Compositions and methods for the treatment of spinal muscular atrophy

Abstract

An expression cassette and a recombinant AAV vector containing the same are provided for the delivery of a nucleotide sequence encoding hSMN1. The provided composition is useful in a method for treating spinal muscular atrophy (SMA) in subjects requiring such treatment.

Description

[Technical Field]

[0001] Reference to electronic sequence listings The electronic sequence listing filed with this specification, named "21-10509.PCT.xml" (53,945 bytes, created on 8 August 2024), is incorporated herein by reference in its entirety. [Background technology]

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive disorder caused by mutations in the SMN1 gene, which result in reduced expression of motor neuron survival (SMN) protein. It is the most common genetic cause of infant mortality, with a global incidence of SMA of approximately 1 in 10,000 live births. SMN proteins play a role in spliceosome assembly, protein translation, cytoskeletal dynamics, and mitochondrial function. The destruction of motor units (motor neurons and the muscle fibers they innervate) underlies the most prominent clinical manifestations of SMA (skeletal muscular atrophy). Infants with SMA type 1 have severe signs of hypotonia, as well as progressive respiratory and swallowing difficulties. Patient management typically includes physiotherapy, orthopedic support, respiratory care, and management of bulbar dysfunction.

[0003] Several therapies have been developed for SMA, including nusinersen (Spinraza), onasemnogene abeparvovec (Zolgensma), and adeno-associated virus (AAV)-mediated gene therapy, which are antisense oligonucleotides that alter the splicing of the SMN2 protein, as well as risdiplam (Evrysdi), a modifier of SMN2 protein splicing. While there has been significant progress in the treatment of SMA, these therapies are expensive and may require repeated doses (in the case of nusinersen and risdiplam). AAV-mediated gene therapy is effective with a single dose, but the current FDA-approved product for the treatment of SMA type I (Zolgensma) is expensive and has been associated with several cases of serious toxicity, including acute liver failure. Furthermore, its safety profile currently prohibits the extended use of Zolgensma in elderly SMA II / III patients with lower severity.

[0004] There is a need for improved treatments for SMA that are effective in improving the symptoms of the disorder while reducing the potential for toxic side effects. [Overview of the Initiative]

[0005] In one embodiment, a recombinant adeno-associated virus (AAV) comprising an AAV capsid containing a vector genome is provided herein, wherein the vector genome comprises an expression cassette comprising (a) a UbC promoter sequence, (b) a coding sequence for a functional human motor neuron survival 1 (SMN1) protein, (c) at least four miR182 target sequences, and (d) a poly-A sequence, the coding sequence, at least four miR182 target sequences, and poly-A sequence are operably linked to the UbC promoter sequence. In a particular embodiment, the recombinant AAV according to claim 1, wherein the SMN1 protein is the SMN1 isoform D protein. In a particular embodiment, the coding sequence comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% identical to SEQ ID NO: 7. In a particular embodiment, the recombinant AAV is not a self-complementary AAV vector.

[0006] In another embodiment, compositions comprising a stock of recombinant AAV in an aqueous suspension medium are provided herein. In a particular embodiment, the suspension is formulated for intrathecal delivery and optional In terms of choice, intrathecal delivery is either intraventricular (ICV) injection or intracisional cisternus (ICM) injection.

[0007] In another embodiment, a pharmaceutical composition comprising recombinant AAV and an aqueous formulation buffer is provided herein. In certain embodiments, the composition is formulated for intrathecal delivery. In certain embodiments, the composition is formulated for intraventricular (ICV) or intracisional (ICM) injection.

[0008] In yet another embodiment, a recombinant nucleic acid molecule is provided herein, comprising an expression cassette comprising (a) a 5'AAV ITR sequence, (b) a UbC promoter sequence, (c) a coding sequence for a functional human motor neuron survival 1 (SMN1) protein, (d) at least four miR182 target sequences, (e) a poly-A sequence, and (f) a 3'AAV ITR sequence, wherein the coding sequence, at least four miR182 target sequences, and poly-A sequence are operably linked to the UbC promoter sequence. In a particular embodiment, the SMN1 protein is the SMN1 isoform D protein. In a particular embodiment, the coding sequence comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence at least 95% identical to SEQ ID NO: 7. In a particular embodiment, a plasmid comprising the nucleic acid is provided. In a further embodiment, a packaging host cell comprising the recombinant nucleic acid molecule or plasmid is provided herein.

[0009] In another embodiment, a recombinant AAV production system useful for producing recombinant AAV is provided herein.

[0010] In yet another embodiment, a method for treating spinal muscular atrophy (SMA) in a subject requiring treatment is described herein, the method comprising administering an aqueous suspension containing recombinant AAV as described herein to the subject. In certain embodiments, the subject has type I (Werdnig-Hoffmann disease), type II (Dubowitz disease), type III (Kugelberg-Welander disease), or type IV (adult) SMA.

[0011] These and other aspects of the present invention will become apparent from the following detailed description of the invention. [Brief explanation of the drawing]

[0012] [Figure 1] A schematic diagram of the rAAV.hSMN1 vector genome is provided. [Figure 2] This shows an ISH for detecting hSMN1 expression in wild-type liver after IV administration of vectors using different promoters. [Figure 3] This shows the survival of SMNΔ7 mice after administration of the AAVhu68.hSMN1 vector. [Figure 4] This shows the body weight of SMNΔ7 mice after administration of the AAVhu68.hSMN1 vector. [Figure 5] The righting reflex (left) and gripping (right) responses of SMNΔ7 mice after administration of the AAVhu68.hSMN1 vector are shown. [Figure 6] This shows the survival, body weight, and grip response scores of C57BL / 6J mice after ICV administration of the AAVhu68.hSMN1 vector. [Figure 7A] The level of neuronal transduction (A) is shown by measuring transduced motor neurons using ISH (ChAT + hSMN1 transgene + cells), and cardiac pathology scores are shown after ICV administration of AAVhu68.CB7.CI.hSMN1co.rBG or AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG vectors to SMNΔ7 mice. [Figure 7B]The level of neuronal transduction (A) is shown by measuring transduced motor neurons using ISH (ChAT + hSMN1 transgene + cells), and cardiac pathology scores are shown after ICV administration of AAVhu68.CB7.CI.hSMN1co.rBG or AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG vectors to SMNΔ7 mice. [Figure 8A] Figure 9B shows the expression levels of hSMN1 (ISH intensity) after ICM administration of the AAVhu68.CB7.CI.hSMN1co.rBG(CB7), AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG(CB7.4xmiR182), and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG(UBC.4xmiR182) vectors (A), as well as the quantification of SMN+ChAT+ cells. [Figure 8B] Figure 9B shows the expression levels of hSMN1 (ISH intensity) after ICM administration of the AAVhu68.CB7.CI.hSMN1co.rBG(CB7), AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG(CB7.4xmiR182), and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG(UBC.4xmiR182) vectors (A), as well as the quantification of SMN+ChAT+ cells. [Figure 9] The results of clinicopathological studies, including CSF WBC count (left) and CSF RBC count (right), after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown. [Figure 10] The results of nerve conduction studies after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown. [Figure 11]The results from the evaluation of DRG neurodegeneration after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown. [Figure 12] The results of the evaluation of spinal cord axonal damage after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown. [Figure 13A] The results from scoring the severity of axonal damage after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown (A). [Figure 13B] The results from NfL measurements in CSF on day 29 after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP are shown (B). [Figure 14A] This shows the spinal cord axonal injury score in CSF(A) relative to NfL levels after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP. [Figure 14B] This shows the spinal cord axonal injury score in serum (B) with NfL levels after ICM administration of AAVhu68.CB7.CI.hSMN1co.rBG, AAVhu68.CB7.CI.hSMN1co.4xmiR182.rBG, and AAVhu68.UbC.PI.hSMN1co.4xmiR182.rBG vectors to NHP. [Figure 15] This study demonstrates the survival of SMNΔ7 mice after ICV administration of various doses of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector. [Figure 16] This shows the survival of wild-type mice after ICV administration of various doses of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector. [Figure 17] This shows the body weight of SMNΔ7 mice after ICV administration of various doses of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector. [Figure 18] This shows the body weight of wild-type mice after ICV administration of various doses of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector. [Figure 19] The results from the evaluation of righting reflexes in SMNΔ7 mice after ICV administration of the indicated dose of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector are shown. [Figure 20] The results from the evaluation of the hindlimb grip response in wild-type mice after ICV administration of the indicated dose of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector are shown. [Figure 21] The results from the evaluation of the hindlimb gripping response in SMNΔ7 mice after ICV administration of the AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG vector are shown. [Figure 22] The results of a nerve conduction study (NCS) after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are shown. [Figure 23] The results of a clinicopathological study, including CSF WBC count (top left), CSF RBC count (top right), CSF protein level (bottom left), and CSF glucose level (bottom right), after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP, are shown. [Figure 24]The results of evaluating liver enzyme levels after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are shown. [Figure 25A] The results of liver function assessment by detection of total protein, albumin, globulin, and albumin / globulin ratio (A / G) (A) after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are shown. [Figure 25B] The results of liver function evaluation by measuring creatine levels (B) after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are shown. [Figure 25C] The results of liver function evaluation by measuring blood urea nitrogen (BUN) levels (C) after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are shown. [Figure 26] The results of hematological clinical pathological evaluation after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to NHP are presented. [Modes for carrying out the invention]

[0013] Recombinant adeno-associated virus (AAV) vectors having an AAV capsid containing nucleic acid having a sequence encoding the human motor neuron survival (SMN1) gene under the control of a regulatory sequence are provided herein. The vectors, and compositions containing these vectors, are useful for treating SMA in patients requiring such treatment.

[0014] Spinal muscular atrophy, or proximal spinal muscular atrophy (SMA), is a genetic, neurodegenerative disorder characterized by the loss of motor neurons in the spinal cord. SMA is an early-onset autosomal recessive disorder and is currently a leading cause of death among infants. The severity of SMA varies from patient to patient and is therefore classified into different types depending on the age of onset and motor development milestones. The designation of SMA 0 is proposed to reflect prenatal onset and severe joint contractures, bilateral facial nerve palsy, and respiratory failure. Three postnatal forms of SMA have been designated. Type I SMA (also known as Werdnig-Hoffmann disease) is the most severe form, presenting at birth or within 6 months and typically leading to death within 2 years. Children with type II SMA are unable to sit or walk and have severe respiratory impairment. Type II SMA is an intermediate form that develops within the first two years. Children with type II SMA can sit but cannot stand or walk. Type III (also known as Kugelberg-Welander disease) begins between 18 months and 2 years of age (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531-1536) and usually has a chronic progression. Children with type III SMA can stand and walk without assistance at least in infancy. The adult form (type IV) is the mildest form of SMA, developing after the age of 30, and very few cases have been reported. Types III and IV SMA are also known as late-onset SMA.

[0015] The molecular basis of SMA stems from the loss of both copies of the survival motor neuron gene 1 (SMN1), which is a protein that is part of a multiprotein complex thought to be involved in snRNP biodevelopment and recirculation, and may also be known as the SMN telomere. SMN2, a nearly identical gene, also known as the SMN centromere, resides in a replicated region on chromosome 5ql3 and regulates disease severity. Expression of the normal SMN1 gene results in the expression of only the survival motor neuron (SMN) protein. While SMN1 and SMN2 may encode the same protein, SMN2 contains a translationally silent mutation at the +6 position of exon 7, resulting in inefficient inclusion of exon 7 in the SMN2 transcript. Therefore, the dominant form of SMN2 is the cleaved form lacking the unstable and inactive exon 7 (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). Expression of the SMN2 gene results in approximately 10–20% of SMN proteins and 80–90% of unstable / non-functional SMN delta 7 proteins. SMN proteins play well-established roles in spliceosome assembly and can also mediate mRNA transport in neuronal axons and nerve terminals.

[0016] As used herein, “patient,” “subject,” or “individual” refers to mammals, including humans, veterinary or agricultural animals, domestic or companion animals, and animals typically used in clinical research. In certain embodiments, the subject is human.

[0017] The terms “comprise,” “comprises,” and “comprising” should be interpreted comprehensively, not exclusively. The terms “consist,” “consisting,” and their variations should be interpreted exclusively, not comprehensively. While various embodiments herein are indicated using the word “comprising,” in other contexts, relevant embodiments are also intended to be included and described using the words “consisting of” or “consisting essentially of.” As used throughout this specification and the claims, the terms “comprising,” “containing,” and “including,” and their variations, include other components, elements, integers, steps, etc. Conversely, the term “consisting,” and its variations, exclude other components, elements, integers, steps, etc.

[0018] Please note that the terms "a" or "an" refer to one or more. Therefore, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably in this specification.

[0019] Where used herein, the terms “about” or “~” refer to a range of ±10% from a reference integer and values ​​in between, unless otherwise specified. For example, “about” 500 μM includes ±50 (i.e., integers in between, from 450 to 550). Regarding other values, particularly when referring to percentages (e.g., 90% of the taste), the term "approximately" encompasses all ranges, including both integers and fractions. As stated above, when the term “approximately” is used to modify a number, unless otherwise specified, it means a variation of ±10% from the given reference (e.g., ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, ±10, or values ​​in between). In this specification, the “maximum” number (e.g., maximum 50) includes the number (e.g., 50). The terms “in the range” or “within a range” (and similar descriptions) include the endpoint of the range stated. Also in this specification, an enumeration of numerical ranges by endpoint includes all numerical values ​​that fall within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0020] In certain cases, the term "E+ number" or "e+ number" is used to refer to an exponent. For example, "5E10" or "5e10" means 5 × 10⁻¹⁰ 10 These terms can be used interchangeably.

[0021] With regard to the description of various embodiments herein, each of the compositions described herein is intended to be useful in a different embodiment for the method of the present invention. In addition, each of the compositions described herein that is useful for the method is also intended to be an embodiment of the present invention in a different embodiment.

[0022] Unless otherwise defined herein, the technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention pertains, and by referring to published documents that provide general guidance to those skilled in the art for many of the terms used herein.

[0023] Expression Cassette In one embodiment, an engineered nucleic acid construct comprising an hSMN1 coding sequence is provided herein. The nucleic acid can be used to generate a viral vector for therapeutically delivering a transgene to a target cell of interest and / or for delivering the SMN1 coding sequence to a host cell, e.g., naked DNA or a plasmid. In a particular embodiment, an expression cassette comprising the hSMN1 sequence is provided.

[0024] As used herein, “expression cassette” refers to a nucleic acid molecule comprising a biologically useful nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, such as mRNA) and regulatory sequences operably linked thereto that direct or regulate the transcription, translation, and / or expression of the nucleic acid sequence and its gene product. In certain embodiments, the term “expression cassette” refers to a nucleic acid molecule comprising an SMN1 coding sequence and its regulatory sequences (e.g., promoter, enhancer, polyA sequence), the cassette may be packaged in the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for generating a viral vector contains the hSMN sequence described herein, and other expression regulatory sequences, such as those described herein, adjacent to the packaging signals of the viral genome. For example, in the case of an AAV viral vector, the packaging signals are a 5' inverted end repeat (ITR) sequence and a 3' ITR sequence. In certain embodiments, the term “transgene” may be used interchangeably with “expression cassette.” In other embodiments, the term “transgene” refers only to the coding sequence of a selected gene, for example, “hSMN1”.

[0025] In a particular embodiment, the expression cassette includes (a) a UbC promoter, (b) a coding sequence for a functional SMN1 protein, (c) at least four miR182 target sequences, and (d) optionally, a poly-A sequence having spacer sequences between them. Recombinant nucleic acid molecules are provided herein. In certain embodiments, the expression cassette comprises (a) a 5'AAV ITR, (b) a UbC promoter, (c) a coding sequence for a functional SMN1 protein, (d) at least four miR182 target sequences, (e) a poly-A sequence, and (f) optionally a 3'AAV ITR having spacer sequences between them. In certain embodiments, one or more of the UbC promoter, SMN1 coding sequence, miR182 target sequences, and poly-A sequences are operably linked. In certain embodiments, the expression cassette comprises additional regulatory elements (e.g., intron sequences).

[0026] As used herein, the terms “SMN1” or “hSMN1” include any isoform of SMN1 that, when delivering a composition or method provided herein, restores a desired function, alleviates a symptom, or provides another desired physiological outcome. An example provided herein is a patient unaffected by SMN deficiency or absence, utilizing isoform D, which is considered to be the longest isoform and the dominant transcript produced by the gene. Isoform D is a 294-amino acid protein [e.g., NCBI accession NM_000334 / NP_000335;ENSEMBL]. [See ID ENST00000380707] The protein sequence is reproduced in SEQ ID NO: 5, and the coding sequence is reproduced in SEQ ID NO: 6. However, a different isoform may be selected. For example, isoform B has an alternative in-frame exon in the 3' coding sequence and is shorter in length (262 amino acids) than isoform D, but results in a protein with the same N-terminus and C-terminus as that isoform. NCBI accession numbers NM_022874 / NP_075012;ENSEMBL See ID ENST00000503079. Isoform A lacks the second-to-last exon, resulting in an alternative translation stop codon compared to isoform D. Therefore, isoform A is shorter (282 amino acids) and has a distinct C-terminus compared to isoform D. See NCBI accession numbers NM_001297715 / NP_001284644; ENSEMBL ID ENSTL00000506163.

[0027] As used herein, “vector” is a biological or chemical portion comprising a nucleic acid sequence that can be introduced into a suitable target cell for replication or expression of the nucleic acid sequence. Examples of vectors include, but are not limited to, recombinant viruses, plasmids, lipoplexes, polymerosomes, polyplexes, dendrimers, cell-permeable peptide (CPP) conjugates, magnetic particles, or nanoparticles. In certain embodiments, the vector is a nucleic acid molecule into which an engineered nucleic acid encoding a functional hSMN1 may be inserted and then introduced into a suitable target cell. Such a vector preferably has one or more origins of replication and one or more sites into which recombinant DNA may be inserted. Vectors often have means for selecting cells that have the vector from cells that do not, for example, they encode drug resistance genes. Common vectors include plasmids, viral genomes, and “artificial chromosomes.” Conventional methods for generating, producing, characterizing, or quantifying vectors are available to those skilled in the art.

[0028] In certain embodiments, the vector is a nucleic acid comprising an expression cassette described herein (e.g., “Naked DNA”, “Naked Plasmid DNA”, RNA, and mRNA), and the nucleic acid may be combined with various compositions and nanoparticles, e.g., micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymers, lipids and / or cholesterol-nucleic acid conjugates, and other constructs as described herein. For example, X. Su et al, Mol. Pharmaceuticals, 2011, 8(3), pp 774-787; published online: March 21, 2011, WO2013 / 182683, WO2010 / 053572, and See also WO2012 / 170930, all of which are incorporated herein by reference.

[0029] In certain embodiments, the vectors described herein refer to synthetic or artificial viral particles, known as "replication-deficient viruses" or "viral vectors," in which an expression cassette containing a nucleic acid sequence encoding hSMN1 is packaged within a viral capsid or envelope, and any viral genome sequence packaged within the viral capsid or envelope is replication-deficient (i.e., retains the ability to infect target cells but cannot produce progeny virions).

[0030] As used herein, recombinant viral vectors are adeno-associated viruses (AAV), adenoviruses, bocaviruses, hybrid AAV / bocaviruses, herpes simplex viruses, or lentiviruses.

[0031] In certain embodiments, a host cell is provided having a nucleic acid containing an SMN1 coding sequence or an expression cassette containing an SMN1 coding sequence. In certain embodiments, the host cell contains a plasmid having the SMN1 coding sequence or an expression cassette containing an SMN1 coding sequence as described herein.

