5p CAUUAUUACUUUUGGUACGCG (Sequence ID 10) miR130a-3p CAGUGCAAUGUUAAAAGGGCAU (Sequence ID 2) miR130a-5p GCUCUUUUCACAUUGUGCUACU (Sequence ID 11) miR21-3p CAACACCAGUCGAUGGGCUGU (Sequence ID 16) miR21-5p UAGCUUAUCAGACUGAUGUUGA (Sequence ID 3) miR26a-3p CCUAUUCUUGGUUACUUGCACG (Sequence ID 17) miR26a-5p UUCAAGUAAUCCAGGAUAGGCU (Sequence ID 4) miR378a-3p ACUGGACUUGGAGUCAGAAGGC (Sequence ID 5) miR378a-5p CCUCCUGACUCCAGGUCCUGUGU (Sequence ID 12) miR146a-3p CCUCUGAAAUUCAGUUCUUCAG (Sequence ID 18) miR146a-5p UGAGAACUGAAUUCCAUGGGUU (Sequence ID 6) miR199a-3p ACAGUAGUCUGCACAUUGGUUA (Sequence ID 7) miR199a-5p CCCAGUGUUCAGACUACCUGUUC (Sequence ID 13) miR590-3p UAAUUUUAUGUAUAAGCUAGU (Sequence ID 8) miR590-5p GAGCUUAUUCAUAAAAGUGCAG (Sequence ID 14) miR133a-3p UUUGGUCCCCUUCAACCAGCUG (Sequence ID 9) miR133a-5p AGCUGGUAAAAUGGAACCAAAU (Sequence ID 15) miR24-1-5p UGCCUACUGAGCUGAUAUCAGU (Sequence ID 19) miR24-2-5p UGCCUACUGAGCUGAAACACAG (Sequence ID 20) miR24-3p UGGCUCAGUUCAGCAGGAACAG (Sequence ID 21) miR132-5p ACCGUGGCUUUCGAUUGUUACU (Sequence ID 22) miR132-3p UAACAGUCUACAGCCAUGGUCG (Sequence ID 23) miR29b-1-5p GCUGGUUUCAUAUGGUGGUUUAGA (Sequence ID 24) miR29b-2-5p CUGGUUUCACAUGGUGGCUUAG (Sequence ID 25) miR29b-3p UAGCACCAUUUGAAAUCAGUGUU (Sequence ID 26)

[0089] miRNA expression of CD34+ cells for use in the method of the present invention CD34+ cell populations for use in the methods of the present invention may express miRNAs that exhibit biological and / or therapeutic activity or efficacy. For example, CD34+ cell populations for use in the methods of the present invention may express one or more of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, miR133a, miR-24, miR29b, and miR132, or each of them.

[0090] The CD34+ cell population for use in the present invention may express one or more of miR126, miR130a, miR21, miR26a, and miR378a, or each of them.

[0091] A CD34+ cell population for use in the present invention may express one or more of miR21, miR26a, and miR378a, or each of them. A CD34+ cell population for use in the present invention may express miR146a and / or miR21. A CD34+ cell population for use in the present invention may express miR199a and / or miR590. A CD34+ cell population for use in the present invention may express miR133a. miRNAs may be expressed in cells and / or exosomes. CD34+ cells for use in the present invention may secrete exosomes containing one or more (e.g., all) of the miRNAs disclosed herein.

[0092] Delivery, dosage, and administration plan CD34+ cell populations for use in the present invention may be provided as a sterile suspension of cells. The sterile suspension is preferably aqueous. The sterile suspension is preferably isotonic. The sterile suspension may further comprise a pharmaceutically acceptable carrier, diluent, or wetting agent. CD34+ cell populations may be provided as a pharmaceutical composition comprising one or more further substances, e.g., a pharmaceutically acceptable carrier, buffer, diluent, or wetting agent. Pharmaceutical compositions disclosed herein may comprise a CD34+ cell population and a buffer. The buffer may comprise albumin and / or saline and / or PBS. The buffer may comprise or consist of 2%, 3%, 4%, or 5% albumin in saline. In one embodiment, the buffer is 4% albumin in saline. The buffer may be phosphate-buffered saline (PBS) / 2' / 0 human serum albumin (HSA). CD34+ cell populations for use according to the present invention may be provided as cell populations suspended in a buffer. The CD34+ cell population for use in the present invention may be provided, for example, as a suspension in PBS / 2) / 0 human serum albumin.

[0093] The CD34+ cell population for use in this invention is administered intranasally to the subject.

