Methods and compositions for delivering antibodies encoded by mRNA

Abstract

It provides a better method for delivering antibodies in vivo more safely and effectively. In one aspect, the present invention provides one or more nucleic acid sequences encoding the heavy and light chains of an antibody. A method for delivering an antibody in vivo by administering mRNA to a subject in need of the antibody. In some embodiments, the antibody is expressed systemically in the subject. In one embodiment, the one or more mRNAs include a first mRNA encoding a heavy chain of the antibody and a light In some embodiments, the one or more mRNAs encoding the one or more strands are included. The mRNA comprises a single mRNA encoding both the heavy and light chains of the antibody.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a joint venture of U.S. Provisional Patent Application No. 61 / 784,903, filed March 14, 2013, and ... This application claims priority to U.S. Provisional Patent Application No. 61 / 920,165, filed December 23, 2013. , the contents of which are incorporated herein by reference in their entireties. [Background technology]

[0002] Antibodies are known to have powerful therapeutic effects and are used to treat a variety of diseases, including cancer, autoimmune diseases, and cardiovascular diseases. They are currently used to treat a range of diseases, including cancer, osteoporosis, and transplant rejection. The antibodies are produced recombinantly, formulated, and then administered to patients in need of antibody therapy. However, antibody production and formulation are expensive. In addition, many antibodies are not fully understood in vivo. and therefore have a very short half-life when they reach their target antigen or target tissue. To achieve the desired efficacy, antibody therapeutics often require high High doses and frequent dosing are required. Genetic vaccination, also known as gene therapy and DNA vaccination, involves the administration of large amounts of However, the use of drugs in gene therapy provides an alternative method for delivering antibodies to the The use of DNA as a vaccine and genetic vaccination raises several safety concerns. For example, DNA is slowly degraded in the bloodstream, and anti-DNA antibodies may form. (Gilkeson et al., J. Clin. Invest. 1999) 95, 95:1398-1402). There is a possibility that (foreign) DNA may remain in the body. This may lead to hyperactivation of the immune system, which causes splenomegaly in mice. It was known that the anticoagulation effect was r Drug Res. 1997, 12(5):421-432). Insertions can cause mutations in the host genome by disrupting intact genes. There is. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Gilkeson et al.,J.Clin.Invest.1995,95:1398-1402 [Non-Patent Document 2] Montheith et al.,Anticancer Drug Res.1997,12(5):421-432 Summary of the Invention [Means for solving the problem]

[0004] The present invention is based on messenger RNA (mRNA) delivery technology to improve the expression of antibodies in vivo. The present invention provides a better method for safely and effectively delivering antibody heavy and light chains. By delivering exogenous mRNA encoding the heavy and light chains, Even when delivered by ELISA, production of fully assembled multichain antibodies can be achieved in vivo. The present invention is based in part on the surprising discovery that the method of the present invention can be used to treat a wide variety of conditions, as illustrated by the non-limiting examples set forth below in the Examples section. As shown, mRNA constructs encoding the heavy and light chains were encapsulated in liposomes and expressed in mice. When the mRNA was injected intravenously into the mouse, the desired antibody was expressed in the mouse within 6 hours of injection. Substantial amounts can be detected in serum, peaking at 72 or 96 hours. The effect persisted even 3 weeks after injection. Thus, the present inventors demonstrated that a multi-chain therapeutic antibody can be delivered by mRNA and produced by the patient's body itself, thereby reducing the high costs We have successfully demonstrated that the recombinant antibody production process can be omitted. In contrast to the transient and fragile nature of A, antibodies generated from mRNA are surprisingly long-lasting. The transient nature of mRNA also allows for efficient systemic distribution. Thus, the safety concerns typically associated with nucleic acids of the present invention can be minimized. provides a safer, less costly and more effective method of antibody delivery for therapeutic use.

[0005] In one aspect, the present invention provides one or more mRNAs encoding the heavy and light chains of an antibody. A method for in vivo antibody delivery by administering the antibody to a subject in need thereof, In some embodiments, the method further comprises the step of: The one or more mRNAs include a first mRNA encoding a heavy chain of the antibody and a second mRNA encoding a light chain. In some embodiments, the one or more mRNAs include a second mRNA that It contains a single mRNA that encodes both the heavy and light chains of the antibody.

[0006] In some embodiments, the mRNA encoding the heavy or light chain contains a signal peptide. In some embodiments, the mRNA encoding the heavy or light chain is A is a sequence encoding the human growth hormone (hGH) signal peptide (e.g., SEQ ID NO: In some embodiments, the signal peptide sequence comprises a codon. The coding sequence (e.g., SEQ ID NO: 9 or SEQ ID NO: 10) encodes a heavy or light chain. It binds directly or indirectly to the N-terminus of the mRNA sequence.

[0007] In some embodiments, a first mRNA encoding a heavy chain and a second mRNA encoding a light chain. The ratio of mRNA to total RNA is about 10:1 to 1:10 (e.g., about 9:1 to 1:9, 8:1 to 1:8, 7 :1~1:7, 6:1~1:6, 5:1~1:5, 4:1~1:4, 3:1~1:3, In some embodiments, the heavy chain encoding the ribozyme is present in a ratio ranging from 1:1 to 2:1 to 1:2. The first mRNA encoding the light chain and the second mRNA encoding the light chain are expressed in a ratio ranging from about 4:1 to 1:4. In some embodiments, a first mRNA encoding a heavy chain and a second mRNA encoding a light chain are present in the The second mRNA is expressed at approximately 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, and 4: In some embodiments, the heavy chains are present in a ratio of 1, 3:1, 2:1, or 1:1. The first mRNA encoding the light chain and the second mRNA encoding the light chain are present in a ratio of about 4:1. In some embodiments, a first mRNA encoding a heavy chain and a second mRNA encoding a light chain are In some embodiments, the mRNAs encoding the heavy chain and the heavy chain are present in a ratio of about 1:1. The first mRNA and the second mRNA encoding the light chain are more than 1 (e.g., about 10 :1~1:1, 9:1~1:1, 8:1~1:1, 7:1~1:1, 6:1~1:1, 5 :1 to 1:1, 4:1 to 1:1, 3:1 to 1:1, or 2:1 to 1:1 exist.

[0008] In some embodiments, one or more mRNAs encoding the heavy and light chains of the antibody. is delivered by a polymer-based and / or lipid-based delivery vehicle. In the present invention, one or more mRNAs encoding the heavy and light chains of an antibody are In some embodiments, the first mRNA encoding the heavy chain is encapsulated in a liposome. The second mRNA encoding the light chain and the second mRNA encoding the light chain are encapsulated in separate liposomes. In an embodiment, the first mRNA encoding the heavy chain and the second mRNA encoding the light chain are In some embodiments, the one or more liposomes are encapsulated in the same liposome. , cationic lipids, neutral lipids, cholesterol-based lipids, and PEG-modified lipids, or In some embodiments, the one or more liposomes contain a cationic lipid. , neutral lipids, cholesterol-based lipids, and PEG-modified lipids.

[0009] In some embodiments, the liposome or liposomes are about 250 nm or smaller (e.g., , about 225nm, 200nm, 175nm, 150nm, 125nm, 100nm, 75 In some embodiments, one or more A number of the liposomes have a size of about 150 nm or less. Alternatively, the liposomes have a size of about 100 nm or less. In some embodiments, the one or more liposomes have a size of about 75 nm or less. In the form, the liposome or liposomes have a size of about 50 nm or less.

[0010] In some embodiments, the liposome or liposomes are in the range of about 250-10 nm. (For example, about 225-10 nm, 200-10 nm, 175-10 nm, 150-10 nm m, 125-10nm, 100-10nm, 75-10nm, or 50-10nm range In some embodiments, the one or more liposomes have a size of about 2 In the range of 50-100 nm (e.g., about 225-100 nm, 200-100 nm, 175 In some embodiments, the size of the nanoparticles ranges from 100 nm to 150 nm. The one or more liposomes may be in the range of about 100 to 10 nm (e.g., about 90 to 10 nm). m, 80-10 nm, 70-10 nm, 60-10 nm, or 50-10 nm range) It has a size of

[0011] In some embodiments, one or more mRNAs are modified to improve stability. In some embodiments, the one or more mRNAs include modified nucleotides. , modified sugar backbones, cap structures, polyA tails, 5' and / or 3' untranslated regions. In some embodiments, one or more mRNAs are unmodified. .

[0012] In some embodiments, the one or more mRNAs are administered intravenously. In embodiments, the one or more mRNAs are administered intraperitoneally. In some embodiments, the one or more mRNAs are administered subcutaneously. A number of mRNAs are administered via pulmonary administration.

