Recombinant vectors for high gene expression

Abstract

This application relates to a DNA structure for high expression of a target gene in microorganisms of the genus Schizochytrium, and a method for expressing a target gene in microorganisms of the genus Schizochytrium using the same. The DNA structure is characterized by including a 5' homology arm and a 3' homology arm that can be hybridized with high-expression sites of the genome of a microbial species Schizochytrium.

Description

Technical Field

[0001] Mutual citation with related applications This application claims the benefit of priority based on Korean Patent Application No. 10-2023-0079290, filed on June 20, 2023, and all the contents disclosed in the document of the Korean patent application are incorporated herein by reference.

[0002] This application relates to a DNA construct for high expression of a target gene in Schizochytrium microorganisms and a method for expressing a target gene in Schizochytrium microorganisms using the same.

Background Art

[0003] Recently, synthetic biology and metabolic engineering technologies have rapidly developed, facilitating the development and optimization of microbial cell factories based on more sophisticated gene correction technologies. Such gene correction technologies have been quickly applied to various microbial cell factories, but efficient strain development based on them has only been limitedly carried out and reported for model organisms such as Escherichia coli, Corynebacterium, and yeast. For microalgae, strain development technologies are insufficient for species other than some that fall under model organisms. In particular, in the case of developing Schizochytrium family microalgae strains, although some results of transformation have been reported, there has been no report on the high expression of transgenes at an epoch-making level.

[0004] If the expression level of the introduced gene is not guaranteed, the confirmation of phenotypic changes in response to the introduced gene may be ambiguous due to insufficient gene expression. Furthermore, in the case of microalgae of the family Schizochytriaceae, during gene introduction, the gene is randomly inserted at any position within the entire microalgal gene dataset. In such cases, the expression level of the introduced gene may differ from one transformant to another depending on the insertion site. Differences in expression levels depending on the insertion site have been studied in various microorganisms such as E. coli, yeast, and the microalga Nannochloropsis, and based on this, a strategy for successfully achieving high expression of introduced genes through 'specific gene insertion to high-expression sites' has been reported (Bioresource Technology 340 (2021) 125676).

[0005] High gene expression is essential during the development of Schizochytrium strains to ensure gene expression levels and reduce the deviation in gene expression levels between transformants, thereby enabling more stable transgene expression and accurate confirmation of phenotypic changes. Our research team transformed Schizochytrium microalgae with the green fluorescent protein gene and then identified the insertion site of the green fluorescent protein gene in the microalgae transformants that highly expressed green fluorescent protein through genomic analysis. Furthermore, we selected the identified gene site as a high-expression site and developed a vector composition that allows for the specific insertion of the gene at this site using homologous recombination technology. Based on this vector composition, we ultimately developed novel microalgae that exhibit differentiation from the parent strain through the high expression of diverse microalgae genes. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Ae Jin Ryu, Byeong-ryool Jeong, Nam Kyu Kang, Seungjib Jeon, Min Gi Sohn, Hyo Jin Yun, Jong Min Lim, Seok Won Jeong, Youn-Il Park, Won Joong Jeong, Sunghoon Park, Yong Keun Chang, Ki Jun Jeong, Safe-Harboring based novel genetic toolkit for Nannochloropsis salina CCMP1776: Efficient overexpression of transgene via CRISPR / Cas9-Mediated Knock-in at the transcriptional hotspot, Bioresource Technology, Volume 340, 2021, 125676, ISSN 0960-8524 [Overview of the project] [Problems that the invention aims to solve]

[0007] One example is providing a DNA structure for high expression of a target gene in microorganisms of the genus Schizochytrium.

[0008] The aforementioned structure is for inserting the target gene into a target site within the genome of a microorganism of the genus Schizochytrium, and the target site may be a highly expressed site within the genome of a microorganism of the genus Schizochytrium.

[0009] More specifically, the DNA structure may include a 5' homology arm, a target gene, and a 3' homology arm, and the 5' homology arm and the 3' homology arm may be hybridizable to the 5' and 3' regions of the target site (high-expression site), respectively.

[0010] For example, the target site is a site in the genome of a microorganism of the genus Schizochytrium that corresponds to sequence number 1, sequence number 2, or a nucleic acid sequence having 95% or more homology thereto. The 5' homology arm can be hybridized to a region of 20,000 bp or less upstream of the target gene insertion site within the target site, and / or The 3' homology arm is capable of being hybridized within a region of 20,000 bp or less on the downstream side of the target gene insertion site within the target region. That's fine.

[0011] Another example provides a microorganism of the genus Schizochytrium containing the aforementioned DNA structure.

[0012] Other examples include compositions for expressing a target gene in a Schizochytrium microorganism and / or for producing a target protein, comprising the DNA structure, a Schizochytrium microorganism containing the DNA structure, or a combination thereof.

[0013] Other examples provide uses for the expression of a target gene and / or for the production of a target protein in the DNA structure, a Schizochytrium microorganism containing the DNA structure, or a combination thereof in a Schizochytrium microorganism.

[0014] Another example provides a method for producing Schizochytrium microorganisms for use in target gene expression and / or target protein production, comprising the step of introducing the DNA structure into the Schizochytrium microorganism.

[0015] Another example provides a method for expressing a target gene and / or producing a target protein in a Schizochytrium microorganism, which includes the step of culturing the Schizochytrium microorganism containing the aforementioned DNA structure. [Means for solving the problem]

[0016] This application provides a technology for highly expressing a target gene in a microorganism of the genus Schizochytrium and / or producing a target protein in a microorganism of the genus Schizochytrium, by designing a DNA structure that can discover high-expression sites within the genome of a microorganism of the genus Schizochytrium and introduce a target gene into said high-expression site.