[0094] For example, the administration protocol may include one or more of the following steps, for example, all of them. 1. Remove the vial containing the CD34+ cells from the liquid nitrogen storage and place it on ice. 2. Next, thaw the vial in a 37°C hot water bath. 3. Once the tube is almost completely thawed (small chunks of ice are visible), disinfect the tube and transfer it to a biosafety cabinet (BSC). 4. Transfer the cell suspension to a 50 mL tube. 5. Add 20 mL of RPMI to the tube and centrifuge at room temperature for 5 minutes using 400 g. 6. After centrifugation, carefully discard the supernatant under BSC (Best Steady Core) conditions. 7. Next, resuspend the cell precipitate in injection buffer (PBS or an alternative containing 2% HSA). 8. Draw up the cell suspension with a syringe and connect the syringe to a nasal delivery nozzle or catheter. 9. Optionally, spray a hyaluronidase solution into the inside of the nostrils approximately 30 minutes before cell administration. 10. Spray (using a nozzle) or inject (using a catheter) 1-2 mL of cell suspension into each nostril of a patient who is at rest in a supine position. 11. After cell administration, the patient should remain in a supine position for 10 minutes.

[0095] The number of CD34+ cells administered per dose is approximately 1 × 10⁶ 6 , about 2×10 6 , about 3×10 6 , about 4×10 6 , about 5×10 6 , about 6×10 6 , about 7×10 6 , about 8×10 6 Approximately 9x10 6 Or approximately 10 x 10 6 These may be cells. Preferably, the number of administered CD34+ cells per dose is approximately 7 × 10⁶ 6 These are cells. The cells can be counted by any suitable method, such as flow cytometry. Kits that enable reliable counting of CD34+ stem cells are commercially available, such as the BD® Stem Cell Enumeration Kit (BD Biosciences).

[0096] The number of CD34+ cells administered per dose is at least approximately 1 × 10⁶ 6 , at least about 2 × 10 6 , at least about 3 × 10 6 , at least about 4 × 10 6 , at least about 5 × 10 6 , at least about 6 × 10 6 , at least about 7 × 10 6 , at least about 8 × 10 6 , at least about 9 x 10 6 , at least about 10 x 10 6 These may be cells. Preferably, the number of administered CD34+ cells per dose is at least about 7 × 10⁶ 6 It is a cell.

[0097] CD34+ cells are administered intranasally. The administration of CD34+ cells may involve administering the CD34+ cells into one or both nostrils. The dose per nostril may be about 0.1 ml, about 0.2 ml, about 0.4 ml, about 0.5 ml, about 0.75 ml, about 1 ml, about 2 ml, about 3 ml, about 4 ml, about 5 ml, about 10 ml, or about 15 ml. In a preferred embodiment, the dose per nostril is about 1 ml.

[0098] Therefore, the total volume of CD34+ cells administered per dose may be 0.2 ml, approximately 0.4 ml, approximately 0.8 ml, approximately 1 ml, approximately 1.5 ml, approximately 2 ml, approximately 4 ml, approximately 6 ml, approximately 8 ml, approximately 10 ml, approximately 20 ml, or approximately 30 ml.

[0099] The drug may be administered to isolated CD34+ cells in single or multiple doses. For example, it may be administered to isolated CD34+ cells in single, double, triple, quadruple, or quintuple doses. In a preferred embodiment, it is administered to isolated CD34+ cells in single doses. Sequential doses may be divided at least once a month, for example, every one, two, three, four, five, or six months or more.

[0100] Embedding by reference All documents referenced herein are incorporated herein by reference to the maximum extent permitted by law. [Examples]

[0101] (Example 1) Obtaining CD34+ cells Patient samples, healthy donors, and cell generation centers AMI patients and healthy male volunteers were enrolled in this study after approval by the French regulatory authority, the National Agency for the Safety of Medicines and Health Products, and local ethics committees. All participants signed informed consent. Each participant initially received subcutaneous (sc) administration of 10 μg / kg of G-CSF (lenograstim) daily for four days. On the morning of day 5, a whole blood (WB) sample of 250-440 mL ± 10 mL was collected by simple venipuncture, collected in a blood bag, and immediately transported to the cell generation center at ambient temperature. After overnight storage of the WB samples at 4°C-8°C, the manufacturing process was initiated on day 6 using the StemXpand® automated integration system and Stem Pack® disposable kits developed by CellProthera®.

[0102] Umbilical cord blood-derived CD34+ cells After participants signed informed consent, fresh or frozen umbilical cord blood was obtained from a cord blood bank.