[0013] In some embodiments, systemic expression of the antibody is at least Approximately 6 hours, 12 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, and 96 hours Detectable at 120, 144, 156, 168, or 180 hours In some embodiments, systemic expression of the antibody occurs at low levels after administration (e.g., after a single administration). At least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 days, Detectable on the 12th, 13th, 14th, 15th, 20th, 22nd, 25th, or 30th day In some embodiments, systemic expression of the antibody occurs at low levels after administration (e.g., after a single administration). At least about 0.5 weeks, 1 week, 1.5 weeks, 2 weeks, 2.5 weeks, 3 weeks, 3.5 weeks , 4 weeks, 4.5 weeks, 5 weeks, 5.5 weeks, 6 weeks, 6.5 weeks, 7 weeks, 7.5 weeks In some embodiments, systemic expression of the antibody is detectable within 1 to 8 weeks of administration. detectable at least about 1 month, 2 months, 3 months, or 4 months after (e.g., after a single dose) It is Noh.

[0014] In some embodiments, the antibody is an intact immunoglobulin, (Fab)2, (Fab')2 In some embodiments, the antibody is an IgG. In some embodiments, the antibody is anti-CCL2, anti-lysyl oxidase-like-2 (LOX2), OXL2), anti-Flt-1, anti-TNF-α, anti-interleukin-2Rα receptor (CD2 5), anti-TGF β , anti-B cell activating factor, anti-alpha-4 integrin, anti-BAGE, anti β-catenin / m, anti-Bcr-abl, anti-C5, anti-CA125, anti-CAMEL, anti-CAP -1, anti-CASP-8, anti-CD4, anti-CD19, anti-CD20, anti-CD22, anti-CD25, Anti-CDC27 / m, anti-CD30, anti-CD33, anti-CD52, anti-CD56, anti-CD80, anti- CDK4 / m, anti-CEA, anti-CT, anti-CTL4, anti-Cyp-B, anti-DAM, anti-EGFR, Anti-ErbB3, anti-ELF2M, anti-EMMPRIN, anti-EpCam, anti-ETV6-AML1 , anti-HER2, anti-G250, anti-GAGE, anti-GnT-V, anti-Gp100, anti-HAGE, anti- HER-2 / neu, anti-HLA-A *0201-R170I, anti-IGF-1R, anti-IL- 2R, anti-IL-5, anti-MC1R, anti-myosin / m, anti-MUC1, anti-MUM-1, -2, - 3, anti-proteinase-3, anti-p190 minor bcr-abl, anti-Pml / RARα; Anti-PRAMS, anti-PSA, anti-PSM, anti-PSMA, anti-RAGE, anti-RANKL, anti-RU1 or RU2, anti-SAGE, anti-SART-1 or anti-SART-3, anti-survivin, anti-T EL / AML1, anti-TPI / m, anti-TRP-1, anti-TRP-2, anti-TRP-2 / INT2 and anti-VEGF or anti-VEGF receptor.

[0015] In another aspect, the invention provides a first mRNA encoding the heavy chain of an antibody and a second mRNA encoding the light chain. a method for producing an antibody by administering to a cell a second mRNA corresponding to the antibody, the antibody being produced by the cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. The cells are cultured cells. In some embodiments, the cells are in vivo cells. In embodiments, the antibody is expressed intracellularly. In some embodiments, the antibody is expressed by the cell. It is secreted.

[0016] In yet another aspect, the present invention provides a first mRNA encoding a heavy chain of an antibody and a light chain. A composition comprising a second mRNA that is read in a first mRNA and a second mRNA that is read in a second mRNA. A composition is provided that is encapsulated in a liposome or liposomes.

[0017] In particular, the present invention also relates to certain compounds, such as anti-CCL2 antibodies and compositions containing the same. Examples of mRNAs encoding the heavy and light chains of the antibody of the present invention are provided. The invention relates to a sequence which is at least 50%, 55%, 60% identical to SEQ ID NO: 1 or SEQ ID NO: 2 described herein. %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% The present invention provides an mRNA encoding a heavy chain of an anti-CCL2 antibody having a sequence identical to that of the antibody of the present invention, the heavy chain of which has a sequence identical to that of the antibody of the present invention. In certain particular embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising the steps of: The present invention provides an mRNA encoding the heavy chain of an anti-CCL2 antibody having the sequence of SEQ ID NO:2. In an embodiment, the present invention relates to a method for the preparation of a nucleic acid sequence comprising the steps of: 0%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 9 The light chain of an anti-CCL2 antibody having a sequence identity of 6%, 97%, 98%, or 99% is encoded by the antibody. In certain specific embodiments, the present invention provides mRNA that encodes the sequences described herein. mRNA encoding the light chain of an anti-CCL2 antibody having the sequence of SEQ ID NO:3 or SEQ ID NO:4 to provide.

[0018] As used herein, the terms "about" and "approximately" mean "About" and "approximately" are used as equivalent phrases in this application. The numbers with or without the (at least) prefix may be used in any manner that would be understood by one of ordinary skill in the art. This also includes normal fluctuations.

[0019] Other features, objects, and advantages of the present invention will become apparent from the detailed description which follows. It should be understood that this detailed description, while illustrating embodiments of the present invention, is not intended to be limiting. It should be understood that the present invention is given by way of example only. Variations and modifications will become apparent to those skilled in the art from this detailed description.

[0020] The following diagrams are for illustrative purposes only and are not limiting. [Brief description of the drawings]

[0021]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

[0022] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions for other terms are set forth throughout the specification.

[0023] Amino acid: As used herein, the term "amino acid" in its broadest sense Any compound and / or compound that can be used in the synthesis of a polypeptide chain and that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure HN-C(H)(R)- In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a synthetic amino acid; in some embodiments, the amino acid In some embodiments, the amino acid is an L-amino acid. "Quasi-amino acid" refers to any of the 20 standard L-amino acids commonly found in natural peptides. A "nonstandard amino acid" refers to an amino acid that is either synthetically prepared or obtained from a natural source. As used herein, the term refers to any amino acid other than the standard amino acids, regardless of whether it is a "Synthetic amino acids" include salts, amino acid derivatives (e.g., amides), and / or substituted amino acids. Amino acids include, but are not limited to, chemically modified amino acids. For example, the carboxy- and / or amino-terminal amino acids of the peptide may be methylated, amido can be modified by oxidation, acetylation, protecting groups and / or by the addition of other chemical groups. Such other compounds can alter the circulating half-life of a peptide without adversely affecting its activity. The amino acids can be modified by substitution with chemical groups such as An amino acid may have one or more chemical moieties (e.g., a methyl group, an acetate group, an acetyl ... alkyl group, phosphate group, formyl component, isoprenoid group, sulfate group, polyethylene glycol binding with a single or multiple components (e.g., lipid components, carbohydrate components, biotin components, etc.) The term "amino acid" may be used interchangeably with "amino acid residue." It may refer to free amino acids and / or amino acid residues of peptides. Whether a term refers to an isolated amino acid or a residue of a peptide is clear from the context in which it is used. be.

[0024] Animal: As used herein, the term "animal" refers to any animal of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, , monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, In some embodiments, the animals include genus, insects, and / or worms. The animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0025] Antibody: As used herein, the term "antibody" includes both intact antibodies and antibody fragments. Typically, an intact "antibody" is an immunoglobulin that specifically binds to a particular antigen. The antibody may be of any immunoglobulin class, for example, human Toxic class: IgG, IgM, IgA, IgE, and IgD. A typical immunoglobulin (antibody) structural unit as understood in the art is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair consisting of one " It has one "light" chain (about 25 kD) and one "heavy" chain (about 50 kD to about 70 kD). The N-terminus consists of approximately 100-110 or more amino acids that are primarily responsible for antigen recognition. The terms "variable light chain" (VL) and "variable heavy chain" (VH) refer to the variable regions that Each variable region is further divided into hypervariable (HV) and heavy chain regions. The hypervariable regions are subdivided into the framework (FR) region and the complementarity determining region (CDR1). It contains three hypervariable sequence regions, called CDR1, CDR2, and CDR3, which are divided into four fragments. The framework is divided into framework regions (FR1, FR2, FR3, and FR4). The work domain forms a β-sheet structure and acts as a scaffold to hold the HV domain in place. The C-terminus of each heavy and light chain consists of one region (CL) for the light chain and three regions (CL) for the heavy chain. The constant region is characterized as consisting of three regions (CH1, CH2, and CH3). In embodiments, the terms "intact antibody" or "fully assembled antibody" are used to refer to an antibody. It is linked by disulfide bonds as occurs in naturally produced antibodies. In some embodiments, the present invention includes a method for the production of a fusion protein comprising the steps of: The antibody according to the invention is an antibody fragment. As used herein, an "antibody fragment" refers to, e.g. Antibody fragments include portions of an intact antibody, such as the antigen-binding or variable region of the antibody. Examples of antibody fragments include For example, Fab, Fab', F(ab')2, and Fv fragments; triabodies dies; tetrabodies; linear antibodies; single-chain antibody molecules; and and multispecific antibodies formed from antibody fragments. a separate fragment, an "Fv" fragment consisting of the variable regions of the heavy and light chains; A recombinant single-chain polypeptide molecule ("ScFv") in which These include the "protein" and the minimal recognition unit consisting of amino acid residues similar to a hypervariable region. In many embodiments, an antibody fragment contains enough of the sequence of the parent antibody of the fragment. In some embodiments, the fragment binds to the same antigen as the parent antibody; Binds to antigens with an affinity comparable to that of antibodies, or Antigen-binding fragments of antibodies that compete with the parent antibody or both. Examples of antigen-binding fragments of antibodies include, but are not limited to, Not limited, Fab fragments, Fab' fragments, F(ab')2 fragments, scFv fragments, Fv fragments, fragments, dsFv diabodies, dAb fragments, Fd' fragments, Fd fragments, and and isolated complementarity determining region (CDR) regions.