[0017] Definition of Terms In this application, the term “corresponding to” can mean the amino acid sequence or nucleic acid sequence of a corresponding region in any polypeptide or polynucleotide that is confirmed by aligning the amino acid sequence or nucleic acid sequence of the polypeptide or polynucleotide with a specific amino acid sequence or nucleic acid sequence provided in this application. Such sequence alignment can be performed by conventional sequence alignment methods, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), etc., but is not limited to these, and any sequence alignment program or pairwise sequence comparison algorithm known in the industry may be used appropriately.

[0018] In this application, the phrase "a polynucleotide or polypeptide comprising or consisting of a specific nucleic acid sequence (base sequence) or amino acid sequence" can be interpreted as meaning that the polynucleotide or polypeptide must include the specific nucleic acid sequence (base sequence) or amino acid sequence, and that it includes (or does not exclude) a "substantially equivalent sequence" to which mutations (deletions, substitutions, alterations, and / or additions) have been made to the specific nucleic acid sequence (base sequence) or amino acid sequence, to the extent that the original function and / or intended function of the polynucleotide or polypeptide is maintained. For example, when a polynucleotide or polypeptide is described as "containing or consisting of a specific nucleic acid sequence (base sequence) or amino acid sequence," it can mean that the polynucleotide or polypeptide (i) essentially contains the specific nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially contains a nucleic acid sequence or amino acid sequence having 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more homology or identity with the specific nucleic acid sequence (base sequence) or amino acid sequence, thereby maintaining its original function and / or intended function. For example, the intended function could mean high gene expression function within a microorganism of the genus Schizochytrium.

[0019] In this application, “homology” means the percentage of identity between two polynucleotide or polypeptide molecules. Inter-sequence homology from one molecule to another can be determined by known techniques. For example, homology can be determined by directly aligning the sequence information between two polynucleotide molecules or two polypeptide molecules, such as parameters like score, identity, and similarity, using readily available computer programs that align sequence information. Such computer programs may include BLAST (NCBI), CLC Main Workbench (CLC bio), and MegAlign™ (DNASTAR Inc). Inter-polynucleotide homology can also be determined by hybridizing polynucleotides under conditions that form a stable double helix between homologous regions, then degrading them with a single-chain-specific nuclease, and examining the size of the degraded fragments.

[0020] In this application, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, and can be expressed as a percentage. The terms homology and identity may sometimes be used interchangeably.

[0021] The sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard sequence algorithms, which may also be used in conjunction with a default gap penalty established by the program used. Substantially, homologous or identical sequences can generally be hybridized in whole or in part with intermediate or highly stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing general codons or codons considering codon degeneracy.

[0022] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program with default parameters such as those of Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Or it can be determined using the Needleman - Wunsch (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443 - 453) as performed by the needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276 - 277) (version 5.0.0 or later versions) (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073). For example, homology, similarity or identity can be determined using BLAST of the National Center for Biotechnology Information database, or ClustalW.

[0023] The homology, similarity or identity of a polynucleotide or polypeptide can be determined by, for example, comparing sequence information using a GAP computer program as known in Smith and Waterman, Adv. Appl. Math (1981) 2:482, such as Needleman et al. (1970), J Mol Biol. 48:443. Briefly, the GAP program can be defined as the number of similar aligned symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. The default parameters for the GAP program are (1) a binary comparison matrix (containing a value of 1 for identity and 0 for non-identity) and a weighted comparison matrix as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14:6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps can be included.

[0024] In this application, "polynucleotide" means a polymer of nucleotides in which nucleotide monomers are covalently linked in a long chain, a DNA or RNA strand of a certain length or more, and more specifically, a polynucleotide fragment encoding the mutant.

[0025] In this application, “homologous arm (or homology arm)” means a nucleic acid sequence used to insert a gene into a target site, and can mean, for example, a nucleic acid sequence used for gene insertion by homologous recombination (HR). More specifically, a homology arm can mean a sequence that can be hybridized with the 5' end (or left or upstream) region of the target nucleic acid sequence site (5' homologous arm, left arm, or upstream arm) and / or a sequence that can be hybridized with the 3' end (or right or downstream) region (3' homologous arm, right arm, or downstream arm). The 5' end (or left or upstream) region and the 3' end (or right or downstream) region can mean, but are not limited to, a region within approximately 100 kbp on the 5' end (or left or upstream) side and a region within approximately 100 kbp on the 3' end (or right or downstream) side of the target site, respectively. The 5' end (or left or upstream) arm and the 3' end (or right or downstream) arm can each independently have a length of approximately 10 bp to approximately 5000 bp, but are not limited to this.

[0026] In this application, "capable of hybridization with or hybridizable with" a given nucleic acid sequence region can mean a state in which the nucleic acid sequence region can form a double helix with all or part of the nucleic acid sequence region, including a complementary sequence.

[0027] In this application, when the term “hybridization” is used in relation to homology arms, it can be interpreted as having the same meaning as “homological recombination,” and the two terms can be used interchangeably.

[0028] In this application, the term “about” preceding a numerical value may be used to comprehensively mean a range of numerical values ​​equivalent to or similar to the numerical value described later, for example, the equivalent or similar range may mean, but is not limited to, a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, ±1% of the stated numerical value.

[0029] The present invention will be described in more detail below.

[0030] One example is the provision of a DNA structure for inserting a target gene into a target site (high-expression region) within the genome of a microorganism of the genus Schizochytrium.

[0031] More specifically, the DNA structure may include a 5' homology arm, a target gene, and a 3' homology arm.

[0032] In other words, the DNA structure may have the following structure: 5'-[X]-[Y]-[Z]-3' (Structural formula 1) In the above formula, X represents the 5' homology arm, Y represents the target gene, and Z represents the 3' homology arm.