[0103] Preparation of ProtheraCytes® Starting with initial WB samples, red blood cell (RBC) sedimentation was performed, followed by total nucleus cell (TNC) isolation using either the gelatin method or an alternative method involving centrifugation without gelatin. Briefly, in the gelatin method, 250-440 mL of a 1:1 WB / phosphate-buffered saline solution (PBS; Macopharma, Mouvaux, France) was mixed with an equal volume (250-440 mL) of 4% gelatin (Gelofusine, BBrau, Melsungen, Germany) in two 600 mL transport bags, and these were suspended for 20 minutes to facilitate RBC sedimentation. The remaining RBCs in the precipitate were mixed again with 4% gelatin and subjected to a second 20-minute sedimentation period. The two supernatants were stored and centrifuged at 400g for 10 minutes at room temperature to precipitate TNCs. These basic (b)-CD34+ stem cells (SCs) were purified using the CliniMACS system (magnetically activated cell sorting, Miltenyi Biotec, Bergisch Gladbach, Germany). Bags containing the purified b-CD34+ SC suspension or thawed frozen healthy donor (FHD) CD34+ cells (Lonza) were immediately connected to a machine kit and subjected to a 9-day culture period in a StemXpand® incubator using our StemFeed® medium. This growth process was automatically programmed and controlled. First, predetermined amounts of StemFeed® culture medium, cytokine mix (composed of various concentrations of interleukins IL6, IL3, stem cell factors, thrombopoietin, and Fms-like tyrosine kinase 3 ligand), and CD34+SC were sequentially distributed into dedicated culture bags placed on a stirrer mounted on an incubator. The bags were then gently agitated for 30 seconds to disperse the cell mixture, and then incubated at 37°C in a 5% CO2 controlled atmosphere for 8-9 days of cell growth without further intervention. At the end of incubation, the cell suspension was gently agitated to disperse it, and then the agitation tray was tilted to 80° to facilitate the equal distribution of the cell suspension into two sample bags. Samples were collected on day 0 and day 7, the cell suspension was dispersed, and the agitation tray was tilted to 50° before sterility analysis.

[0104] At the end of the 8-9 day period, the culture product was collected, centrifuged, and immunoselected using the CliniMACS system to purify the proliferated (e)CD34+ SCs. These were resuspended in 15 ml of PBS / 2' / 0 human serum albumin (HSA) and conditioned into three 5 ml syringes to produce the final product (ProtheraCytes®).

[0105] (Example 2) This embodiment describes the in vivo evaluation of the efficacy of administering CD34+ cells via various routes in the treatment of ischemic stroke.

[0106] As previously described (Saucourt et al., 2019), human CD34+ cells were grown and purified. The source of CD34+ cells may be autologous (from the same patient) or allogeneic (from an adult donor or umbilical cord blood, preferably derived from umbilical cord blood).

[0107] The rat model examined was a 1-hour middle cerebral artery occlusion (MCAO) ischemia model using a reperfusion mechanism. This is an established pre-stroke model.

[0108] The treatment group and the control group were assigned as follows:

[0109] [Table 1]

[0110] General Procedure 1. All animals (250g male, approximately 8 weeks old, Sprague Dolly rat) were initially behavioralally examined using the Elevated Body Swing Test (EBST) and neurological examinations to obtain baseline behavior. 2. Next, all animals were subjected to a 1-hour middle cerebral artery occlusion (MCAO) and reperfusion model to induce stroke. 3. Next, the animals were re-examined using EBST and neurological tests to assess the achievement of stroke induction. Subsequently, only animals showing significant behavioral impairment in both EBST (75% bias) and neurological tests (neuroscore 2.5) were enrolled in the following series of procedures. 4. Three days after stroke, the animals were randomly assigned to receive ProtheraCytes® transplantation via one of the following methods: intra-arterial (3 million cells per 1 ml of solvent; n=10), intracerebral (300k cells per 10 μl of solvent; n=10), intranasal (1 million cells per 36 μl of solvent; n=10), or solvent alone (physiological saline intra-arterial, intracerebral, or nasal; n=30). 5. At specific time points after stroke (days 7, 14, and 28), the animals were re-examined by EBST and neurological examination. 6. After behavioral testing on day 28, behavioral data was analyzed, and the animals were euthanized for histological analysis of the infarct area, periinfarct cell loss, inflammation, neurogenesis, and angiogenesis. 7. Detailed behavioral assessments, stroke protocols, and transplant protocols are presented below.

