Composition for improving lipid metabolism

Abstract

The present invention relates to a composition for improving lipid metabolism, which contains a culture and / or bacterial cells of lactic acid bacteria belonging to Streptococcus thermophilus. By ingesting the composition for improving lipid metabolism, and lipid metabolism-improving foods, medicines, and feeds containing the composition, lipid metabolism is improved, resulting in weight loss.

Description

[Technical field]

[0001] The present invention relates to a composition for improving lipid metabolism, which contains lactic acid bacteria belonging to Streptococcus thermophilus, and to a food, a medicine, and a feed containing the composition. The present invention also relates to a composition for improving metabolic syndrome, which contains lactic acid bacteria belonging to Streptococcus thermophilus. [Background technology]

[0002] Fatty liver is a general term for diseases caused by excessive deposition of neutral fat in the liver, resulting in liver damage, and is known to develop due to various factors such as excessive alcohol intake, obesity, diabetes, drugs, etc. In recent years, non-alcoholic fatty liver disease (NAFLD) caused by obesity, metabolic syndrome, diabetes, etc. has been rapidly increasing, and it is said that 30% of adults are affected (Non-Patent Document 1). The main cause of fat accumulation in the liver is thought to be the influx of fat accumulated in adipose tissue into the liver. However, in patients with NAFLD, increased lipogenesis in the liver is also a major cause, accounting for 25% of fat accumulation in the liver. Fatty acid synthesis-related genes, such as acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), and stearyl-CoA desaturase 1 (SCD1), as well as SREBP-1c, a transcription factor that controls the expression of these fatty acid synthesis-related genes, are involved in this increase in fat synthesis. When insulin resistance is caused by obesity or metabolic syndrome, SREBP-1c is induced, and the expression of fatty acid synthesis-related genes is increased, resulting in fat accumulation in the liver.

[0003] Patent Document 1 discloses a functional food and drink having a body fat accumulation-inhibiting and anti-obesity effect, which comprises a culture (a) obtained by culturing a culture medium containing at least whey protein and skim milk with Lactobacillus rhamnosus GG strain (ATCC53103), a culture (b) obtained by culturing the above culture medium with Lactobacillus casei TMC0409 strain (FERM P-17047), a culture (c) obtained by culturing the above culture medium with Streptococcus thermophilus TMC1543 strain (FERM P-17046), and a mixture containing a calcium preparation, and which is characterized in that the proportion of calcium in the milk solids is 1.5% by weight or more. Patent Document 2 describes a method for preventing and treating nonalcoholic steatohepatitis (NASH), a condition in which fatty liver accompanied by balloon-like swelling of hepatocytes is observed in liver tissue and there is a high risk of developing cirrhosis or liver cancer. 10 The study discloses a preventive and therapeutic agent for NASH, which contains lactic acid bacteria as an active ingredient, in which mice are fed a high-fat diet containing lactic acid bacteria / g of lactic acid bacteria at a daily intake of 3 g for 12 weeks, and carbon tetrachloride is subcutaneously administered twice a week (initial dose: 0.05 ml / kg BW (body weight), second dose and thereafter: 0.1 ml / kg BW) a total of eight times to induce liver damage from the 9th to 12th week after the start of administration of the lactic acid bacteria-containing high-fat diet, resulting in a 65% or greater decrease in serum ALT levels compared to mice not administered lactic acid bacteria.

[0004] Incidentally, with recent changes in eating habits and lifestyles, the number of patients with obesity, particularly visceral obesity, and metabolic syndrome, a condition in which two or more of the following symptoms are accumulated in an individual, including hyperglycemia, hypertension, and dyslipidemia, is increasing, especially in developed countries, and this has become a major social problem. Obesity is believed to be primarily caused by the hypertrophy of adipocytes, but it is known that there are two types of adipocytes, white adipocytes and brown adipocytes, which have different roles (Non-Patent Document 2). White adipocytes store fat in the form of triglycerides within the cells and store energy. Therefore, when excess fat accumulates in white adipocytes and they become enlarged, obesity occurs. Enlarged white adipocytes secrete inflammatory cytokines such as MCP1 (Monocyte chemotactic protein 1), which induces insulin resistance due to a chronic inflammatory state and is thought to be the cause of the development of lifestyle-related diseases, including diabetes. On the other hand, brown fat cells, like white fat cells, accumulate fat within the cells, but consume energy by burning fat to produce heat through the action of UCP1 (uncoupling protein 1) present on the mitochondrial membrane. In other words, in the body, the balance of energy and body fat in the entire body is regulated by energy storage in white fat cells and energy consumption through heat production in brown fat cells. Furthermore, recent research has revealed the existence of "induced" brown adipocytes that are induced to differentiate from white adipose precursor cells in white adipose tissue by various environmental factors (Non-Patent Document 2).

[0005] Patent Document 3 aims to provide an agent for promoting differentiation of stem cells into brown fat cells that can improve and prevent obesity and metabolic syndrome, and discloses as a solution a differentiation promoter of stem cells into brown fat cells that contains catechins as an active ingredient, and pharmaceuticals, quasi-drugs, cosmetics, and foods and beverages that contain the differentiation promoter. Patent Document 4 aims to provide a composition for enhancing or increasing muscle mass, or improving metabolic syndrome, and improving QOL, and discloses a composition containing triterpene and polyphenols, preferably oleanolic acid and oleuropein, as well as a pharmaceutical composition and food containing the composition, as a solution. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] JP 2010-57465 A [Patent Document 2] JP 2014-24776 A [Patent Document 3] JP 2014-65672 A [Patent Document 4] JP 2016-199536 A [Non-patent literature]

[0007] [Non-Patent Document 1] Eguchi Y. et.al., J. Gastroenterol, 2012, 47:586-595 [Non-Patent Document 2] Kajimura S. et. al., Cell Metab., 2010, 11:257-262 Summary of the Invention [Problem to be solved by the invention]

[0008] However, the lactic acid bacteria culture of Patent Document 1 is a mixture of cultures of the three types of lactic acid bacteria (a) to (c), and it was unclear which lactic acid bacteria had the body fat accumulation suppression and anti-obesity effects. Furthermore, Patent Document 2 lists Streptococcus thermophilus as the lactic acid bacteria to be tested, but the effect on liver damage induced by carbon tetrachloride was examined, and there was no description of the lipid metabolism improving effect. In other words, neither Patent Document 1 nor Patent Document 2 reported a means of improving lipid metabolism using lactic acid bacteria. Therefore, there has been a demand for a means of improving lipid metabolism using lactic acid bacteria. The first object of the present invention is to provide a composition for improving lipid metabolism containing lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and foods, medicines, and feeds for improving lipid metabolism that contain said composition, as a new solution for improving lipid metabolism.