[0033] The DNA structure may be for inserting the target gene into a target site within the genome of a microorganism of the genus Schizochytrium.

[0034] The target site may also be a gene overexpression site within the genome of a microorganism of the genus Schizochytrium.

[0035] For example, the target site may correspond to a nucleic acid sequence having 60% or more homology to SEQ ID NO: 1 (Contig3, 2001468 (HindIII), SCH_00001433), SEQ ID NO: 2 (Contig3, 1116023 (HindIII), SCH_00001298), or 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more within the genome of a microorganism of the genus Schizochytrium.

[0036] The sequence of target sites in this application is shown in Table 1 below:

[0037] [Table 1] JPEG2026521763000003.jpg190149

[0038] The 5' homology arm extends approximately 100,000 bp (for example, approximately 1 bp to approximately 100,000 bp, approximately 1 bp to approximately 50,000 bp, approximately 1 bp to approximately 10,000 bp, approximately 1 bp to approximately 7,500 bp, approximately 1 bp to approximately 5,000 bp, approximately 1 bp to approximately 2,500 bp, approximately 1 bp to approximately 2,000 bp, approximately 1 bp to approximately 2,000 bp) in the 5' direction or upstream of the target site (gene high expression site; more specifically, based on the target gene insertion site within the target site (gene high expression site)) within approximately 100,000 bp. It may be possible to hybridize (recombinate homology) with all or part of the region (approximately bp to about 1,500 bp, approximately 1 bp to about 1,400 bp, approximately 1 bp to about 1,300 bp, approximately 1 bp to about 1,200 bp, approximately 1 bp to about 1,100 bp, approximately 1 bp to about 1,000 bp, approximately 1 bp to about 750 bp, or approximately 1 bp to about 500 bp) (for example, a portion having a length corresponding to the length of the homology arm and being hybridizable (recombinate homology) with the homology arm). The aforementioned 5' homology arms are approximately 10bp to 5,000bp, 10bp to 4,000bp, 10bp to 3,000bp, 10bp to 2,000bp, 10bp to 1,500bp, 10bp to 1,400bp, 10bp to 1,300bp, 10bp to 1,200bp, 10bp to 1,100bp, 10bp to 1,000bp, 20bp to 5,000bp, 20bp to 4,000bp, 20bp to 3,000bp, 20bp to 2,000bp, 20bp to 1,500bp, 20bp to 1,400bp, 20bp to 1,300bp, 20bp to 1,200bp, and 2 0bp~about 1,100bp, about 20bp~about 1,000bp, about 23bp~about 5,000bp, about 23bp~about 4,000bp, about 23bp~about 3,000bp p, about 23bp to about 2,000bp, about 23bp to about 1,500bp, about 23bp to about 1,400bp, about 23bp to about 1,300bp, about 23bp to about 1, 200bp, about 23bp to about 1,100bp, about 23bp to about 1,000bp, about 100bp to about 5,000bp, about 100bp to about 4,000bp, about 10 0bp~about 3,000bp, about 100bp~about 2,000bp, about 100bp~about 1,500bp, about 100bp~about 1,400bp, about 100bp~about 1,300bp, about 100bp to about 1,200bp, about 100bp to about 1,100bp, about 100bp to about 1,000bp, about 250bp to about 5,000bp, about 250bp to about 4,000bp, about 250b p ~ about 3,000bp, about 250bp - about 2,000bp, about 250bp - about 1,500bp, about 250bp - about 1,400bp, about 250bp - about 1,300bp, about 250bp - about 1,200bp, Approximately 250bp to approximately 1,100bp, approximately 250bp to approximately 1,000bp, approximately 500bp to approximately 5,000bp, approximately 500bp to approximately 4,000bp, approximately 500bp to approximately 3,000bp, approximately 500bp to approximately 2,0 00bp, approximately 500bp to approximately 1,500bp, approximately 500bp to approximately 1,400bp, approximately 500bp to approximately 1,300bp, approximately 500bp to approximately 1,200bp, approximately 500bp to approximately 1,100bp, approximately 500bp~ Approximately 1,000bp, approximately 750bp to approximately 5,000bp, approximately 750bp to approximately 4,000bp, approximately 750bp to approximately 3,000bp, approximately 750bp to approximately 2,000bp, approximately 750bp to approximately 1,500bp, approximately 7 50bp to approximately 1,400bp, approximately 750bp to approximately 1,300bp, approximately 750bp to approximately 1,200bp, approximately 750bp to approximately 1,100bp, approximately 750bp to approximately 1,000bp, approximately 900bp to approximately 5,000bp The size may be, but is not limited to, bp, approximately 900bp to 4,000bp, approximately 900bp to 3,000bp, approximately 900bp to 2,000bp, approximately 900bp to 1,500bp, approximately 900bp to 1,400bp, approximately 900bp to 1,300bp, approximately 900bp to 1,200bp, approximately 900bp to 1,100bp, or approximately 900bp to 1,000bp.