[0111] Stroke surgery Stroke surgery was performed using the middle cerebral artery occlusion (MCAO) technique. The animals were anesthetized via a face mask using a mixture of 1-2% isoflurane in nitric oxide / oxygen (69% / 30%), and their body temperature was maintained at 37±0.3°C during surgery. After a midline skin incision in the neck, the left common carotid artery, external carotid artery (ECA), and internal carotid artery were isolated. Then, suturing was carried out using 4-0 monofilament nylon sutures (15.0-17.0 mm) from the common carotid artery bifurcation to the origin of the MCA. The skin incision was closed with surgical clips. The animals were allowed to recover from anesthesia during 1 hour of MCAO. One hour after MCAO, the animals were anesthetized again, the nylon sutures were removed, and reperfusion was initiated. The MCAO model was standardized using stroke animals that showed a reduction in focal cerebral blood flow (CBF) of ≥80% during the occlusion period, as determined by laser Doppler (Perimed, Periflux System 5000). For baseline focal CBF measurement, a laser Doppler probe was placed across the right frontoparietal cortex region supplied by the MCA. No significant differences were found in physiological parameters, including PaO2, PaCO2, and plasma pH measurements. Rats that achieved swing activity with a bias >75% during occlusion were enrolled in the study. Subsequently, the surgical incision was closed and the animals recovered from anesthesia.

[0112] Porting protocol Three days after MCAO, animals were randomly assigned to receive ProtheraCytes® transplantation via one of the following methods: intravascular (IV) (3 million cells per 1 ml of solvent; n=10), intracerebral (IC) (300k cells per 10 μl of solvent; n=10), intranasal (IN) (1 million cells per 36 μl of solvent; n=10), or solvent alone (physiological saline intraarterial, intracerebral, or nasal cavity; n=30).

[0113] IV was administered via the carotid artery. To ensure proper MCAO in the animals, intracarotid injection of cells / saline was also performed. The animals were anesthetized via face mask with a mixture of 1-2% isoflurane in nitric oxide / oxygen (69% / 30%), and their body temperature was maintained at 37±0.3°C during surgery. Cell / saline injection was performed via bolus injection, delivered through a 25G needle in a 1-mL syringe inserted into the carotid artery. The syringe was filled with cells / saline. After administration, the needle was removed, the carotid artery was compressed for 30 seconds to stop bleeding, and the skin wound was re-closed with a surgical clip.

[0114] In IC implantation, the right striatum was targeted by stereotactic fixation surgery. All surgical procedures were performed under sterile conditions. Animals were anesthetized via face mask with a mixture of 1-2% isoflurane in nitric oxide / oxygen (69% / 30%), and their body temperature was maintained at 37±0.3°C during surgery. Once deep anesthesia was reached (by confirming the pain reflex), the area around the surgical incision (cranial region) was trimmed to create a border to prevent contamination of the surgical site, and then the site was surgically sterilized and cleaned twice, and covered with a sterile drape. The animals were then fixed to a stereotactic fixation device (Kopf Instruments). A 26-gauge Hamilton syringe was then lowered into a small perforated cranial opening (the implantation coordinates were adjusted to correspond to the striatal region adjacent to the infarct site: 0.5 mm anterior and 1.0 mm lateral to the bregma, and 4.0 mm, 3.5 mm, and 3.0 mm below the dura mater). During this single needle insertion, three deposits of the test material were generated (100,000 cells per 3 μl deposit or a total of 300,000 cells per 3 deposits in 9 μl of saline). Based on target sites previously established by similar stereotactic implantation, the target region was the medial striatum, corresponding to the striatal region surrounding the infarct. Each deposit consisted of 100,000 living cells in a 3 μl volume injected over 3 minutes. After a further 2 minutes of absorption time, the needle was retrieved and the wound was closed with a stainless steel wound clip. During the procedure and after recovery from anesthesia, body temperature was maintained at approximately 37°C using a heating pad and rectal thermometer.

[0115] In IN transplantation, the animals were positioned supine with their skulls fixed by holding them in the hand, and a nasal drop containing the substance / cell suspension was carefully placed over one nostril and allowed to be naturally inhaled through the nose, followed by inhalation through the other nostril. 100 units of hyaluronidase (Sigma-Aldrich Chemie GmbH, H3506) dissolved in 24 μL of sterile PBS were administered into the nostrils of rats 30 minutes before administration of ProtheraCytes® or the solvent (6 μL / nostril, repeated once after 2 minutes). One million cells resuspended in 36 μL were applied to each rat using the same method as described for hyaluronidase, and the control group was administered the same amount of solvent alone.