[0009] On the other hand, Non-Patent Document 2 discloses white adipocytes and brown adipocytes, but has not reported a method for improving adipocyte metabolism using lactic acid bacteria. Patent Documents 3 and 4 disclose methods for improving and preventing metabolic syndrome, but have not reported a method using lactic acid bacteria. Therefore, there has been a demand for a method for improving the metabolism of fat cells and for improving and preventing metabolic syndrome using lactic acid bacteria. A second object of the present invention is to provide a novel composition for improving the metabolism of adipocytes, and a food, a medicine, and a feed for improving the metabolism of adipocytes, which includes the novel composition. Also, a second object of the present invention is to provide a novel composition for improving metabolic syndrome, and a food, a medicine, and a feed for improving metabolic syndrome, which includes the novel composition. [Means for solving the problem]

[0010] In order to achieve the first object of the present invention, the present inventors have conducted extensive research into a composition that improves lipid metabolism in the body, and have found that lactic acid bacteria belonging to Streptococcus thermophilus have the effect of improving lipid metabolism, thereby completing the present invention. (A1) A composition for improving lipid metabolism, comprising as an active ingredient a culture and / or bacterial cells of lactic acid bacteria belonging to Streptococcus thermophilus. (A2) The lactic acid bacterium belonging to Streptococcus thermophilus is Streptococcus thermophilus SBT1 277 (FERM BP-03234), or SBT1063 (NITE P-02398). (A3) The composition for improving lipid metabolism according to (A1) or (A2), wherein the lipid metabolism is lipid metabolism in the liver. (A4) A food for improving lipid metabolism, comprising the composition for improving lipid metabolism according to any one of (A1) to (A3). (A5) A pharmaceutical for improving lipid metabolism, comprising the composition for improving lipid metabolism according to any one of (A1) to (A3). (A6) A feed for improving lipid metabolism, comprising the composition for improving lipid metabolism according to any one of (A1) to (A3). (A7) Streptococcus thermophilus SBT-1063 (NITE P-02398), a novel lactic acid bacterium belonging to the genus Streptococcus thermophilus.

[0011] In order to achieve the second object of the present invention, the present inventors have conducted extensive research into compositions that suppress the accumulation of excess fat and obesity in the body and improve metabolic syndrome, and have found that Streptococcus thermophilus has the effect of improving these conditions, leading to the completion of the present invention. (B1) A composition for promoting differentiation of white adipose precursor cells into brown adipose cells, comprising as an active ingredient a culture and / or bacterial cells of lactic acid bacteria belonging to Streptococcus thermophilus. (B2) The composition according to (B1), wherein the lactic acid bacterium belonging to Streptococcus thermophilus is Streptococcus thermophilus SBT1277 (FERM BP-03234). (B3) A composition for activating brown adipocytes, comprising as an active ingredient a culture and / or bacterial cells of lactic acid bacteria belonging to Streptococcus thermophilus. (B4) The composition according to (B3), wherein the lactic acid bacterium belonging to Streptococcus thermophilus is Streptococcus thermophilus SBT1277 (FERM BP-03234). (B5) A composition for improving metabolic syndrome, comprising as an active ingredient a culture and / or bacterial cells of lactic acid bacteria belonging to Streptococcus thermophilus. (B6) The composition for improving metabolic syndrome according to (B5), wherein the lactic acid bacterium belonging to Streptococcus thermophilus is Streptococcus thermophilus SBT1277 (FERM BP-03234). (B7) A food for promoting differentiation of white adipose precursor cells into brown adipose cells, comprising the composition according to (B1) or (B2). (B8) A pharmaceutical agent for promoting differentiation of white adipose precursor cells into brown adipose cells, comprising the composition according to (B1) or (B2). (B9) A feed for promoting differentiation of white adipose precursor cells into brown adipose cells, comprising the composition according to (B1) or (B2). (B10) A food for activating brown adipocytes, comprising the composition according to (B3) or (B4). (B11) A pharmaceutical for activating brown adipocytes, comprising the composition according to (B3) or (B4). (B12) A feed for activating brown adipocytes, comprising the composition according to (B3) or (B4). (B13) A food for improving metabolic syndrome, comprising the composition according to (B5) or (B6). (B14) A pharmaceutical for improving metabolic syndrome, comprising the composition according to (B5) or (B6). (B15) A feed for improving metabolic syndrome, comprising the composition according to (B5) or (B6). Furthermore, the second object of the present invention also includes the composition of a fatty acid synthesis inhibitor, a cholesterol synthesis inhibitor, a gluconeogenesis inhibitor, or an adipose tissue inflammation inhibitor, which contains lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient. Effect of the Invention

[0012] The first invention provides a new solution for improving lipid metabolism, namely, a composition for improving lipid metabolism containing lactic acid bacteria belonging to Streptococcus thermophilus, and foods, medicines, and feed for improving lipid metabolism containing such a composition. Therefore, lipid metabolism can be expected to be improved in a simple and safe manner by ingesting the above-mentioned composition, food, medicine, and feed of the present invention.

[0013] The second invention provides a lipid metabolism improving composition containing lactic acid bacteria belonging to Streptococcus thermophilus as a new solution for suppressing excess fat accumulation and obesity in the body, which improves the metabolism of fat cells, such as promoting the differentiation of white fat precursor cells into brown fat cells and activating brown fat cells, as well as foods, medicines, and feed containing said composition. In addition, the second invention provides a new solution for improving metabolic syndrome, providing a composition for improving metabolic syndrome containing lactic acid bacteria belonging to Streptococcus thermophilus, and foods, medicines, and feed for improving metabolic syndrome containing such a composition. Therefore, by ingesting the composition, food, medicine, or feed of the second invention, it is expected that the metabolism of adipocytes and metabolic syndrome can be improved in a simple and safe manner. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] [A: First Invention] The present inventors came up with the idea that it is possible to prevent fat accumulation in the liver by suppressing fat synthesis in the liver, in addition to suppressing fat accumulation in adipose tissue. As a result of continuing intensive research, they discovered that lactic acid bacteria belonging to Streptococcus thermophilus prevent fat accumulation in the liver. The first invention is based on the above findings. (Active ingredient) The present invention relates to a composition for improving lipid metabolism containing lactic acid bacteria belonging to Streptococcus thermophilus, and foods, medicines, and feeds containing the same. However, the Streptococcus thermophilus used in the present invention can be any lactic acid bacteria classified into the genus Streptococcus thermophilus species according to common classification methods such as 16S ribosomal RNA gene sequence analysis. In the present invention, it is particularly preferable to use Streptococcus thermophilus SBT1277 (FERM BP-3234), SBT1063 (NITE P-02398), SBT1021A (FERM P-10658), SBT10137 (FERM P-19531), SBT0104 (FERM P-9442), SBT0113 (FERM P-9443), SBT0144 (FERM P-16638), SBT1035 (FERM P-16945), and ATCC19258, and among these, SBT1063 (NITE P-02398) and SBT1277 (FERM BP-03234) are particularly preferable. Strains with numbers beginning with FERM or NITE in parentheses can be obtained from the respective depositories described below, and ATCC19258 can be purchased from the American Type Culture Collection, a microorganism distribution organization in the United States. The Streptococcus thermophilus used in the present invention may be in the form of live cells, killed cells, cell cultures, or cytoplasm or cell wall fractions obtained by treating these cells with enzymes or physical means, and one or more of these may be used.