[0039] Furthermore, the 3' homology arm extends approximately 100,000 bp (for example, approximately 1 bp to approximately 100,000 bp, approximately 1 bp to approximately 50,000 bp, approximately 1 bp to approximately 10,000 bp, approximately 1 bp to approximately 7,500 bp, approximately 1 bp to approximately 5,000 bp, approximately 1 bp to approximately 2,500 bp, approximately) in the 3' direction or downstream of the target site (gene high expression site; more specifically, based on the insertion site of the target gene within the target site (gene high expression site)). It may be a region that is hybridizable with all or part of the region (1 bp to approximately 2,000 bp, approximately 1 bp to approximately 1,500 bp, approximately 1 bp to approximately 1,400 bp, approximately 1 bp to approximately 1,300 bp, approximately 1 bp to approximately 1,200 bp, approximately 1 bp to approximately 1,100 bp, approximately 1 bp to approximately 1,000 bp, approximately 1 bp to approximately 750 bp, or approximately 1 bp to approximately 500 bp) (for example, a portion having a length corresponding to the length of the homology arm and hybridizable with the homology arm). The aforementioned 3' homology arms are approximately 10 bp to 5,000 bp, approximately 10 bp to 4,000 bp, approximately 10 bp to 3,000 bp, approximately 10 bp to 2,000 bp, approximately 10 bp to 1,500 bp, approximately 10 bp to 1,400 bp, approximately 10 bp to 1,300 bp, approximately 10 bp to 1,200 bp, and approximately 10 bp to 1,100 bp. , about 10bp to about 1,000bp, about 20bp to about 5,000bp, about 20bp to about 4,000bp, about 20bp to about 3,000bp, about 20bp to about 2,000 bp, about 20bp to about 1,500bp, about 20bp to about 1,400bp, about 20bp to about 1,300bp, about 20bp to about 1,200bp, about 20bp to about 1,1 00bp, about 20bp to about 1,000bp, about 23bp to about 5,000bp, about 23bp to about 4,000bp, about 23bp to about 3,000bp, about 23bp to about 2 ,000bp, about 23bp~about 1,500bp, about 23bp~about 1,400bp, about 23bp~about 1,300bp, about 23bp~about 1,200bp, about 23bp~ Approximately 1,100bp, approximately 23bp to approximately 1,000bp, approximately 100bp to approximately 5,000bp, approximately 100bp to approximately 4,000bp, approximately 100bp to approximately 3,000bp, approximately 100bp to about 2,000bp, about 100bp to about 1,500bp, about 100bp to about 1,400bp, about 100bp to about 1,300bp, about 100bp to about 1,200bp, about 100bp to about 1,100bp, about 100bp to about 1,000bp, about 250bp to about 5,000bp, about 250bp to about 4,000bp, about 250bp to about 3,000bp, about 25 0bp~about 2,000bp, about 250bp~about 1,500bp, about 250bp~about 1,400bp, about 250bp~about 1,300bp, about 250bp~about 1,200bp, about 250bp~about 1,10 0bp, about 250bp to about 1,000bp, about 500bp to about 5,000bp, about 500bp to about 4,000bp, about 500bp to about 3,000bp, about 500bp to about 2,000bp, about 500b p ~ about 1,500bp, about 500bp - about 1,400bp, about 500bp - about 1,300bp, about 500bp - about 1,200bp, about 500bp - about 1,100bp, about 500bp - about 1,000bp , about 750bp to about 5,000bp, about 750bp to about 4,000bp, about 750bp to about 3,000bp, about 750bp to about 2,000bp, about 750bp to about 1,500bp, about 750bp to about 1,400bp, about 750bp to about 1,300bp, about 750bp to about 1,200bp, about 750bp to about 1,100bp, about 750bp to about 1,000bp, about 900bp to about 5,000bp, about The size may be, but is not limited to, 900bp to approximately 4,000bp, approximately 900bp to approximately 3,000bp, approximately 900bp to approximately 2,000bp, approximately 900bp to approximately 1,500bp, approximately 900bp to approximately 1,400bp, approximately 900bp to approximately 1,300bp, approximately 900bp to approximately 1,200bp, approximately 900bp to approximately 1,100bp, or approximately 900bp to approximately 1,000bp.

[0040] The insertion site of the target gene within the aforementioned target site (high gene expression site) is not limited to any position within the sequence of Sequence ID No. 1 or Sequence ID No. 2 described herein, and can be appropriately set by a person with ordinary skill in the art to which this application belongs, taking into consideration the purpose, conditions, and desired effects of the insertion of the target gene. For example, a gene insertion site located in an intermediate position within the sequence of Sequence ID No. 1 or Sequence ID No. 2 (for example, within 800 bp to 1200 bp from the 5' end towards the 3' end) can be arbitrarily determined, and a vector containing an upstream sequence (5' homology arm) and a downstream sequence (3' homology arm) can be prepared and used based on that position, but is not limited thereto.

[0041] The aforementioned target gene means a gene to be inserted into the genome of a microorganism of the genus Schizochytrium, and may be a gene to be expressed in the Schizochytrium microorganism and / or a coding gene for a protein (target protein) to be produced in the Schizochytrium microorganism. In the DNA structure provided in this application, the target gene may be one or more (for example, two, three, four, five, six, seven, eight, nine, or ten).

[0042] For example, the target gene may be a coding gene for the target protein, a non-coding sequence such as a regulatory sequence (e.g., a transcription factor), or a combination thereof.

[0043] For example, the target protein may refer to all proteins that can be usefully used in a variety of industrial fields such as pharmaceuticals, food, cosmetics, agriculture, animal feed, and fertilizers. For example, the target protein may be one or more selected from the group consisting of antibodies (e.g., mammalian (e.g., human)-derived immunoglobulins (IgG (e.g., IgG1, IgG2, IgG3, IgG4, etc.), IgA, IgD, IgM, IgE, etc.)), antibody parts (e.g., heavy chain variable region and / or light chain variable region, heavy chain and / or light chain, Fc, CH3, CH2-CH3, hinge, etc.), antibody fragments (e.g., Fab fragment, F(ab)2 fragment, Fv, scFv, scFv-Fc, etc.), antibody analogs (e.g., multibody containing multiple antigen-binding domains (e.g., diabody, triabody, tetrabody, etc.), single-domain antibodies, affibody, etc.), receptors, growth factors, enzymes, hormones, transport (or efflux) proteins, fluorescent proteins, etc.), but is not limited thereto.