[0032] As used herein, the term “host cell” may refer to a packaging cell line on which a vector (e.g., recombinant AAV) is produced. The host cell may be a prokaryotic or eukaryotic cell (e.g., human, insect, or yeast) and may contain exogenous or heterologous DNA introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, fast DNA-coated pellets, viral infection, and protoplast fusion. Examples of host cells may include, but are not limited to, isolated cells, cell cultures, Escherichia coli cells, yeast cells, human cells, non-human cells, mammalian cells, non-mammalian cells, insect cells, HEK-293 cells, liver cells, kidney cells, central nervous system cells, nerve cells, glial cells, or stem cells.

[0033] As used herein, the term “target cells” refers to any cells in which functional hSMN1 expression is desired. In certain embodiments, the term “target cells” is intended to refer to target cells being treated for SMA that are intended to be transduced by an rAAV vector. Target cells include neuronal and non-neuronal cells. In certain embodiments, target cells may be central nervous system cells. In certain embodiments, target cells may be one or more of excitatory neurons, inhibitory neurons, glial cells, cortical cells, prefrontal cortical cells, cerebral cortical cells, and spinal cord cells. In certain embodiments, target cells may be located in the leptomeningeal membrane (LM) of the CNS. In certain embodiments, target cells may be located in the parenchyma of the CNS. In certain embodiments, target cells may include one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (visual cells), or heart.

[0034] In certain embodiments, the provided composition comprises an engineered human (h) motor neuron survival (SMN)1 coding sequence. The natural hSMN1 coding sequence is provided in SEQ ID NO: 6, which codes for the amino acid sequence of SEQ ID NO: 5.

[0035] The hSMN1 coding sequences used can be generated in vitro, synthetically, or by any other suitable method using techniques well known in the art. For example, Xiong et al, PCR-based accurate synthesis of long DNA sequences, Nature Protocol As described in ls 1,791-797 (2006), PCR-based precise synthesis (PAS) methods for long DNA sequences may be used. A method combining double asymmetric PCR and overlap extension PCR is described in Young and Dong, Two-step total gene synthesis method, Nucleic Acids Res. 2004;32(7):e59. See also Gordeeva et al, J Microbiol Methods. Improved PCR-based gene synthesis method and its application to the Citrobacter freundii phytase gene codon modification. 2010 May;81(2):147-52. Epub 2010 Mar 10. See also the following patents relating to oligonucleotide synthesis and gene synthesis, Gene Seq. 2012 Apr;6(1):10-21;US8008005; and US7985565. Each of these documents is incorporated herein by reference. In addition, kits and protocols for generating DNA via PCR are commercially available. These include the use of polymerases, including, but not limited to, Taq polymerase, OneTaq® (New England Biolabs), Q5® high-fidelity DNA polymerase (New England Biolabs), and GoTaq® G2 polymerase (Promega). DNA may also be generated from cells transfected with plasmids containing the hOTC sequences described herein. Known and commercially available kits and protocols include, but are not limited to, the QIAGEN plasmid kit, the Chargeswitch® Pro Filter plasmid kit (Invitrogen), and the GenElute® plasmid kit (Sigma Aldrich). Other techniques useful herein include sequence-specific isothermal amplification methods that eliminate the need for heat circulation. Instead of heating, these methods typically use Bst. to separate double-stranded DNA. DNA polymerase, such as strand-displacement DNA polymerase (Large Fragment, New England Biolabs), is used. DNA can also be produced from RNA molecules by amplification via the use of reverse transcriptase (RT), an RNA-dependent DNA polymerase. RT is complementary to the original RNA template and polymerizes a strand of DNA called cDNA. This cDNA can then be further amplified by PCR or isothermal methods as outlined above. Custom DNA can also be commercially produced by companies including, but not limited to, GenScript, GENEWIZ®, GeneArt® (Life Technologies), and Integrated DNA Technologies.

[0036] "Functional hSMN1" refers to a gene encoding the SMN protein that provides at least about 50%, at least about 75%, at least about 80%, at least about 90%, or nearly the same as, or greater than 100%, the biological activity level of the native motor neuron survival protein, or its native variant or polymorph that is not associated with disease. Furthermore, the SMN1 homolog, SMN2, also encodes the SMN protein, but does not process the functional protein as efficiently. Based on the copy number of SMN2, subjects lacking the functional hSMN1 gene exhibit varying degrees of SMA. Therefore, for some subjects, it may be desirable for the hSMN1 protein to provide less than 100% of the biological activity of the native SMN1 protein. In certain embodiments, the terms "hSMN1," "functional hSMN1," and "SMN1" are used interchangeably.

[0037] Various assays exist for measuring SMN expression and activity levels in vitro. See, for example, Tanguy et al, 2015 mentioned above. The methods described herein can also be combined with any other therapies for the treatment of SMA or its symptoms. In certain embodiments, the standard treatment may include nusinersen, and this This is an SMN2 premessenger ribonucleic acid (mRNA) targeted antisense oligonucleotide (ASO) approved by the FDA and EMA [SPINRAZA®, Biogen]. See, for example, U.S. Patents 6,166,197, US6,210,892, US7,101,993, US7,838,657, US8,110,560, US8,361,977, and US8,980,853. This is an SMN2-targeted antisense oligonucleotide administered intrathecally. The recommended dose is 12 mg (5 mL per dose). Treatment is initiated with four loading doses, the first three loading doses administered at 14-day intervals, the fourth loading dose administered 30 days after the third loading dose, and then a maintenance dose administered once every four months thereafter.

[0038] In certain embodiments, the amino acid sequence of functional hSMN1 is the amino acid sequence of SEQ ID NO: 5. In certain embodiments, the amino acid sequence of functional hSMN1 is SEQ ID NO: 5, or a sequence that shares at least 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 5. In certain embodiments, a modified hSMN coding sequence is provided. Preferably, the modified hSMN coding sequence has less than about 80% identity, preferably about 75% or less identity, with the full-length natural hSMN coding sequence (SEQ ID NO: 6). In certain embodiments, the modified hSMN coding sequence is characterized by an improved translation rate compared to natural hSMN after AAV-mediated delivery. In certain embodiments, the modified hSMN coding sequence shares approximately 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, or less than 61% identity with the full-length natural hSMN1 coding sequence. In certain embodiments, the modified hSMN1 coding sequence includes sequence number 7, or a sequence that shares at least 70%, 75%, 80%, 85%, 90%, 95%, or more identity with sequence number 7. In certain embodiments, the modified hSMN1 coding sequence is a sequence that shares at least 70%, 75%, 80%, 85%, 90%, 95%, or more identity with sequence number 7, which codes for the amino acid sequence of sequence number 5. In certain embodiments, the modified hSMN1 coding sequence is a sequence that, when aligned to the nucleotide sequence of SEQ ID NO: 7, has up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 base pair mismatches, and expresses functional SMN1, while in other embodiments, a different SMN1 coding sequence is selected.

[0039] In certain embodiments, recombinant nucleic acid molecules comprising an expression cassette are provided herein, the expression cassette having the nucleic acid sequence of SEQ ID NO: 16, or a nucleic acid sequence at least 99% identical to SEQ ID NO: 16. In certain embodiments, the expression cassette is adjacent to the AAV 5'ITR sequence and the AAV 3'ITR sequence, and optionally has additional sequences between the expression cassette and the ITR sequences. In certain embodiments, recombinant nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence at least 99% identical to SEQ ID NO: 2 are provided herein.

[0040] In the context of nucleic acid sequences, the terms “identity percentage (%)”, “sequence identity”, “sequence identity percentage”, or “identity percentage” refer to the percentage of residues in two sequences that are identical when aligned for correspondence. The length of the sequence identity comparison can be obtained over the full length of the genome, the full length of the gene coding sequence, or a fragment of at least approximately 500–5000 nucleotides, and this is desirable. However, identity between smaller fragments of, for example, at least approximately 9 nucleotides, typically at least approximately 20–24 nucleotides, at least approximately 28–32 nucleotides, or at least approximately 36 or more nucleotides may also be desirable.

[0041] Identity percentage is the amino acid sequence over the full length of a protein, a polypeptide, approximately 32 amino acids, approximately 330 amino acids, or a peptide fragment thereof, or the sequence is coded The corresponding nucleic acid sequence may be easily determined. A suitable amino acid fragment may be at least about 8 amino acids long and may be up to about 700 amino acids. Generally, when referring to “identity,” “homology,” or “similarity” between two different sequences, “identity,” “homology,” or “similarity” is determined by referring to an “aligned” sequence. An “aligned” sequence or “alignment” refers to multiple nucleic acid sequences or protein (amino acid) sequences that, compared to a reference sequence, often include corrections for missing or additional bases or amino acids.

[0042] Identity may be determined by preparing a sequence alignment, which may be determined by using various algorithms and / or computer programs known or commercially available in the art (e.g., BLAST, ExPASy, Clustal Omega, FASTA, e.g., those using the Needleman-Wunsch algorithm, Smith-Waterman algorithm). Alignment is performed using one of the various publicly or commercially available multiplex sequence alignment programs. For amino acid sequences, sequence alignment programs such as "Clustal Omega," "Clustal X," "MUSCLE," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box" programs are available. Generally, one of these programs is used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize other algorithms or computer programs that provide at least the same level of identity or alignment as provided by the algorithms and programs of reference. For example, see JDThompson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690(1999).

[0043] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include "Clustal Omega," "Clustal W," "MUSCLE," "CAP Sequence Assembly," "BLAST," "MAP," and "MEME," which are accessible through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the Vector NTI utility can also be used. Several algorithms known in the art also exist and can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using the Fasta® program in GCG version 10.1. Fasta® provides alignment and percent sequence identity of the best overlap region between query and search sequences. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta® with its default parameters provided in GCG version 10.1 (word size of 6 and NOPAM factor for scoring matrix), which are incorporated herein by reference.

[0044] As used herein, “operably linked” sequences include both regulatory sequences that are continuous or discontinuous with a nucleic acid sequence and regulatory sequences that act in cis or trans with a nucleic acid sequence. Such regulatory sequences typically include one or more of the following: promoters, enhancers, introns, Kozak sequences, polyadenylation sequences, and TATA signals. Among other elements, an expression cassette may contain, among other elements, one or more upstream (5'~) regulatory sequences of the gene sequence, such as promoters, enhancers, and introns, and one or more downstream (3'~) regulatory sequences of the gene sequence, such as enhancers or 3' untranslated regions (3'UTR) containing polyadenylation sites. In the embodiment, the regulatory sequence is operably linked to the nucleic acid sequence of the gene product, and the regulatory sequence is separated from the nucleic acid sequence encoding the gene product by an intervening nucleic acid sequence, i.e., the 5' untranslated region (5'UTR). In certain embodiments, the expression cassette comprises one or more nucleic acid sequences of gene products. In some embodiments, the expression cassette may be a monocistronic or bicistronic expression cassette. In other embodiments, the term “transgene” refers to one or more DNA sequences from an exogenous source to be inserted into a target cell. Typically, such an expression cassette for generating a viral vector comprises a coding sequence for the gene product described herein, adjacent to the packaging signal of the viral genome, and other expression regulatory sequences, such as those described herein. In certain embodiments, the vector genome may comprise two or more expression cassettes.

[0045] The term "exogenous" used to describe nucleic acid sequences or proteins means that the nucleic acid or protein does not occur naturally at the location where it exists on a chromosome or in a host cell. Exogenous nucleic acid sequences also refer to sequences that originate from and are inserted into the same host cell or subject, but exist in a non-natural state, for example, at a different copy number or under the control of different regulatory elements.

[0046] When used to describe nucleic acid sequences or proteins, the term “heterogeneous” means that the nucleic acid or protein originates from a different organism or a different species of the same organism from the host cell or target in which it is expressed. When used in relation to proteins, or nucleic acids in plasmids, expression cassettes, or vectors, the term “heterogeneous” indicates that the protein or nucleic acid exists in a different sequence or subsequence that is not found in nature in the same relationship to one another.

[0047] As used herein, “encoded amino acid sequence” refers to the amino acids predicted based on the translation of known DNA codons in a reference nucleic acid sequence that are translated into amino acids. The following table illustrates DNA codons and 20 common amino acids, showing both single-letter codes (SLC) and three-letter codes (3LC).

[0048] In certain embodiments, the promoter is a chicken β-actin (also known as chicken β-actin, CB, or CBA) promoter. In further embodiments, the promoter is a CB7 promoter (also called a hybrid CB7) comprising a cytomegalovirus (CMV IE) enhancer and a chicken β-actin promoter, optionally having a spacer sequence, optionally containing a chicken β-actin intron, and optionally having a chimeric intron further comprising a chicken β-actin splicing donor (containing an exon sequence, chicken β-actin intron) and a rabbit beta-globin splicing acceptor. See, for example, the cytomegalovirus (CMV) early enhancer (260 bp, C4, GenBank number K03104.1). Chicken β-actin promoter (281 bp, CB, GenBank number X00182.1).

[0049] In other embodiments, the promoter is a ubiquitin C (UbC) promoter. In certain embodiments, the UbC promoter is a human UbC promoter. See also WO2001 / 091800. For example, see GenBank accession numbers AF232305 (rat), D63791 (human), NCBI reference sequence: NG_027722.2, and Schorpp et al. Nucleic Acids Res. 1996 May 1;24(9):1787-8. In certain embodiments, the UbC promoter includes the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the UbC promoter includes the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the UbC promoter includes either or both of SEQ ID NOs: 10 and 17. When aligned to a nucleotide sequence, the nucleotide sequence contains up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pair mismatches, and when operably ligated to the transgene (i.e., SMN1), the transgene can be expressed in the target cell.

[0050] In certain embodiments, other promoters and / or enhancers may be selected. In another embodiment, preferred promoters include, but are not limited to, the elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene. 1990 Jul 16;91(2):217-23), the human synapsin 1 (hSyn) promoter (see, e.g., Kugler S et al, Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther. 2003 Feb;10(4):337-47), and the neuron-specific enolase (NSE) promoter (see, e.g., Kim J et al, Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology. 2004). This may include a CB6 promoter (see Feb;145(2):613-9.Epub 2003 Oct 16), or a CB6 promoter (see, for example, Large-Scale Production of Adeno-Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, Mol Biotechnol.2016 Jan;58(1):30-6.doi:10.1007 / s12033-015-9899-5).In certain embodiments, the promoter is a JeT promoter (Tornoe J et al. Gene. 2002 Sep 4;297(1-2):21-32). In yet other embodiments, multiple enhancers and / or promoters may be included.

[0051] In certain embodiments, additional or alternative promoter sequences may be included as part of the expression regulatory sequence (regulatory sequence). Constitutive promoters, regulated promoters [see, for example, WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters responsive to physiological signals may be used in the vectors described herein. The promoter(s) can be selected from different sources, such as the human cytomegalovirus earliest (CMV IE) enhancer / promoter, SV40 earliest enhancer / promoter, JC polymovirus promoter, myelin basic protein (MBP) or collagen fiber acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latent-associated promoter (LAP), Roussarcoma virus (RSV) long-terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, melanin-concentrating hormone (MCH) promoter, CBA, or matrix metalloprotein promoter (MPP), and chicken beta-actin promoter. In certain embodiments, the expression cassette is designed for the expression of SMN1 in the central nervous system (CNS), including cerebrospinal fluid and the brain. In further embodiments, the expression cassette is useful for expression in both the CNS and systemically.

[0052] In addition to the promoter, the vector may include one or more other suitable transcription start sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA (e.g., WPRE), sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, if necessary, sequences that enhance the secretion of the encoded product.

[0053] In certain embodiments, the regulatory sequence includes an enhancer. In certain embodiments, the regulatory sequence includes one enhancer. In other embodiments, the regulatory sequence includes two or more enhancers. These enhancers may be the same or different. For example, the enhancer may include an alpha-mic / bik enhancer or a CMV IE enhancer. This enhancer may exist in two copies located adjacent to each other within the expression cassette. Alternatively, duplicate copies of the enhancer may be separated by one or more sequences.

[0054] In certain embodiments, the regulatory sequence includes an intron. In certain embodiments, the intron is a chicken beta-actin intron. In one embodiment, the intron is 875 bp (GenBank, #X00182.1). In certain embodiments, the intron is a 973 bp intron from the chicken beta-actin gene (GenBank number X00182.1). In certain embodiments, the intron is a hybrid intron consisting of a chimeric intron (CI)-human beta-globin splice donor and an immunoglobulin G (IgG) splice acceptor element. In certain embodiments, the intron is a chimeric intron containing a chicken beta-actin splicing donor (including an exon sequence), a chicken beta-actin intron, and a rabbit beta-globin splicing acceptor. In certain embodiments, the intron includes the nucleic acid sequence of Sequence ID No. 11. In certain embodiments, the intron comprises a nucleotide sequence having up to 1, up to 2, up to 3, up to 4, up to 5, up to 6, up to 7, up to 8, up to 9, or up to 10 base pair mismatches when aligned to the nucleotide sequence of SEQ ID NO: 11. Other suitable introns include those known in the art, human β-globulin introns and / or commercially available introns, as well as those described in WO2011 / 126808.

[0055] In certain embodiments, the regulatory sequence includes a polyadenylation signal (PolyA). Examples of preferred PolyA sequences include, for example, rabbit betaglobin (RBG or rBG) PolyA, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic PolyA. Optionally, one or more sequences may be selected to stabilize the mRNA. In certain embodiments, PolyA is rabbit betaglobin PolyA (rabbit globin PolyA or rBG). See, for example, WO2014 / 151341. In certain embodiments, rBG PolyA includes Sequence ID No. 13. In certain embodiments, human growth hormone (hGH) polyadenylation sequences, SV40 PolyA, or synthetic PolyA may be included in the expression cassette. In certain embodiments, SV40 PolyA is selected.

[0056] In certain embodiments, the expression cassette contains one or more miRNA (also referred to as miR or microRNA) target sequences in its untranslated region. The miRNA target sequences are designed to be specifically recognized by miRNAs present in cells where transgene expression is undesirable and / or where a reduction in the level of transgene expression is desired. In certain embodiments, the expression cassette contains miRNA target sequences that specifically reduce SMN1 expression in the dorsal root ganglia. In certain embodiments, the miRNA target sequences are located in the 3'UTR, 5'UTR, and / or both the 3' and 5'UTR of the expression cassette. In certain embodiments, the expression cassette contains at least two, at least three, and The expression cassette comprises at least four tandem repeats of dorsal root ganglion (DRG)-specific miRNA target sequences, where each tandem repeat comprises the same or different miRNA target sequences. In certain embodiments, the first start of the DRG-specific miRNA tandem repeat is within 20 nucleotides from the 3' end of the SMN1 coding sequence. In certain embodiments, the first start of the DRG-specific miRNA tandem repeat is at least 100 nucleotides from the 3' end of the SMN1 coding sequence. In certain embodiments, the miRNA tandem repeat comprises a length of 200 to 1200 nucleotides. In certain embodiments, the inclusion of the miR target does not alter the expression or efficacy of the therapeutic transgene in one or more target tissues compared to an expression cassette lacking the miR target sequence.