[0015] (Preparation of a composition containing Streptococcus thermophilus) The composition containing the lactic acid bacteria belonging to Streptococcus thermophilus, which is the active ingredient of the present invention, can be obtained according to a conventional method for preparing a culture of lactic acid bacteria. For the culture, various media such as a milk medium or a medium containing milk components, or a semi-synthetic medium not containing the same can be used. A culture of lactic acid bacteria can be obtained by inoculating the lactic acid bacteria belonging to Streptococcus thermophilus into the above sterilized medium and culturing it for 5 hours to several days at about 20° C. to 45° C. The temperature and period of the culture can be appropriately adjusted depending on the strain of Streptococcus thermophilus used and the desired number of bacteria. The culture containing lactic acid bacteria belonging to Streptococcus thermophilus obtained by culturing can be used as it is as a composition containing lactic acid bacteria belonging to Streptococcus thermophilus, which is the active ingredient of the present invention. In addition, a composition obtained by subjecting the culture to a process such as centrifugation, membrane concentration, drying, or freeze-drying can also be used. One embodiment of a method for preparing a composition containing Streptococcus thermophilus includes sterilizing an 11.55% skim milk medium containing 0.5% yeast extract (manufactured by Asahi Breweries, Ltd.) at 115°C for 20 minutes, cooling to room temperature, inoculating it with Streptococcus thermophilus SBT1277 (FERM BP-03234), culturing it at 37°C for 16 hours, and freeze-drying the resulting culture and pulverizing it in a mortar.

[0016] (Amount of active ingredient taken) The daily intake of the active ingredient of the present invention, lactic acid bacteria belonging to Streptococcus thermophilus, is 5×10 8 Anything above 1×10 10 More preferably, 1×10 11 The above is most preferable. If the Streptococcus thermophilus is killed, the amount should be equivalent to the number of live bacteria above. If both live and killed bacteria are included, the total amount of live and killed bacteria should be equivalent to the number of live bacteria above. In the case of cytoplasm or cell wall fractions obtained by treating bacterial cells with enzymes or physical means, the daily intake per adult is from 0.1 mg to 5,000 mg, preferably from 100 mg to 2,500 mg, and most preferably from 500 mg to 1,000 mg.

[0017] (Effectiveness) The lipid metabolism improving composition containing the lactic acid bacteria belonging to Streptococcus thermophilus of the present invention, and the foods, medicines, and feed containing such compositions, when ingested in the above-mentioned amounts, can reduce the expression of fatty acid synthesis-related genes in the liver, reduce the accumulation of triglycerides and total lipids in the liver and plasma triglyceride concentrations, and further reduce body weight. By taking the above-mentioned lipid metabolism improving composition and food, medicine, and feed containing the composition, it is expected to prevent or improve dyslipidemia, which is said to occur due to an imbalance of cholesterol and triglycerides (neutral fats) in the blood.Furthermore, it is expected to prevent or improve diseases caused by dyslipidemia (e.g., insulin resistance, diabetes, nonalcoholic fatty liver disease, nonalcoholic fatty liver disease, liver cirrhosis, liver cancer) and arteriosclerosis diseases (e.g., hypertension, angina pectoris, myocardial infarction, cerebral infarction, cerebral hemorrhage, aortic aneurysm, renal infarction, obliterative arteriosclerosis).

[0018] (Evaluation of efficacy) The effects on lipid metabolism of the lipid metabolism improving composition of the present invention containing lactic acid bacteria belonging to Streptococcus thermophilus and foods, medicines, and feed containing such compositions can be evaluated by the in vitro or in vivo tests described in Example A.

[0019] (Food, medicine, and feed to which a composition containing Streptococcus thermophilus has been added) The composition containing Streptococcus thermophilus of the present invention can be added to any food product, and the amount of the composition to be added can be adjusted taking into consideration the intake amount of the above-mentioned active ingredient, and the food product can otherwise be produced according to the standard method for each food product. Examples of foods include dairy products such as cheese, fermented milk, dairy lactic acid bacteria drinks, lactic acid bacteria drinks, butter, margarine, and the like; beverages such as milk drinks, fruit juice drinks, and soft drinks; egg products such as jelly, candy, pudding, and mayonnaise; confectioneries and breads such as butter cake; and further, various types of milk powder, as well as foods for infants and young children, and nutritional compositions.

[0020] The composition containing Streptococcus thermophilus of the present invention can be incorporated into any pharmaceutical product, and the amount of the composition to be incorporated can be adjusted taking into consideration the intake amount of the above-mentioned active ingredient, and the rest can be manufactured according to the standard method for the desired pharmaceutical product.

[0021] The composition containing Streptococcus thermophilus of the present invention can be added to any feed, and the amount of the composition to be added can be adjusted taking into consideration the intake amount of the above-mentioned active ingredient, and the rest can be produced by standard methods for the desired feed.

[0022] [Example A] The present invention will be described in detail below with reference to Example A and Test Example A, but the present invention is not limited to these. [Example A1] Preparation of a composition containing Streptococcus thermophilus Streptococcus thermophilus SBT1277 (FERM BP-03234) was activated by culturing it for 16 hours at 37℃ for more than three generations in 11.55% skim milk medium containing 0.5% yeast extract (manufactured by Asahi Breweries) after sterilization at 115℃ for 20 minutes. This was inoculated into the same medium at 3% and cultured at 37℃ for 16 hours. The culture obtained was freeze-dried and then crushed in a mortar to obtain a composition containing powdered Streptococcus thermophilus. The viable cell count of Streptococcus thermophilus SBT1277 in the above composition was 3.6 × 10 9 cfu / g.