[0044] The target genes, taking into consideration the genome size of the host cell (Schizochytrium microorganism), are roughly 30-100,000 bp, 30-75,000 bp, 30-5,000 bp, 30-25,000 bp, 30-20,000 bp, 30-15,000 bp, 30-10,000 bp, 30-7,500 bp, 30-5,000 bp, 30-2,500 bp, 30-1,000 bp, and 1 The sizes may be, but are not limited to, 00-100,000 bp, 100-75,000 bp, 100-5,000 bp, 100-25,000 bp, 100-20,000 bp, 100-15,000 bp, 100-10,000 bp, 100-7,500 bp, 100-5,000 bp, 100-2,500 bp, or 100-1,000 bp.

[0045] For example, the DNA structure may be an expression vector for the expression of the target gene in a microorganism of the genus Schizochytrium.

[0046] For example, if the target gene is a protein coding sequence, the DNA structure may additionally include one or more regulatory elements selected from the group consisting of, for example, replication origins, promoters, enhancers, polyadenylation signals, terminators, protein transfer and / or degradation signals. In this case, the regulatory elements may be operatively, operably linked to the target gene. In another example, the DNA structure may additionally include one or more elements selected from the group consisting of, for example, selection markers and reporter genes, for confirmation of insertion into the genome.

[0047] The selection markers are for confirming whether the DNA structure has been inserted into the genome of a Schizochytrium microorganism or for selecting Schizochytrium strains in which the DNA structure has been inserted. They can be appropriately selected from all selection markers available for selecting Schizochytrium strains, and are not limited to, for example, markers that confer selectable phenotypes such as drug (antibiotic) resistance, nutritional requirements (metabolism-related enzymes), resistance to cytotoxic agents, or expression of surface mutant proteins. For example, the selection marker may be one or more selected from the group consisting of ampicillin resistance genes, tetracycline resistance genes, kanamycin resistance genes, chloramphenicol resistance genes, streptomycin resistance genes, neomycin resistance genes, blasticidin resistance genes, zeocin resistance genes, hygromycin resistance genes, puromycin resistance genes, paromomycin resistance genes, thymidine kinase (TK) genes, dihydrofolate reductase (DHFR) genes, glutamine synthetase (GS) genes, etc., but is not limited to these. Examples of the reporter gene may include one or more selected from the group consisting of fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), and cyan fluorescent protein (CFP), as well as luciferase, but is not limited to these.

[0048] The insertion of the aforementioned DNA structure into the genome of a microorganism of the genus Schizochytrium may be performed by one or more methods selected from the group consisting of homologous recombination (e.g., homology-induced repair (HDR)) and non-homologous end joining (NHEJ), but is not limited to these methods.

[0049] The DNA structure may be for the intragenomic transmission (e.g., within a high-expression region) and / or insertion of the target gene in a microorganism of the genus Schizochytrium, and / or for the expression of the target gene in the microorganism of the genus Schizochytrium.

[0050] Furthermore, as described above, since the DNA structure can insert the target gene into a high-expression region within the genome of a microorganism of the genus Schizochytrium, it can have the function of expressing (e.g., highly expressing) the target gene in a microorganism of the genus Schizochytrium, or producing (e.g., producing at a high level) the "target protein coded by the target gene and / or metabolites (intermediate products and / or final products) of metabolic pathways in which the target protein is involved" (hereinafter referred to as "target product").

[0051] Therefore, the DNA structure is Transduction and / or insertion of target genes within the genome of microbial species of Schizochytrium (e.g., within a target site (high-expression region)), Expression of the target gene in microorganisms of the genus Schizochytrium, Production of target products in microorganisms of the genus Schizochytrium, or a combination of two or more of these It may also have the function of

[0052] Therefore, other examples include compositions for insertion and / or transmission of a target gene within the genome of a microbial species of Schizochytrium (e.g., within a target site (high-expression region)), and / or compositions for expression of the target gene in the microbial species of Schizochytrium, comprising the aforementioned DNA structures.

[0053] Other examples include applications of the DNA structure for the insertion and / or transmission of a target gene within the genome of a microbial species of the genus Schizochytrium (e.g., within a target site (high-expression region)), and / or for the expression of the target gene in the microbial species of Schizochytrium.

[0054] Other examples include a method for inserting and / or transmitting a target gene into the genome of a Schizochytrium microorganism (e.g., within a target site (high-expression region)), a method for expressing the target gene in the Schizochytrium microorganism, and / or a method for producing Schizochytrium microorganisms for use in the production of a target product, which includes the step of introducing the DNA structure into the Schizochytrium microorganism.

[0055] Other examples provide microorganisms of the genus Schizochytrium containing the aforementioned DNA structure.

[0056] In this application, the microorganism of the genus Schizochytrium may be one or more species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, Schizochytrium minutum, etc., but is not limited thereto. More specifically, the microorganism of the genus Schizochytrium may be one or more species selected from the following strains, but is not limited thereto: Schizochytrium sp.CD01-5000(KCTC 14344BP), Schizochytrium sp.CD01-5004(KCTC 14345BP), Schizochytrium sp.CD01-1821(KCTC 14660BP), Schizochytrium sp.CD01-2147(KCTC 14661BP), Schizochytrium sp.CD01-1003(KCTC 15201BP), Schizochytrium sp.CD02-8025(KCTC 15246BP), and Schizochytrium sp.CD03-7004(KCTC 15006BP).

[0057] A microorganism of the genus Schizochytrium containing the DNA structure provided in this application may have increased expression of the target gene contained within the DNA structure and / or increased production of target products related to the target gene (the target protein coded by the target gene and / or metabolites (intermediate and / or final products) of metabolic pathways in which the target protein is involved) compared to a microorganism of the genus Schizochytrium that does not contain the DNA structure (for example, a wild-type microorganism of the genus Schizochytrium and / or a microorganism of the genus Schizochytrium that contains the DNA structure at a site other than the target site).