[0057] In certain embodiments, the expression cassette contains at least one, two, three, or four miRNA target sequences, which are target sequences of miR-182. In certain embodiments, the expression cassette contains a miR-182 target sequence, which includes the nucleotide sequence AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 12). In certain embodiments, the expression cassette contains two or more copies (e.g., two, three, or four copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 to about 28 nucleotides long and includes at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence contains a sequence that is partially complementary to SEQ ID NO: 12, and therefore, when aligned with SEQ ID NO: 12, one or more base pair mismatches exist. In certain embodiments, the miR-182 target sequence includes a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pair mismatches when aligned to sequence number 12, and the base pair mismatches may be discontinuous. In certain embodiments, the miR-182 target sequence includes a 100% complementary region, which also includes at least 30% of the length of the miR-182 target sequence. In certain embodiments, the 100% complementary region includes a sequence having 100% complementarity to the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity to miR-182. In a particular embodiment, the expression cassette includes a miR-182 target sequence comprising a cleaved SEQ ID NO: 12, i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either the 5' or 3' end or both of the SEQ ID NO: 12.

[0058] The term “tandem repeat” is used herein to refer to the presence of two, three, four, or more consecutive miRNA target sequences. These miRNA target sequences may be consecutive, i.e., one 3' end may be directly after the other, such that one 3' end is immediately upstream of the 5' end of the next sequence, or vice versa, without an intervening sequence. In another embodiment, two, three, four, or more of the miRNA target sequences are separated from each other by spacer sequences. In a particular embodiment, the expression cassette includes one or more mir182 target sequences located in the sequence encoding the 5'UTR, and one or more mir182 target sequences located in the sequence encoding the 3'UTR. In a particular embodiment, the provided expression cassette includes at least four miR182 target sequences located at 3' of the SMN1 encoding sequence and 5' of the polyA sequence. In other embodiments, the expression cassette comprises at least four miR182 target sequences, at least one of which is located at 5' of the UbC promoter, and at least one of which is located at 3' of the SMN1 coding sequence and 5' of the polyA sequence.

[0059] As used herein, “spacer” is any selected nucleic acid sequence, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides long, located between two or more consecutive miRNA target sequences. In a particular embodiment, the spacer is 1 The spacer is a number of ~8 nucleotides, 2~7 nucleotides, 3~6 nucleotides, 4 nucleotides, 4~9 nucleotides, 3~7 nucleotides, or longer. Preferably, the spacer is a non-coding sequence. In certain embodiments, the spacer may be four nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0060] In certain embodiments, the tandem repeat contains two, three, four, or more identical miRNA target sequences. In certain embodiments, the tandem repeat contains at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, and so on. In certain embodiments, the tandem repeat may contain two or three identical miRNA target sequences and a different fourth miRNA target sequence.

[0061] In certain embodiments, the expression cassette may contain at least two different sets of tandem repeats. For example, the 3'UTR may contain a tandem repeat immediately downstream of the transgene, a UTR sequence, and two or more tandem repeats closer to the 3' end of the UTR. In another example, the 5'UTR may contain one, two, or more miRNA target sequences. In yet another example, the 3'UTR may contain tandem repeats, and the 5'UTR may contain at least one miRNA target sequence.

[0062] In certain embodiments, the expression cassette contains two, three, four, or more tandem repeats that begin within approximately 0 to 20 nucleotides of the stop codon of the SMN1 transgene. In other embodiments, the expression cassette contains miRNA tandem repeats at least 100 to approximately 4000 nucleotides from the stop codon of the SMN1 transgene.

[0063] See also WO2020 / 132455A1 and WO2021 / 231579A1, which are incorporated herein by reference in their entirety.

[0064] Recombinant adeno-associated virus (rAAV) A recombinant adeno-associated virus (rAAV) vector having a capsid containing an expression cassette comprising a nucleotide sequence encoding hSMN1 is provided herein. The rAAV vector is useful for the treatment of SMN1. Preferably, the selected AAV capsid targets the cells to be treated.

[0065] As used herein, "rAAV.hSMN1" refers to an rAAV having a vector genome containing an hSMN1 coding sequence. "rAAVhu68.hSMN1" refers to an rAAV having a vector genome containing an AAVhu68 capsid and an hSMN1 coding sequence. The vector genome comprises an AAV 5' inverted end repeat (ITR) sequence, an expression cassette containing an SMN1 coding sequence operably ligated to a regulatory sequence, and an AAV 3' ITR.

[0066] As used herein, the term “vector genome” refers to a nucleic acid molecule packaged within a viral capsid, such as an AAV capsid, which can be delivered to a host cell or a cell in a patient. In certain embodiments, the vector genome includes terminal repeat sequences (e.g., AAV inverted terminal repeat sequences (ITRs)) at the 5' and 3' ends necessary for packaging the vector genome within the capsid, and between them, an expression cassette containing the SMN1 coding sequence described herein, operably linked to a sequence that directs the expression of SMN1.

[0067] AAV sequences present in vector genomes typically contain cis-acting 5' and 3' inverted terminal repeats (ITRs) (see, e.g., B.J. Carter, “Handbook of Parvoviruses”, edited by P. Tijsser, CRC Press, pp. 155-168 (1990)). ITR sequences are approximately 145 base pairs (bp) in length. Preferably, substantially complete sequences encoding ITRs are used in the molecule, although some minimal modification of these sequences is acceptable. The ability to modify these ITR sequences is within the scope of the art (see, e.g., Sambrook et al., “Molecular Cloning. A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such molecules used in the present invention is a “cis-acting” plasmid containing a transgene, where the selected transgene sequence and associated regulatory elements are adjacent to 5' and 3' AAV ITR sequences. In one embodiment, the ITR is from a different AAV than the one supplying the capsid. In one embodiment, the ITR sequence is from AAV2. A shortened version of the 5' ITR, referred to as ΔITR, is described, with a deletion of the D sequence and terminal segregation sites (trs). In a particular embodiment, the vector genome (e.g., of a plasmid) contains a 130-base-pair shortened AAV2 ITR with a deletion of the outer A element. The shortened ITR can be packaged in a capsid using the inner A element as a template to form a viral particle, and then reverted to the 145-base-pair wild-type length during vector DNA amplification. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV sources may be selected. If the ITR source is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as pseudotype. However, other configurations of these elements may also be preferable.

[0068] As used herein, the term “AAV” refers to naturally occurring adeno-associated viruses, adeno-associated viruses available to those skilled in the art and / or available in view of the compositions and methods described herein, and artificial AAVs. An adeno-associated virus (AAV) viral vector is an AAV DNase-resistant particle having an AAV protein capsid, in which an expression cassette is packaged, flanked by the inverted terminal repeat sequence (ITR) of AAV for delivery to target cells. The AAV capsid consists of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, arranged icosahedral symmetrically in a ratio of approximately 1:1:10 to 1:1:20, depending on the selected AAV. Various AAVs can be selected as the source of the capsid for the AAV viral vector described above. See, for example, U.S. Patent Publication No. 2007 / 0036760-A1, U.S. Patent Publication No. 2009 / 0197338-A1, and EP1310571. Also see WO2003 / 042397 (AAV7 and other monkey AAVs), U.S. Patent Nos. 7,790449 and 7,282199 (AAV8), WO2005 / 033321 and 7,906,111 (AAV9), and WO2006 / 110689 and WO2003 / 042397 (rh.10). These documents also describe and are incorporated by reference to other AAVs that may be selected to generate AAVs. Of the well-characterized AAVs isolated or manipulated from humans or non-human primates (NHPs), human AAV2 was the first AAV developed as a gene transfer vector and is widely used in efficient gene transfer experiments in various target tissues and animal models. Unless otherwise specified, the AAV capsids, ITRs, and other selected AAV components described herein include, but are not limited to, AAVs commonly identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and AAVAnc80, AAVhu68, any variant of any known or mentioned AAV, or any yet-to-be-discovered AAV. Any AAV can be readily selected, including unseen AAVs or variants, or mixtures thereof. AAV9 capsids include rAAVs having a capsid protein with an amino acid sequence 99% identical to AAS99264. See also US7906111 and WO2005 / 033321. Additional capsids are provided in WO2022 / 119871 and WO2022 / 226263, which are incorporated herein by reference. See also PCT / US19 / 19804 and PCT / US19 / 19861, filed on 27 February 2019, titled “Novel Adeno-Associated Virus (AAV) Vectors, AAV Vectors Having Reduced Capsid Deamidation and Uses Therefor,” PCT / US2024 / 036237, filed on 28 June 2024, titled “Mutant AAV with Central Nervous System Targeting Motifs and Compositions Containing Same,” and US2024-0024507A1, “Novel Compositions with Tissue-Specific Targeting Motifs And Compositions Containing Same,” all of which are incorporated herein by reference. In certain embodiments, the capsid protein is designated by a number or a combination of a number and letters following the term “AAV” in the name of the rAAV vector.

[0069] In certain embodiments, a recombinant AAV is provided having a vector genome comprising an expression cassette comprising (a) a UbC promoter, (b) a coding sequence for a functional SMN1 protein, (c) at least four miR182 target sequences, and (d) optionally, a poly-A sequence having spacer sequences between them. The coding sequence, at least four miR182 target sequences, and poly-A sequence are operably ligated to the UbC promoter. In certain embodiments, the expression comprises additional regulatory elements (e.g., introns). In certain embodiments, the poly-A sequence is a rabbit beta-globin poly-A sequence. In certain embodiments, the vector genome comprises the nucleic acid sequence of SEQ ID NO: 16, or an expression cassette having a nucleic acid sequence at least 99% identical to SEQ ID NO: 16. In certain embodiments, the vector genome has the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence at least 99% identical to SEQ ID NO: 2.

[0070] In certain embodiments, the AAV capsid is a clade F capsid, e.g., AAV9 capsid, AAVhu68 capsid, hu31 capsid, hu32 capsid, or a variation thereof. See, for example, WO2005 / 033321, WO2018 / 160582, and US2015 / 0079038, published on April 14, 2015, each of which is incorporated herein by reference in whole. In certain embodiments, the AAV capsid is a non-clade F capsid, e.g., a clade A, B, C, D, or E capsid. In certain embodiments, the non-clade F capsid is AAV1 or a variation thereof. In certain embodiments, the AAV capsid transduces target cells other than neural cells. In certain embodiments, the AAV capsid is a clade A capsid (e.g., AAV1, AAV6, AAVrh91), a clade B capsid (e.g., AAV2), a clade C capsid (e.g., hu53), a clade D capsid (e.g., AAV7), or a clade E capsid (e.g., rh10).

[0071] In certain embodiments, the clade F AAV capsid is the AAVhu68 capsid [see, for example, US2020 / 0056159, PCT / US21 / 55436, SEQ ID NO: 8 for the nucleic acid sequence, SEQ ID NO: 9 for the amino acid sequence], the AAVhu95 capsid [see, for example, U.S. Provisional Application No. 63 / 251,599 filed October 2, 2201]. This includes the AAVhu96 capsid [see, for example, U.S. Provisional Application No. 63 / 251,599 filed October 2, 2022, and the AAVrh91 capsid], or the AAV9 capsid. In certain embodiments, the AAV capsid is a clade A capsid, for example, the AAVrh91 capsid. See also PCT / US20 / 030266, filed on 29 April 2020, WO2020 / 223231, which is now published, and International Application PCT / US21 / 45945, filed on 13 August 2021, which are incorporated herein by reference.

[0072] In certain embodiments, the AAV capsid for the compositions and methods described herein is selected based on target cells. In certain embodiments, the AAV capsid transduces CNS cells and / or PNS cells. In certain embodiments, a different AAV capsid may be selected. The AAV capsid is selected from cy02 capsid, rh43 capsid, AAV8 capsid, rh01 capsid, AAV9 capsid, rh8 capsid, rh10 capsid, bb01 capsid, hu37 capsid, rh02 capsid, rh20 capsid, rh39 capsid, rh64 capsid, AAV6 capsid, AAV1 capsid, hu44 capsid, hu48 capsid, cy05 capsid, hu11 capsid, hu32 capsid, pi2 capsid, or variations thereof.

[0073] AAV capsids are aggregates of heterogeneous populations of vp1 protein, vp2 protein, and vp3 protein. As used herein, the term “heterogeneous” or any grammatical variation thereof, when used to refer to vp capsid proteins, refers to a population consisting of non-identical elements, e.g., a population having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0074] As used herein, when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof refers to a group of non-identical elements having vp1, vp2, or vp3 (also referred to as VP1, VP2, VP3, or Vp1, Vp2, Vp3) monomers (proteins) with different modified amino acid sequences, for example. The term “heterogeneous group” as used in relation to vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to the differences in amino acid sequences of vp1, vp2, and vp3 proteins within the capsid. AAV capsids contain subpopulations within the vp1 protein, vp2 protein, and vp3 protein, and these subpopulations have modifications from predicted amino acid residues. These subpopulations contain, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation may have at least one, two, three, or four highly deamidated asparagine-glycine pairs, and optionally include an asparagine(N) position further containing other deamidated amino acids, where deamide results in amino acid changes and other optional modifications.

[0075] In certain embodiments, an AAV capsid is provided having a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3), wherein the AAV capsid isoforms contain a plurality of highly deamidated "NG" positions. In certain embodiments, the highly deamidated positions are located at positions specified below with respect to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that a referenced "NG" is removed, and the mutant "NG" is manipulated to a different position.

[0076] In certain embodiments, the rAAV provided herein has an AAVhu68 capsid comprising AAVhu68 VP1 protein, AAVhu68 VP2 protein, and AAVhu68 VP3 protein expressed from the nucleic acid sequence (amino acids 1-736) encoding SEQ ID NO: 9.

[0077] In a particular embodiment, the AAV hu68 capsid comprises heterogeneous populations of AAVhu68 vp1 protein, AAVhu68 vp2 protein, and AAVhu68 vp3 protein, each containing amino acid residues 1-736 (vp1), 138-736 (vp2), and 203-736 (vp3) of SEQ ID NO: 9, respectively, and the heterogeneous AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins are encoded when determined using mass spectrometry. Based on the numbering of the VP1 amino acid sequence (SEQ ID NO: 9), the amino acid modification includes 50% to 100% deamidation of at least two asparagine(N) atoms in the asparagine-glycine pair of SEQ ID NO: 9 at positions N57, N329, N452, and / or N512, and optionally further includes a subgroup containing other deamidated amino acids, where deamidation results in an amino acid change, and the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, interconverted aspartic acid / isoaspartic acid pairs, or combinations thereof.In certain embodiments, the subpopulations of AAVhu68 VP1 protein, AAVhu68 VP2 protein, and AAVhu68 VP3 protein further include one or more of the following: (a) based on the numbering in SEQ ID NO: 9, at least 65% of the asparagine (N) at position N57 of the vp1 protein is deamidated; (b) based on the residue numbering of the amino acid sequence in SEQ ID NO: 9, at least 75% of the N at position N329 of the vp1, v2, and vp3 proteins is deamidated; (c) based on the residue numbering of the amino acid sequence in SEQ ID NO: 9, at least 50% of the N at position N452 of the vp1, v2, and vp3 proteins is deamidated; and / or (d) based on the residue numbering of the amino acid sequence in SEQ ID NO: 9, at least 75% of the N at N512 of the vp1, v2, and vp3 proteins is deamidated. A heterogeneous population of vp1 protein contains glutamate at position 67 based on the numbering in SEQ ID NO: 9, and a heterogeneous population of AAVhu68 vp1 and AAVhu68 vp2 proteins contains valine at position 157 based on the numbering of the vp1 capsid in SEQ ID NO: 9. In certain embodiments, the rAAVhu68 capsid contains a subpopulation of vp1 in which 75% to 100% of the nitrogen at position 57 of the vp1 protein is deamidated, based on the numbering in SEQ ID NO: 9, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid contains subpopulations of vp1, vp2, and / or vp3 proteins in which 75% to 100% of the nitrogen at position 329 is deamidated, based on the numbering in SEQ ID NO: 9, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of vp1, vp2, and / or vp3 proteins, based on the numbering in Sequence ID No. 9, where 75%–100% of the nitrogen is deamidated at position 452, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of vp1, vp2, and / or vp3 proteins, based on the numbering in Sequence ID No. 9, where 75%–100% of the nitrogen is deamidated at position 512.In certain embodiments, the nucleic acid sequence encoding the protein is at least 80% to at least 99% identical to sequence number 9, or sequence number 8 encoding the amino acid sequence of sequence number 9. In certain embodiments, the nucleic acid sequence is at least 80% to 97% identical to sequence number 8. In certain embodiments, the rAAVhu68 capsid comprises subpopulations having 50% to 100% deamidation in each of N57, N329, N452, and N512, and optionally, based on the amino acid numbering of sequence number 9, N94, N113, N252, N253, Q258, N270, N303, N304, N305, N319, N328, and N3. The present invention further comprises subpopulations of vp1, vp2, and / or vp3 proteins, further comprising 1% to about 40% deamidation at at least one of the positions 36, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or any combination thereof. In certain embodiments, the rAAVhu68 capsid vp1, vp2, and / or vp3 proteins further comprises one or more modifications selected from one or more modifications of acetylated lysine, phosphorylated serine, and / or threonine, isomerized aspartic acid, oxidized tryptophan, and / or methionine, or amidated amino acids.

[0078] In a particular embodiment, the AAVhu68 capsid comprises a heterogeneous population of AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins produced by expression from a nucleic acid molecule having a nucleic acid sequence encoding amino acid sequences 1-736 of SEQ ID NO: 9, and each of these heterogeneous populations comprises amino acids 1-736 (vp1), 138-736 (vp2), and 203-736 (vp3) of SEQ ID NO: 9, respectively, having amino acid modifications that, when determined using mass spectrometry, include 50-100% deamidation of at least two asparagine (N)-glycine pairs in two or more of N57, N329, N452, and / or N512 of SEQ ID NO: 9, and optionally further include subpopulations containing other deamidated amino acids. The heterogeneous population of vp1 protein contains glutamic acid at position 67 based on the numbering in SEQ ID NO: 9, and the heterogeneous populations of AAVhu68 vp1 and AAvhu68 vp2 protein contain valine at position 157 based on the numbering of the vp1 capsid in SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence of the VP1 protein is at least 70% identical to SEQ ID NO: 8, or SEQ ID NO: 8 which codes for the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence is SEQ ID NO: 8. In certain embodiments, the rAAVhu68 capsid contains a subpopulation of AAVhu68 vp1 in which 75% to 100% of the N at position 57 of the vp1 protein is deamidated, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, which, when determined using mass spectrometry, have 75%–100% of the nitrogen deamidated at position 329, based on the numbering in Sequence ID No. 9. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, which, when determined using mass spectrometry, have 75%–100% of the nitrogen deamidated at position 452, based on the numbering in Sequence ID No. 9. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, based on the numbering in Sequence ID No. 9, in which 75% to 100% of the nitrogen atoms are deamidated at position 512.In certain embodiments, the rAAVhu68 capsid comprises subpopulations having 50% to 100% deamidation at each of N57, N329, N452, and N512, and optionally further comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, further comprising 1% to about 40% deamidation at at least one or more of the following positions, based on the amino acid numbering of SEQ ID NO: 9: N94, N113, N252, N253, Q258, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or combinations thereof.