[0023] [Test Example A1] Effect of various lactic acid bacteria on the expression of genes related to fatty acid synthesis in hepatocytes The effect of various lactic acid bacteria on the expression of genes related to fatty acid synthesis in hepatocytes was investigated. 1. Test Method 1-1.Cell culture method HepG2 cells, an established hepatoma cell line, were seeded on a 12-well plate and cultured in 10% FBS-containing DMEM medium until confluent. After further culturing overnight in FBS-free DMEM medium, the medium was replaced with FBS-free DMEM medium supplemented with skim milk medium (final concentration 5 mg / mL) or skim milk cultures of lactic acid bacteria (1) to (5) below (final concentration 5 mg / mL for each), and cultured for 2 days. The strains with numbers starting with JCM can be purchased from the Microbial Materials Development Division of the RIKEN Bioresource Center. The strains with numbers starting with ATCC can be purchased from the American Type Culture Collection, an American microorganism distribution organization. <Lactic acid bacteria> (1) Lactobacillus gasseri (JCM1131) (2) Bifidobacterium longum (JCM1217) (3) Lactobacillus helveticus (JCM1120) (4) Lactobacillus delbrueckii subsp. bulgaricus (ATCC11842) (5) Streptococcus thermophilus (ATCC19258)

[0024] 1-2. Gene expression analysis After that, total RNA was extracted from the cultured cells using Sepasol RNA I SuperG Reagent (Nacalai Tesque). Reverse transcription was performed using ReverTra Ace qPCR. RT Master Mix (Toyobo Co., Ltd.) was used. Real-time PCR was performed using the obtained cDNA with THUNDERBIRD qPCR Mix (Toyobo Co., Ltd.) to quantify the expression levels of fatty acid synthesis-related genes (SREBP-1c, FAS, SCD1). The expression level of the cyplophilin gene was used as an internal standard for evaluating the gene expression level, and the following primers were used for the analysis. SREBP1c-F; TCGCGGAGCCATGGATT (Sequence Listing SEQ ID NO: 1) SREBP1c-R; GCCAGGGAAGTCACTGTCTTG (Sequence Listing SEQ ID NO: 2) FAS-F; GCAAATTCGACCTTTCTCAGAAC (Sequence Listing SEQ ID NO: 3) FAS-R; GGACCCCGTGGAATGTCA (Sequence Listing SEQ ID NO: 4) SCD1-F: TGTGGAGCCACCGCTCTTAC (Sequence Listing SEQ ID NO: 5) SCD1-R; ACGAGCCCATTCATAGACATCA (Sequence Listing SEQ ID NO: 6) Cyclophilin-F: GCGTCTCCTTTGAGCTGTTTG (Sequence Listing SEQ ID NO: 7) Cyclophilin-R; ATCCTTTCTCTCCAGTGCTCAGA (Sequence Listing SEQ ID NO: 8)

[0025] 2. Test Results The results are shown in Table A1. Skim milk culture of Streptococcus thermophilus significantly decreased the expression of fatty acid synthesis-related genes in hepatocytes. On the other hand, skim milk cultures of Lactobacillus gasseri, Bifidobacterium longum, Lactobacillus helveticus, and Lactobacillus bulgaricus hardly changed the expression of fatty acid synthesis-related genes.

[0026] [Table A1]

[0027] [Test Example A2] Effect of Streptococcus thermophilus on the expression of fatty acid synthesis-related genes in hepatocytes The effect of Streptococcus thermophilus on the expression of fatty acid synthesis-related genes in hepatocytes was investigated. 1. Test Method As in Test Example A1, HepG2 cells were seeded on a 12-well plate and cultured, then the cells were cultured in skim milk medium. The medium was replaced with FBS-free DMEM medium supplemented with FBS (final concentration 1 mg / mL), or Streptococcus thermophilus ATCC 19258, or SBT1277 (FERM BP-3234), or SBT1063 (NITE P-02398) skim milk culture (final concentrations of 0.1, 0.5, and 1 mg / mL for each), and cultured for 2 days. After that, RNA was purified in the same manner as in Test Example A1, and the expression levels of fatty acid synthesis-related genes (SREBP-1c, FAS) were quantified.

[0028] 2. Test Results The results are shown in Table A2. Streptococcus thermophilus SBT1277 and SBT1063 reduced the expression of fatty acid synthesis-related genes in hepatocytes even at concentrations of 1 mg / mL or less, where no difference was observed with Streptococcus thermophilus ATCC 19258.

[0029] [Table A2]

[0030] [Test Example A3] Effect of Streptococcus thermophilus on the accumulation of triglycerides in hepatocytes The effect of Streptococcus thermophilus on triglyceride accumulation in hepatocytes was investigated. 1. Test Method As in Test Example A1, HepG2 cells were seeded on a 12-well plate and cultured, and then the medium was replaced with FBS-free DMEM medium supplemented with skim milk medium (final concentration 0.2 mg / mL) or skim milk culture of Streptococcus thermophilus ATCC19258, SBT1277, or SBT1063 (final concentration 0.5 mg / mL for each), and cultured for 2 days. The cells were disrupted in extraction buffer (50 mM Tris-HCl, pH 7.5, 0.1% Triton X-100), centrifuged, and the triglyceride concentration of the supernatant was measured using Triglyceride E Test Wako (Wako Pure Chemical Industries, Ltd.). In addition, the protein concentration was measured using BCA Protein Assay (Thermo Fisher Scientific).

[0031] 2. Test Results The results are shown in Table A3. All strains of S. thermophilus significantly reduced the accumulation of triglycerides in cells compared to the control, but the effect was greater in S. thermophilus SBT1277 and SBT1063 compared to S. thermophilus ATCC 19258, with S. thermophilus SBT1277 being the most effective.

[0032] [Table A3]

[0033] [Test Example A4] Effect of Streptococcus thermophilus SBT1277 (FERM BP-03234) on improving lipid metabolism The lipid metabolism-improving effect of Streptococcus thermophilus SBT1277 (FERM BP-3234) was investigated using mice. 1. Test Method 1-1. Rearing method Five-week-old male C57BL6 / JJcl mice were acclimated for one week, and then divided into two groups of 20 mice each so as to have the same average body weight, and were kept for eight weeks under the following conditions. (1) Control group The rats were fed a high-fat diet based on the AIN76 diet and containing 20% ​​skim milk medium and 20% fat. (2) Thermophilus group Instead of the skim milk medium used in the control group, the mice were fed a high-fat diet containing 20% ​​of the Streptococcus thermophilus SBT1277 skim milk culture prepared in Example A1.

[0034] 1-2.Measurement method (1) Body weight and plasma triglyceride concentration After measuring the body weight, blood was collected and the liver was excised. The triglyceride concentration was measured using plasma prepared from the blood. The measurement was performed using a Wako Triglyceride E-Test. (2) Gene expression analysis RNA was extracted from the liver, and the expression levels of fatty acid synthesis-related genes were analyzed in the same manner as in Test Example A2. (3) Liver lipid concentration Lipids were extracted from the liver with chloroform / methanol, and the total lipid concentration and triglyceride concentration were measured. The total lipid concentration was measured by weighing the lipid after extraction, and the triglyceride concentration was measured using a triglyceride E-Test Wako after dissolving the extracted lipid in isopropanol. The concentration per gram of liver was calculated by dividing each measured value by the weight of the liver used for extraction.

[0035] 2. Test Results (1) Body weight, liver weight, and plasma triglyceride concentration The results are shown in Table A4. The thermophilus group showed a significant decrease in body weight compared to the control group, and the plasma triglyceride concentration was also significantly decreased.

[0036] [Table A4]

[0037] (2) Expression of fatty acid synthesis-related genes The results are shown in Table A5. The expression levels of fatty acid synthesis-related genes in the liver of the Thermophilus group were significantly decreased compared to the control group.