[0058] Other examples include compositions for producing a target product, comprising the aforementioned DNA structure, a microorganism of the genus Schizochytrium containing the DNA structure, or a combination thereof.

[0059] Other examples provide applications for the production of target products using the DNA structure, a Schizochytrium microorganism containing the DNA structure, or a combination thereof.

[0060] Another example provides a method for producing a target product using a Schizochytrium microorganism, comprising the step of culturing the Schizochytrium microorganism containing the DNA structure. The method may additionally include a step of preparing the Schizochytrium microorganism containing the DNA structure prior to the culturing step.

[0061] The preparation step may include the step of producing or obtaining a microorganism of the genus Schizochytrium containing the DNA structure. For example, the step of preparing a microorganism of the genus Schizochytrium containing the DNA structure may include the step of introducing the DNA structure into the microorganism of the genus Schizochytrium. For example, if the introduction is performed by a site-specific endonuclease system, the step of introducing the DNA structure into the microorganism of the genus Schizochytrium may additionally include the step of introducing a site-specific endonuclease system into the microorganism of the genus Schizochytrium.

[0062] The culturing step can be carried out under normal conditions suitable for culturing and / or gene expression in Schizochytrium microorganisms. The culturing means growing Schizochytrium microorganisms under appropriately controlled environmental conditions. The culturing can be carried out using appropriate culture media and conditions for Schizochytrium microorganisms known in the art, and may be appropriately modified by a skilled technician. The culturing method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof. The culture medium means a mixture mainly consisting of nutrients necessary for culturing the Schizochytrium microorganisms of this application, and may be for supplying nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the culture medium and other culture conditions can be applied without special restrictions as long as they are culture media and culture conditions normally used for culturing Schizochytrium microorganisms. For example, Schizochytrium microorganisms can be cultured in a normal culture medium containing a suitable carbon source, nitrogen source, phosphorus source, inorganic compounds, amino acids and / or vitamins, while adjusting the temperature, pH, humidity, atmospheric conditions, etc.

[0063] The method for producing the target product may additionally include, after the culturing step, a step of separating, recovering, and / or purifying the target product. The separation, recovery, and / or purification can be carried out under normal conditions for microorganisms of the genus Schizochytrium. [Effects of the Invention]

[0064] The novel vector composition of the present invention contains sequences homologous to gene overexpression sites excavated in Schizochytrium strains within a range of +20kbp and -20kbp. Each gene overexpression vector contains a left-side homologous sequence and a right-side homologous sequence to the gene overexpression site, with a promoter, target gene, and terminator between the two sequences. Such gene overexpression vectors utilizing gene overexpression sites should contribute to the expansion of Schizochytrium-based gene expression technology and the acceleration of strain development. [Brief explanation of the drawing]

[0065] [Figure 1] This graph shows the fluorescence analysis results of a schizochytrium green fluorescent protein transformant. [Figure 2] This is a gel electrophoresis image showing the results of PCR performed to confirm the presence or absence of homologous recombination at different gene expression sites. [Figure 3] This graph shows the results of comparing the fluorescence intensity of transformants in which the green fluorescent protein gene was inserted at the high-expression site (Site 1) on a homologous recombination substrate. [Figure 4] This graph shows the results of comparing the fluorescence intensity of transformants in which the green fluorescent protein gene was inserted at the high-expression site (Site 2) on a homologous recombination substrate. [Figure 5] This is a cleavage map of pUC19-sfGFP-Zeo. [Figure 6] This is a fracture map of pUC19-HR(site1)-GsfGFPZeoG-HR(site1). [Modes for carrying out the invention]

[0066] The present application will be described in more detail below through examples and experimental examples. However, these examples and experimental examples are for illustrative purposes only, and the scope of this application is not limited to these examples and experimental examples. [Examples]

[0067] Example 1. Securing a high-expression site for the Schizochytrium microalgae gene. To identify high-expression sites for Schizochytrium microalgae genes, a vector composition expressing green fluorescent protein (pUC19-sfGFP-Zeo) was created by inserting a gene encoding green fluorescent protein into pUC19 (Plasmid#50005, Addgene) (see Figure 5), and this was then used to transform microalgae.

[0068] The nucleic acid sequence (SEQ ID NO: 3) of the aforementioned green fluorescent protein (GFP) coding gene is as follows: cgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggac

[0069] 50 mL of GYPS medium (20 g / L glucose, 6 g / L peptone, 2 g / L yeast extract, 12.5 g / L solar salt, 17.1 g / L sucrose) was placed in a 250 mL flask, and then the microalga Schizochytrium sp. CD01-2147 (KCTC 14661BP) was inoculated and cultured for 48 hours. The cultured microalgae were transferred to two EP tubes, 1 mL each, and then centrifuged for 1 minute. After removing the supernatant of the centrifuged microalgae culture, the separated microalgae precipitate was dissolved in 1XBSS solution (10 mM KCl, 10 mM NaCl, and 3 mM CaCl2) and then centrifuged. After removing the supernatant from the centrifuged sample, the microalgae precipitate was dissolved in 50 mM sucrose, followed by centrifugation. This process was repeated a total of three times. Subsequently, 0.1 mL of 50 mM sucrose was added to the microalgae precipitate from which the supernatant had been removed and dissolved.

[0070] The microalgae prepared in this manner were transformed with the prepared green fluorescent protein expression vector (Figure 5) by electroporation, and a total of 105 types of schizochytrium transformants into which the green fluorescent protein gene was introduced were obtained. In the case of these transformants, the green fluorescent protein gene is inserted at an arbitrary gene position, and they can have different fluorescence expression levels from one another.