[0079] In a particular embodiment, the AAVhu68 capsid, when determined using mass spectrometry, contains 50 asparagine(N) in at least two asparagine-glycine pairs in two or more of the N57, N329, N452, and / or N512 of SEQ ID NO: 9. The heterogeneous population of AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins each contains amino acids 1-736 (vp1), amino acids 138-736 (vp2), and amino acids 203-736 (vp3) of SEQ ID NO: 9, respectively, and has amino acid modifications that include %-100% deamidation and optionally further include subpopulations containing other deamidated amino acids, and the AAVhu68 protein contains amino acid modifications that include 50%-100% deamidation of two or more asparagine (N) at positions N57, N329, N452, and / or N512, based on the residue numbering of SEQ ID NO: 9, as determined by mass spectrometry, and optionally further include subpopulations containing other deamidated amino acids, and the heterogeneous population of AAVhu68 vp1 protein includes at least a subpopulation having glutamic acid at position 67, based on the numbering of SEQ ID NO: 9, and AAVhu68 The heterogeneous populations of vp1 and AAVhu68 vp2 proteins include at least subpopulations containing valine at position 157, based on the numbering in SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence is at least 70% identical to SEQ ID NO: 8, or to SEQ ID NO: 8 encoding the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence is SEQ ID NO: 8. In certain embodiments, the rAAVhu68 capsid includes a subpopulation of AAVhu68 vp1, in which 75%–100% of the N at position 57 of the vp1 protein is deamidated, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid includes subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, in which 75%–100% of the N at position 329 is deamidated, based on the numbering in SEQ ID NO: 9, as determined by mass spectrometry. In certain embodiments, the rAAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, which, when determined using mass spectrometry, have 75%–100% of the nitrogen deamidated at position 452, based on the numbering in Sequence ID No. 9.In certain embodiments, the rAAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and / or AAVhu68 vp3 proteins, which, when determined using mass spectrometry, have 75%–100% of the nitrogen deamidated at position 512, based on the numbering in Sequence ID No. 9. In certain embodiments, the rAAVhu68 capsid comprises subgroups having 50% to 100% deamidation at each of N57, N329, N452, and N512, and optionally further comprising 1% to about 40% deamidation at at least one or more of the following positions, based on the amino acid numbering of SEQ ID NO: 9: N94, N113, N252, N253, Q258, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or combinations thereof.

[0080] In a particular embodiment, the AAVhu68 capsid comprises AAVhu68 vp1 protein, AAVhu68 vp2 protein, and AAVhu68 vp3 protein produced from a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 9, wherein the AAVhu68 vp1 protein contains glutamic acid at position 67 and valine at position 157, and the AAVhu68 vp2 protein contains valine at position 157 based on the numbering of SEQ ID NO: 9. In certain embodiments, the AAVhu68 capsid comprises subpopulations of AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins, where each asparagine-glycine pair at positions 57, 329, 452, and 512 contains at least 50% to 100% deamidated asparagine(N) compared to the amino acids of SEQ ID NO: 9, and the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, interconverted aspartic acid / isoaspartic acid, or a combination thereof, as determined by mass spectrometry. In certain embodiments, the nucleic acid sequence encoding the vp1 protein is SEQ ID NO: 9, or the amino acid sequence encoding SEQ ID NO: 9 The sequence is at least 80% to at least 99% identical to sequence number 8, and optionally, the nucleic acid sequence is at least 80% to 97% identical to sequence number 8.

[0081] In a particular embodiment, the AAVhu68 capsid comprises a heterogeneity of AAVhu68 vp1, AAVhu68 vp2, and AAVhu68 vp3 proteins, wherein the AAVhu68 vp1 protein is amino acids 1-736 (vp1) of SEQ ID NO: 9, which contains glutamic acid at position 67 and valine at position 157, and further comprises a subpopulation of vp1 proteins containing modified amino acids based on the amino acid positions of SEQ ID NO: 9, the AAVhu68 vp2 protein is amino acids 138-736 (vp2) of SEQ ID NO: 9, which contains valine at position 157, and further comprises a subpopulation of vp2 proteins containing modified amino acids based on the amino acid positions of SEQ ID NO: 9, and the AAVhu68 vp3 protein is amino acids 203-736 (vp3) of SEQ ID NO: 9, and further comprises a subpopulation of vp3 proteins containing modified amino acids based on the amino acid positions of SEQ ID NO: 9, AAVhu68 Subpopulations of the vp2 and AAVhu68 vp3 proteins contain at least 50%–100% deamidated asparagine(N) at positions 57, 329, 452, and 512 of each asparagine-glycine pair, compared to the amino acids of SEQ ID NO: 9, and the deamidated asparagine is deamidated to aspartic acid, isoaspartic acid, interconverted aspartic acid / isoaspartic acid pairs, or combinations thereof, as determined by mass spectrometry. In certain embodiments, subpopulations of AAVhu68 vp1, vp2, and vp3 proteins further include (i) one or more modifications selected from acetylated lysine, phosphorylated serine, and / or threonine, isomerized aspartate, deamidated glutamine, oxidized tryptophan, and / or methionine, or amidated amino acids, as determined by mass spectrometry, and / or (ii) 1% to 40% deamidation of asparagine at one or more positions, or combinations thereof, based on the numbering in Sequence ID No. 9, as determined by mass spectrometry.In certain embodiments, the AAVhu68 capsid subpopulation of AAVhu68 vp1, vp2, and vp3 capsid proteins are such that (a) at least 65% of the asparagine(N) at position 57 of the vp1 protein is deamidated, as determined by mass spectrometry based on the numbering in SEQ ID NO: 9, and / or (b) at least 75% of the N at position 329 of the asparagine(Glycine) pair of the vp1, vp2, and vp3 proteins is deamidated, as determined by mass spectrometry based on the residue numbering of the amino acid sequence in SEQ ID NO: 9. The further includes being midified, and / or (c) deamidated to at least 50% of the N in the asparagine-glycine pair at position 452 of the vp1, vp2, and vp3 proteins, as determined by mass spectrometry based on the residue numbering of the amino acid sequence of SEQ ID NO: 9, and / or (d) deamidated to at least 75% of the N in the asparagine-glycine pair at position 512 of the vp1, vp2, and vp3 proteins, as determined by mass spectrometry based on the residue numbering of the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence encoding the vp1 protein is at least 80% to at least 99% identical to SEQ ID NO: 8, or SEQ ID NO: 8 encoding the amino acid sequence of SEQ ID NO: 9, and optionally, the nucleic acid sequence is at least 80% to 97% identical to SEQ ID NO: 8.

[0082] For example, see WO2018 / 160582 (which is incorporated herein by reference).

[0083] In addition, this specification provides an rAAV production system useful for producing the rAAV described herein. The production system comprises (a) a nucleus encoding the AAV capsid protein. The invention comprises a cell culture including (b) an acid sequence, a vector genome, and (c) sufficient AAV rep functionality and helper functionality to enable packaging the vector genome into an AAV capsid. In certain embodiments, the vector genome includes SEQ ID NO: 2. In certain embodiments, the vector genome includes SEQ ID NO: 16. In certain embodiments, the cell culture is a bacterial cell culture. In certain embodiments, the cell culture is a mammalian cell culture. In certain embodiments, the cell culture is a human fetal kidney 293 (HEK293) cell culture. In certain embodiments, the cell culture is a suspension cell culture. In certain embodiments, the AAV rep is derived from a different AAV. In certain embodiments, the AAV rep is derived from AAV2. In certain embodiments, the AAV The rep coding sequence and the cap gene are located on the same nucleic acid molecule, and a spacer may optionally be present between the rep sequence and the cap gene.

[0084] For use in the production of AAV virus vectors (e.g., recombinant AAV), the vector genome can be loaded onto any suitable vector, such as a plasmid, to be delivered to a packaging host cell. Plasmids useful in this invention can be engineered to be suitable for in vitro replication and packaging in, among other things, prokaryotic cells, insect cells, and mammalian cells. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by those skilled in the art.

[0085] Methods for generating and isolating AAVs suitable for use as vectors are known in the art. Generally, see, for example, Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production. See also and clinical applications, Adv. Biochem.Engin / Biotechnol.99:119-145, Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J. Gene Med.10:717-733, and the references cited below (each of these is incorporated herein in whole by reference). As used herein, gene therapy vector refers to the rAAV described herein and is suitable for use in treating patients. To package the gene into a virion, the ITR is the only AAV component required in cis in the same construct as the nucleic acid molecule containing the gene. The cap and rep genes may be supplied in trans.

[0086] Methods for determining the potency (e.g., biological activity) of SMN polypeptides, particularly those expressed by recombinant viral vectors used in the treatment of SMA, are known in the art. See US2022 / 0267798A1, incorporated herein by reference.

[0087] In certain embodiments, the expression cassette described herein is engineered into a gene element (e.g., a shuttle plasmid) that introduces the sequence supported thereon into a packaging host cell in order to produce a viral vector. In one embodiment, the selected gene element may be delivered to the AAV packaging cell by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, fast DNA coated pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be constructed. Methods used to construct such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. For example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring. Harbor Press, Cold Spring Harbor, NY (2012 Please refer to ).

[0088] The term “AAV intermediate” or “AAV vector intermediate” refers to an assembled rAAV capsid that lacks the desired genomic sequence to be packaged into it. These may also be referred to as “empty” capsids. Such capsids may either not contain a detectable genomic sequence for the expression cassette, or they may contain only a partially packaged genomic sequence that is insufficient to achieve gene product expression. These empty capsids are incapable of introducing the target gene into a host cell.

[0089] The recombinant adeno-associated viruses (AAVs) described herein may be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and US7588772 B2. Such methods involve culturing host cells containing a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, an expression cassette consisting of at least an AAV inverted terminal repeat (ITR) and a transgene, and sufficient helper function to allow the expression cassette to be packaged into an AAV capsid protein. Methods for generating the capsid, the coding sequence therefor, and methods for producing rAAV viral vectors are described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003), and US2013 / 0045186A1.

[0090] In certain embodiments, a productive cell culture useful for producing recombinant AAV is provided, wherein the recombinant AAV has a capsid selected from AAVhu68, AAVrh91, AAVhu95, or AAVhu96. Such a cell culture includes a nucleic acid expressing the AAV capsid protein in a host cell, a nucleic acid molecule suitable for packaging into the AAV capsid, e.g., a vector genome including AAV ITR, and a non-AAV nucleic acid sequence encoding a transgene (hSMN1) operably linked to a regulatory sequence directing the expression of the transgene in the host cell, as well as sufficient AAV rep and adenovirus helper functions to enable packaging of the vector genome into the AAV capsid. In certain embodiments, the cell culture is a mammalian cell (e.g., human embryonic kidney 293 cells, among others) or an insect cell (e.g., Spodoptera It consists of frugiperda (Sf9) cells. In certain embodiments, baculoviruses provide the helper function necessary for packaging the vector genome within the recombinant AAV capsid. Optionally, the rep function is provided by an AAV other than AAV2, selected to supplement the ITR source.

[0091] The methods for producing gene therapy vectors described herein include methods well known in the art, such as generating plasmid DNA used in the production of gene therapy vectors, generating vectors, and purifying vectors. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmids are the AAV vector genome and an AAV cis-plasmid encoding the gene of interest, an AAV trans-plasmid containing the rep and cap genes of AAV, and an adenovirus helper plasmid. The vector production process may include method steps such as initiating cell culture, subculturing cells, seeding cells, transfection of cells with plasmid DNA, changing the medium to serum-free medium after transfection, and recovering the vector-containing cells and culture medium. The recovered vector-containing cells and culture medium are referred to herein as crude cell recoveries. In yet another system, gene therapy vectors are introduced into insect cells by infection with a baculovirus-based vector. For an overview of these production systems, see, for example, Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale See recombinant adeno-associated virus production, Human Gene Therapy 20:922–929, the contents of which are incorporated herein by reference in their entirety. Methods for fabricating and using these and other AAV production systems are also described in the following U.S. Patents, the contents of which are incorporated herein by reference in their entirety: U.S. Patents Nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0092] Crude cell recoveries may then be subjected to method steps such as concentration of vector recoveries, diafiltration of vector recoveries, microfluidization of vector recoveries, nuclease digestion of vector recoveries, filtration of microfluidized intermediates, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration for the preparation of bulk vectors. Affinity chromatography purification, followed by anion exchange resin chromatography, is used to purify the vector drug product and remove empty capsids. These methods are referred to as "Scalable Purification." The purification methods described herein are all incorporated by reference in WO2017 / 160360 (incorporated by reference), filed on December 9, 2016, entitled “Method for AAV9”. For AAV8, WO2017 / 100676, filed on December 9, 2016, entitled “Scalable Purification Method for AAVrh10”, for rh10, WO2017 / 100704, filed on December 9, 2016, and also filed on December 11, 2015, entitled “Scalable Purification Method for AAV1”, and WO2017 / 100674, filed on December 9, 2016, entitled “Scalable Purification Method for AAV1”, for AAV1. Other preferred methods may be selected.

[0093] To calculate the content of empty and complete particles, the VP3 band volume for a selected sample (e.g., in the examples herein, a preparation purified by an iodixanol gradient, number of genome copies (GC) = number of particles) is plotted against the loaded GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test peak. The number of particles per 20 μL loaded (pt) is then multiplied by 50 to obtain particles (pt) / mL. The particle-to-genome copy ratio (pt / GC) is obtained by dividing Pt / mL by GC / mL. Empty pt / mL is obtained by Pt / mL - GC / mL. The percentage of empty particles is obtained by dividing empty pt / mL by pt / mL and multiplying by 100.

[0094] In general, methods for assaying AAV vector particles having empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330 and Sommer et al., Molec.Ther. (2003) 7:122-128. To test for denatured capsids, the method comprises subjecting a processed AAV stock to electrophoresis using any SDS-polyacrylamide gel capable of separating three capsid proteins (e.g., a gradient gel containing 3-8% trisacetic acid in buffer), then running the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon. Then, an anti-AAV capsid antibody is used as the primary antibody to bind to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably B 1. An anti-AAV-2 monoclonal antibody is used (Wobus et al., J. Virol. (2000) 74:9281-9293). Next, a secondary antibody is used that binds to the primary antibody and includes means for detecting the binding, more preferably an anti-IgG antibody containing a detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively determine the binding between the primary and secondary antibodies, a method for detecting the binding is used, preferably a detection method capable of detecting radioisotope radiation, electromagnetic radiation, or a colorimetric change, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, a sample may be taken from the column fraction and heated in an SDS-PAGE loading buffer containing a reducing agent (e.g., DTT). Capsid proteins were separated on a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions for use, or other preferred staining methods, namely SYPRO ruby ​​or Coomassie staining, may be performed. In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another preferred nuclease) to remove exogenous DNA. After nuclease inactivation, the sample is further diluted and amplified using a TaqMan® fluorescence-generating probe specific to the DNA sequences between primers and primers. The number of cycles required to reach a specified level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as that contained in the AAV vector is used to generate a standard curve in the Q-PCR reaction. The vector genome titer is determined by using the cycle threshold (Ct) value obtained from the sample and normalizing it to the Ct value of the plasmid standard curve. Endpoint assays based on digital PCR are also available.

[0095] In certain embodiments, an optimized q-PCR method utilizing a broad-spectrum serine protease, such as proteinase K (e.g., available from Qiagen), is used. More specifically, the optimized qPCR genome titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with proteinase K buffer, treated with proteinase K, and subsequently thermally inactivated. Preferably, the sample is diluted with an amount of proteinase K buffer equal to the sample size. The proteinase K buffer can be concentrated more than 2-fold. Typically, the proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The processing steps are generally carried out at approximately 55°C for approximately 15 minutes, but may be carried out at lower temperatures (e.g., approximately 37°C to approximately 50°C) for longer periods (e.g., approximately 20 to approximately 30 minutes), or at higher temperatures (e.g., up to approximately 60°C) for shorter periods (e.g., approximately 5 to 10 minutes). Similarly, thermal inactivation is generally at approximately 95°C for approximately 15 minutes, but the temperature may be lower (e.g., approximately 70 to approximately 90°C) and the time may be extended (e.g., approximately 20 to approximately 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in standard assays.

[0096] Additionally or alternatively, droplet digital PCR (ddPCR) may be used. For example, a method for determining single-stranded and self-complementary AAV vector genome titers by ddPCR has been described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hu Gene Ther Methods. 2014. See Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0097] In certain embodiments, the manufacturing process for the rAAV described herein is 202 With regard to the methods described in U.S. Provisional Patent Application No. 63 / 371,597, filed on 16 August 2022, and U.S. Provisional Patent Application No. 63 / 371,592, filed on 16 August 2022, these are incorporated herein by reference in their entirety.

[0098] In short, a method for separating rAAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) particles having a packaged genome sequence from genome-deficient AAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) intermediates involves subjecting a suspension containing recombinant AAVhu68 (or AAVrh91) virus particles and AAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) capsid intermediates to high-performance liquid chromatography, wherein the AAVhu68 (or AAVrh91, AAVhu95, or AAVhu96) virus particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at approximately 10.2 (or approximately 9.8 for AAVrh91) pH and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at approximately 260 nanometers (nm) and approximately 280 nm. While not ideal for rAAVhu68 and AAVrh91, the pH can be in the range of approximately 10–10.4. In this method, the complete AAV capsid is recovered from the fraction eluted when the A260 / A280 ratio reaches an inflection point. In one embodiment, for the affinity chromatography step, the diafiltration product may be applied to an affinity resin (Life Technologies) that efficiently captures the AAV serotype. Under these ionic conditions, a considerable percentage of residual cellular DNA and proteins flow through the column, and the AAV particles are efficiently captured.

[0099] As used herein, the term “clade” relating to a group of AAVs refers to a group of AAVs that are phylogenetically related to one another, determined using an adjacent joining algorithm based on the alignment of the AAV vp1 amino acid sequence, with at least 75% bootstrap values ​​(out of at least 1000 replicas) and Poisson-corrected distance measurements of 0.05 or less. The adjacent joining algorithm is described in the literature; see, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs that can be used to implement this algorithm are available; for example, MEGA The v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequences of the AAV vp1 capsid protein, those skilled in the art can easily determine whether a selected AAV belongs to one of the clades identified herein, another clade, or outside of these clades. For example, see G Gao, et al, J Virol 2004 Jun;78(10):6381-6388, which identifies clades A, B, C, D, E, and F and provides nucleic acid sequences of novel AAVs (GenBank accession numbers AY530553~AY530629). See also WO2005 / 033321.

[0100] The abbreviation "sc" stands for self-complementary. "Self-complementary AAV" refers to a construct in which the coding region held by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. During infection, instead of waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV associate to form a single double-stranded DNA (dsDNA) unit readily available for immediate replication and transcription. For example, DM McCarty et al., “Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient See "Transduction independently of DNA synthesis," Gene Therapy, (August 2001), Vol. 8, No. 16, pp. 1248–1254. Self-complementary AAVs are described, for example, in U.S. Patents 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in whole. In certain embodiments, the rAAV provided herein is an scAAV vector. In certain embodiments, the rAAV comprises a single-stranded DNA genome rather than an scAAV vector.

[0101] A “replication-deficient virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing the gene of interest is packaged within a viral capsid or envelope, and any viral genome sequence packaged within the viral capsid or envelope is replication-deficient, i.e., it cannot produce progeny virions but retains the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be “gutless” containing only the gene of interest adjacent to the signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, replication and infection by progeny virions cannot occur without the presence of the viral enzymes required for replication, and thus it is considered safe for use in gene therapy.

[0102] As used herein, the terms “recombinant AAV,” “rAAV,” and “artificial AAV” are interchangeable and, without limitation, mean an AAV comprising a capsid protein and a vector genome packaged therein, the vector genome comprising nucleic acids heterologous to the AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such an artificial capsid may be produced by any preferred technique using a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with a heterologous sequence, the heterologous sequence may be obtained from a different selected AAV, a non-adjacent portion of the same AAV, a non-AAV viral source, or a non-viral source. An artificial AAV may, without limitation, be a pseudotyped AAV capsid, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. A pseudotyped vector in which the capsid of one AAV is replaced with a heterologous capsid protein is useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotype vectors. Selected gene elements may be delivered by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, fast DNA-coated pellets, viral infection, and protoplast fusion. Methods used to construct such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0103] In many cases, rAAV particles are referred to as DNase-resistant. However, in addition to this endonuclease (DNase), other endonucleases and exonucleases may be used in the purification steps described herein to remove contaminating nucleic acids. Such nucleases may be selected to degrade single-stranded DNA and / or double-stranded DNA, and RNA. Such steps may involve a single nuclease or a mixture of nucleases targeted to different targets, and may be endonucleases or exonucleases.