[0038] [Table A5]

[0039] (3) Liver lipid concentration The results are shown in Table A6. The thermophilus group showed a tendency toward decreased total lipid and triglyceride concentrations in the liver compared to the control group.

[0040] [Table A6]

[0041] These results indicate that Streptococcus thermophilus reduces blood triglycerides and inhibits fat accumulation in the liver, thereby improving metabolism and reducing body weight.

[0042] [Example A2] Preparation of a composition for improving lipid metabolism The culture of Streptococcus thermophilus SBT1277 in M17 medium (OXOID) was centrifuged at 4°C and 7000 rpm for 15 minutes, and then washed with sterile water and centrifuged three times to obtain washed cells. The washed cells were freeze-dried to obtain a powder of cells. This can be used as a lipid metabolism improving composition as it is. The viable cell count of Streptococcus thermophilus SBT1277 in the above composition was 1.6 × 10 11 cfu / g.

[0043] [Example A3] Manufacture of pharmaceutical for improving lipid metabolism One part of the bacterial cell powder prepared in Example A2 was mixed with 4 parts of skim milk powder, and this mixed powder was compressed into tablets of 1 g each using a tablet press in a conventional manner to prepare tablets containing 200 mg of Streptococcus thermophilus SBT1277 bacterial cells.

[0044] [Example A4] Production of fermented milk for improving lipid metabolism After sterilizing 10% reconstituted skim milk medium at 115°C for 15 minutes, Streptococcus thermophilus SBT1277 was inoculated and cultured at 37°C for 16 hours to prepare skim milk culture. The fermentation mix (16% skim milk powder + 3% glucose) sterilized at 100°C for 10 minutes was inoculated and fermented at 39°C for 10 hours to obtain fermented milk for improving lipid metabolism. The viable cell count of Streptococcus thermophilus SBT1277 in the above fermented milk was 1.8 × 10 9 cfu / g.

[0045] [Example A5] Production of lactobacillus beverage for improving lipid metabolism Streptococcus thermophilus SBT1277 cultured in 10% reconstituted skim milk medium was added to 10g of fermentation mix (16% skim milk powder + 3% glucose) sterilized at 95℃ for 90 minutes at a concentration of 3%, and cultured for 20 hours at 35℃. 10g of this culture was mixed with 40g of isomerized sugar (BRIX 15%) to obtain a lactic acid bacteria drink for improving lipid metabolism. The viable cell count of Streptococcus thermophilus SBT1277 in the above-mentioned lactic acid bacteria drink was 4 × 10 8 cfu / g.

[0046] [Example A6] Preparation of a composition for improving lipid metabolism After sterilizing reduced skim milk medium (13% by weight skim milk powder, 0.5% yeast extract) at 95℃ for 30 minutes, Streptococcus thermophilus SBT1277 was inoculated and cultured at 37℃ for 16 hours, and the resulting culture was centrifuged at 5000rpm for 20 minutes to remove the precipitate and obtain the culture supernatant. This can be used as a lipid metabolism improving composition as it is.

[0047] [Example A7] Production of health food for improving lipid metabolism 50 g of the culture powder of Streptococcus thermophilus SBT1277 obtained in Example A1 was mixed with 40 g of an equal mixture of vitamin C and citric acid, 100 g of granulated sugar, and 60 g of an equal mixture of cornstarch and lactose. The mixture was packed into a stick bag to obtain a health food for improving lipid metabolism.

[0048] [Example A8] Production of feed for improving lipid metabolism A mixture of 12 kg of soybean meal, 14 kg of skimmed milk powder, 4 kg of soybean oil, 2 kg of corn oil, 23.2 kg of palm oil, 14 kg of corn starch, 9 kg of wheat flour, 2 kg of bran, 5 kg of vitamin mixture, 2.8 kg of cellulose, and 2 kg of mineral mixture was sterilized at 120°C for 4 minutes, and then 10 kg of the culture powder of Streptococcus thermophilus SBT1277 obtained in Example A1 was added to produce a feed for improving lipid metabolism.

[0049] [Example A9] Production of cheese for improving lipid metabolism The raw milk was pasteurized (75°C, 15 seconds), cooled to 30°C, and 0.01% calcium chloride was added. In addition, 0.7% of a commercial lactic acid bacteria starter (LD starter, Christian Hansen) and 1% of Streptococcus thermophilus SBT1277 culture were added, and 0.003% rennet was added to coagulate the milk. The curd thus obtained was cut and stirred until the pH reached 6.2-6.1, and the whey was drained off to obtain curd grains. The curd grains were then molded and pressed, salted, and aged at 10°C to produce a Gouda-type hard natural cheese for improving lipid metabolism containing Streptococcus thermophilus SBT1277. [B: Second Invention] The present inventors came up with the idea of ​​improving the metabolism in fat cells, promoting the differentiation of white fat precursor cells into brown fat cells, and activating brown fat cells, thereby enhancing energy consumption through heat production, suppressing excess fat accumulation and obesity in the body, and preventing or ameliorating metabolic syndrome, etc. As a result of continuing intensive research, they discovered that lactic acid bacteria belonging to Streptococcus thermophilus promote the differentiation of white fat precursor cells into brown fat cells and activate brown fat cells. The second invention is based on the above findings. (Active ingredient) The present invention relates to a composition for improving lipid metabolism that promotes differentiation of white adipose precursor cells into brown adipose cells, which contains lactic acid bacteria belonging to Streptococcus thermophilus, a composition for activating brown adipose cells, a composition for improving metabolic syndrome metabolism, and foods, medicines, and feeds containing them. The Streptococcus thermophilus used in the present invention may be any lactic acid bacterium that is classified into the genus Streptococcus thermophilus by a common classification method such as 16S ribosomal RNA gene sequence analysis. In the present invention, it is particularly preferable to use Streptococcus thermophilus SBT1277 (FERM BP-3234), SBT1063 (NITE P-02398), SBT1021A (FERM P-10658), SBT10137 (FERM P-19531), SBT0104 (FERM P-9442), SBT0113 (FERM P-9443), SBT0144 (FERM P-16638), SBT1035 (FERM P-16945), and ATCC 19258, and of these, SBT1277 (FERM BP-3234) is particularly preferable. Strains with numbers beginning with FERM or NITE in parentheses can be obtained from the respective depositories described below, and ATCC19258 can be purchased from the American Type Culture Collection, a microorganism distribution organization in the United States. The Streptococcus thermophilus used in the present invention may be in the form of live cells, killed cells, cell cultures, or cytoplasm or cell wall fractions obtained by treating these cells with enzymes or physical means, and one or more of these may be used.