[0116] Behavioral testing Behavioral testing included the Elevated Body Swing Test (EBST) and Bederson's Neurological Examination. The EBST is a measure of asymmetrical motor behavior that does not require animal training or drug injection. Rats were held vertically about 1 inch from the base of their tails and then raised 1 inch above the surface on which they were stationary. The frequency and direction of swinging behavior were recorded over 20 tail elevations. A swing was counted if the rat's head moved more than 10° to either side of the vertical axis. Typically, intact rats exhibit a swing bias of 50%, meaning that swings to the left and right are equal in number. A swing bias of 75% in one direction was used as a criterion for motor impairment. The total number of biased swings per animal was summed up and divided by 20 to obtain the average number of biased swings per individual animal.

[0117] Bederson's neurological examination is an assessment of an animal's sensorimotor function, consisting of three characteristic tasks performed over approximately 10 minutes per rat. Each task was performed sequentially and scored from 0 to 3. These three assessments included: 1. retraction of the contralateral hind limb, 2. grasping of both forelimbs, and 3. balance beam walking ability.

[0118] The contralateral hind limb retraction test measures the animal's ability to replace one hind limb 2-3 cm laterally with the other hind limb. The grades are as follows: 0 immediate and smooth replacement, 1 slow replacement, 2 partially rigid replacement, and 3 no replacement.

[0119] In the bilateral forelimb grasping test, the rat's ability to remain on a 2 mm diameter steel rod is measured. Grade 0 is used for rats with normal forelimb grasping behavior, Grade 1 for rats that grasp quickly but are rigid, Grade 2 for rats that grasp slowly but are rigid, and Grade 3 for rats that are unable to grasp with their forelimbs.

[0120] For the balance beam walking ability test, a balance beam apparatus is used that is 80 cm long and has a 2-4 cm wide plane placed on two bars at least 40 cm above the table / surface. The animal is placed at one end of the balance beam and then its ability to cross the balance beam and reach the other end is evaluated. The grades are as follows: 0 Rats that easily cross the balance beam, 1 Rats that slowly cross the balance beam, 2 Rats that partially cross the balance beam but fall, and 3 Rats that cannot stay on the balance beam for 10 seconds.

[0121] The scores from all three tests were totaled to obtain a total neurological impairment score (the highest possible score was 9, and the average combined neurological score was 3). A score of 2.5 was set as the criterion for classifying an animal as having a "stroke."

[0122] result Behavioral tests showed that MCAO rats implanted with ProtheraCytes® via all three administration routes (IV, IC, and IN) showed significant improvement in all behavioral tests compared to solvent-controlled MCAO rats (Figures 1A-1D). Surprisingly, intranasal administration of ProtheraCytes® had the same efficacy as intracerebral administration. In the intracerebral route, ProtheraCytes® is delivered directly to the periinfarct region via stereotactic surgery to maximize cell engraftment around the lesion site, while the intranasal route delivers cells along the olfactory and trigeminal pathways, causing dispersed intracellular distribution of cells through the central nervous system. Therefore, it was surprising to find that ProtheraCytes® delivered via the intranasal route also engrafted in the periinfarct region and had the same efficacy as the intracerebral route. In most cases, the treatment group improved to the point where it returned to baseline values ​​before the ischemic lesion (Figures 1A-1D). No observable adverse behaviors were observed in any of the cell-transplanted stroke animals.

[0123] MCAO rats transplanted with ProtheraCytes® via all three administration routes showed a significantly reduced infarct area compared to solvent-controlled MCAO animals (Figure 2). MCAO rats transplanted with ProtheraCytes® via all three administration routes also showed a significantly reduced cellular loss in the periinfarct area compared to solvent-controlled animals (Figure 3).

[0124] MCAO rats transplanted with ProtheraCytes® via all three administration routes also showed a reduction in inflammation (IBA-1 labeled inflammatory cells) compared to solvent control animals (Figure 4). Survival and engraftment of transplanted ProtheraCytes® were detected via all three administration routes (Figure 4).

[0125] MCAO rats implanted with ProtheraCytes® via all three administration routes showed significant upregulation of neurogenesis (double cortin DCX) compared to solvent control animals (Figure 5).

[0126] MCAO rats transplanted with ProtheraCytes® via all three administration routes showed increased angiogenesis (VEGFR1-positive cells) compared to solvent-controlled MCAO rats (Figure 6). The observation of increased angiogenesis in close proximity to the transplanted ProtheraCytes® supported the mechanism by which CD34+ cells promote angiogenesis through the secretion of paracrine factors, such as exosomes containing VEGF and miRNA (Figure 6).