[0104] The term "nuclease resistance" refers to the fact that AAV capsids deliver genes to host cells. This demonstrates that the packaged genomic sequences are fully constructed around an expression cassette designed to protect them from degradation (digestion) during the nuclease incubation step, which is designed to remove any contaminating nucleic acids that may be present in the production process.

[0105] As used herein, the term “heterogeneous” or any grammatical variation thereof, when used to refer to vp capsid proteins, refers to a group of non-identical elements, for example, a group having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0106] The term “heterogeneous” as used in relation to the vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to the differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. The AAV capsid contains subpopulations within the vp1, vp2, and vp3 proteins, and these subpopulations have modifications from the predicted amino acid residues. These subpopulations contain at least a certain deamidated asparagine (N or Asn) residue. For example, a certain subpopulation contains at least one, two, three, or four highly deamidated asparagine (N) positions in the asparagine-glycine pair, and optionally further containing other deamidated amino acids, where deamidation results in amino acid changes and other optional modifications.

[0107] As used herein, a “subpopulation” of vp proteins means, unless otherwise specified, a group of vp proteins that share at least one defined common feature and consist of at least one group member with fewer members than all members of the reference group. For example, a “subpopulation” of vp1 proteins is, unless otherwise specified, at least one vp1 protein in an assembled AAV capsid and fewer than all vp1 proteins. A “subpopulation” of vp3 proteins is, unless otherwise specified, one vp3 protein in an assembled AAV capsid and fewer than all vp3 proteins. For example, in an assembled AAV capsid, vp1 proteins may be a subpopulation of vp proteins, vp2 proteins may be another subpopulation of vp proteins, and vp3 may be yet another subpopulation of vp proteins. In another example, the vp1, vp2, and vp3 proteins may comprise subpopulations having different modifications, for example, with at least one, two, three, or four highly deamidated asparagine pairs, such as asparagine-glycine pairs.

[0108] nucleic acid molecule As used herein, the term “nucleic acid” can be RNA, DNA, or a modification thereof, and can be single-stranded or double-stranded, and can be selected from the group including, for example, nucleic acids, oligonucleotides, and nucleic acid analogs that encode a protein of interest, such as peptide nucleic acids (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acids (LNA), etc. Nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of any type of nucleotide (e.g., peptide nucleic acid oligomers). It will be understood by those skilled in the art that functional variants of these nucleic acid molecules are also intended to be part of the present invention. A functional variant is a nucleic acid sequence that can be directly translated using a standard genetic code and provide an identical amino acid sequence to that translated from the parent nucleic acid molecule. For example, such nucleic acid sequences include:

[0109] In certain embodiments, recombinant nucleic acid molecules and other constructs encoding a functional SMN1 protein, which are included by this disclosure and useful for generating expression cassettes and vector genomes, may be manipulated for expression in mammalian cells such as yeast cells, insect cells, or human cells. Methods are known and previously described (e.g., WO96 / 09378). At least one undesirable codon compared to the wild-type (WT) sequence is more A sequence is considered manipulated when it is replaced by a preferred codon. In this specification, an undesirable codon is one that is used less frequently in an organism than another codon encoding the same amino acid, and a more preferred codon is one that is used more frequently in an organism than an undesirable codon. The codon usage frequencies of a particular organism can be found in a codon frequency table, e.g., the codon frequency table at kazusa.jp / codon. Preferably, one or more undesirable codons, preferably most or all undesirable codons, are replaced by more preferred codons. Preferably, the most frequently used codon in an organism is used in the manipulated sequence. Replacement with preferred codons generally results in higher expression. It will also be understood by those skilled in the art that, as a result of gene coding degeneracy, numerous different nucleic acid molecules can encode the same polypeptide. Furthermore, it will be understood that, using routine techniques, nucleotide substitutions that do not affect the amino acid sequence encoded by the nucleic acid molecule may be made to reflect the codon usage of any particular host organism in which the polypeptide is expressed. Therefore, unless otherwise specified, “nucleic acid sequences encoding amino acid sequences” include all nucleotide sequences that are degenerate in nature and encode the same amino acid sequence. Nucleic acid sequences can be cloned using routine molecular biology techniques or generated de novo by DNA synthesis, which can be carried out using routine procedures by service companies that operate in the field of DNA synthesis and / or molecular cloning (e.g., GeneArt, GenScript, Life Technologies, Eurofins).

[0110] "Engineered" means that a nucleic acid molecule containing the sequence encoding the SMN1 gene described herein, any suitable gene element, such as naked DNA, a phage, a transposon, a cosmid, or an episome, introduces the SMN1 gene into a host cell, for example, to generate a non-viral delivery system (e.g., an RNA-based system, naked DNA, etc.) or to generate a viral vector in a packaging host cell and / or for delivery to a target cell of interest. In certain embodiments, the gene element is a vector. In certain embodiments, the gene element is a plasmid. Methods used to construct such engineered constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0111] Pharmaceutical composition In certain embodiments, a pharmaceutical composition comprising the rAAV or stock of rAAV described herein in a formulation buffer is provided herein. The pharmaceutical composition described herein is designed to be delivered to a target requiring it by any preferred route or a combination of different routes.

[0112] In a particular embodiment, the pharmaceutical composition is approximately 1 × 10 9 10⁴ genome copies (GC) / mL ~ approximately 1 × 10⁶ 14 The formulation is prepared with rAAV of 1 GC / mL. In other embodiments, the pharmaceutical composition is approximately 3 × 10 9 GC / mL ~ approximately 3 × 10 13 The formulation is prepared with rAAV of 1 GC / mL. In other embodiments, the pharmaceutical composition is approximately 1 × 10⁶ 9 GC / mL ~ approximately 1 × 10 13 The formulation is formulated with rAAV of 1 GC / mL. In certain embodiments, the pharmaceutical composition is at least 1 × 10 11It is formulated with rAAV at a concentration of GC / mL.

[0113] Furthermore, compositions comprising the rAAV and aqueous suspension media described herein are provided. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal administration, or intraventricular administration. In one embodiment, the composition comprises at least one rAAV It contains tok and an optional carrier, excipient, and / or preservative.

[0114] As used herein, a “stock” of rAAVs refers to a population of rAAVs. Despite heterogeneity of capsid proteins resulting from deamidation, rAAVs within a stock are expected to share the same vector genome. A stock may include, for example, rAAVs having a capsid with a selected AAV capsid protein and a heterogeneous deamidation pattern characteristic of a selected production system. A stock may be produced from a single production system or pooled from multiple runs of a production system. A variety of production systems may be selected, including but not limited to those described herein.

[0115] As used herein, “carrier” includes all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption retarders, buffers, carrier solutions, suspensions, and colloids. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, nanoparticles, lipid nanoparticles (LNPs), microparticles, microspheres, lipid particles, and vesicles may be used to introduce the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivery vector genome may be formulated for delivery encapsulated in any of the following: lipid particles, liposomes, vesicles, nanospheres, or nanoparticles.

[0116] In certain embodiments, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically suitable pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate that is diluted for administration to a subject. In yet another embodiment, the composition may be lyophilized and reconstituted at the time of administration.

[0117] A suitable surfactant, or combination of surfactants, may be selected from among non-toxic, nonionic surfactants.

[0118] In certain embodiments, the composition comprises a carrier, a diluent, an excipient, and / or an adjuvant. A suitable carrier can be readily selected by those skilled in the art in terms of the indication to which the introduced virus is targeted. For example, one suitable carrier is saline, which can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the infusion tube but do not interfere with the in vivo rAAV binding activity. A suitable surfactant, or combination of surfactants, may be selected from non-toxic nonionic surfactants. In one embodiment, a bifunctional block copolymer surfactant with primary hydroxyl groups at the terminal ends is selected, for example, poloxamer 188 (also known as trade names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, and Kolliphor® P188) having a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers may be selected, namely nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy-oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains poloxamer. These copolymers are generally named with the letter "P" (in the case of poloxamers) followed by a three-digit number, where the first two digits × 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount of up to about 0.0005% to about 0.001% of the suspension.

[0119] In certain embodiments, the composition containing rAAV is delivered at a pH in the range of 6–8, 7.2–7.8, or 7.5–8. For intrathecal delivery, a pH greater than 7.5, for example, 7.5–8, or 7.8 may be desirable. For intravenous delivery, a pH of about 6.8–7.2 may be desired.

[0120] In certain embodiments, the formulation may contain a buffered saline solution that does not contain sodium bicarbonate. Such a formulation may contain a buffered saline solution such as Harvard's buffer, which contains one or more of the following in water: sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof. In one embodiment, the buffer is PBS. In another embodiment, the buffer is artificial cerebrospinal fluid (aCSF), for example, Eliott's formulation buffer, or Harvard apparatus perfusion fluid (artificial CSF having final ion concentrations (mM) of Na 150, K 3.0, Ca 1.4, Mg 0.8, P 1.0, Cl 155). The aqueous solution may further contain Kolliphor® P188, a poloxamer, which is commercially available from BASF and was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2.

[0121] In another embodiment, the formulation may contain a buffered saline solution comprising 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% poloxamer (e.g., Kolliphor®) 188, pH 7.2. See, for example, harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard's buffer is preferred because better pH stability is observed with Harvard's buffer.

[0122] In certain embodiments, the formulation buffer is an artificial CSF containing Pluronic F68. In other embodiments, the formulation may contain one or more osmotic enhancers. Examples of suitable osmotic enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.

[0123] Optionally, the compositions of the present invention may include other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to rAAV and carriers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0124] The compositions according to the present invention may comprise a pharmaceutically acceptable carrier as defined above. Preferably, the compositions described herein comprise an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a target via infusion, permeation pump, intrathecal catheter, or by another device or route. In certain embodiments, an Omaya reservoir is used for delivery. Example The composition is then formulated for intrathecal delivery. In one example, the composition is formulated for intravenous (IV) delivery.

[0125] In certain embodiments, a therapeutically effective amount of the vector is included within a pharmaceutical composition. The choice of carrier is not a limitation of the present invention. Other conventional pharmaceutically acceptable carriers such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0126] As used herein, the term "dosage" or "amount" can refer to the total dosage or amount delivered to a subject over the course of treatment, or the dosage or amount delivered in a single unit (or multiple units or divided dosages) administration.

[0127] In certain embodiments, the composition is formulated into dosage units containing an amount of rAAV that is in the range of about 1×10 9 genomic copies (GC) per gram (g) of brain mass to about 1×10 13 GC per g of brain mass (including all integer or fractional amounts within that range and endpoints). In other embodiments, the dosage is 1×10 10 GC per gram of brain mass to about 1×10 13 GC per gram of brain mass. In specific embodiments, the dosage of rAAV administered to a patient is at least about 1.0×10 9 GC / g of brain mass, about 1.5×10 9 GC / g of brain mass, about 2.0×10 9 GC / g of brain mass, about 2.5×10 9 GC / g of brain mass, about 3.0×10 9 GC / g of brain mass, about 3.5×10 9 GC / g of brain mass, about 4.0×10 9 GC / g of brain mass, about 4.5×10 9 GC / g of brain mass, about 5.0×10 9 GC / g of brain mass, about 5.5×10 9 GC / g of brain mass, about 6.0×10 9The number of GCs per brain mass in grams is approximately 6.5 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 7.0 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 7.5 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 8.0 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 8.5 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 9.0 × 10⁻⁶. 9 The number of GCs per brain mass in grams is approximately 9.5 × 10⁻⁶. 9 The number of GCs per brain mass in g is approximately 1.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 1.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 2.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 2.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 3.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 3.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 4.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 4.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 5.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 5.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 6.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 6.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 7.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 7.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 8.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 8.5 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 9.0 × 10⁻⁶. 10 The number of GCs per brain mass in grams is approximately 9.5 × 10⁻⁶. 10 The number of GCs per brain mass in g is approximately 1.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 1.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 2.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 2.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 3.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 3.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 4.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 4.5 × 10⁻⁶. 11The number of GCs per brain mass in grams is approximately 5.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 5.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 6.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 6.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 7.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 7.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 8.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 8.5 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 9.0 × 10⁻⁶. 11 The number of GCs per brain mass in grams is approximately 9.5 × 10⁻⁶. 11 The number of GCs per brain mass in g is approximately 1.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 1.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 2.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 2.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 3.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 3.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 4.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 4.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 5.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 5.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 6.0 × 10⁻⁶. 12 Individual G C / brain mass in g, approximately 6.5 × 10 12 The number of GCs per brain mass in grams is approximately 7.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 7.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 8.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 8.5 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 9.0 × 10⁻⁶. 12 The number of GCs per brain mass in grams is approximately 9.5 × 10⁻⁶. 12 The number of GCs per brain mass in g is approximately 1.0 × 10⁻⁶. 13 The number of GCs per brain mass in grams is approximately 1.5 × 10⁻⁶. 13 The number of GCs per brain mass in grams is approximately 2.0 × 10⁻⁶. 13 The number of GCs per brain mass in grams is approximately 2.5 × 10⁻⁶. 13 The number of GCs per brain mass in grams is approximately 3.0 × 10⁻⁶. 13GCs per gram of brain mass, about 3.5×10 13 GCs per gram of brain mass, about 4.0×10 13 GCs per gram of brain mass, about 4.5×10 13 GCs per gram of brain mass, about 5.0×10 13 GCs per gram of brain mass, about 5.5×10 13 GCs per gram of brain mass, about 6.0×10 13 GCs per gram of brain mass, about 6.5×10 13 GCs per gram of brain mass, about 7.0×10 13 GCs per gram of brain mass, about 7.5×10 13 GCs per gram of brain mass, about 8.0×10 13 GCs per gram of brain mass, about 8.5×10 13 GCs per gram of brain mass, about 9.0×10 13 GCs per gram of brain mass, about 9.5×10 13 GCs per gram of brain mass, or about 1.0×10 14 GCs per gram of brain mass.

[0128] Furthermore, the composition can be formulated in dosage units containing a replication-deficient virus in an amount in the range of about 1.0×10 9 GCs to about 1.0×10 16 GCs of rAAV, preferably in the range of 1.0×10 12 GCs to 1.0×10 14 GCs. In certain embodiments, the composition contains at least 1×10 9 GCs, 2×10 9 GCs, 3×10 9 GCs, 4×10 9 GCs, 5×10 9 GCs, 6×10 9 GCs, 7×10 9 GCs, 8×10 9 GCs, or 9×10 9 GCs per dose, and includes all integer or fractional amounts within the range. In another embodiment, the composition contains at least 1×10 10 GCs, 2×10 10 GCs, 3×10 10 GCs, 4×1010 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 The formulation contains GCs, the content of which includes all integer or fractional amounts within the range. In another embodiment, the composition contains at least 1 × 10 per dose. 11 , 2×10 11 , 3 x 10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 The formulation contains GCs, the content of which includes all integer or fractional amounts within the range. In another embodiment, the composition contains at least 1 × 10 per dose. 12 , 2×10 12 , 3 x 10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 The formulation contains GCs, the content of which includes all integer or fractional amounts within the range. In another embodiment, the composition contains at least 1 × 10 per dose. 13 , 2×10 13 , 3 x 10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 The formulation contains GCs, the content of which includes all integer or fractional amounts within the range. In another embodiment, the composition contains at least 1 × 10 per dose, including all integer or fractional amounts within the range. 14 , 2×10 14 , 3 x 10 14 , 4×1014, 5×10 14 , 6×10 14 , 7×1014 , 8×10 14 , or 9×10 14 The formulation contains GC. In another embodiment, the composition contains at least 1 × 10 per dose. 15 , 2×10 15 , 3 x 10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 Formulated to contain GCs, the content includes all integer or fractional amounts within the range. In a particular embodiment, for human application, the dose is 1 × 10⁶ per dose, including all integer or fractional amounts within the range. 10 ~Approx. 1×10 12 This can be within the scope of individual garbage collectors.

[0129] In certain embodiments, the composition is administered intravenously. In certain embodiments, the composition is optionally administered intrathecally via intracisional cisterna magna (ICM) infusion. In certain embodiments, the composition is administered via intraparenchymal administration. In certain embodiments, the composition is administered via the Omaya reservoir delivery system. In certain embodiments, the composition is administered via multiple routes, such as intravenous and intrathecal.

[0130] In a particular embodiment, the pharmaceutical composition comprising rAAV as described herein contains approximately 1 × 10⁶ units per gram of brain mass. 9 The number of GCs per gram of brain mass is approximately 1 x 10⁻¹⁶. 13 It is administered in doses of GC. In certain embodiments, the pharmaceutical composition comprising rAAV as described herein is approximately 1 × 10⁶ per gram of brain mass. 11 The number of GCs per gram of brain mass is approximately 6 x 10⁻¹⁴. 11 It can be administered in doses of one GC. In certain embodiments, the pharmaceutical composition comprising rAAV as described herein contains about 1 × 10⁶ units per gram of brain mass. 11It can be administered in doses of one GC. In certain embodiments, the pharmaceutical composition comprising rAAV as described herein is approximately 3.3 × 10⁶ per gram of brain mass. 11 It can be administered in doses of one GC. In certain embodiments, the pharmaceutical composition comprising rAAV as described herein contains approximately 6.7 × 10¹⁶ units per gram of brain mass. 11 It can be administered in doses of this GC.

[0131] method In certain embodiments, a method for treating SMA in subjects requiring treatment is provided herein. The method comprises administering an rAAV vector provided herein, or a composition containing rAAV in an aqueous suspension.

[0132] In certain embodiments, the method includes treating a subject having one or more symptoms associated with SMA (e.g., limb muscle atrophy, difficulty or inability to walk, difficulty breathing, or other symptoms of SMA). In certain embodiments, the subject has reduced levels of viable motor neuron (SMN) protein as a result of loss or mutation of the SMN1 gene. In certain embodiments, the subject is identified as having type I (Werdnig-Hoffmann disease), type II (Dubowitz disease), type III (Kugelberg-Welander disease), or type IV (adult) SMA. In certain embodiments, the subject having SMA has two mutant alleles in the genomic SMN1 gene. In certain embodiments, the subject has a deletion or mutation (e.g., loss of a functional point mutation) in each SMN1 allele. In certain embodiments, the subject is homozygous for the SMN1 gene mutation. In certain embodiments, the subject is heterozygous for two different SMN1 gene mutations. In certain embodiments, the subject has at least one, at least two, at least three, or at least four copies of the functional SMN2 gene. In certain embodiments, the subject has fewer than one, two, three, or four copies of the functional SMN2 gene. In certain embodiments, the subject is human and selected from pediatric and adult populations. In certain embodiments, the subject is over 18 years of age or equal to 18 years of age (e.g., 18 years or older). In certain embodiments, the subject is under 18 years of age, under 10 years of age, or under 6 years of age. In certain embodiments, the subject is approximately 2 weeks old, 1 month old, 3 months old, 6 months old, 1 year old, 2 years old, 3 years old, 4 years old, or 5 years old. In certain embodiments, the subject is less than 1 month old. In certain embodiments, the subject is less than 6 months old. In certain embodiments, the subject is less than 1 year old. In certain embodiments, the subject is between 1 and 10 months old. In certain embodiments, subjects are postnatal and under 2 years of age with spinal muscular atrophy (SMA) having two-allele mutations in the Survival Motor Neuron 1 (SMN1) gene. In certain embodiments, subjects are not age-restricted.