[0050] (Preparation of a composition containing Streptococcus thermophilus) The composition containing the active ingredient of the present invention, lactic acid bacteria belonging to Streptococcus thermophilus, can be obtained according to a conventional method for preparing a culture of lactic acid bacteria. For the culture, various media can be used, such as a milk medium or a medium containing milk components, or a semi-synthetic medium not containing milk components. A culture of lactic acid bacteria can be obtained by inoculating the lactic acid bacteria belonging to Streptococcus thermophilus into the above-mentioned sterilized medium and culturing it for 5 hours to several days at about 20° C. to 45° C. The culture temperature and period may be appropriately adjusted depending on the strain of Streptococcus thermophilus used and the desired number of bacteria. The culture containing lactic acid bacteria belonging to Streptococcus thermophilus obtained by culturing can be used as it is as a composition containing lactic acid bacteria belonging to Streptococcus thermophilus, which is the active ingredient of the present invention. In addition, a composition obtained by subjecting the culture to a process such as centrifugation, membrane concentration, drying, or freeze-drying can also be used. One embodiment of a method for preparing a composition containing Streptococcus thermophilus includes sterilizing an 11.55% skim milk medium containing 0.5% yeast extract (manufactured by Asahi Breweries, Ltd.) at 115°C for 20 minutes, cooling to room temperature, inoculating it with Streptococcus thermophilus, culturing it at 37°C for 16 hours, freeze-drying the resulting culture, and pulverizing it in a mortar.

[0051] (Amount of active ingredient taken) The daily intake of the active ingredient of the present invention, lactic acid bacteria belonging to Streptococcus thermophilus, is 5×10 8 Anything above 1×10 10More preferably, 1×10 11 The above is most preferable. If the Streptococcus thermophilus is killed, the amount should be equivalent to the number of live bacteria above. If both live and killed bacteria are included, the total amount of live and killed bacteria should be equivalent to the number of live bacteria above. In the case of cytoplasm or cell wall fractions obtained by treating bacterial cells with enzymes or physical means, the daily intake per adult is from 0.1 mg to 5,000 mg, preferably from 100 mg to 2,500 mg, and most preferably from 500 mg to 1,000 mg.

[0052] (Effectiveness) When the composition containing the lactic acid bacteria belonging to Streptococcus thermophilus of the present invention and the food, medicine, and feed containing such composition are ingested in the above-mentioned intake amounts, white adipose precursor cells are differentiated into brown adipose cells, the brown adipose cells are activated, and further subcutaneous fat and visceral fat are reduced, resulting in a loss of body weight. Furthermore, when the composition of the present invention containing the lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and the food, medicine, and feed containing the composition are ingested in the above-mentioned intake amounts, the expression of fatty acid synthesis-related genes, the expression of cholesterol synthesis-related genes, and the expression of gluconeogenesis-related genes are suppressed, thereby improving metabolic syndrome. By taking the above-mentioned lipid metabolism improving composition and food, medicine, and feed containing the composition, it is expected to prevent or improve dyslipidemia, which is said to occur due to an imbalance of cholesterol and triglycerides (neutral fats) in the blood.Furthermore, it is expected to prevent or improve diseases caused by dyslipidemia (e.g., insulin resistance, diabetes, nonalcoholic fatty liver disease, nonalcoholic fatty liver disease, liver cirrhosis, liver cancer) and arteriosclerosis diseases (e.g., angina pectoris, myocardial infarction, cerebral infarction, cerebral hemorrhage, aortic aneurysm, renal infarction, obliterative arteriosclerosis).

[0053] (Evaluation of efficacy) The improving effect on fat cell metabolism of the composition of the present invention containing lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and foods, medicines, and feeds containing the composition, can be evaluated by the in vivo test described in Example B.

[0054] (Food, medicine, and feed to which a composition containing Streptococcus thermophilus has been added) The composition containing Streptococcus thermophilus of the present invention can be added to any food product, and the amount of the composition added can be adjusted taking into account the intake amount of the above-mentioned active ingredient, and the rest can be produced according to the standard method for each food product. Examples of foods include dairy products such as cheese, fermented milk, dairy lactic acid bacteria drinks, lactic acid bacteria drinks, butter, margarine, and the like; beverages such as milk drinks, fruit juice drinks, and soft drinks; egg products such as jelly, candy, pudding, and mayonnaise; confectioneries and breads such as butter cake; and further, various types of milk powder, as well as foods for infants and young children, and nutritional compositions.

[0055] The composition containing Streptococcus thermophilus of the present invention can be incorporated into any pharmaceutical product, and the amount of the composition should be adjusted taking into account the intake amount of the above-mentioned active ingredient, and otherwise the product can be manufactured according to the standard method for the desired pharmaceutical product.

[0056] The composition containing Streptococcus thermophilus of the present invention can be added to any feed, and the amount of the composition should be adjusted taking into account the intake amount of the above-mentioned active ingredient, and otherwise the desired feed can be produced according to standard methods.

[0057] [Example B] The present invention will be described in detail below with reference to Example B and Test Example B, but the present invention is not limited thereto.

[0058] (Example B1: Preparation of a composition containing Streptococcus thermophilus) Streptococcus thermophilus SBT1277 (FERM BP-03234) was activated by culturing it for 16 hours at 37℃ for more than three generations in 11.55% skim milk medium containing 0.5% yeast extract (manufactured by Asahi Breweries) after sterilization at 115℃ for 20 minutes. This was inoculated into the same medium at 3% and cultured at 37℃ for 16 hours. The culture obtained was freeze-dried and then crushed in a mortar to obtain a composition containing powdered Streptococcus thermophilus. The viable cell count of Streptococcus thermophilus SBT1277 in the above composition was 3.6 × 10 9 cfu / g.

[0059] [Test Example B1] The metabolic improving effect of Streptococcus thermophilus was investigated using mice. 1. Test Method 1-1. Rearing method Five-week-old male C57BL6 / JJcl mice were acclimated for one week, and then divided into two groups of 20 mice each so as to have the same average body weight, and were kept for eight weeks under the following conditions. (1) Control group The AIN76 mice were fed a high-fat diet containing 20% ​​skim milk medium and 20% fat. (2) Thermophilus group Instead of the skim milk medium in the control group, the mice were given a high-fat diet containing 20% ​​of the composition (skim milk culture) containing Streptococcus thermophilus SBT1277 prepared in Example B1.

[0060] 1-2.Measurement method (1) Body weight, tissue weight, and plasma parameters After measuring body weight, blood, liver, inguinal adipose tissue, peritellar adipose tissue, mesenteric adipose tissue, and interscapular brown adipose tissue were collected. The triglyceride and insulin concentrations were measured using plasma prepared from the blood. The triglyceride concentration was measured using a Triglyceride E-Test Wako kit, and the insulin concentration was measured using an ultra-sensitive mouse insulin measurement kit (Morinaga Institute of Biological Sciences). (2) Liver total lipids and liver triglyceride concentrations Lipids were extracted from the liver with chloroform / methanol, and the total lipid concentration and triglyceride concentration were measured. The total lipid concentration was measured by weighing the lipid after extraction, and the triglyceride concentration was measured using a triglyceride E-Test Wako after dissolving the extracted lipid in isopropanol. The concentration per gram of liver was calculated by dividing each measured value by the weight of the liver used for extraction.