[0127] MCAO rats transplanted with ProtheraCytes® via all three administration routes possessed significantly more extracellular vesicles (CD63+ exosomes) than solvent control animals (Figure 7). This important finding demonstrates that ProtheraCytes® secretes extracellular vesicles in vivo, supporting the in vitro observation that CD34+ cells secrete exosomes with pro-angiogenic and anti-apoptotic properties (Example 3). This finding provides further evidence for the mechanism of action of ProtheraCytes®, demonstrating that cells promote neurogenesis and angiogenesis in stroke brains by secreting such CD63+ extracellular vesicles / exosomes.

[0128] This is the first report of treating an ischemic stroke model with intranasal administration of CD34+ cells. Intranasal administration of CD34+ cells significantly reduced stroke-induced behavioral dysfunction, along with corresponding histological improvements.

[0129] (Example 3) Measurement of VEGF expression and exosomal miRNA expression using ProtheraCytes® method cell culture ProtheraCytes® were obtained after proliferation of CD34+ cells mobilized from AMI patients (EXCELLENT Phase I / 1lb clinical trial NCT02669810) and purified CD34+ cells from frozen healthy donors (FHD) (Lonza, NC, USA) as previously described (Saucourt et al., 2019).

[0130] Quantitative analysis of VEGF Nine days after cell growth in StemFeed® cell culture medium (Eurobio, France), ProtheraCytes® supernatants were collected from AMI patients and FHD patients and stored at -80°C until analysis. The supernatants were thawed, and VEGF levels were measured using the Human VEGF QuantiGlo ELISA Kit (R&D Systems, MN, USA) according to the manufacturer's instructions, and SpectraMax L (Molecular Devices, San Jose, CA, USA). Immunoassay Control Set 732 for Human VEGF (R&D Systems) was used as a positive control, and StemFeed® medium was used as a negative control.

[0131] In vitro tube formation assay Overnight serum-starved human umbilical vein endothelial cells (HUVECs) 2.5 × 10⁻¹⁴ 4 Cells were seeded in 48-well plates coated with 150 μL of growth factor-reduced Matrigel (Corning, Arizona, USA) along with ProtheraCytes® supernatant or StemFeed® medium as a negative control. After 6 hours, tube formation was examined by phase-contrast microscopy, and the number of tubes was quantified using triplicates under each condition.

[0132] Isolation of exosomes ProtheraCytes® were seeded in serum-free medium (DMEM medium) in a bioreactor, and extracellular vesicles were released by applying controlled mechanical stimulation to the cells for 30 minutes to 2 hours according to Everzom's proprietary method. The size distribution and concentration of ProtheraCytes®-derived exosomes were measured using Nanosight (NS300, Malvern, UK). Exosome membrane markers were quantified by flow cytometry using the MACSPlex Exosome Kit (Miltenyi).

[0133] In miRNA analysis, ProtheraCytes® was measured at 2.5 × 10⁻⁶ 5 Cells were cultured for 40 hours in StemSpan-AOF (StemCell Technologies, BC, Canada) supplemented with cytokines at a concentration of cells / mL. Cells were then collected by centrifugation at 400g for 10 minutes, and exosomes were purified from the supernatant by precipitation using the ExoQuick-TC® kit (System Biosciences, CA, USA) according to the manufacturer's instructions. After isolation, the exosomes were characterized by flow cytometry using the ExoStep® kit with bead-conjugated anti-CD63 capture antibody, anti-CD81 antibody, and anti-CD34 antibody (ImmunoStep, Spain) to confirm the identity of the exosomes secreted by ProtheraCytes®.

[0134] Quantification of microRNAs Total RNA derived from ProtheraCytes® and their secreted exosomes was collected from seven AMI patients and isolated using the miRNeasy Tissue / cells Advanced MiniKit and miRNeasy Serum / Plasma Advanced Kit (QiAGEN, France) according to the manufacturer's protocol. The RNA isolated from exosomes and cells was reverse transcribed into cDNA using the miCURY LNA RT Kit (QIAGEN, France). A UniSp6 RNA spike-in control was added during cDNA synthesis to ensure experimental quality. Real-time qPCR amplification was performed in each RT reaction. The reactions were carried out using the miRCURY LNA miRNA SYBR Green PCR Kit (QIAGEN, France) and the Bio-Rad CFX96® Real-time PCR Detection System (BioRad Laboratories, France) according to the manufacturer's instructions. All primer sets were specially designed by the supplier. The primers used were miR-21-5p (YP00204230), miR-26a-5p (YP00206023), miR-126-3p (YP00204227), miR-130a-3p (YP002046658), miR-133a-3p (YP00204788), miR146a-5p (YP00204688), miR-199a-3p (YP00204536), miR-378a-3p (YP00205946), and miR-590-3p (YP00205448). The qPCR data were normalized to the miR-let7a-5p (YP00205727) value. Relative miRNA expression is 2 -'8"8.ct It was calculated using the method.