[0026] Approximately or about: As used herein, In this case, the term "approximately" or "about" means When applied to one or more values ​​in a range, it refers to a value similar to the stated reference value. In certain embodiments, the terms "approximately" or "about "out" refers to a value from a stated reference value unless otherwise stated or otherwise clear from the context. 25%, 20%, 19%, 18%, 17% for either (larger or smaller) , 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6% , 5%, 4%, 3%, 2%, 1% or less (however, (Except where such figure is believed to exceed 100% of possible values).

[0027] Bioavailability: As used herein, the term "bioavailability" generally refers to Refers to the percentage of an administered dose that reaches a subject's bloodstream.

[0028] Bioactive: As used herein, the phrase "bioactive" refers to a compound that is biologically active. It refers to the property of an agent that has activity on a system, especially a living organism. For example, the ability of an agent to affect the function of a living organism when administered to that organism. An agent that has a biological effect on the functioning of the target organ is considered to be bioactive.

[0029] Expression: As used herein, "expression" of a nucleic acid sequence refers to the conversion of mRNA to a polypeptide. (e.g., a heavy or light chain of an antibody), and / or, Post-translationally modifying a polypeptide or a fully assembled protein (e.g., an antibody) In this application, the terms "expression" and "production" and their grammatical equivalents are used interchangeably. It is used for the purpose.

[0030] Functional: As used herein, a "functional" biomolecule is a biomolecule that is characterized by A biological molecule in a form in which it exhibits a property and / or activity.

[0031] GC content: As used herein, "GC content" refers to the amount of guanine residues, cytosine residues, or The fraction or percentage of the total number of nucleobase residues that are nucleotides or analogs thereof in a nucleic acid sequence. For example, exactly 30 cytosines, exactly 30 guanines, exactly one A 100 nt sequence containing 62 cytosine analogs and exactly one guanine analog is % GC concentration.

[0032] Half-life: As used herein, the term "half-life" refers to the decrease in the concentration or activity of a protein. The time it takes for a quantity, such as a substance, to fall to half its value measured at the beginning of a period.

[0033] Improve, increase or decrease: As used herein, the terms "improve," "increase," or "reduce" "Reduction," or grammatical equivalents, refers to a reduction in a baseline measurement, e.g., a reduction in Measurements in the same individual before treatment was started or without the treatments described herein. Refers to a value compared to a measurement in a control subject (or multiple control subjects). A "control subject" is a subject who has the same form of disease as the subject being treated and is not being treated. The subjects are approximately the same age as the subjects being studied.

[0034] In vitro: As used herein, the term "in vitro" refers to, for example, an organism that is in a multicellular organism. It refers to events that occur in an artificial environment, such as in a test tube, a reactor, or a cell culture medium, rather than in a laboratory.

[0035] In vivo: As used herein, the term "in vivo" refers to a variety of organisms, including humans and non-human animals. Refers to events that occur within a cellular organism. In the context of cell-based systems, the term , used to refer to events that occur within living cells (as opposed to, for example, in vitro systems) This may be the case.

[0036] Isolated: As used herein, the term “isolated” means (1) (naturally and and / or in an experimental setting) of at least one of the components that was connected when it was first produced. (2) produced, prepared, and / or isolated from any An isolated substance and / or entity refers to a substance and / or entity that has been produced. About 10%, 20%, 30%, 40%, or 50% of the other components that were originally connected to it %, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 91%, approx. 92%, approx. 93%, approx. 94 %, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% In some embodiments, the isolated agent is about 80%, about 85% , about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97% The material may be substantially pure, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is said to be "pure" if it is free of other components. When used, the calculation of percent purity of isolated substances and / or entities shall include excipients (e.g. This does not include any substances (e.g., buffer solutions, solvents, water, etc.).

[0037] Linker: As used herein, the term "linker" refers to a linker that is a It generally refers to an amino acid sequence in a fusion protein other than that which appears at a particular position in the In order to provide flexibility or to provide structures such as α-helices between the two protein components, The linker is also called a spacer. Typically, the linker That is, the spacer has no biological function by itself.

[0038] Local distribution or delivery: As used herein, the terms "local distribution," "local delivery," "Delivery," or grammatical equivalents, refers to tissue-specific delivery or distribution. Typically, The localized distribution or delivery of the protein (e.g., an antibody) encoded by the mRNA can be achieved by However, the protein is either translated and expressed intracellularly or secreted in a limited manner to avoid entering the patient's circulatory system. It is necessary for the protein to be translated and expressed by the

[0039] Messenger RNA (mRNA): As used herein, the term "messenger "RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA refers to both modified and unmodified RNA. An mRNA may contain one or more coding and non-coding regions. good.

[0040] Nucleic Acid: As used herein, the term "nucleic acid" refers in its broadest sense to any nucleic acid. Any compound that is or can be incorporated into a oligonucleotide chain and / or In some embodiments, a nucleic acid is a polynucleotide that is bound to a nucleic acid by a phosphodiester bond. Compounds and / or substances that are incorporated or can be incorporated into nucleotide chains In some embodiments, a "nucleic acid" refers to an individual nucleic acid residue (e.g., a nucleoside). In some embodiments, "nucleic acid" refers to an individual In some embodiments, a "nucleic acid" refers to a polynucleotide chain that includes nucleic acid residues of R It includes NA, as well as single-stranded and / or double-stranded DNA, and / or cDNA. In the present specification, the terms "nucleic acid", "DNA", "RNA" and / or similar terms are used to refer to nucleic acid analogs, That is, it includes analogs having other than a phosphodiester backbone. "Peptide nucleic acids" are known in the art and contain peptide bonds instead of phosphodiester bonds in the backbone. The term "encoding an amino acid sequence" is intended to be within the scope of the present invention. "Nucleotide sequences corresponding to each other" are degenerate versions of each other and / or encode the same amino acid sequence. This includes all nucleotide sequences that code for proteins and The nucleic acid may be purified from a natural source or recombinantly produced. It can be produced using an expression system and optionally purified, or it can be chemically synthesized, etc. In some cases, for example in the case of chemically synthesized molecules, the nucleic acid may contain chemically modified bases or can include nucleoside analogs, such as analogs having sugars, backbone modifications, etc. is represented in the 5' to 3' direction unless otherwise noted. Nucleic acids consist of natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uracil, Lysine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine. thymidine; nucleoside analogues (e.g., 2-aminoadenosine, 2-thiothymidine, isothiocyanate, adenosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 proline C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromo Uridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- Deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine , O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; Chemically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and 6-carbon sugars); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N- In some embodiments, the present invention provides a method for the preparation of a cyclic amine-based amine comprising the steps of: Nucleic acids that have not been chemically modified to enhance or achieve delivery (e.g., nucleotides "Non-peptide" means a polynucleotide and its residues, including but not limited to nucleotides and / or nucleosides. Of particular interest are "modified nucleic acids."

[0041] Patient: As used herein, the term "patient" or "subject" refers to a subject receiving a provided composition. The subject matter may be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. The term "patient" refers to any living organism to which the subject may be administered. Typical patients include animals (e.g., mice, mammals, such as rats, rabbits, non-human primates, and / or humans. In some embodiments, the patient is a human, including pre- and post-natal forms.

[0042] Pharmaceutically acceptable: The term "pharmaceutical acceptable" as used herein means Within the bounds of sound medical judgment, the Company may determine that excessive toxicity, irritation, allergic response, or other issues are likely to occur. may be placed in contact with human and animal tissues without problems or complications, with reasonable risk-benefit considerations. Refers to a material suitable for use in proportion to the ratio.