[0071] To analyze the expression levels of green fluorescent protein in the 105 tested transformants, the fluorescence intensity of each transformant was measured and compared. More specifically, a filter capable of detecting the 509 nm fluorescence emission wavelength band of green fluorescent protein was set using a flow cytometer, and the fluorescence intensity emitted around this wavelength band was measured for each transformant. The results are shown in Figure 1.

[0072] Based on the fluorescence intensity measurement results, the top six transformants exhibiting high fluorescence intensity were selected.

[0073] The high-expression gene sites were finally identified by analyzing the gene insertion sites of the top six transformants with high fluorescence expression levels selected as described above.

[0074] To this end, through genetic analysis of the six selected transformants, it was confirmed that in five of the six transformants, the foreign gene (green fluorescent protein gene) was inserted at the same location, Contig 3, 2001468 (SEQ ID NO: 1) (HindIII, SCH_00001433, Similar to AIH: Aginatine deaminase (Arabidopsis thaliana)) (hereafter, this gene overexpression site will be explicitly referred to as site 1), and in one transformant, it was inserted at Contig 3, 1116023 (SEQ ID NO: 2) (HindIII, SCH_00001298, Similar to cyc: Cytochrome C (Lampetra tridentata)) (hereafter, this gene overexpression site will be explicitly referred to as site 2).

[0075] Example 2. High expression of foreign genes through homologous recombination to high gene expression sites in Schizochytrium microalgae. The possibility of high gene expression using the high gene expression sites discovered in Example 1 was confirmed through transformation of a homologous recombination technology platform. Green fluorescent protein genes were inserted into Site 1 (SEQ ID NO: 1) and Site 2 (SEQ ID NO: 2), discovered in Example 1, using homologous recombination technology or random insertion.

[0076] The vector for homologous recombination was designed as follows: Using the insertion site within the gene high-expression site Site 1 or Site 2 as a reference, sequences in the 800-1500 bp length range were amplified on both the left and right sides to secure arm sequences for homologous recombination. Table 2 shows the arm arrays typically used in this embodiment:

[0077] [Table 2] JPEG2026521763000005.jpg192149

[0078] Furthermore, the green fluorescent protein coding gene, the antibiotic resistance gene expression site, and the backbone were amplified using the random insertion vector (pUC19-sfGFP-Zeo; Figure 5) used in Example 1. The amplified sequences were cloned together with the homologous recombination arm sequences amplified from Site 1 and Site 2 using the Gibson assembly method (Gibson assembly®; NEB) to obtain homologous recombination vectors targeting Site 1 and Site 2, respectively. To illustrate the structure of the homologous recombination vectors, a homologous recombination vector targeting Site 1 (pUC19-HR(site1)-GsfGFPZeoG-HR(site1)) is shown in Figure 6.

[0079] The primer sequences used in the preparation of the homologous recombinant vector are described below: (Primers for amplifying green fluorescent protein coding genes or antibiotic resistance genes) Forward-facing primer: CCTCCTCTTCTGTTCGTGCAAGCATATGACGGTACCCTTGATCTTGTG (Sequence No. 8) Reverse primer: AGGGGCCATGTGGAGTTTCAGAATATTGGCATGCCTTGAAGC (SEQ ID NO: 9) (Backbone) Forward-directing primer: ATCATCATTGACACATCTAATGTTGTTAAGCTTGGCGTAATCATG (Sequence ID 10) Reverse primer: CCGGTTATGAGATCGGGCCTCGTGCACTGAGCTCGAATTCACTGG (Sequence No. 11)

[0080] For the production of the aforementioned random insertion vector, the sequence from the promoter to the terminator was amplified from the vector (pUC19-sfGFP-Zeo) produced in Example 1 via a PCR reaction.

[0081] Using the prepared vector and amplified PCR reaction product, schizochytrium microalgae were transformed using electroporation, and the transformed organisms were obtained by screening in a culture medium containing the antibiotic (zeocin).

[0082] The expression levels (fluorescence intensity) of homologous recombinant transformants transformed with the prepared homologous recombination vector and random insertion transformants transformed with the random insertion vector were measured and compared based on the presence or absence of gene insertion at the high-expression site (see Example 1).

[0083] We obtained 30 different transformants for each site by attempting to insert green fluorescent protein into a gene overexpression site via homologous recombination, and a total of 60 transformants were subjected to polymerase chain reaction (PCR)-based genotype confirmation. For PCR, we designed an oligomer (primer) pair in which one of two oligomers selectively attaches to the gene overexpression site, and the other selectively attaches to the inserted green fluorescent protein gene. PCR was then performed using this oligomer pair.

[0084] The Site 1 transformation validation primer sequences are as follows: Forward primer: TTCCTTCTGAAGAAGGGTCGTTGGTCT (Sequence ID 12) Reverse primer:CCAGGAAAGGACTTGAGATG (Sequence ID 13)

[0085] The Site 2 transformation validation primer sequences are as follows: Forward primer:GAAAAGGACTTGTGCCTC (Sequence ID 14) Reverse primer:CCAGGAAAGGACTTGAGATG (Sequence ID 15)

[0086] The PCR reaction conditions are as follows: Temperature: 53℃, Cycle: 35, Taq polymerase used

[0087] Through this type of PCR, if the green fluorescent protein gene is inserted into the high-expression sites (Site 1 and Site 2) via homologous recombination, a DNA section of approximately 1500 bp can be obtained.

[0088] The PCR results are shown in Figure 2. As shown in Figure 2, when homologous recombination-based transformation of green fluorescent protein was attempted on Site 1, it was confirmed that gene insertion based on homologous recombination occurred in 2 out of a total of 30 transformants (transformers 1 and 7) on Site 1. In the case of Site 2, it was confirmed that gene insertion based on homologous recombination occurred in a total of 11 out of a total of 30 transformants (transformers 2, 5, 6, 8, 13, 14, 16, 18, 19, 20, and 29).