[0135] result VEGF secretion as an efficacy test Since human CD34+ cells are known to secrete VEGF (Bautz et al., 2000), it was necessary to determine the level of VEGF secretion by CD34+ cells after proliferation of 16 batches of ProtheraCytes® generated from AMI patients in the EXCELLENT Phase I / 1lb clinical trial and 4 batches generated from healthy donors. ELISA quantification of VEGF concentration showed that the culture supernatant of patient-derived ProtheraCytes® ranged from 185.6 pg / mL to 1032.4 pg / mL, with a mean of 596.2 ± 242.3 pg / mL, while the VEGF concentration of healthy donor cells ranged from 315.3 pg / mL to 718.3 pg / mL, with a mean of 526.2 ± 208.1 pg / mL (Figure 8A). No significant difference was observed between patient and healthy donor VEGF concentrations (Figures 8A and 8B). Conversely, the VEGF concentration observed in StemFeed® culture medium (negative control) ranged from 2.7 pg / mL to 3.0 pg / mL, with a mean of 2.8 ± 0.2 pg / mL, which was significantly lower than the VEGF concentrations in patients (p = 0.0007) and healthy donors (p = 0.087) (Figure 8B). When VEGF concentration was normalized by CD34+ cell count, the secreted VEGF per cell in AMI patients was 4.4 fg / cell, which was not significantly different from the secreted VEGF per cell in healthy donors (4.1 fg / cell) (p = 0.6343) (Figure 8C). Furthermore, the VEGF concentration in the culture supernatant of proliferating CD34+ cells derived from AMI patients was significantly correlated with the number of CD34+ cells obtained after proliferation (Figures 8D and 8E) (Pearson correlation coefficient r = 0.7484; p = 0.0009).

[0136] Next, an in vitro tubule formation assay was performed using HUVEC to determine whether the ProtheraCytes® supernatant containing VEGF exhibited in vitro angiogenesis. Tube formation was quantified in HUVEC co-cultured for 6 hours with either ProtheraCytes® supernatant or StemFeed® medium as a negative control. Significantly higher tubule formation was observed in HUVEC co-cultured with ProtheraCytes® supernatant (p=0.0082) (Figure 8F).

[0137] Characterization of exosomes derived from ProtheraCytes® In collaboration with Everzom, we seeded ProtheraCytes® in a bioreactor with controlled mechanical stimulation and collected exosomes. The average size of ProtheraCytes®-derived exosomes was 86.7 ± 10.17 nm (Figure 9A). We observed that the number of exosomes secreted by ProtheraCytes® increased over time from approximately 6,000 extracellular vesicles / cell in 30 minutes to 16,000 extracellular vesicles / cell in 2 hours (Figure 9B). Furthermore, analysis of exosome marker expression showed that the exosomes expressed the exosome markers CD9, CD63, and CD81, as well as the endothelial cell markers CD49e and CD44, and the stem cell marker CD133 (Figure 9C).

[0138] miRNA expression in ProtheraCytes®-derived exosomes (CD34Exo) To investigate the angiogenic activity of exosomes derived from ProtheraCytes® (CD34Exo), exosomes were first isolated and characterized by flow cytometry. Next, RNA was isolated from CD34Exo, and the expression levels of miRNAs, which have been reported to be key positive regulators of the angiogenic process, were determined. The expression levels of miR-126, miR-130a, miR-21, miR-378, and miR-26a in ProtheraCytes® and their exosomes (CD34Exo) were evaluated (Sahoo et al., 2011; Mathiyalagan et al., 2017; Templin et al., 2017; Mcneill et al., 2019; Li et al., 2021; Chang et al., 2022). Exosomes were found to be significantly enriched with miR-130a, miR-126, miR-378, miR-26a, and miR-21 compared to ProtheraCytes® (Figure 10A). miR-130a and miR-21 were the two most enriched miRNAs in CD34Exo, with their expression levels 6.9-fold and 12.1-fold higher, respectively, than in ProtheraCytes® (Figure 10B). Similarly, in ExoCD34+, miR-126 was observed to be 4.4-fold higher, and miR-378 and miR-26a were observed to be 3.2-fold higher, compared to ProtheraCytes® (Figure 10B).

[0139] These results indicate that ProtheraCytes® can secrete exosomes containing angiogenesis-promoting miRNAs that can induce angiogenesis and contribute to the vascular repair process. Furthermore, we examined the expression level of miR-146a, which is known to attenuate apoptosis (Huang et al., 2016; Scarlatescu et al., 2021), and found that miR-146a was also enriched 3.5 times in ExoCD34+ compared to ProtheraCytes® (Figure 10B).