[0043] Systemic distribution or delivery: As used herein, the terms "systemic distribution," "systemic delivery," "Delivery," or grammatical equivalents, refers to delivery or distribution that affects the entire body or organism. Typically, systemic distribution or delivery refers to delivery to the circulatory system of the body, e.g., Accomplished via the bloodstream. Compare definition of "local distribution or delivery."

[0044] Subject: As used herein, the term "subject" refers to a human or any non-human animal. (e.g., mice, rats, rabbits, dogs, cats, cows, pigs, sheep, horses, or Humans also refer to animals (primates). Humans include prenatal and postnatal forms. In many embodiments, The subject may be a patient, which is a medical professional providing diagnostic or treatment for a disease. The term "subject" refers to a human subject to medical treatment. " is used interchangeably with ". A subject is a person who is susceptible to or susceptible to a disease or disorder. A person may have a medical condition that may or may not be symptomatic of the disease or disorder.

[0045] Substantially: As used herein, the term "substantially" refers to a feature or characteristic of interest. It refers to a qualitative state that represents the entire or nearly entire extent or degree of something. If one is a person, biological and chemical phenomena will progress to completion and / or to a state of perfection. or to achieve or avoid an absolute result, if at all. It is understood that this is rarely the case. Thus, the term "substantially" is used herein as a is used to capture the potential lack of completeness inherent in many biological and chemical phenomena. will be done.

[0046] Target tissue: As used herein, the term "target tissue" refers to the tissue that is affected by the disease to be treated. In some embodiments, the target tissue includes any tissue that is involved in a disease. Also included are tissues that exhibit an associated disease state, symptom, or characteristic.

[0047] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means When administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, Treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition. A therapeutically effective amount typically comprises at least one unit dose. It will be understood by those skilled in the art that the compound is administered according to a dosing regimen including

[0048] Treating: As used herein, the term "treat" refers to "treatment" or "treating" means, in particular Partial or partial response to one or more symptoms or characteristics of a particular disease, disorder, and / or condition. or completely ameliorate, ameliorate, reduce, inhibit, prevent, delay the onset of, reduce the severity of, and / or cause Treatment refers to any method used to reduce survival rates. and / or in subjects who exhibit only early signs of the disease, causing symptoms associated with the disease. This may be done to reduce the risk of

[0049] (Mode for carrying out the invention) The present invention provides methods and compositions for delivering antibodies in vivo based on mRNA delivery technology. In some embodiments, the present invention provides a method for encoding the heavy and light chains of an antibody. The antibody is delivered to a subject in need of delivery by administering one or more mRNAs that encode the antibody. In some embodiments, the heavy and light chains of the antibody are delivered separately. In some embodiments, the heavy and light chains of the antibody are delivered by the same mRNA. The mRNA is delivered in a packaged particle (e.g., a liposome or Delivered as particles either encapsulated in polymeric excipients or unpackaged (i.e., naked) The antibody encoded by the mRNA may be delivered locally (e.g., in a tissue-specific manner) or Alternatively, the gene may be expressed systematically.

[0050] Various aspects of the invention are described in detail in the following subsections. The use of subsections limits the invention. Each section may be applicable to any aspect of the present invention. In this document, the use of "or" means "and / or" unless otherwise stated. / or)".

[0051] mRNA-encoded antibodies The present invention may be used to deliver any type of antibody. In this context, the term "antibody" encompasses both intact antibodies and antibody fragments. An "immunoglobulin" is an immunoglobulin that specifically binds to a particular antigen. It may be one of the globulin classes, e.g., human classes: IgG, IgM IgE, IgA, and IgD. Typically, intact antibodies are tetramers. Each tetramer is composed of two identical pairs of polypeptide chains, each of which is composed of one "light The N chain of each chain is 1. The terminus consists of about 100-110 or more amino acids that are primarily responsible for antigen recognition. The terms "variable light chain" (VL) and "variable heavy chain" (VH) refer to the respective Each variable region is further divided into hypervariable (H) and hypervariable (H) regions. The hypervariable region can be subdivided into a hypervariable (V) region and a framework (FR) region. , three hypervariable sequence regions called complementarity determining regions (CDR1, CDR2, and CDR3). The region comprises four framework regions (FR1, FR2, FR2, and FR4). The framework regions form a β-sheet structure and hold the HV regions in place. The C-terminus of each heavy and light chain is divided into two parts, the light chain (CL) and the carboxyl group (C-terminal) of each heavy and light chain. The constant region consists of one region and three regions for the heavy chain (CH1, CH2, and CH3). The light chains of immunoglobulins are further divided into kappa and lambda isotypes. can.

[0052] In some embodiments, the term "intact antibody" or "fully assembled antibody" refers to a naturally occurring Two heavy chains that may be linked by disulfide bonds, as occurs in antibodies produced in In some embodiments, the antibody of the present invention is used to refer to an antibody that contains one or more of a light chain and two light chains. The antibody is an antibody fragment.

[0053] In some embodiments, the present invention can be used to deliver "antibody fragments." As used herein, an "antibody fragment" refers to, for example, an antigen-binding region or a fragment thereof of an antibody. Examples of antibody fragments include Fab, Fab', F( ab')2, and Fv fragments; triabodies; tetrabodies; linear antibodies; single chain antibody molecules; and multispecific antibodies formed from antibody fragments. For example, antibody fragments include: An isolated fragment, an "Fv" fragment consisting of the variable regions of the heavy and light chains, A recombinant single-chain polypeptide molecule ("ScF") in which the domains are connected by a peptide linker Examples of such recognition units include the "antibody" ("antibody v protein") and the minimal recognition units consisting of amino acid residues similar to those in the hypervariable region. In many embodiments, an antibody fragment contains enough of the sequence of the parent antibody of the fragment. In some embodiments, the fragment binds to the same antigen as the parent antibody; It binds to the antigen with an affinity comparable to that of the parent antibody or Examples of antigen-binding fragments of antibodies include: Examples of the antibody include, but are not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, scFv fragments, Fv Fragments, dsFv diabodies, dAb fragments, Fd' fragments, Fd fragments, and isolated complementary Examples include the sex determining region (CDR) region.

[0054] The present invention relates to antibodies known in the art and produced against a desired antigen using standard methods. The present invention may be used to deliver antibodies that can be generated using monoclonal antibodies. antibodies, polyclonal antibodies, antibody mixtures or cocktails, human or humanized antibodies, chimeric antibodies The present invention may also be used to deliver antibodies to a host cell, such as a medicament for treating a disease.

[0055] Examples of antibodies include, but are not limited to, anti-chemokine (CC motif) ligands. 2 (CCL2), anti-lysyl oxidase-like-2 (LOXL2), anti-Flt-1, anti-TNF -α, anti-interleukin-2Rα receptor (CD25), anti-TGF β , anti-B cell activator Anti-alpha-4 integrin, anti-BAGE, anti-β-catenin / m, anti-Bcr-abl , anti-C5, anti-CA125, anti-CAMEL, anti-CAP-1, anti-CASP-8, anti-CD4, anti- CD19, anti-CD20, anti-CD22, anti-CD25, anti-CDC27 / m, anti-CD30, anti-C D33, anti-CD52, anti-CD56, anti-CD80, anti-CDK4 / m, anti-CEA, anti-CT, anti- CTL4, anti-Cyp-B, anti-DAM, anti-EGFR, anti-ErbB3, anti-ELF2M, anti-EM MPRIN, anti-EpCam, anti-ETV6-AML1, anti-HER2, anti-G250, anti-GAG E, anti-GnT-V, anti-Gp100, anti-HAGE, anti-HER-2 / neu, anti-HLA-A * 0201-R170I, anti-IGF-1R, anti-IL-2R, anti-IL-5, anti-MC1R, anti-mi Osin / m, anti-MUC1, anti-MUM-1, -2, -3, anti-proteinase-3, anti-p19 0 minor bcr-abl, anti-Pml / RARα, anti-PRAMS, anti-PSA, anti-PSM, Anti-PSMA, anti-RAGE, anti-RANKL, anti-RU1 or RU2, anti-SAGE, anti-SAR T-1 or anti-SART-3, anti-survivin, anti-TEL / AML1, anti-TPI / m, anti-T RP-1, anti-TRP-2, anti-TRP-2 / INT2, and anti-VEGF or anti-VEGF receptor The condition is mentioned.