[0133] In certain embodiments, treatment includes alleviating the patient's symptoms so that the severity of the disease is reduced to, for example, SMA1 (also known as Werdnig-Hoffmann disease, 0–6 months), SMA2 (intermediate–6–18 months, Dubowitz disease), SMA3 (over 12 months, Kugelberg-Welander disease), or SMA4 (adult-onset).

[0134] In certain embodiments, the method involves one or more disease symptoms (e.g., particularly loss of limb reflexes; generalized muscle weakness, poor muscle tone, limping, or tendency to fall; difficulty achieving developmental milestones). Treatment of subjects after or before the onset of the following: difficulty sitting / standing / walking; in children, adopting a frog-leg posture while sitting (hip abduction and knee flexion); loss of respiratory muscle strength: weak cough, weak cry (in infants), accumulation of secretions from the lungs or throat, dyspnea; and in severe SMA type, bell-shaped torso (caused by using only abdominal muscles for breathing), fasciculations of the tongue (spasms), and one or more of the following: difficulty sucking or swallowing, loss of appetite.

[0135] In some embodiments, the method targets approximately 1 × 10 11 ~Approx. 1×10 14 The method comprises administering a suspension of rAAV as described herein in a formulation buffer at a dose of 1 GC / kg body weight. In certain embodiments, the method is approximately 1 × 10⁻⁶ 12 rAAV with 1 genome copy (GC) / kg is approximately 1 × 10⁶ per kg. 14 This includes intravenous administration of GCs in doses ranging from rAAV. In certain embodiments, the dose is approximately 1 × 10⁶ per patient. 13 GC / kg ~ approximately 1 × 10 14 The rAAV of individual GCs, or approximately 3 × 10⁶ 13 The GC / kg is 3 × 10⁻¹⁶. In certain embodiments, delivery by intravenous administration is approximately 3 × 10⁻¹⁶. 12 GC / kg ~ approximately 1 × 10 14 The intended dose is one GC / kg, approximately 3.0 × 10⁻⁶ 13 GC / kg and approximately 1.0 × 10⁻⁶ 13Further includes individual GC / kg doses.

[0136] In a particular embodiment, the method involves applying approximately 1 × 10⁶ units of brain mass per gram of subject. 9 The number of GCs per gram of brain mass is approximately 1 x 10⁻¹⁶. 13 The method involves administering a suspension of rAAV as described herein in a formulation buffer at a dose of GC. In certain embodiments, the method involves administering approximately 1 × 10⁶ of brain mass per gram. 11 The number of GCs per gram of brain mass is approximately 6 x 10⁻¹⁴. 11 The method includes administering the rAAV described herein in doses of individual GCs. In certain embodiments, the method involves administering approximately 1 × 10⁶ gram of brain mass per gram. 11 The method includes administering the rAAV described herein in doses of individual GCs. In certain embodiments, the method involves administering approximately 3.3 × 10⁶ gram of brain mass. 11 The method includes administering the rAAV described herein in doses of individual GCs. In certain embodiments, the method involves administering approximately 6.7 × 10⁶ gram of brain mass per gram. 11 This includes administration of rAAV as described herein in the dose of one GC.

[0137] In certain embodiments, a subject is delivered a therapeutically effective dose of the rAAV described herein. As used herein, “therapeutically effective dose” refers to the amount of a composition comprising the nucleic acid sequence encoding SMN1 that delivers to and expresses in target cells a sufficient amount of the gene product to achieve efficacy. Such doses may be adjusted to balance the therapeutic effect with any side effects, and such doses may vary depending on the therapeutic application in which the recombinant vector is used. The expression level of the transgene product can be monitored to determine the frequency of doses resulting in the viral vector, preferably the AAV vector containing the transgene. Optionally, dosing regimens similar to those described for therapeutic purposes may be used in immunizations using the compositions provided herein.

[0138] Preferred, conventionally pharmaceutically acceptable routes of administration include, but are not limited to, direct administration to the desired organ (e.g., brain, CSF, heart), intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, intraparenchymal, intraventricular, intrathecal, ICM, lumbar puncture, and other parenteral routes of administration. Routes of administration may be combined as desired.

[0139] As used herein, the term “administer” or any grammatical variation thereof refers to the delivery of the composition described herein to the subject.

[0140] Suitable volumes for the delivery of these doses and concentrations can be determined by those skilled in the art. For example, volumes of about 1 μL to 150 mL may be selected for CNS delivery, and higher volumes are selected for adults. Typically, for neonates, suitable volumes are about 0.5 mL to about 10 mL, and for infants, about 0.5 mL to about 15 mL may be selected. For this, a volume of approximately 0.5 mL to approximately 20 mL may be selected. For children, a maximum volume of approximately 30 mL may be selected. For pre-teens and teenagers, a maximum volume of approximately 50 mL may be selected. In other embodiments, patients may accept and be selected for intrathecal administration in a volume of approximately 5 mL to approximately 15 mL, or approximately 7.5 mL to approximately 10 mL.

[0141] In certain embodiments, the method includes administering the rAAV described herein to a subject. Preferably, the rAAV suspended in a physiologically compatible carrier may be administered to a human or non-human mammalian patient of interest. In certain embodiments, for administration to a human patient, the rAAV is preferably suspended in an aqueous solution containing physiological saline, a surfactant, and a physiologically compatible salt or mixture of salts. Preferably, the formulation is adjusted to a physiologically acceptable pH, for example, pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. Since the pH of cerebrospinal fluid is approximately 7.28 to approximately 7.32, a pH within this range is desirable for intrathecal delivery, and a pH of approximately 6.8 to approximately 7.2 may be desirable for intravenous delivery. For intravenous delivery, a pH of approximately 6.8 to approximately 7.2 may be desired. However, other pH ranges, and sub-ranges thereof, are available and may be selected for other delivery routes.

[0142] Preferably, the pharmaceutical compositions described herein, and their use thereof, involve delivery to a target by infusion, permeation pump, intrathecal catheter, or delivery by another device or route. In one example, the composition is formulated for intrathecal delivery.

[0143] As used herein, the terms “intrathecal delivery” or “intrathecal administration” refer to a route of administration via injection into the spinal canal, more specifically into the subarachnoid space, to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including lateral ventricles (ICV)), suboccipital / cisternal, and / or C1-2 puncture. For example, the material may be introduced by means of lumbar puncture to diffuse throughout the subarachnoid space. In another example, it may be injected into the cisterna magna. In certain embodiments, the rAAV vector or composition described herein is administered to a subject requiring it via intrathecal administration. In certain embodiments, intrathecal administration is carried out as described in U.S. Patent Publication 2018 / 0339065A1, published November 29, 2019, which is incorporated herein by reference in its entirety. In certain embodiments, CNS administration is performed using an Omaya reservoir (also referred to as an Omaya device or Omaya system).

[0144] As used herein, the terms “intracisternal delivery” or “intracisternal administration” refer to a direct route of drug administration into the cerebrospinal fluid of the cisterna magnum of the cerebellum, more specifically, a route of drug administration by suboccipital puncture, direct injection into the cisterna magnum, or a permanently placed tube.

[0145] In certain embodiments, administration of the rAAV vector provided herein is associated with reduced toxicity, which may include, for example, reduced neurodegeneration, reduced spinal axonal injury, reduced dorsal root ganglion (DRG) toxicity (including lesions characterized by, e.g., neurodegeneration / necrosis, nerve fiber degeneration, and / or mononuclear cell infiltration), reduced NfL levels in serum and / or CSF, reduced hepatotoxicity, or a risk of liver injury or liver failure. In certain embodiments, the toxicity is reduced compared to another gene therapy for SMN1 delivery, e.g., a gene therapy requiring an alternative AVV capsid, being scAAV, utilizing an alternative promoter that is not the UbC promoter, having a vector genome that does not contain miRNA target sequences, and / or being delivered by an alternative route of administration, particularly intravenous administration. In certain embodiments, the reduced toxicity allows for the delivery of lower doses of the rAAV provided herein compared to another gene therapy for SMN1 delivery.

[0146] An increase in NfL levels has been detected after administration of gene therapy (Alves CRR, et al. Implications of circulating neurofilaments for spinal muscular atrophy treatment early in life: A case series. Mol Ther Methods Clin Dev. 2021 Oct 30;23:524-538). In certain embodiments, the method provided includes obtaining one or more measurements of NfL levels in a biological sample obtained from a subject. In certain embodiments, administration of rAAV provided herein results in a reduction or undetectable increase in NfL levels in a biological sample (e.g., serum, plasma, and / or CSF) compared to alternative gene therapy for SMN1 delivery. In certain embodiments, the method provided includes obtaining one or more measurements of serum myostatin levels in a biological sample obtained from a subject. In certain embodiments, administration of rAAV provided herein results in low levels of serum myostatin in a biological sample (e.g., serum, plasma, and / or CSF) compared to alternative gene therapy for SMN1 delivery. To evaluate relative changes, biological samples may be obtained before and after administration of the rAAV vector.

[0147] In a further embodiment, preferably, the compositions of the present invention are designed so that an rAAV vector carries a nucleic acid expression cassette comprising an SMN1 coding sequence and a regulatory sequence that directs the expression of SMN1 in target cells. The use of the compositions described herein in methods for treating SMA may involve the delivery of one or more other combination therapies, as well as the use of these compositions in regimens.

[0148] In certain embodiments, the method involves administering an immunosuppressant as the target of a combination therapy. Such immunosuppressants for combination therapies include, but are not limited to, glucocorticoids, steroids or corticosteroids, antimetabolists, T cell inhibitors, macrolides (e.g., rapamycin or rapalog), and cell division inhibitors including alkylating agents, antimetabolists, cytotoxic antibiotics, antibodies, or immunophilin activators. Immunosuppressants include nitrogen mustard, nitrosourea, platinum compounds, methotrexate, azathioprine, mycophenolate mofetil, methotrexate, leflunomide (Arava), cyclophosphamide, chlorambucil (Leukeran), chloroquine (e.g., hydroxychloroquine), quinine sulfate, mefloquine, atobakon and proguanil combination, sulfasalazine, mercaptopurine, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, mithramycin, and those targeted to the IL-2 receptor (CD25) or CD3. This may include antibodies, anti-IL-2 antibodies, cyclosporine, abatacept (Orencia), adalimumab (Humira), anakinra (Kineret), certolizumab (Cimzia), etanercept (Enbrel), golimumab (Simponi), infliximab (Remicade), rituximab (Rituxan), tocilizumab (Actemra) and tofacitinib (Xeljanz), cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-alpha) conjugates, as well as combinations of these drugs.

[0149] In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 7 days before or earlier than the administration of the rAAV vector. Such therapy may involve co-administration of two or more drugs on the same day, the (e.g., prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)). One or more of these drugs may be continued after gene therapy administration at the same or adjusted doses. Such therapy may last, if necessary, about 1 week (7 days), about 60 days, or longer. In certain embodiments, a regimen that does not include tacrolimus is selected.

[0150] In certain embodiments, the need for immunosuppressant treatment required for other SMA gene therapies is reduced or eliminated in terms of dose and / or duration. In certain embodiments, the method provided includes treatment with an immunosuppressant for about one week, about two weeks, about three weeks, or within about one month after administration of the rAAV vector.

[0151] In a particular embodiment, the method is Combination therapy includes administering an rAAV vector containing the SMN1 coding sequence described herein in combination with an antisense oligonucleotide (ASO) that increases full-length SMN2 mRNA in a subject (for example, an ASO that promotes the inclusion of exon 7 in SMN2 mRNA) (see US2021 / 0308281A1, incorporated herein by reference). In certain embodiments, the SMN2 ASO is SPINRAZA® (nusinersen). The rAAV and ASO may be combined into a single formulation or administered separately.

[0152] In a particular embodiment, the method is The method includes combination therapy, comprising administering an rAAV vector containing the SMN1 coding sequence described herein in combination with one or more additional agents, such as oresoxime, AVX-101, CK-2127107, RG7916, RG7800, R07034067, LMI070, SRK-015, a p38aDMAPK inhibitor, a DcpS inhibitor, or a JNK inhibitor. In certain embodiments, the method includes combination therapy, comprising an agent, such as oresoxime, a certain beta-lactam antibiotic, such as thyrotropin-releasing hormone, riurzole, ceflet4riaxone, or a neuroprotective compound, such as follistatin. In certain embodiments, the method includes combination therapy comprising agents that promote muscle recovery, such as reldesemtiv (a skeletal troponin activator), apatiglomab (a myostatin-blocking Mab), and GYM329 (a myostatin activation blocker). rAAV and additional agents may be combined into a single formulation or administered separately.

[0153] In a particular embodiment, the method is Combination therapy includes administering an rAAV vector containing the SMN1 coding sequence described herein in combination with a small molecule that promotes SMN function (see US2022 / 0280548A1, incorporated herein by reference). The rAAV and the small molecule may be combined in a single formulation or administered separately. In certain embodiments, the small molecule is a splice modifier, an HDAC inhibitor, or a molecule that modulates the activity of an mRNA decapping enzyme. In certain embodiments, the small molecule is an SMN2 splice modifier. In certain embodiments, the splice modifier is 7-disubstituted phenyltetracycline. In certain embodiments, the splice modifier is substituted isoindolinone. In certain embodiments, the splice modifier is a substituted carbazole derivative. In certain embodiments, the SMN2 splice modifier is substituted 1,4-diazepane. In certain embodiments, the SMN2 splice modifier is substituted pyridazine. In certain embodiments, the SMN2 splice modifier is risdiplam. In a particular embodiment, the SMN2 splice modifier is branapram.

[0154] In certain embodiments, the method includes administering an anti-AAV neutralizing antibody (NAb) to reduce peripheral transduction and mitigate the potential risk of AAV-induced toxicity. In certain embodiments, the method includes detecting the presence of systemic AAV NAb before treatment with anti-AAV NAb, and patients with anti-AAV NAb levels exceeding a predetermined level against rAAV capsid (or serum cross-reactive capsid) do not require pretreatment. Such levels are, for example, about 1:10, about 1:20, about 1:50, about 1:100, about 1 :250, or higher or lower levels. In certain embodiments, the method further comprises administering to the patient intravenously a human anti-AAV polyclonal antibody (e.g., plasma-derived pooled human immunoglobulin (IVIG)), an anti-AAV monoclonal antibody, or a cocktail of anti-AAV antibodies about 1 day to about 2 hours before treatment for rAAV. In certain embodiments, the therapeutic method provided herein is not limited by the presence of anti-AAV NAb detected in the subject, so the efficacy of the treatment is not limited and / or there is no need to exclude or delay the treatment of subjects found to have detectable levels of anti-AAV NAb.

[0155] In certain embodiments, a combination regimen is provided to prevent off-target delivery of rAAV, the regimen comprising (a) pre-treating the patient by systemically administering a composition comprising an anti-AAV capsid neutralizing antibody directed against the AAV capsid in a recombinant AAV vector, and (b) administering the rAAV described herein. See also U.S. Provisional Patent Application No. 63 / 328,227, filed April 6, 2022, which is incorporated herein by reference in its entirety.

[0156] As used herein, “neutralizing antibody” or “NAb” specifically binds to a viral capsid or envelope and interferes with the infectivity of the virus or a recombinant viral vector having a viral capsid or envelope, thereby preventing the recombinant viral vector from delivering an effective amount of gene products encoded by the expression cassette within its vector genome. Various methods may be available for evaluating neutralizing antibodies in a patient’s serum. The terms method and assay may be used synonymously. As used herein, the terms “neutralizing assay” and “serum viral neutralizing assay” refer to serological tests for detecting the presence of systemic antibodies that can interfere with the infectivity of a virus. Such assays may also qualitatively or quantitatively identify the binding ability (e.g., scale) or efficiency of an antibody that neutralizes a target. Immunological assays may include enzyme immunoassay (EIA), radioimmunoassay (RIA) using radioisotopes, fluorescence immunoassay (FIA) using fluorescent materials, chemiluminescence immunoassay (CLIA) using chemiluminescent materials, as well as counting immunoassay (CIA) employing particle counting techniques, Western blotting, immunohistochemistry (IHC), and other modified assays such as agglutination. One of the most common enzyme immunoassays is enzyme-linked immunosorbent assay (ELISA).

[0157] Examples of preferred methods include, for example, R Calcedo, et al, Journal Infectious Diseases, 2009, 199:381-290; GUO, et al., “Rapid AAV Neutralizing Antibody Determination with a Cell-Binding Assay”, Molecular Therapy: Methods & Clinical Development Vol.13 June 2019; and T. Ito et al, “A convenient enzyme-linked immunosorbent This includes assays described in "Assassination for rapid screening of anti-adeno-associated virus neutralizing antibodies," Ann Clin Biochem 2009;46:508-510, US2018 / 0356394A2 (Voyager Therapeutics). In addition, commercially available kits exist (see, for example, Athena Diagnostics, Invitrogen, ThermoFisher.com, and Covance).

[0158] The neutralizing ability of an antibody is typically measured through the expression of a reporter gene such as luciferase or GFP. To determine and compare the activity of neutralizing antibodies, the antibody being tested should exhibit a neutralizing activity of 50% or more in one of the neutralization assays described herein. In some embodiments, neutralization ability is determined by measuring the activity of a reporter gene product (e.g., luciferase, GFP). The neutralization ability of an antibody against a specific viral vector may be at least 50%, for example, at least 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%.

[0159] As used herein, the term “NAb titer” is a measure of how much neutralizing antibody (e.g., anti-AAV Nab) is produced and neutralizes the physiological effect of its target epitope (e.g., AAV). Anti-AAV NAb titer can be measured as described, for example, in Calcedo, R., et al., *Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses*, *Journal of Infectious Diseases*, 2009. 199(3): pp. 381-390, which is incorporated herein by reference.

[0160] Further concomitant therapies may include, for example, anti-IgG enzymes reported to be useful in depleting anti-AAV antibodies (and thus enabling administration to patients who test above threshold levels of antibodies against selected AAV capsids), as well as delivery of anti-FcRN antibodies, and / or one or more of the following: a) steroids or combinations of steroids, and / or (b) IgG cleavage enzymes, (c) Fc-IgE binding inhibitors, (d) Fc-IgM binding inhibitors, (e) Fc-IgA binding inhibitors, and / or (f) gamma interferons. Examples of anti-FcRN antibodies include rozanolixizumab (UCB7665) (UCB SA), IMVT-1401, RVT-1401 (HL161), HBM9161 (all forms, HanAll BioPhrma Co.Ltd), and nipocalimab (M281) (Momenta Pharmaceuticals). Alexion Pharmaceuticals Inc., ARGX-113 (efgartigimod) (Argenx SE), olilanorimab (ALXN1830, SYNT001, Alexion Pharmaceuticals Inc.), SYNT002, ABY-039 (Affibody This includes AB), or DX-2507 (Takeda Pharmaceutical Co. Ltd). In certain embodiments, a combination of anti-FcRN antibodies is administered. In certain embodiments, the anti-FcRN antibody is administered in combination with a suitable anti-FcRn ligand (i.e., a peptide or protein construct that binds to human FcRn to inhibit IgG binding).

[0161] In certain embodiments, an anti-FcRn ligand(s) (e.g., antibodies) is administered to a patient with a neutralizing antibody prior to and optionally simultaneously with a selected viral vector. In certain embodiments, continuous expression of the anti-FcRn ligand after administration of the gene therapy vector may be desired on a short-term (transient basis), for example, until the viral vector is cleared from the patient. In certain embodiments, sustained expression of the anti-FcRn ligand may be desired. Optionally, in this embodiment, the ligand may be delivered via a viral vector, for example, within a viral vector expressing a therapeutic transgene. However, this embodiment is undesirable if the therapeutic gene being delivered is an antibody or antibody construct, or another construct containing an IgG chain. In such embodiments, where an antibody construct containing an IgG chain is delivered via a viral vector to a patient with pre-existing immunity, the anti-FcRn ligand is delivered or administered transiently so that the amount of circulating anti-FcRn ligand is cleared from the serum before an effective level of the vector-mediated transgene product is expressed.