[0140] Although the expression levels of both miR-199a and miR-590 detected were low, they were significantly higher in ExoCD34+ compared to ProtheraCytes® (Figure 10A). Interestingly, miR590 was one of the most enriched miRNAs in ExoCD34+, with a 13.5-fold increase in expression, while miR-199a was 4.6-fold higher in ExoCD34+ than in cells (Figure 10B).

[0141] Ultimately, we further investigated the expression of miR-133a, miR-24, miR-29b, and miR-132, which are known to possess anti-fibrotic activity (Xiao et al., 2019). As shown in Figures 10A and 10B, miR-29b, miR-24, and miR-132 were significantly enriched in Exo CD34+, with their expression levels 11.7 times, 5.8 times, and 4.3 times higher, respectively, than in ProtheraCytes®. On the other hand, no significant difference was observed in miR133 expression between ExoCD34+ and ProtheraCytes®.

[0142] (References) TIFF2026520825000003.tif195155TIFF2026520825000004.tif186155

Claims

1. A CD34+ cell population for use in a method for treating stroke, wherein the method comprises the step of intranasal administration of the CD34+ cell population.

2. (a) A method for treating stroke, comprising administering CD34+ cells intranasally, wherein the CD34+ cells secrete paracrine factors into the stroke-affected area, and / or (b) A method for treating stroke, comprising administering CD34+ cells intranasally, wherein the CD34+ cells promote angiogenesis in the stroke-affected area, and / or (c) A method for treating stroke, comprising intranasal administration of CD34+ cells targeting the CD34+ cells, wherein the CD34+ cells promote neurogenesis, and / or (d) Methods for stimulating angiogenesis in a subject, and / or (e) Methods for stimulating neurogenesis in a subject, and / or (f) A method for treating stroke, comprising administering CD34+ cells intranasally, wherein the CD34+ cells promote reduction of infarct size and / or reduce cell loss in the infarct area and / or periinfarct area and / or reduce inflammation in the infarct area and / or periinfarct area, and / or (g) A method for treating stroke, comprising administering CD34+ cells intranasally, wherein the CD34+ cells promote motor and / or neurological recovery. CD34+ cell population for use in [location / field].

3. A population of CD34+ cells isolated from umbilical cord blood or whole blood, for use in the method according to claim 1 or 2.

4. A CD34+ cell population for use in the method according to any one of claims 1 to 3, administered to the subject within 1, 2, 3, or 4 days of stroke onset.

5. The above method is at least 7 × 10 6 A population of CD34+ cells for use in the method according to any one of claims 1 to 4, comprising the step of administering CD34+ cells to cells.

6. A population of CD34+ cells for use according to any one of claims 1 to 5, expressing one or more paracrine factors and / or VEGF.

7. The CD34+ cell population for use according to claim 6, wherein the amount of VEGF expressed by the CD34+ cells in the culture medium is at least about 150 pg / ml, or the amount of VEGF expressed by the CD34+ cells in the culture medium is at least about 4 pg / cell.

8. A CD34+ cell population for use according to any one of claims 1 to 7, wherein the CD34+ cells express one or more of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR21, miR199a, miR590, miR133a, miR-24, miR29b, and miR132.

9. A CD34+ cell population for use according to any one of claims 1 to 8, wherein the viability of the CD34+ cells is at least about 90%, and / or the purity of the CD34+ cells is at least about 75%.

10. A population of CD34+ cells for use according to any one of claims 1 to 9, which is a cultured and / or grown population, and / or a purified population, and / or an isolated population.

11. (i) at least about 75% CD34+ cells, and / or (ii) Monocytes of approximately 15% or less, and / or (iii) Granulocytes of approximately 5% or less, and / or (iv) Lymphocytes of approximately 3% or less A CD34+ cell population for use according to any one of claims 1 to 10, comprising:

12. The number of cells administered per dose is approximately 7 × 10⁶ 6 A population of CD34+ cells for use according to any one of claims 1 to 11.

13. A CD34+ cell population for use according to any one of claims 1 to 12, wherein the amount of cells administered per nostril is approximately 1 ml, and / or the total amount administered per dose is approximately 2 ml.

14. A CD34+ cell population for use according to any one of claims 1 to 13, wherein the CD34+ cells are provided as a sterile suspension and / or the population is provided in the form of a pharmaceutical composition comprising a buffer, optionally.

15. A CD34+ cell population for use according to any one of claims 1 to 14, which increases the expression of doublecortin DCX and / or VEGFR1.