[0056] mRNA encoding the heavy and light chains According to the present invention, antibodies (e.g., intact antibodies and antibody fragments) are capable of binding to exogenous factors in cells and in vivo. In particular, according to the present invention, The production of a fully assembled multichain antibody can be achieved by cloning exogenous mRNA encoding the heavy and light chains of the antibody. This can be achieved in a cell or in vivo by delivering In this embodiment, a tetramer containing two heavy chains and two light chains is produced.

[0057] As used herein, the term "heavy chain" refers to any of the different classes of immunoglobulins. The heavy chains include natural heavy chains of IgM (μ), IgD (δ), IgG (γ), IgA (α ), and IgE(ε), and biologically active variants thereof. Typically, the heavy chain of the present invention contains an N-terminal variable region responsible for antigen recognition, typically comprising 4 separated by four framework regions (FR1, FR2, FR2, and FR4), Typically, the N-terminal variable region comprises about 100 to about 200 amino acids. In some embodiments, the heavy chains of the invention contain 110 or more amino acids. Constant regions (e.g., C H 1. C H 2, and / or C H 3) Contains one or more of the following: In some embodiments, the mRNA encoding the heavy chain of the antibody is 0.3 kb in length, 0.5 kb in length, .5kb, 0.75kb, 1.0kb, 1.25kb, 1.5kb, 1.75kb, 2. 0kb, 2.5kb, 3.0kb, 3.5kb, 4.0kb, or more.

[0058] As used herein, the term "light chain" refers to any of the different classes of immunoglobulins. The present invention includes the native light chains of the present invention, e.g., kappa or lambda isotypes, and their biologically active variants. Typically, the light chain of the present invention comprises an N-terminal variable region ( V L In some embodiments, the light chains of the invention comprise a C-terminal constant region (C L ) In some embodiments, the mRNA encoding the light chain of the antibody is less than or equal to 0.1 kb in length. , 0.2kb, 0.3kb, 0.4kb, 0.5kb, 0.6kb, 0.7kb, 0.8 kb, 0.9kb, 1.0kb, 1.25kb, 1.5kb, 1.75kb, 2.0kb , 2.5 kb, or 3.0 kb, or more.

[0059] Typically, two heavy chains and two light chains encoded by the mRNA are disulfide-coupled. A tetrameric antibody containing 5'-dimers linked together by phosphoryl bridges.

[0060] According to the present invention, the heavy and light chains of the antibody are encoded by a single mRNA or multiple separate mRNAs. To optimize production of fully constructed functional antibodies, and delivering various ratios of mRNA encoding the heavy chain and mRNA encoding the light chain to the target cell. Thus, in some embodiments, the heavy chain may be encoded by The mRNA encoding the light chain (also called the first mRNA) and the mRNA encoding the light chain (also called the second mRNA) are A) is about 10:1 to 1:10 (for example, about 9:1 to 1:9, 8:1 to 1:8 , 7:1~1:7, 6:1~1:6, 5:1~1:5, 4:1~1:4, 3:1~1:3 In some embodiments, the heavy chain is delivered in a ratio ranging from 1:1 to 2:2 (or 2:1 to 1:2). The mRNA encoding the light chain (also called the first mRNA) and the mRNA encoding the light chain (also called the second mRNA) RNA) is approximately 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1 In some embodiments, the heavy chain is delivered in a ratio of 1:1, 3:1, 2:1, or 1:1 or greater. The mRNA encoding the light chain (also called the first mRNA) and the mRNA encoding the light chain (also called the second mRNA) The mRNA is delivered in a ratio of about 1:1 (i.e., equimolar). In an embodiment, an mRNA encoding a heavy chain (also referred to as a first mRNA) and an mRNA encoding a light chain are The mRNA (also referred to as the second mRNA) is delivered in a ratio other than 1:1 (equimolar ratio). For example, a heavy chain-encoding mRNA (also referred to as the first mRNA) and a light chain-encoding mRNA (also referred to as the second mRNA) are The RNA (also referred to as the second mRNA) is a nucleotide sequence having a ratio of greater than 1 (e.g., about 10:1 to 1:1, 9:1~1:1, 8:1~1:1, 7:1~1:1, 6:1~1:1, 5:1~1:1, The ratio is delivered in the range of 4:1 to 1:1, 3:1 to 1:1, or 2:1 to 1:1. Alternatively, a heavy chain-encoding mRNA (also referred to as the first mRNA) and a light chain-encoding mRNA The RNA (also referred to as the second mRNA) is smaller than 1 (e.g., about 1:1 to 1:10, 1:1~1:9, 1:1~1:8, 1:1~1:7, 1:1~1:6, 1:1~1:5, The ratio is delivered in the range of 1:1 to 1:4, 1:1 to 1:3, or 1:1 to 1:2.

[0061] Signal peptide In some embodiments, the mRNA encoding the heavy and / or light chains contains a signal peptide. As used herein, the term "signature" refers to a sequence of nucleotides that encodes a sequence that is Null peptides are present in newly synthesized proteins and are involved in transporting the protein through the secretory pathway. Typically, a signal peptide is a peptide that can direct a gene to an mRNA. Following translation, the protein is translocated into the endoplasmic reticulum and then cleaved. The signal peptide is a signal sequence A signal peptide is also called a leader sequence or a leader peptide. are short (e.g., 5–30, 5–25, 5–20, 5–15, or 5–10 amino acids) Signal peptides are peptides that are present at the N-terminus of newly synthesized proteins. Without wishing to be bound by any particular theory, A sequence encoding a signal peptide is inserted into the mRNA encoding the heavy chain and / or the light chain. The incorporation of the mRNA promotes the secretion and / or production of antibodies produced in vivo. It may be promoted.

[0062] Signal peptides suitable in the present invention are those derived from a variety of proteins, both eukaryotic and prokaryotic, in particular The heterologous sequence may be derived from a secreted protein. In some embodiments, a suitable The signal peptide is a leucine-rich sequence. amoto Y et al. (1989),Biochemistry,28:272 8-2732. A suitable signal peptide is the human growth hormone (hGH) , serum albumin preproprotein, Igκ light chain precursor, azurocidin preproprotein, cysta Chin S precursor, trypsinogen 2 precursor, potassium channel inhibitor, α-conotoxin lp1.3, α-conotoxin, α-galactosidase, cellulose, aspartic acid protease Roteinase nepenthesin-1, acid chitinase, K28 preprotoxin, killer toxin digoshi Exemplary signal peptides may be derived from zygocin precursors, and cholera toxin. The peptide sequence was reported by Kober, et al., Biotechnol. Bioeng., 11 0:1164-73, 2012, which is incorporated herein by reference. will be done.

[0063] In some embodiments, the mRNA encoding the heavy and / or light chains is derived from a human growth hormone A sequence encoding a signal peptide derived from human GH, or a fragment thereof A non-limiting nucleotide sequence encoding the hGH signal peptide may be incorporated. Shown below. 5' human growth hormone (hGH) sequence (SEQ ID NO:9): AUGGCCACUGGAUCAAGAACCUCACUGCUGCUCGCUUUUGGACUGCUUUGCCUGCCCUGGUUGCAAGAAGGAUCGGCUUU CCCGACCAUCCCACUCUCC Alternative 5' human growth hormone (hGH) sequence (SEQ ID NO:10): AUGGCAACUGGAUCAAGAACCUCCCUCCUGCUCGCAUUCGGCCUGCUCUGUCUCCCAUGGCUCCAAGAAGGAAGCGCGUU CCCCACUAUCCCCCUCUCG

[0064] In some embodiments, the mRNA according to the present invention has the sequence identical to SEQ ID NO:9 or SEQ ID NO:10. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 95%, 96%, 97%, 98%, 99% or more identity to the signaling sequence. The vector may also include a sequence encoding a polypeptide.

[0065] Synthesis of mRNA The mRNA according to the present invention may be synthesized by any of a variety of known methods. For example, In accordance with the present invention, mRNA may be synthesized by in vitro transcription (IVT). For example, IVT typically involves the synthesis of a linear or circular DNA template containing a promoter, a ribonucleic acid a pool of leutidine triphosphate, DTT and a buffer system which may contain magnesium ions. , a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase) , deoxyribonuclease I, pyrophosphatase, and / or ribonuclease inhibitors The exact conditions depend on the specific application.

[0066] In some embodiments, for the preparation of the mRNA of the invention encoding an antibody, DNA The template is transcribed in vitro. A suitable DNA template is typically a promoter for in vitro transcription. A promoter such as a T3, T7, or SP6 promoter followed by the desired antibody. The desired nucleotide sequence for the mRNA encoding (e.g., encoding a heavy or light chain) It has a sequence and a termination signal.