[0162] In certain embodiments, the FcRn ligand is delivered 1 to 7 days before administration of the vector (e.g., rAAV). In certain embodiments, the FcRn ligand is delivered daily. In certain embodiments, the FcRn ligand (e.g., immunoglobulin construct(s)) is delivered on the same day as the vector is administered. In certain embodiments, the FcRn ligand (e.g., immunoglobulin construct(s)) is delivered at least 1 to 4 weeks after rAAV administration. In certain embodiments, the ligand is delivered 4 weeks to 6 months after rAAV administration. In certain embodiments, the ligand is administered via a different route of administration than rAAV. In certain embodiments, the ligand is administered orally, intravenously, or intraperitoneally. See also International Patent Application PCT / US2021 / 037575, filed on 16 June 2021, and WO2021 / 257668A1, which is currently published and is incorporated herein by reference in its entirety.

[0163] In certain embodiments, the method includes measuring nerve filament levels (e.g., pNF-H levels). The method includes providing a biological sample obtained from a human subject having mutations in both copies of the SMN1 gene, leading to functional SMN protein deficiency, and measuring nerve filament levels (e.g., pNF-H levels) in the biological sample. In certain embodiments, the method includes measuring nerve filament levels (e.g., pNF-H levels) in a first biological sample obtained from a human subject before administering the rAAV described herein that delivers the SMN1 coding sequence, administering the rAAV (e.g., a therapeutically effective dose of rAAV) to the human subject, and measuring nerve filament levels (e.g., pNF-H levels) in a second biological sample obtained from the human subject after administration of the rAAV. In certain embodiments, the nerve filament is the nerve filament heavy chain (e.g., phosphorylated NF-H). In certain embodiments, the nerve filament is the nerve filament medium / intermediate chain. In certain embodiments, the nerve filament is the nerve filament light chain. In certain embodiments, the nerve filament is intemexin. In certain embodiments, the nerve filament is peripherin. See US2023 / 0107651A1 incorporated herein by reference.

[0164] As used herein, the term “biological sample” refers to any cell, biological fluid, or tissue. Suitable samples for use in the present invention may include, but are not limited to, whole blood, leukocytes, fibroblasts, serum, urine, plasma, saliva, bone marrow, cerebrospinal fluid, amniotic fluid, and skin cells. Such samples may be further diluted with saline, buffer, or physiologically acceptable diluents. Alternatively, such samples may be concentrated by conventional means.

[0165] kit In certain embodiments, a kit is provided comprising a concentrated vector suspended in a (optionally frozen) formulation, an optional dilution buffer, and devices and other components required for intrathecal, intraventricular, or intracisional administration. In other embodiments, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to enable infusion. Such buffer may allow for dilutions of the concentrated vector of approximately 1:1 to 1:5, or more. In other embodiments, a larger or smaller volume of buffer or sterile water is included to allow for dose titration and other adjustments by the treating physician. In yet another embodiment, the kit includes one or more components of a device. Suitable dilution buffers, such as physiological saline, phosphate-buffered saline (PBS), or glycerol / PBS, are available.

[0166] Apparatus and method for delivering pharmaceutical compositions In one embodiment, the vectors, rAAVs, or compositions thereof provided herein are used in this context. The vector, rAAV, or its composition provided herein may be administered intrathecally via methods and / or devices as described in WO2017 / 136500 and WO2018 / 160582 (incorporated herein by reference). Alternatively, other devices and methods may be selected. In certain embodiments, the method includes the step of CT-guided suboccipital injection into the patient's cisterna magna via a spinal needle. As used herein, the term computed tomography (CT) refers to radiography in which a computer constructs a three-dimensional image of a body structure from a series of planar cross-sectional images created along an axis. In certain embodiments, the apparatus is described in U.S. Patent Publication No. 2018-0339065A1, published November 29, 2019, which is incorporated herein in its entirety by reference. In certain embodiments, the vector, rAAV, or its composition provided herein may be administered using an Omaya reservoir.

[0167] The following embodiments are provided to illustrate specific aspects of the claimed invention. The present invention is not limited to these embodiments. [Examples]

[0168] Example 1: Development of an improved AAV vector for delivery of the hSMN1 transgene. A series of recombinant vector genomes were manipulated and packaged into an AAVhu68 capsid. The constructs contained the same SMN1 coding sequence but included different regulatory sequences, including one combination of four promoters (CB7, UbC, Jet, and hSyn), intron sequences, and the miR182 target sequence. The vector genomes and their components are shown in Figure 1. UbC.PI.hSMN1co.rBG UbC.PI.hSMN1co.4xmiR182.rBG (Sequence ID 2) CB7.CI.hSMN1co.4xmiR182.rBG (Sequence ID 1) hSYN.hSMN1co.4xmiR182.rBG (Sequence ID 3) Jet.hSMN1co.4xmiR182.rBG (Sequence ID 4)

[0169] Description of vector elements: 1. Inverted End Sequence (ITR): An AAV ITR is a sequence that is identical at both ends but has opposite orientations. When AAV and adenovirus helper function is provided in trans, the AAV2 ITR sequence functions as both the origin of vector DNA replication and the packaging signal for the vector genome. Therefore, the ITR sequence represents the only cis sequence necessary for vector genome replication and packaging. 2. Promoter: (i) CB7 promoter (Cytomegalovirus early stage (CMV) (i) enhancer and chicken β-actin promoter), (ii) ubiquitin C (UbC) promoter (SEQ ID NO: 10), (iii) human synapsin 1 (hSYN) promoter, and (iv) JeT promoter (synthetic promoter). 3. Introns: (i) Chimeric chicken β-actin intron (CI), and (ii): Intron (PI) (SEQ ID NO: 11) (see also GenBank: U47121.2). 4. hSMN1 code sequence: The manipulated SMN1 code sequence (sequence number 7). 5. miR182 target sequences: Tandem repeats of four target sequences (each having the nucleotide sequence shown in SEQ ID NO: 12) that can be conjugated by miR182 to promote transgene expression and DRG-specific reduction of toxicity. (For example, as described in WO2020 / 132455A1 and WO2021 / 231579A1). 6. Polyadenylation Signal (PolyA): The rabbit β-globin polyadenylation signal (rBG) provides a cis sequence for efficient polyadenylation of antibody mRNA. This element functions as a signal for transcription termination, a specific cleavage event at the 3' end of the nascent transcript, and the addition of a long polyadeny tail. (SEQ ID NO: 13).

[0170] As described, the AAVhu68 vector was prepared using conventional triple transfection techniques in 293 cells [Mizukami, Hiroaki, et al. A Protocol for AAV vector production and purification. Diss. Division of Genetics]. Therapeutics, Center for Molecular Medicine, 1998, Lock, M., et al, Hum Gene Ther, 21:1259-1271 (2010)]. Transplasmid: pAAV2 / hu68n.KanR Helper plasmid: pAdDeltaF6(Kan)

[0171] Example 2: Efficacy study of AAVhu68.hSMN1 vector in mice We conducted a study to evaluate hSMN1 expression after delivery of the AAVhu68 vector. In a group of C57BL / 6J mice, 1 × 10⁶ mice were subjected to the following treatment.12 One of the following GC vectors was IV-injected: AAVhu68.CB7.hSMN1.rBG AAVhu68.CB7.hSMN1.4XmiR182.rBG AAVhu68.Jet.hSMN1.4XmiR182.rBG AAVhu68.Ubc.hSMN1.4XmiR182.rBG

[0172] On day 7, mice were euthanized and liver tissue was collected for detection of hSMN1 transcripts by ISH. IV-administered WT mice showed that the CB7 promoter produced the highest hSMN1 expression, followed by the Ubc and Jet promoters. The presence of four sequence targets of miR182 in the 3' untranslated region of the corresponding transgene messenger RNA into the vector genome, which are added to the vector to prevent transgene overexpression-dependent DRG toxicity, did not affect the level of hSMN1 expression produced by the CB7 promoter (Figure 2).

[0173] This study demonstrated the superiority of the CB7 promoter over other promoters in generating high levels of hSMN1 expression in the liver after IV administration of the different vectors tested. For safety reasons, weaker liver expression, such as that achieved with the Ubc and Jet promoters, is preferable.

[0174] Additional studies were conducted using the SMA mouse model, also known as the SMNΔ7 mouse, FVB.Cg-Grm7Tg.(SMN2)89Ahmb Smn1tm1MsdTg(SMN2*delta7)4299Ahmb / J. This triple mutant mouse has two transgenic alleles and a single target null mutant (the mouse lacks mouse Smn and expresses the intact human SMN2 gene + SMN2Δ7 cDNA). The mice exhibit low birth weight and show abnormal gait, hindlimb tremors, and a tendency to fall at 1 week of age. The average lifespan of these mice is approximately 17 days.

[0175] Newborn (P0) SMNΔ7 mice were administered one of the following vectors by GC (ICV): 11 AAVhu68.CB7.hSMN1.rBG, n = 15 AAVhu68.CB7.hSMN1.rBG, n = 15 AAVhu68.CB7.hSMN1.4XmiR182.rBG, n = 13 AAVhu68.Jet.hSMN1.4XmiR182.rBG, n = 10 AAVhu68.Syn.hSMN1.4XmiR182.rBG, n = 9 AAVhu68.Ubc.hSMN1.4XmiR182.rBG, n = 9

[0176] Surviving leads-out included monitoring of survival, body weight, righting reflex, and grip strength. The mice were euthanized on day 120, and tissues were collected for determination of transgene (hSMN1) expression by ISH and the potential for toxicity, particularly in the spinal cord and dorsal root ganglia (DRG). Surviving leads-out included monitoring of survival, body weight, righting reflex, and grip strength. The mice were euthanized on day 120, and tissues were collected for determination of transgene (hSMN1) expression by ISH and the potential for toxicity, particularly in the spinal cord and dorsal root ganglia (DRG).

[0177] PBS was administered to WT (C57BL6 / J) and SMNΔ7 mice as a control. When only PBS was administered, the median survival period of SMNΔ7 mice was 12 days.

[0178] In contrast, the median survival period of SMNΔ7 mice was significantly increased when AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG was administered ICV to the animals. 55% of the animals treated with AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG survived until the end point of the 120-day study, so the median survival period could not be defined, but it was at least 10 times the median survival period with only PBS (Figure 3).

[0179] Also, the median survival period increased to 39 days with AAVhu68.CB7.hSMN1.rBG and to 26 days with AAVhu68.CB7.hSMN1.4xmiR182.rBG.

[0180] However, ICV administration of AAVhu68.Jet.hSMN1.4xmiR182.rBG and AAVhu68.hSyn.hSMN1co.4xmiR182.rBG had little effect on the median survival time of SMNΔ7 mice, which was 14 and 15 days, respectively.

[0181] SMNΔ7 mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG also showed a gradual improvement in body weight, which was better than other vectors (Figure 4).

[0182] In addition to best survival, mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG also showed normalized righting reflexes and improved gripping scores. This gripping score was a measure of impaired information regarding limb and joint position, altered reflexes, or improper integration of sensory and motor information, including proprioceptive neuronal dysfunction (Figure 5).

[0183] Importantly, AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG and other vectors did not induce toxicity in healthy littermates (smn+ / +) in terms of survival, weight gain, and gripping reflex, the latter demonstrating that SMN overexpression is not associated with motor and sensory circuit toxicity (Figure 6).

[0184] Survival rescue was associated with higher mean motor neuron transduction (52% of ChAT+ cells expressing hSMN1 by ISH) compared to mice treated with vehicle and other test substances (Figure 7A), and also with better cardiac pathology rescue in SMNΔ7 mice treated with AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG.KanR(p7097) (Figure 7B).

[0185] Example 3: NHP study on expression and safety after administration of SMN1 AAV vector Safety and toxicity studies in NHP, 3.0 × 10 13 GC(3.3×1011 The following three studies were conducted using GC / g brain doses, with adult rhesus monkeys (6-7 years old), 3 animals per group, and both sexes receiving ICM: AAVhu68.CB7.hSMN1.rBG AAVhu68.CB7.hSMN1.4XmiR182.rBG AAVhu68.Ubc.hSMN1.4XmiR182.rBG

[0186] Survival assessment included behavioral observation, clinicopathological examination, CSF collection, and nerve conduction studies. Animals were euthanized on day 35, and tissue was collected for detection of hSMN1 expression by ISH and H&E staining for pathology. Immune responses to the transgene and vector were also measured.

[0187] hSMN1 expression in motor neurons after ICM administration is related to hSMN1 and ChAT Confirmed by ISH. Overall, the number of hSMN1-positive cells was comparable across all three groups, as expected with the use of the same capsid, although signal intensity was weaker with the UbC promoter, as expected given the relative intensities of the CB7 and UbC promoters (Figures 8A and 8B). Based on improved phenotypic survival and rescue in rodent studies with 52% motor neuron transduction, the percentage of hSMN1+ cells detected in animals treated with UbC.hSMN1.4xmiR182 (45%) is likely to be beneficial to patients.

[0188] Clinicopathological evaluation revealed mild asymptomatic pleocytosis in CSF of animals treated with a vector containing the Ubc promoter (AAVhu68.UbC.PI.hSMN1.4xmiR182.rBG) (Figure 9).

[0189] Nerve conduction velocity and sensory nerve action potential amplitude (SNAP) were unaffected by the administration of any of the vectors (Figure 10), and neurodegeneration was similar across the three different promoters, ranging from minimal to mild (Figure 11).

[0190] Aggregating data from all histological sections scored within the group, AAVhu68.UbC.hSMN1.4XmiR182 resulted in the lowest levels of dorsal spinal cord axonal injury and the lowest CSF NfL elevation at day 28, consistent with a favorable DRG toxicity profile (Figures 12, 13A, and 13B). Lower NfL multiplier changes in animals treated with AAVhu68.UbC.hSMN1.4XmiR182 were consistent with lower axonal injury scores (Figures 14A and 14B).

[0191] Blood chemistry was not significant in macaques treated over the 35-day study period. Cage lateral assessments revealed no animals with clinically significant conditions or neurological concerns. Blood coagulation was normal, except for a slight transient increase in the coagulation factor fibrinogen. In treated monkeys, liver and kidney damage, as well as biomarkers for circulating ions and metabolites, were all within the normal range. Treatment with the three vectors showed no evidence of toxicity.

[0192] Increased neutralizing and binding antibody titers were observed, with the highest levels detected on day 35 in all treated animals. The increase in antibody titers was not associated with any clinical complications. The ELISPOT study identified moderate immune responses to AAVhu68 peptide pool C in PBMCs and spleen. Overall, the immune response to AAVhu68 was milder in the Ubc.4XmiR182 and CB7.4XmiR182 promoter groups. The immune response to AAVhu68 did not cause any adverse events in animals treated with the vector. The ELISPOT study identified moderate immune responses to the hSMN1 peptide in PBMCs, liver, and spleen. Overall, the immune response to hSMN1 was milder in the Ubc.4XmiR182 and CB7.4XmiR182 promoter groups. The immune response to AAVhu68 did not cause any adverse events in animals treated with the vector.

[0193] Transgene immunogenicity can confound the results of NHP studies due to non-self responses, but is not a concern in the trial as patients are expected to be tolerant to endogenous SMN derived from SMN2 transcription.

[0194] Example 4: Pharmacology and safety study of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to determine the minimum effective dose (MED) after ICV administration in SMNΔ7 mice A study was conducted to evaluate efficacy and safety and determine the MED of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG administered ICV.

[0195] As summarized in the following table, the study evaluated SMNΔ7 mice (N = 60) and wild-type controls (N = 60) treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG in N = 120 neonates (PND0 - 1). This study included one necropsy time point (120 days post-treatment).

[0196] Four dose levels of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG were evaluated after ICV administration. The dose levels evaluated encompassed the expected clinical doses.

Table 1

[0197] Survival evaluations included daily survival checks, body weight measurements, and behavioral evaluations (righting reflex and hindlimb grip test). Transgene product expression (by ISH and IF) was evaluated in disease-related target tissues and highly transduced peripheral tissues.

[0198] The MED was determined in target tissues of SMNΔ7 mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG compared to vehicle-treated WT control mice The effectiveness of transgene product expression was determined based on an analysis of improvements in survival and behavioral phenotype. Higher dose (1.0 × 10) 11 Administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG (1 GC) increased the survival of SMNΔ7 mice (Figure 15). Wild-type mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG showed no evidence of overexpression toxicity up to day 120 of the study (Figure 16). Two doses (1.0 × 10) 11 GC and 5.0 × 10 9 Administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to SMNΔ7 mice in individual GCs resulted in improved body weight (Figure 17), while administration of the vector to wild-type mice did not affect body weight gain (Figure 18).

[0199] Administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG in three doses resulted in improved righting reflexes compared to untreated mice starting with PND7 (Figure 19). Two doses (1.0 × 10⁻⁶) 11 GC and 5.0 × 10 9 SMNΔ7 mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG in individual GCs showed improvement in the gripping phenotype (Figure 21). Wild-type mice treated with AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG did not show the gripping phenotype and did not exhibit overexpression toxicity (Figure 20).

[0200] Example 5: Toxicity study - AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG administered to juvenile rhesus monkeys via intracisional chamber (ICM) injection. Animal models and the age of the animals A GLP-compliant toxicity study was conducted using young (2-3 year old) NHPs. This age range allows for modeling of the size and anatomical structure of the cisterna magna in the youngest intended patient population to the greatest extent possible. The dimensions of the CNS in NHPs serve as a representative model of our target clinical population, enabling the administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG using the intended clinical administration route. Furthermore, the toxicity and immune response of NHPs are very similar to those of humans. This study provided important data on the safety and pharmacokinetics of the test substance related to the administration route after administration to rhesus monkeys.

[0201] We selected both sexes to model the patient population (male and female SMA patients) intended for the planned clinical trial.

[0202] Dosage selection In GLP-compliant toxicity studies in juvenile rhesus monkeys, the highest dose used in the MED mouse study (1 × 10⁻¹⁰) was observed. 11 5.8 × 10 (corresponding to individual GC / animals) 13 Using a dose of GC, this amounts to approximately 6.7 × 10⁶ per gram of mouse brain. 11 (Assuming a neonatal mouse brain weight of 0.150 g) and the brain of a young rhesus monkey, approximately 6.0 × 10⁶ per gram. 13 This corresponds to one GC (assuming a brain weight of 90 grams). This dose also represents a dose close to the technically maximum practicable dose based on the maximum safe CSF infusion volume (1.5 mL) in juvenile rhesus monkeys and under vector titer constraints.

[0203] Research period A GLP-compliant toxicity study in juvenile rhesus monkeys was conducted over a 90-day period. This 90-day duration allowed for the confirmation of the non-progressive nature of the DRG pathological condition and enabled the acquisition of long-term safety and immunological data.

[0204] Route of administration The ICM pathway reflects the intended clinical pathway and is used in planned clinical trials. It was selected for GLP-compliant toxicity studies in juvenile rhesus monkeys to enable the use of an equivalent clinical administration system. [Table 2] [Table 3-1] [Table 3-2] [Table 3-3] Abbreviations: BAb, binding antibody; BT, blue top: sodium citrate; CSF, cerebrospinal fluid; DRG, dorsal root ganglion; ELISPOT, enzyme-linked immunosorbent spot; GT, green top: heparin; ITFFB, intrathecal final preparation buffer; kg, kilogram; LT, lavender top: K2EDTA; mg, milligram; NA, not applicable; NAb, neutralizing antibody; PMBC, peripheral blood mononuclear cells; PK, pharmacokinetics; RC, red top: no anticoagulant. a The number of animals evaluated. b Includes whole blood count and differential diagnosis (hematology), clinical chemistry, and coagulation panels.