[0061] (3) Gene expression analysis Total RNA was extracted from each tissue using Sepasol RNA I SuperG Reagent (Nacalai Tesque). ReverTra Ace qPCR RT Master Mix (Toyobo) was used for reverse transcription. The obtained cDNA was used to perform real-time PCR using THUNDERBIRD qPCR Mix (Toyobo) to analyze gene expression levels. In the liver, the expression of fatty acid synthesis-related genes (SREBP-1c, FAS, SCD1), cholesterol synthesis-related genes (SREBP-2), and gluconeogenesis-related genes (G6Pase) was analyzed, while in inguinal adipose tissue and interscapular brown adipose tissue, the expression of the UCP1 gene, a marker of brown adipocyte activation, was analyzed. We also analyzed the expression levels of the MCP1 gene, a marker of inflammation, in all adipose tissues (inguinal adipose tissue, peritestril adipose tissue, mesenteric adipose tissue, and interscapular brown adipose tissue). The 36B4 gene was used as an internal standard, and the following primers were used to analyze the expression level of each gene.

[0062] SREBP1c-F; TCGCGGAGCCATGGATT (Sequence Listing SEQ ID NO: 1) SREBP1c-R; GCCAGGGAAGTCACTGTCTTG ((Sequence Listing SEQ ID NO: 2) FAS-F; GCAAATTCGACCTTTCTCAGAAC (Sequence Listing SEQ ID NO: 3) FAS-R; GGACCCCGTGGAATGTCA (Sequence Listing SEQ ID NO: 4) SCD1-F: TGTGGAGCCACCGCTCTTAC (Sequence Listing SEQ ID NO: 5) SCD1-R; ACGAGCCCATTCATAGACATCA (Sequence Listing SEQ ID NO: 6) G6Pase-F: TCGGAGACTGGTTCAACCTC (Sequence Listing SEQ ID NO: 7) G6Pase-R: TCACAGGTGACAGGGAACTG (Sequence Listing SEQ ID NO: 8) SREBP2-F: AAGTGACCGAGAGTCCCTTG (Sequence Listing SEQ ID NO: 9) SREBP2-R: ACGTTGAGACTGCTCCACAG (Sequence Listing SEQ ID NO: 10) UCP1-F: CCAAAGTCCGCCTTCAGA (Sequence Listing SEQ ID NO: 11) UCP1-R: GGCAATCCTTCTGTTTTTGC (Sequence Listing SEQ ID NO: 12) MCP1-F: CCACTCACCTGCTGCTACTCAT (Sequence Listing SEQ ID NO: 13) MCP1-R: TGGTGATCCTCTTGTAGCTCTCC (Sequence Listing SEQ ID NO: 14) 36B4-F: GGCCCTGCACTCTCGCTTTC (Sequence Listing SEQ ID NO: 15) 36B4-R: TGCCAGGACGCGCTTGT (Sequence Listing SEQ ID NO: 16)

[0063] 2. Test Results (1) Body weight, tissue weight, and plasma parameters The results are shown in Table B1. The thermophilus group had a significant decrease in body weight compared to the control group. In addition, the weights of the liver and interscapular brown adipose tissue were significantly reduced, as were the weights of the inguinal adipose tissue (equivalent to subcutaneous fat), the peritedibula adipose tissue (equivalent to visceral fat), and the mesenteric adipose tissue (equivalent to visceral fat). Furthermore, the plasma triglyceride concentration was also significantly reduced.

[0064] [Table B1]

[0065] (2) Liver lipids The results are shown in Table B2. The thermophilus group showed a tendency toward decreased total lipid and triglyceride concentrations in the liver compared to the control group.

[0066] [Table B2] These results indicate that Streptococcus thermophilus prevents obesity by suppressing the accumulation of subcutaneous and visceral fat, and improves metabolism by lowering blood triglycerides and suppressing fat accumulation in the liver.

[0067] (3) Metabolic improvement mechanism (i) Expression of fatty acid synthesis-related genes, cholesterol synthesis-related genes, and gluconeogenesis-related genes in the liver The results are shown in Table B3. In the thermophilus group, the expression of fatty acid synthesis-related genes, cholesterol synthesis-related genes, and gluconeogenesis-related genes in the liver was significantly decreased compared to the control group.

[0068] [Table B3]

[0069] (ii) Expression of the UCP1 gene The results are shown in Table B4. In the Thermophilus group, the expression of the UCP1 gene, a marker of brown adipocyte activation, was significantly increased in the interscapular brown adipose tissue compared to the control group. Therefore, it is considered that the expression of the UCP1 gene per cell in the interscapular brown adipose tissue was increased in the Thermophilus group, promoting fat burning, and therefore the weight of the interscapular brown adipose tissue was reduced compared to the control group, as shown in Table B1. In addition, the expression of the UCP1 gene, a marker of brown adipocyte activation, was significantly increased in the inguinal adipose tissue, which is a white adipose tissue, indicating that a portion of the white adipose precursor cells were differentiated into brown adipocytes.

[0070] [Table B4]

[0071] (iii) Expression of the MCP1 gene The results are shown in Table B5. The expression of MCP1 gene, a marker of inflammation in adipose tissue, was significantly decreased in the thermophilic group compared to the control group.

[0072] [Table B5]

[0073] These results suggest that Streptococcus thermophilus promotes the differentiation of white adipose precursor cells into brown adipocytes and also promotes the activation of brown adipose tissue. It also suppresses the expression of fatty acid synthesis-related genes, cholesterol synthesis-related genes, and gluconeogenesis-related genes in the liver, and furthermore, improves metabolic syndrome by suppressing inflammation in adipose tissue.

[0074] [Example B2] Preparation of a composition for improving fat cell metabolism The culture of Streptococcus thermophilus SBT1277 in M17 medium (OXOID) was centrifuged at 4°C and 7000 rpm for 15 minutes, and then washed with sterile water and centrifuged three times to obtain washed cells. The washed cells were freeze-dried to obtain a powder of cells. This can be used as a composition for improving the metabolism of fat cells as it is. The viable cell count of Streptococcus thermophilus SBT1277 in the above composition was 1.6 × 10 11 cfu / g.

[0075] [Example B3] Production of a drug for improving fat cell metabolism One part of the bacterial cell powder prepared in Example B2 was mixed with 4 parts of skim milk powder, and this mixed powder was compressed into tablets of 1 g each using a tablet press in a conventional manner to prepare tablets containing 200 mg of Streptococcus thermophilus SBT1277 bacterial cells.

[0076] [Example B4] Production of fermented milk for improving fat cell metabolism After sterilizing 10% reconstituted skim milk medium at 115°C for 15 minutes, Streptococcus thermophilus SBT1277 was inoculated and cultured at 37°C for 16 hours to prepare a skim milk culture. The skim milk culture was inoculated into a fermentation mix (16% skim milk powder + 3% glucose) sterilized at 100°C for 10 minutes, and fermented at 39°C for 10 hours to obtain fermented milk for improving the metabolism of adipocytes. The viable cell count of Streptococcus thermophilus SBT1277 in the fermented milk was 1.8 × 10 9 cfu / g.