[0067] According to the present invention, an mRNA encoding a desired antibody (e.g., encoding a heavy or light chain) is The NA sequence may be determined and incorporated into the DNA template using standard methods. Starting from a desired amino acid sequence (e.g., a desired heavy or light chain sequence), Then, an optimization algorithm is used to select the appropriate codons. Typically, the G / C content is determined on the one hand to achieve as high a G / C content as possible. On the other hand, the frequency of tRNAs is optimized according to codon usage. The optimized RNA sequence can be determined and, for example, appropriately labeled. The instrument can be used to display and compare the sequence with the original (wild type) sequence. Analyzing the structure and calculating the RNA stabilizing and destabilizing properties or respective regions. It is also possible.

[0068] The mRNA of the present invention may be synthesized as unmodified or modified mRNA. RNA can be modified to improve its stability. In the case of mRNA modifications, e.g. Thus, the modified mRNA of the present invention can include modifications of the nucleotides of the RNA. In some embodiments, the antibody may include, for example, backbone modifications, sugar modifications, or base modifications. The mRNA encoding the polypeptide (e.g., mRNA encoding the heavy and light chains) can be, for example, The amino acids may include, but are not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thiol). nucleotide analogs or modified nucleotide analogs. Derivatives of purine and pyrimidine include, for example, 1-methyl-adenine, 2-methyl- -adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-Acetyl-cytosine, 5-Methyl-cytosine, 2,6-Diaminopurine, 1-Methyl -Guanine, 2-Methyl-guanine, 2,2-Dimethyl-guanine, 7-Methyl-guanine Inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro- Uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethy 5-fluoro-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-Methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-hydroxyacetone Acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2 -Thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil Uracil-5-oxyacetic acid methyl ester, Uracil-5-oxyacetic acid (v), 1- Methyl-pseudouracil, queuosine, β-D-mannosyl-queuosine (queos ine), wybutoxosine, and phosphoramidate ( phosphoramidate, phosphorothioate, peptide nucleotide, methyl Naturally occurring phosphonates such as 7-deazaguanosine, 5-methylcytosine, and inosine May be synthesized from nucleotides and / or nucleotide analogues (modified nucleotides) The preparation of such analogs is described, for example, in U.S. Pat. No. 4,373,071, U.S. Pat. 01,796, U.S. Patent No. 4,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707, U.S. Patent No. 4,668,777, U.S. Patent No. 4,9 No. 73,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Patent Nos. 5,153,319, 5,262,530, and 5,700 ,642, the disclosures of which are incorporated herein in their entirety by reference. is incorporated herein by reference.

[0069] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is The mRNA (which encodes the mRNA) may contain RNA backbone modifications. Typically, the backbone modifications are This is a modification in which the phosphate of the backbone of the nucleotide contained in A is chemically modified. Typically, Exemplary backbone modifications include, but are not limited to, methylphosphonates, methyl phosphatides, Sulfamidates, phosphoramidates, phosphorothioates (e.g., cytidine 5'- O-(1-thiophosphate), boranophosphate, positively charged guanidinium group, etc. This means that the phosphodiester bond can be linked to other anionic, cationic or neutral It means that the substituent is substituted by a group.

[0070] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is An mRNA (which is a nucleic acid sequence of an mRNA) may contain sugar modifications. Exemplary sugar modifications are those that modify the nucleobase that it contains. Chemical modifications of the sugars of tides, including but not limited to 2'-deoxy-2'-fluoro- Oligoribonucleotide (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2 '-Fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deoxyuridine Deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine) uridine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'- O-alkyl oligoribonucleotides, 2'-deoxy-2'-C-alkyl oligoribonucleotides Nucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'- triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-alkyl racitidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azidotriphosphate Acid (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxycytidine xylidine 5'-triphosphate).

[0071] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is The mRNA may contain modifications of the bases of the nucleotides (base modifications). The modified nucleotide containing the base is also called a base-modified nucleotide. Examples of nucleotides include, but are not limited to, 2-amino-6-chloropurine ribozyme. 2-Aminoadenosine 5'-triphosphate, 2-Thiocytidine 5'-triphosphate phosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-amino Allylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromo Cytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5' -triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-Methyluridine 5'-triphosphate, 6-Azacytidine 5'-triphosphate, 6-Azauridine 6-Chloropurine riboside 5'-triphosphate, 7-Deazaadenosine 5'-triphosphate '-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate Acid, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate , N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N 6-Methyladenosine 5'-triphosphate, O6-Methylguanosine 5'-triphosphate, Pseudomonas aeruginosa Douridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5' -triphosphate.

[0072] Typically, mRNA synthesis begins with the addition of a "cap" to the N-terminal (5') end and a C-terminal The presence of a cap is found in most eukaryotic cells. The presence of the "tail" is important in making the mRNA resistant to nucleases that are It acts to protect against xonuclease degradation.

[0073] Thus, in some embodiments, an mRNA encoding an antibody (e.g., a heavy chain The mRNA encoding the light chain (and the mRNA encoding the main chain) contains a 5' cap structure. The 5' cap is typically is added as follows: First, RNA terminal phosphatase adds one of the terminal phosphate groups to the 5' nucleotide, leaving two terminal phosphates; then guanosine triphosphate (GT P) is added to the terminal phosphate by guanylyltransferase, resulting in the 5'5'5 triphosphate The 7-nitrogen of guanine is then converted to methyl by methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')pp p(5'(A, G(5')ppp(5')A and G(5')ppp(5')G do.

[0074] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is The poly(A) tail at the 3' end of an mRNA contains a 3' poly(A) tail structure. Typically, about 10 to 300 adenosine nucleotides (e.g., about 10 to 200 adenosines) are adenosine nucleotides, about 10 to 175 adenosine nucleotides, about 10 to 150 adenosine nucleotides nucleotide, about 10 to 125 adenosine nucleotides, 10 to 100 adenosine nucleotides tide, about 10 to 75 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or or about 20 to 60 adenosine nucleotides). The mRNAs that are encoded by the heavy and light chains have 3' poly(C) tails. A suitable poly C tail on the 3' end of an mRNA typically contains about 10 to 200 sites. cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides The poly C tail is a poly A tail that contains about 10 to 40 cytosine nucleotides. It may be added to or may replace the polyA tail.

[0075] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is In some embodiments, the mRNA includes a 5' and / or a 3' untranslated region. 'The untranslated region contains one or more elements that affect mRNA stability or translation, e.g. For example, the 5' untranslated region comprises an iron responsive element. In some embodiments, the 5' untranslated region comprises about 50 to 500 amino acids. Length of nucleotides (e.g., length of about 50 to 400 nucleotides, length of about 50 to 300 nucleotides) The length of the nucleic acid fragment is about 50 to 200 nucleotides, or about 50 to 100 nucleotides. The length of the line may be 100 mm.

[0076] In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is The 5' region of the mRNA encoding the ribozyme may contain a sequence encoding a signal peptide, e.g., In certain embodiments, human growth hormone (hGH) (e.g., SEQ ID NO: A signal peptide derived from the nucleotide sequence of ... A sequence encoding a signal peptide (e.g., SEQ ID NO: 9, which encodes the hGH signal peptide) The sequence encoding the heavy or light chain is directly or indirectly linked at the N-terminus to the sequence encoding the heavy or light chain. can be.