[0205] The animals are visually observed daily for general appearance and signs of toxicity, which may include, but are not limited to, neurological signs or lethargy, distress, and behavioral changes.

[0206] Throughout the study, the following was done at the points defined in the table above. ● The animals underwent neurological monitoring. ● Record the test results of nerve conduction studies from the left and right median nerves. ●Animals were anesthetized and bled from peripheral veins for coagulation panel analysis, CBC, serological chemistry, neutralizing (NAb) and binding (BAb) antibodies against hu68 capsid, isolation of peripheral blood mononuclear cells (PBMCs), vector PK, and biomarker analysis. ● The animals were anesthetized, moved from the holding room to the treatment room, and placed in a lateral decubitus position with their heads flexed forward for CSF collection for CSF clinical pathology, CSF biomarkers, CSF NAb, and / or CSF pharmacokinetic analysis.

[0207] Following autopsy, a comprehensive list of tissues (CNS, PNS, and peripheral organs) was evaluated by a committee-certified veterinary pathologist and peer-reviewed by an independent committee-certified pathologist.

[0208] result ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to juvenile NHP did not affect sensory nerve action potentials (SNAP) or conduction velocity in treated animals (Figure 22). No CSF-related abnormalities were identified after ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to juvenile NHP (Figure 23). Vector administration did not result in elevated liver enzymes (Figure 24) or effects on liver function (Figures 23A-23C). ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to juvenile NHP did not affect coagulation parameters. (Figure 26). Overall, ICM administration of AAVhu68.Ubc.PI.hSMN1.4xmiR182.rBG to rhesus monkeys was safe and well-tolerated.

[0209] Example 6: Method for scaling from non-clinical dose to clinical dose Since administration of the ICM vector resulted in immediate vector distribution within the CSF compartment, both efficacy and toxicity are expected to be related to CNS vector exposure. Therefore, the dose is scaled by brain mass, which provides an approximation of the CSF compartment size. Dose conversion between animals and patients in the FIH study is based on brain masses of 0.15 g for neonatal mice, 90 g for juvenile NHP, 488 g for infants aged 1–4 months, and 960 g for children aged 12 months or older. Estimated brain weights for each age range of human infants are derived from the brain weights of males and females shown in the table below. Examples of dose scaling from neonatal mice, juvenile NHP, and equivalent human doses are presented using the doses used in NHP toxicity and mouse MED studies. The dose volume is also scaled from NHP to humans based on the estimated volumes of brain CSF and spinal cord CSF, so that less than 10% of the total CSF volume is administered, consistent with the NHP safety study. [Table 4]

[0210] Based on interspecies scaling, the selected clinical dose is greater than the mouse MED and below the highest tolerated dose in GLP-compliant NHP safety studies to support the prospect of direct benefit in Phase I trials. In other words, NHP studies demonstrate targeted engagement using the optimal administration route in rodents, while informing of the safety of the maximum enforceable dose (MFD) with intrathecal drug delivery constraints (limited volume and vector titer). If NHP studies demonstrate safety, patients are administered near the MFD, which is typically several times the MED obtained in mice.

[0211] Sensory neurotoxicity in nonclinical studies Published data showed that AAV vectors administered via the ICM pathway resulted in histopathological evidence of damage to peripheral sensory neurons and their associated axons. A meta-analysis of 33 nonclinical studies in 256 NHPs showed that immunosuppression does not prevent DRG degeneration in NHPs, and that T cell responses detected by ELISpot do not predict DRG degeneration. Transgene, time after infusion, and dose appear to have the greatest impact on the severity of sensory neuropathic states, suggesting that transgene overexpression drives early events leading to neurodegeneration. DRG pathology is presented primarily as a minimal to moderate asymptomatic DRG pathology characterized by mononuclear cell infiltration, neurodegeneration, and secondary axonal damage of central and peripheral axons. DRG pathology is similar from 1–5 months post-infusion and becomes less severe at 6 months. Higher AAV doses correlate with increased severity. It appears that younger NHP (infants and juveniles) is less severe compared to adult NHP. The vector purification method does not have an effect. Most studies show that DRG sensory neuronal degeneration occurs in the absence of toxicity to other highly transduced cells (e.g., hepatocytes, cortical neurons, and spinal motor neurons), indicating that DRG sensory neurons are selectively vulnerable to AAV-mediated toxicity. In all cases, only a subset of DRG sensory neurons is affected and degenerates within 14–30 days after gene transfer. Following this acute injury, no further degeneration of transduced cells is detected after 35 days, although slow degeneration of associated axons may persist up to 90 days. Thereafter, findings are non-progressive between 90–180 days, with either similar or improved pathological scores.

[0212] Similar asymptomatic DRG microscopic findings (sometimes associated with nerve satellite lesions or mononuclear cell inflammation due to nerve necrosis) developed within weeks of dose administration but without a progressive course and were observed 2 weeks after intrathecal administration to cynomolgus monkeys with NHP in a nonclinical study conducted to support onasemnogene abeparvovec (Zolgensma) for the treatment of SMA. Increases in serum and CSF NfL levels were observed on day 22, with trends relative to pre-administration and vehicle control concentrations observed by day 163 and resolved by day 365, and a correlation between CSF and serum NfL concentration was observed (R2=0.9044).

[0213] Two recent studies have demonstrated that the biomarker NfL correlates with DRG sensory neurodegeneration. Fader and colleagues evaluated dose- and time-dependent changes in NfL levels after AAV gene therapy and compared protein profiles to the DRG pathological state. Serum / plasma NfL levels began to rise from day 8 in rodents and from day 14 in monkeys and were strongly associated with the severity of neurodegeneration and axonal loss.

[0214] Similarly, in a study conducted with AAVhu68 capsid administered via ICM ROA in healthy NHP, Hordeaux and colleagues observed that animals with histopathological findings of DRG pathology 2–3 months after AAV administration showed elevated NfL levels in both CSF and serum 3–4 weeks after administration, followed by a return to low baseline levels. The degree of NfL spikes observed at 1 month correlated remarkably well with the severity of dorsal spinal cord axonal damage observed at autopsy several weeks later, thereby providing a unique opportunity to monitor the degree of DRG pathology during survival. The observation of NfL spikes at the peak of transgene expression 3–4 weeks post-administration, followed by their resolution, closely coincides with the non-progressive nature of DRG pathology.

[0215] However, clinical trials in humans using high-dose intravenously administered AAV5, AAV8, or AAV9 vectors have not identified any signs of sensory neurotoxicity. To date, 4.2 × 10⁻⁶ 14GC(3.1 × 10) 11 There is only one reported case of a patient who developed sensory symptoms approximately 3 weeks after in vitro (IT) administration of an AAVrh10 vector expressing anti-SOD1 miRNA at a dose equivalent to 1 GC / g brain. This patient, affected by ALS, showed decreased amplitude of sensory nerve action potentials and had radiographic and final pathological evidence of DRG degeneration. However, sensory symptoms are frequently reported in patients with ALS, and the association between IT administration of AAV vectors and the development of sensory neuropathy remains unclear. Therefore, to date, a clear causal relationship between CNS administration of recombinant AAV vectors and sensory deficits in humans has not been established.

[0216] Based on existing nonclinical and clinical data from other AAV programs, the true risk of sensory neurotoxicity in humans is unknown but is expected to be low. The proposed clinical trial is designed to further improve the safety profile of previous AAV clinical trials by using ICM ROA, which typically requires a lower dose of the vector than the systemically administered dose to reduce the risk of sensory neurotoxicity. The planned clinical trial will also involve detailed monitoring of sensory changes with longitudinal monitoring of serum NfL levels. Monitoring can be used to detect even asymptomatic DRG toxicity.

[0217] AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG incorporates the miR182 target sequence into the 3'UTR of the human SMN1 sequence. These sequences were incorporated to downregulate the expression of the transgene product in the dorsal root ganglia (DRG) to minimize the potential for AAV-related sensory neurotoxicity, which is thought to be primarily caused by the overexpression of the transgene product. MicroRNAs downregulate the expression of target messenger ribonucleic acid (mRNA) post-transcriptionally in multicellular organisms by affecting both mRNA stability and translation. Since miR182 expression is primarily confined to the dorsal root ganglia (DRG), the miR182 target sequence enables DRG-specific downregulation of the human SMN1 transgene product. This detargeting approach aims to minimize the potential for AAV-related DRG sensory neurotoxicity.

[0218] Current clinical trials are typically designed to further improve upon the safety profiles of previous AAV clinical trials by using ICM pathways, which require lower doses of the vector than the systemically administered dose, in order to reduce the risk of sensory neurotoxicity.

[0219] Therefore, the planned clinical trial will use detailed monitoring of sensory changes as well as nerve conduction studies to detect even asymptomatic DRG toxicity. Considering the severity of SMA, the benefit / risk characteristics of ICM administration of AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG are expected to remain favorable.

[0220] Example 7: First-in-Human (FIH) Test The FIH trial is an open-label, multicenter, dose-escalation study of AAVhu68.Ubc.PI.hSMN1co.4xmiR182.rBG administered via intracisional cisterna magna (ICM) infusion to evaluate safety, tolerability, and exploratory efficacy endpoints in pediatric patients with type 1 SMA. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6]

[0221] All documents referenced herein are incorporated herein by reference. U.S. Provisional Patent Application No. 63 / 518,796, filed August 10, 2023, and U.S. Provisional Patent Application No. 63 / 662,509, filed June 21, 2024, are incorporated herein by reference. While the present invention is described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

1. Recombinant adeno-associated virus (AAV) containing an AAV capsid containing a vector genome, wherein the vector genome is (a) UbC promoter sequence and (b) The coding sequence for the functional human motor neuron survival 1 (SMN1) protein, (c) at least four miR182 target sequences, (d) an expression cassette comprising a polyA sequence, Recombinant adeno-associated virus (AAV) wherein the coding sequence, the at least four miR182 target sequences, and the polyA sequence are operably linked to the UbC promoter sequence.

2. The recombinant AAV according to claim 1, wherein the SMN1 protein is the SMN1 isoform D protein.

3. The recombinant AAV according to claim 1 or 2, wherein the coding sequence includes the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% identical to SEQ ID NO:

7.

4. The recombinant AAV according to any one of claims 1 to 3, wherein the AAV capsid is clade F AAV capsid.

5. The recombinant AAV according to any one of claims 1 to 4, wherein the AAV capsid is AAVhu68 capsid.

6. The recombinant AAV according to claim 5, wherein the AAVhu68 capsid comprises VP1, VP2, and VP3 proteins expressed from a nucleic acid sequence encoding the amino acid sequence (amino acids 1 to 736) of SEQ ID NO:

9.

7. The recombinant AAV according to any one of claims 1 to 3, wherein the AAV capsid is AAVhu95 capsid, AAVhu96 capsid, or AAV9 capsid.

8. The recombinant AAV according to any one of claims 1 to 7, wherein the at least four miR182 target sequences are located at 3' of the SMN1 coding sequence and 5' of the polyA sequence.

9. The recombinant AAV according to any one of claims 1 to 7, wherein the at least four miR182 target sequences include at least one target sequence located at 5' of the UbC promoter, and at least one target sequence located at 3' of the SMN1 coding sequence and 5' of the polyA sequence.

10. The recombinant AAV according to any one of claims 1 to 9, wherein each of the miR182 target sequences comprises the nucleotide sequence of SEQ ID NO:

12.

11. The recombinant AAV according to any one of claims 1 to 10, wherein the UbC promoter comprises the nucleotide sequence of SEQ ID NO:

10.

12. The recombinant AAV according to any one of claims 1 to 11, wherein the polyA sequence is a rabbit beta-globin (rBG) polyA sequence.

13. The rBG polyA sequence comprises the nucleotide sequence of SEQ ID NO: 13, according to claim 12. Recombinant AAV.

14. The recombinant AAV according to any one of claims 1 to 13, wherein the expression cassette further comprises an intron.

15. The recombinant AAV according to any one of claims 1 to 14, wherein the intron comprises the nucleotide sequence of SEQ ID NO:

11.

16. The recombinant AAV according to any one of claims 1 to 15, wherein the vector genome further comprises an AAV 5'ITR sequence and an AAV 3'ITR sequence, wherein optionally the AAV 5'ITR sequence and the AAV 3'ITR sequence are derived from AAV2.

17. The recombinant AAV according to any one of claims 1 to 16, wherein the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 16, or a nucleic acid sequence that is at least 99% identical to SEQ ID NO:

16.

18. The recombinant AAV according to any one of claims 1 to 17, wherein the vector genome comprises the nucleic acid sequence of SEQ ID NO: 2, or a sequence that is at least 99% identical to SEQ ID NO:

2.

19. The recombinant AAV according to any one of claims 1 to 18, wherein the recombinant AAV is formulated in an aqueous suspension for systemic delivery and / or delivery to the central nervous system.

20. A composition comprising a stock of recombinant AAV according to any one of claims 1 to 18 and an aqueous suspension medium.

21. The composition according to claim 20, wherein the suspension is formulated for intrathecal delivery, and optionally, the intrathecal delivery is intraventricular (ICV) injection or intracisional (ICM) injection.

22. A pharmaceutical composition comprising a recombinant AAV according to any one of claims 1 to 19 and an aqueous formulation buffer.

23. The pharmaceutical composition according to claim 22, which is formulated for intrathecal delivery.

24. The pharmaceutical composition according to claim 22, formulated for intraventricular (ICV) injection or intracisional (ICM) injection.

25. (a) 5'AAV ITR sequence and (b) UbC promoter sequence and (c) The coding sequence for functional human motor neuron survival 1 (SMN1) protein, (d) at least four miR182 target sequences, (e) Poly-A sequence and (f) A recombinant nucleic acid molecule comprising an expression cassette containing a 3'AAV ITR sequence, A recombinant nucleic acid molecule in which the coding sequence, the at least four miR182 target sequences, and the polyA sequence are operably linked to the UbC promoter sequence.

26. The recombinant nucleic acid molecule according to claim 25, wherein the SMN1 protein is the SMN1 isoform D protein.

27. The recombinant nucleic acid molecule according to claim 25 or 26, wherein the coding sequence includes the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% identical to SEQ ID NO:

7.

28. The recombinant nucleic acid molecule according to any one of claims 25 to 27, wherein at least four miR182 target sequences are located at 3' of the SMN1 coding sequence and 5' of the polyA sequence.

29. The recombinant nucleic acid molecule according to any one of claims 25 to 27, wherein the at least four miR182 target sequences include at least one target sequence located at 5' of the UbC promoter, and at least one target sequence located at 3' of the SMN1 coding sequence and 5' of the polyA sequence.

30. The recombinant nucleic acid molecule according to any one of claims 25 to 29, wherein the UbC promoter comprises the nucleotide sequence of SEQ ID NO:

10.

31. The recombinant nucleic acid molecule according to any one of claims 25 to 30, wherein each of the miR182 target sequences comprises the nucleotide sequence of SEQ ID NO:

12.

32. The recombinant nucleic acid molecule according to any one of claims 25 to 31, wherein the polyA sequence is a rabbit beta-globin (rBG) polyA sequence.

33. The recombinant nucleic acid molecule according to claim 32, wherein the rBG polyA sequence includes the nucleotide sequence of SEQ ID NO:

13.

34. The recombinant nucleic acid molecule according to any one of claims 25 to 33, wherein the expression cassette further comprises an intron.

35. The recombinant nucleic acid molecule according to claim 34, wherein the intron comprises the nucleotide sequence of SEQ ID NO:

11.

36. The recombinant nucleic acid molecule according to any one of claims 25 to 34, wherein the AAV 5'ITR sequence and the AAV 3'ITR sequence are derived from AAV2, and optionally the AAV 5'ITR sequence comprises the nucleotide sequence of SEQ ID NO: 14 and / or the AAV 3'ITR sequence comprises the nucleotide sequence of SEQ ID NO:

15.

37. The recombinant nucleic acid molecule according to any one of claims 25 to 35, wherein the expression cassette contains the nucleic acid sequence of SEQ ID NO: 16, or a nucleic acid sequence that is at least 99% identical to SEQ ID NO:

16.

38. A recombinant nucleic acid molecule according to any one of claims 25 to 37, comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 99% identical to SEQ ID NO:

2.

39. A plasmid comprising a nucleic acid molecule according to any one of claims 25 to 38.

40. A packaging host cell comprising a recombinant nucleic acid molecule according to any one of claims 25 to 38, or a plasmid according to claim 39.

41. The packaging host cell according to claim 40, further comprising: an AAV rep coding sequence operably linked to a sequence expressing a rep protein in the packaging host cell; an AAV capsid coding sequence operably linked to a sequence expressing an AAV capsid protein in the packaging host cell; and helper virus functions necessary to enable packaging the expression cassette and the AAV 5'ITR sequence and the AAV 3'ITR sequence into the AAV capsid.

42. The packaging host cell according to claim 40 or 41, wherein the AAV capsid is an AAVhu68 capsid.

43. The packaging host cell according to claim 40 or 41, wherein the AAV capsid is AAV9, AAVrh91, AAVhu95, or AAVhu96 capsid.

44. A recombinant AAV production system for producing recombinant AAV according to any one of claims 1 to 19, wherein the production system comprises a cell culture containing packaging host cells according to any one of claims 28 to 31.

45. The recombinant AAV production system according to claim 44, wherein the AAV capsid is AAVhu68 capsid.

46. The recombinant AAV production system according to claim 44, wherein the AAV capsid is AAV9, AAVrh91, AAVhu95, or AAVhu96 capsid.

47. The recombinant AAV production system according to any one of claims 44 to 46, wherein the vector genome comprises the nucleotide sequence of SEQ ID NO:

16.

48. The recombinant AAV production system according to any one of claims 44 to 47, wherein the vector genome comprises the nucleic acid sequence of SEQ ID NO:

2.

49. A method for treating spinal muscular atrophy (SMA) in a subject requiring treatment, the method comprising administering to the subject an aqueous suspension containing recombinant AAV according to any one of claims 1 to 19.

50. The method according to claim 49, wherein the subject has type I (Werdnig-Hoffmann disease), type II (Dubowitz disease), type III (Kugelberge-Welander disease), or type IV (adult) SMA.

51. The method according to claim 49 or 50, wherein the suspension is administered intrathecally, intravenously, or both intrathecally and intravenously.

52. The suspension is administered intrathecally, and the dose of recombinant AAV is approximately 1 × 10⁶ per gram of brain mass. １１ GC - approximately 6 x 10⁻¹⁰ units per gram of brain mass １１ The method according to claim 49 or 50, wherein the GC is optionally the intrathecal administration is intraventricular (ICV) injection or intracisional (ICM) injection.

53. Recombinant AAV according to any one of claims 1 to 19, for use in the preparation of a pharmaceutical for the treatment of SMA.

54. Recombinant AAV according to any one of claims 1 to 19 for use in the treatment of SMA.

55. In the preparation of a pharmaceutical for the treatment of symptoms associated with SMA and / or functional SMN protein deficiency, a recombinant AAV according to any one of claims 1 to 19, a composition according to claim 20 or 21, a pharmaceutical composition according to any one of claims 22 to 24, a recombinant nucleic acid molecule according to any one of claims 25 to 38, a plasmid according to claim 39, a packaging host cell according to any one of claims 40 to 43, or claims 44 to Use of a recombinant AAV production system as described in any one of item 48.

Images