[0089] As described above, the green fluorescent protein expression levels of 30 transformants (60 in total) obtained through homologous recombination attempts at different gene high-expression sites were measured and compared. The green fluorescent protein expression levels were measured by inoculating each microalgae Schizochytrium transformant into 50 mL of GYPS medium in a 250 mL flask, culturing for 48 hours, and then observing the fluorescence intensity. For comparison, a wild-type (WT) strain without the green fluorescent protein gene insertion was used as a control group.

[0090] The results obtained are shown in Figure 3 (fluorescence intensity of transformants with the green fluorescent protein gene inserted at the high gene expression site (Site 1)) and Figure 4 (fluorescence intensity of transformants with the green fluorescent protein gene inserted at the high gene expression site (Site 2)).

[0091] As shown in Figure 3, the average fluorescence expression level (AU) of Site 1 gene-high-expression site-based homology recombinant transformants 1 and 7 was 714.61, which was superior to the average fluorescence expression level (499.51) of 28 transformants in which genes were randomly inserted into non-site gene locations.

[0092] Furthermore, as shown in Figure 4, the average fluorescence expression level (AU) of the 11 Site 2 gene-high-expression-based homology recombinant transformants was 841.54, which was superior to the average fluorescence expression level (657.05) of the 19 transformants in which genes were randomly inserted into non-site gene locations.

[0093] Furthermore, when transformants were sorted in descending order based on fluorescence expression levels, it was confirmed that transformants in which the green fluorescent protein gene was specifically inserted into high-expression gene sites (Site 1, Site 2) via homologous recombination generally exhibited superior fluorescence expression levels. [Accession Number]

[0094] Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC14344BP Date of acceptance: 20201026 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC14345BP Date of acceptance: 20201026 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC14660BP Date of acceptance: 20210823 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC14661BP Date of acceptance: 20210823 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC15201BP Date of acceptance: 20221121 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC15246BP Date of acceptance: 20221215 Depository name: Korea Biotechnology Research Institute Bioresource Center (KCTC) Accession number: KCTC15006BP Date of acceptance: 20220620

Claims

1. A DNA structure comprising a 5' homology arm, a target gene, and a 3' homology arm, The aforementioned DNA structure is for inserting the target gene into a target site within the genome of a microorganism of the genus Schizochytrium. The aforementioned target site corresponds to sequence number 1, sequence number 2, or a nucleic acid sequence having 95% or more homology thereto in the genome of a microorganism of the genus Schizochytrium. The 5' homology arm can be hybridized within a region of 100,000 bp upstream of the target gene insertion site within the target site. The 3' homology arm is capable of being hybridized within a region of 100,000 bp or less downstream of the target gene insertion site within the target site. DNA structure.

2. The DNA structure according to claim 1, wherein the 5' homology arm and the 3' homology arm each independently have a size of 20 to 5000 bp.

3. The DNA structure according to claim 1, wherein the 5' homology arm and the 3' homology arm each independently have a size of 500 to 2,000 bp.

4. The DNA structure according to claim 1, wherein the target gene has a size of 30 to 100,000 bp.

5. The DNA structure according to claim 1, further comprising one or more selected from the group consisting of an expression regulatory sequence, a selection marker, and a reporter gene.

6. The DNA structure according to claim 1, wherein the insertion is performed by one or more selected from the group consisting of homologous recombination (e.g., homology direct repair (HDR)) and non-homologous end joining (NHEJ).

7. The DNA structure according to any one of claims 1 to 6, wherein the microorganism of the genus Schizochytrium is one or more species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

8. The aforementioned DNA structure is Transduction of the target gene within the genome of the aforementioned Schizochytrium microbial microorganisms, Expression of the target gene in the aforementioned Schizochytrium microorganisms, or All of these A DNA structure according to any one of claims 1 to 6, for the purpose of...

9. A composition for expressing a target gene in a microorganism of the genus Schizochytrium, comprising a DNA structure according to any one of claims 1 to 6.

10. A microorganism of the genus Schizochytrium comprising the DNA structure according to any one of claims 1 to 6.

11. The Schizochytrium microorganism according to claim 10, wherein the Schizochytrium microorganism is one or more species selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

12. A composition for producing a target product, comprising a DNA structure according to any one of claims 1 to 6, a microorganism of the genus Schizochytrium containing the DNA structure, or a combination thereof.

13. A method for producing a microorganism of the genus Schizochytrium for use in the production of a target product, comprising the step of introducing a DNA structure according to any one of claims 1 to 6 into a microorganism of the genus Schizochytrium.

14. A method for producing a microorganism of the genus Schizochytrium for use in producing a target product, according to claim 13, wherein the Schizochytrium microorganism is one or more selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

15. A step of culturing a microorganism of the genus Schizochytrium containing the DNA structure of any one of claims 1 to 6. A method for producing a target product using microorganisms of the genus Schizochytrium, including the above.

16. A method for producing a target product using a microorganism of the genus Schizochytrium according to claim 15, further comprising the step of preparing a microorganism of the genus Schizochytrium containing the DNA structure prior to the culturing step.

17. The method for producing a target product using a microorganism of the genus Schizochytrium according to claim 16, wherein the step of preparing a microorganism of the genus Schizochytrium containing the DNA structure includes the step of introducing the DNA structure into the microorganism of the genus Schizochytrium.

18. The method for producing a target product using a microorganism of the genus Schizochytrium according to claim 15, wherein the microorganism of the genus Schizochytrium is one or more selected from the group consisting of Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium aggregatum, and Schizochytrium minutum.

Images