[0077] [Example B5] Production of lactobacillus beverage for improving fat cell metabolism Streptococcus thermophilus SBT1277 cultured in 10% reduced skim milk medium was added to 10g of fermentation mix (16% skim milk powder + 3% glucose) sterilized at 95℃ for 90 minutes at a concentration of 3%, and cultured at 35℃ for 20 hours. 10g of this culture was mixed with 40g of isomerized sugar (BRIX 15%) to obtain a lactic acid bacteria drink for improving the metabolism of fat cells. The viable cell count of Streptococcus thermophilus SBT1277 in the above-mentioned lactic acid bacteria drink was 4 × 10 8 cfu / g.

[0078] [Example B6] Preparation of a composition for improving fat cell metabolism After sterilizing reduced skim milk medium (13% by weight skim milk powder, 0.5% yeast extract) at 95℃ for 30 minutes, Streptococcus thermophilus SBT1277 was inoculated and cultured at 37℃ for 16 hours, and the resulting culture was centrifuged at 5000rpm for 20 minutes to remove the precipitate and obtain the culture supernatant. This can be used as it is as a composition for improving the metabolism of fat cells.

[0079] [Example B7] Production of health food for improving fat cell metabolism 50 g of the culture powder of Streptococcus thermophilus SBT1277 obtained in Example B1 was mixed with 40 g of an equal mixture of vitamin C and citric acid, 100 g of granulated sugar, and 60 g of an equal mixture of cornstarch and lactose. The mixture was packed into a stick bag to obtain a health food for improving the metabolism of fat cells.

[0080] [Example B8] Production of feed for improving fat cell metabolism 12 kg of soybean meal, 14 kg of skimmed milk powder, 4 kg of soybean oil, 2 kg of corn oil, 23.2 kg of palm oil, 14 kg of corn starch, 9 kg of wheat flour, 2 kg of bran, 5 kg of vitamin mixture, 2.8 kg of cellulose, and 2 kg of mineral mixture were mixed and sterilized at 120°C for 4 minutes, and then 10 kg of the culture powder of Streptococcus thermophilus SBT1277 obtained in Example B1 was added to produce feed for improving the metabolism of fat cells.

[0081] [Example B9] Production of hard natural cheese for improving fat cell metabolism The raw milk was pasteurized (75°C, 15 seconds), cooled to 30°C, and 0.01% calcium chloride was added. In addition, 0.7% of a commercial lactic acid bacteria starter (LD starter, Christian Hansen) and 1% of Streptococcus thermophilus SBT1277 were added, and 0.003% of rennet was added to coagulate the milk. The curd thus obtained was cut and stirred until the pH reached 6.2-6.1, and the whey was drained to obtain curd grains. The curd grains were then molded and pressed, salted, and aged at 10°C to produce a Gouda-type hard natural cheese containing Streptococcus thermophilus SBT1277 for improving the metabolism of fat cells. [Industrial Applicability]

[0082] The first invention provides a new solution for improving lipid metabolism, providing a composition for improving lipid metabolism containing lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and foods, medicines, and feed for improving lipid metabolism that contain the composition. Therefore, lipid metabolism can be expected to be improved in a simple and safe manner by ingesting the above-mentioned composition, food, medicine, and feed of the present invention.

[0083] The second invention provides a composition for improving fat cell metabolism, such as promoting the differentiation of white fat precursor cells into brown fat cells and activating brown fat cells, which contains lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and foods, medicines, and feeds for improving fat cell metabolism that contain the composition; a composition for improving metabolic syndrome, which contains lactic acid bacteria belonging to Streptococcus thermophilus as an active ingredient, and foods, medicines, and feeds for improving metabolic syndrome that contain the composition. According to the present invention, by ingesting the above-mentioned composition, food, medicine, or feed, it is expected that the metabolism of adipocytes and metabolic syndrome can be improved in a simple and safe manner.

[0084] (Accession Number) FERM BP-3234 FERM P-9442 FERM P-9443 FERM P-10658 FERM P-16638 FERM P-19531 NITE P-02398

[0085] [Reference to deposited biological material] (1)SBT1277 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea December 11, 1989 (original deposit date) January 22, 1991 (the date of transfer of the original deposit to the deposit under the Budapest Treaty) The accession number given to the deposit by the depository institution in question FERM BP-3234 (2)SBT0104 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea June 30, 1987 (original deposit date) The accession number given to the deposit by the depository institution in question FERM P-9442 (3)SBT0113 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea June 30, 1987 (original deposit date) The accession number given to the deposit by the depository institution in question FERM P-9443 (4) SBT1021A (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea April 13, 1989 (original deposit date) The accession number given to the deposit by the depository institution in question FERM P-10658 (5)SBT0144 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea February 17, 1998 (original deposit date) The accession number given to the deposit by the depository institution in question FERM P-16638 (6)SBT10137 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea September 25, 2003 (original deposit date) The accession number given to the deposit by the depository institution in question FERM P-19531 (7)SBT1063 (a) The name and address of the depository institution that deposited the biological material National Institute of Technology and Evaluation Patent Microorganism Deposit Center 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code 292-0818) Date of deposit of biological material in a depository institution in the Republic of Korea December 27, 2016 (original deposit date) (After the date of the original deposit, we applied for a transfer to a deposit under the Budapest Treaty based on the original deposit, and after the completion of the viability confirmation test, we received a letter notifying us of the receipt and accession number. The receipt and accession number is ABP-02398.) The accession number given to the deposit by the depository institution in NITE P-02398

Claims

1. A composition for lowering blood triglycerides, comprising a culture and / or cells of Streptococcus thermophilus SBT1277 (FERM BP-3234).

2. A food for lowering blood triglycerides comprising the composition for lowering blood triglycerides according to claim 1.

3. A pharmaceutical for lowering blood triglyceride levels, comprising the composition for lowering blood triglyceride levels according to claim 1.

4. A feed for lowering blood triglyceride levels, comprising the composition for lowering blood triglyceride levels according to claim 1.

5. A composition for lowering blood triglycerides, comprising: The present invention comprises a culture and / or cells of Streptococcus thermophilus SBT1277 (FERM BP-3234), A composition for lowering blood triglycerides that promotes differentiation of white adipose precursor cells into brown adipose cells.

6. A composition for activating brown adipocytes and lowering blood triglyceride levels, comprising a culture and / or cells of Streptococcus thermophilus SBT1277 (FERM BP-3234).

7. A food, medicine, or feed for promoting differentiation of white adipose precursor cells into brown adipose cells and lowering blood triglyceride levels, comprising the composition according to claim 5.

8. A food, medicine, or feed for activating brown adipocytes and lowering blood triglycerides, comprising the composition according to claim 6.

Images