[0077] Exemplary mRNAs Encoding Anti-CCL2 Heavy and Light Chains As a non-limiting example, mRNA encoding the heavy and light chains of an anti-CCL2 antibody is shown in Example 1. The sequence of the mRNA encoding the heavy chain is shown in Fig. 1 with and without the 5' and 3' UTRs. The mRNA encoding the light chain is shown below as SEQ ID NO:1 and SEQ ID NO:2, respectively. The sequences of NA are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, without and with 5' and 3' UTRs. Shown below as SEQ ID NO:4. Anti-CCL2 heavy chain (HC-αCCL2) mRNA without 5' and 3' UTR (SEQ ID NO: 1) : AUGGAAUUCGGCCUGAGCUGGCUGUUCCUGGUGGCCAUCCUGAAGGGCGUGCAGUGCCAGGUCCAGCUGGUGCAGUCUGG CGCCGAAGUGAAGAAACCCGGCUCCUCCGUGAAGGUGUCCUGCAAGGCCUCCGGCGGCACCUUCUCCAGCUACGGCAUCU CCUGGGUCCGACAGGCCCCAGGCCAGGGCCUGGAAUGGAUGGGCGGCAUCAUCCCCAUCUUCGGCACCGCCAACUACGCC CAGAAAUUCCAGGGCAGAGUGACCAUCACCGCCGACGAGUCCACCUCCACCGCCUACAUGGAACUGUCCUCCCUGCGGAG CGAGGACACCGCCGUGUACUACUGCGCCAGAUACGACGGCAUCUACGGCGAGCUGGACUUCUGGGGCCAGGGCACCCUGG UCACCGUGUCCUCUGCCAAGACCACCCCCCCCUCCGUGUACCCUCUGGCCCCUGGCUCUGCCGCCCAGACCAACUCUAUG GUCACCCUGGGCUGCCUGGUCAAGGGCUACUUCCCCGAGCCCGUGACCGUGACCUGGAACUCCGGCUCCCUGUCCUCCGG CGUGCACACCUUCCCUGCCGUGCUGCAGUCCGACCUCUACACCCUGUCCAGCAGCGUGACCGUGCCCUCCUCCACCUGGC CCUCCGAGACAGUGACCUGCAACGUGGCCCACCCCGCCUCCAGCACCAAGGUGGACAAGAAAAUCGUGCCCCGGGACUGC GGCUGCAAGCCCUGCAUCUGUACCGUGCCCGAGGUGUCCUCCGUGUUCAUCUUCCCACCCAAGCCCAAGGACGUGCUGAC CAUCACACUGACCCCCAAAGUGACCUGCGUGGUGGUGGACAUCUCCAAGGACGACCCCGAGGUGCAGUUCAGUUGGUUCG UGGACGACGUGGAAGUGCACACCGCUCAGACCCAGCCCAGAGAGGAACAGUUCAACUCCACCUUCAGAUCCGUGUCCGAG CUGCCCAUCAUGCACCAGGACUGGCUGAACGGCAAAGAAUUCAAGUGCAGAGUGAACUCCGCCGCCUUCCCAGCCCCCAU CGAAAAGACCAUCUCCAAGACCAAGGGCAGACCCAAGGCCCCCCAGGUCUACACCAUCCCCCCACCCAAAGAACAGAUGG CCAAGGACAAGGUGUCCCUGACCUGCAUGAUCACCGAUUUCUUCCCAGAGGACAUCACCGUGGAAUGGCAGUGGAACGGC CAGCCCGCCGAGAACUACAAGAACACCCAGCCCAUCAUGGACACCGACGGCUCCUACUUCGUGUACUCCAAGCUGAACGU GCAGAAGUCCAACUGGGAGGCCGGCAACACCUUCACCUGUAGCGUGCUGCACGAGGGCCUGCACAACCACCACACCGAGA AGUCCCUGUCCCACUCCCCCGGCAAGUGA Anti-CCL2 heavy chain (HC-αCCL2) mRNA with 5’ and 3’ UTRs (SEQ ID NO: 2) : (The sequences of the 5’ and 3’ UTRs are underlined) GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCG GGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG AUGGAAUUCGGCCUGAGCUG GCUGUUCCUGGUGGCCAUCCUGAAGGGCGUGCAGUGCCAGGUCCAGCUGGUGCAGUCUGGCGCCGAAGUGAAGAAACCCG GCUCCUCCGUGAAGGUGUCCUGCAAGGCCUCCGGCGGCACCUUCUCCAGCUACGGCAUCUCCUGGGUCCGACAGGCCCCA GGCCAGGGCCUGGAAUGGAUGGGCGGCAUCAUCCCCAUCUUCGGCACCGCCAACUACGCCCAGAAAUUCCAGGGCAGAGU GACCAUCACCGCCGACGAGUCCACCUCCACCGCCUACAUGGAACUGUCCUCCCUGCGGAGCGAGGACACCGCCGUGUACU ACUGCGCCAGAUACGACGGCAUCUACGGCGAGCUGGACUUCUGGGGCCAGGGCACCCUGGUCACCGUGUCCUCUGCCAAG ACCACCCCCCCCUCCGUGUACCCUCUGGCCCCUGGCUCUGCCGCCCAGACCAACUCUAUGGUCACCCUGGGCUGCCUGGU CAAGGGCUACUUCCCCGAGCCCGUGACCGUGACCUGGAACUCCGGCUCCCUGUCCUCCGGCGUGCACACCUUCCCUGCCG UGCUGCAGUCCGACCUCUACACCCUGUCCAGCAGCGUGACCGUGCCCUCCUCCACCUGGCCCUCCGAGACAGUGACCUGC AACGUGGCCCACCCCGCCUCCAGCACCAAGGUGGACAAGAAAAUCGUGCCCCGGGACUGCGGCUGCAAGCCCUGCAUCUG UACCGUGCCCGAGGUGUCCUCCGUGUUCAUCUUCCCACCCAAGCCCAAGGACGUGCUGACCAUCACACUGACCCCCAAAG UGACCUGCGUGGUGGUGGACAUCUCCAAGGACGACCCCGAGGUGCAGUUCAGUUGGUUCGUGGACGACGUGGAAGUGCAC ACCGCUCAGACCCAGCCCAGAGAGGAACAGUUCAACUCCACCUUCAGAUCCGUGUCCGAGCUGCCCAUCAUGCACCAGGA CUGGCUGAACGGCAAAGAAUUCAAGUGCAGAGUGAACUCCGCCGCCUUCCCAGCCCCCAUCGAAAAGACCAUCUCCAAGA CCAAGGGCAGACCCAAGGCCCCCCAGGUCUACACCAUCCCCCCACCCAAAGAACAGAUGGCCAAGGACAAGGUGUCCCUG ACCUGCAUGAUCACCGAUUUCUUCCCAGAGGACAUCACCGUGGAAUGGCAGUGGAACGGCCAGCCCGCCGAGAACUACAA GAACACCCAGCCCAUCAUGGACACCGACGGCUCCUACUUCGUGUACUCCAAGCUGAACGUGCAGAAGUCCAACUGGGAGG CCGGCAACACCUUCACCUGUAGCGUGCUGCACGAGGGCCUGCACAACCACCACACCGAGAAGUCCCUGUCCCACUCCCCC GGCAAGUGA CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCA GCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU Anti-CCL2 light chain (LC-αCCL2) mRNA without 5’ and 3’ UTR (SEQ ID NO: 3) : AUGGAAACCCCUGCCCAGCUGCUGUUCCUGCUGCUGCUGUGGCUGCCUGAUACCACCGGCGAAAUCGUGCUGACCCAGUC CCCCGCCACCCUGUCUCUGAGCCCUGGCGAGAGAGCCACCCUGAGCUGCAGAGCCUCCCAGUCCGUGUCCGACGCCUACC UGGCCUGGUAUCAGCAGAAGCCCGGCCAGGCCCCUCGGCUGCUGAUCUACGACGCCUCCUCUAGAGCCACCGGCGUGCCC GCCAGAUUCUCCGGCUCUGGCUCUGGCACCGACUUCACCCUGACCAUCUCCAGCCUGGAACCCGAGGACUUCGCCGUGUA CUACUGCCACCAGUACAUCCAGCUGCACAGCUUCACCUUCGGCCAGGGCACCAAGGUGGAAAUCAAGGCCGAUGCCGCCC CUACCGUGUCCAUCUUCCCACCCUCCAGCGAGCAGCUGACCUCUGGCGGCGCUUCCGUCGUGUGCUUCCUGAACAACUUC UACCCCAAGGACAUCAACGUGAAGUGGAAGAUCGACGGCUCCGAGCGGCAGAACGGCGUGCUGAACUCCUGGACCGACCA GGACUCCAAGGACAGCACCUACUCCAUGUCCUCCACCCUGACCCUGACCAAGGACGAGUACGAGCGGCACAACUCCUAUA CCUGCGAGGCCACCCACAAGACCUCCACCUCCCCCAUCGUGAAGUCCUUCAACCGGAACGAGUGCUGA Anti-CCL2 light chain (LC-αCCL2) mRNA with 5’ and 3’ UTRs (SEQ ID NO: 4) : (The sequences of the 5’ and 3’ UTRs are underlined) GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCG GGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG AUGGAAACCCCUGCCCAGCU GCUGUUCCUGCUGCUGCUGUGGCUGCCUGAUACCACCGGCGAAAUCGUGCUGACCCAGUCCCCCGCCACCCUGUCUCUGA GCCCUGGCGAGAGAGCCACCCUGAGCUGCAGAGCCUCCCAGUCCGUGUCCGACGCCUACCUGGCCUGGUAUCAGCAGAAG CCCGGCCAGGCCCCUCGGCUGCUGAUCUACGACGCCUCCUCUAGAGCCACCGGCGUGCCCGCCAGAUUCUCCGGCUCUGG CUCUGGCACCGACUUCACCCUGACCAUCUCCAGCCUGGAACCCGAGGACUUCGCCGUGUACUACUGCCACCAGUACAUCC AGCUGCACAGCUUCACCUUCGGCCAGGGCACCAAGGUGGAAAUCAAGGCCGAUGCCGCCCCUACCGUGUCCAUCUUCCCA CCCUCCAGCGAGCAGCUGACCUCUCUGGCGGCGCUUCCGUGUGUGCUUCCUGAACAACUUCUACCCCAAGGACAUCAACGU GAAGUGGAAGAUCGACGGCUCCGAGCGGCAGAACGGCGUGCUGAACUCCUGGACCGACCAGGACUCCAAGGACAGCACCU ACUCCAUGUCCUCCACCCUGACCCUGACCAAGGACGAGUACGAGCGGCACAACUCCUAUACCUGCGAGGCCACCCACAAG ACCUCCACCUCCCCCAUGCGUGAAGUCCUUCAACCGGAACGAGUGCUGA CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGC CUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU

[0078] In particular, the present invention also provides anti-CC antibodies substantially identical or similar to the sequences described herein. The present invention provides mRNA encoding the heavy and light chains of the L2 antibody. The mRNA encoding the heavy chain of the CCL2 antibody is represented by SEQ ID NO: 1 or SEQ ID NO: No. 2 and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% In some embodiments, the anti-C The mRNA encoding the heavy chain of the CL2 antibody has at least one sequence identical to SEQ ID NO:1 described herein. 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher Some embodiments have nucleotide sequences that code for identical or homologous amino acid sequences. In embodiments, the mRNA encoding the light chain of the anti-CCL2 antibody is selected from the group consisting of SEQ ID NO: 3 or SEQ ID NO: 4 and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical nucleotide sequence. In one embodiment, the mRNA encoding the light chain of the anti-CCL2 antibody is represented by SEQ ID NO:3 as described herein. and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 9 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or or more, have a nucleotide sequence encoding an amino acid sequence identical or homologous thereto. .

[0079] In some embodiments, the mRNA provided herein comprises one or more modified nucleic acids. In some embodiments, the antibody comprises an anti-C The mRNA encoding the heavy and light chains of the CL2 antibody contains all of the modifiable nucleotides of the sequence. At least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 8 0%, at least 85%, at least 90%, or at least 95% modified nucleotides. It may also contain . Exemplary mRNAs Encoding Anti-VEGF Heavy and Light Chains Anti-VEGF heavy chain (HC-αVEGF) mRNA without 5' and 3' UTR (SEQ ID NO:5) : AUGGCAACUGGAUCAAGAACCUCCCUCCUGCUCGCAUUCGGCCUGCUCUGUCUCCCAUGGCUCCAAGAAGGAAGCGCGUU CCCCACUAUCCCCCUCUCGGAGGUUCAGCUGGUCGAAAGCGGGGGCGGCCUCGUCCAGCCAGGUGGAUCCCUCCGCCUGA GCUGCGCCGCGUCCGGAUACACUUUCACCAACUACGGCAUGAACUGGGUCCGCCAGGCGCCGGGAAAGGGACUGGAAUGG GUCGGCUGGAUCAAUACCUACACUGGAGAGCCUACCUACGCCGCUGACUUUAAGAGGCGGUUCACUUUCUCACUGGAUAC UUCCAAGUCAACCGCUUACCUUCAGAUGAAUUCCCUGCGCGCCGAGGAUACCGCAGUGUAUUACUGCGCCAAAUACCCGC AUUACUACGGCUCCAGCCACUGGUACUUUGACGUGUGGGGUCAAGGAACCCUGGUGACUGUGUCGUCCGCUUCCACCAAG GGACCAAGCGUGUUUCCACUCGCCCCGAGCUCAAAAUCGACGUCGGGAGGUACUGCCGCACUGGGGUGCUUGGUCAAGGA CUACUUUCCAGAGCCGGUGACUGUUUCCUGGAACAGCGGAGCGCUCACCUCGGGCGUGCACACCUUCCCUGCGGUGUUGC AGUCAUCUGGACUGUACUCGCUGUCCAGCGUGGUCACGGUCCCGAGCUCGUCGCUCGGGACCCAAACCUACAUUUGCAAU GUCAACCACAAGCCAUCGAACACCAAAGUCGACAAGAAGGUGGAACCGAAGUCGUGCGACAAGACUCAUACGUGCCCACC GUGUCCGGCUCCGGAACUGUUGGGGGGCCCCUCCGUGUUCCUUUUCCCGCCAAAGCCUAAGGACACUCUCAUGAUCUCAC GGACGCCAGAAGUGACCUGUGUGGUCGUGGAUGUGUCACAUGAGGAUCCGGAAGUCAAAUUCAACUGGUAUGUGGACGGG GUGGAAGUGCAUAAUGCCAAAACCAAACCUCGCGAGGAGCAGUACAACUCAACCUACCGGGUGGUGUCCGUGCUGACUGU GCUGCACCAGGACUGGCUGAAUGGAAAGGAGUACAAAUGCAAGGUCAGCAACAAGGCCCUUCCCGCCCCAAUCGAAAAGA CGAUCUCGAAGGCCAAAGGUCAGCCGCGAGAGCCUCAAGUGUACACUCUGCCGCCGUCAAGAGAAGAAAUGACUAAGAAC CAAGUUUCCCUCACUUGCCUGGUGAAGGGCUUCUACCCCAGCGACAUCGCAGUGGAAUGGGAGAGCAACGGACAGCCGGA AAACAACUAUAAGACCACCCCUCCUGUGUUGGACUCGGAUGGUUCCUUCUUCCUUUACAGCAAGCUGACCGUGGAUAAAU CGCGGUGGCAGCAAGGAAAUGUGUUUUCAUGCUCAGUCAUGCACGAGGCGCUGCACAAUCACCUACACUCAGAAGUCCCUG UCGCUGUCGCCAGGAAAAUAA Anti-VEGF heavy chain (HC-αVEGF) mRNA with 5' and 3' UTR (SEQ ID NO:6) : (5' and 3' UTR sequences are underlined, signal peptide sequence is in italics and bold) It is.) [ka] Anti-VEGF light chain (HC-αVEGF) mRNA without 5' and 3' UTR (SEQ ID NO: 7) : AUGGCCACUGGAUCAAGAACCUCACUGCUGCUCGCUUUUGGACUGCUUUGCCUGCCCUGGUUGCAAGAAGGAUCGGCUUU CCCGACCAUCCCACUCUCCGACAUUCAAAUGACGCAGUCCCCAUCGAGCCUCUCAGCAUCAGUGGGGGAUCGCGUGACUA UCACUUGCUCGGCGAGCCAGGAUAUCAGCAAUUACCUGAACUGGUAUCAGCAAAGCCUGGGAAAGGCACCGAAGGUGCUG AUCUACUUCACCUCAAGCCUCCAUUCGGUGUCCCGUCCCGCUUCAGCGGCUCCGGCUCAGGCACUGACUUCACCCUGAC UAUCUCCUCGCUGCAACCGGAAGAUUUCGCCACUUACUACUGUCAGCAGUACUCCACCGUGCCUUGGACGUUCGGACAGG GAACCAAAGUUGAGAUUAAGCGGACGUCGCGGCCCCCUCCGUGUUUAUCUUUCCGCCUUCGGACGAGCAGCUGAAGUCG GGAACCGCCUCUGUCGUGUGCCUCCUGAACAACUUCUACCCGCGGGAAGCCAAGGUGCAGUGGAAAGUGGAUAACGCGCU UCAGAGCGGCAAUUCGCAAGAGUCCUGACCGAAGAGGACUCGAAGGACUCAACCUACUCCCUCAGCUCAACCCUCACUU UGUCGAAGGCCGACUACGAGAAGCACAAAGUCUACGCAUGCGAAGUCACCCACCAGGGUCUGUCGAGCCCAGUGACUAAA UCCUUCAAUAGGGGGGAAUGUUAA Anti-VEGF light chain (HC-αVEGF) mRNA with 5' and 3' UTR (SEQ ID NO: 8) : (5' and 3' UTR sequences are underlined, signal peptide sequence is in italics and bold) It is.) [ka]

[0080] The present invention also relates to, inter alia, anti-VEGF antibodies substantially identical or similar to the sequences described herein. mRNA encoding the heavy and light chains of the GF antibody is provided. In some embodiments, the antibody The mRNA encoding the heavy chain of the VEGF antibody is represented by SEQ ID NO:5 or SEQ ID NO:6 as described herein. No. 6 and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% In some embodiments, the anti-V The mRNA encoding the heavy chain of the EGF antibody has at least one sequence identical to SEQ ID NO:5 described herein. 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher Some embodiments have nucleotide sequences that code for identical or homologous amino acid sequences. In embodiments, the mRNA encoding the light chain of the anti-VEGF antibody is selected from the group consisting of SEQ ID NO: 7 or SEQ ID NO: 8 and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical nucleotide sequence. In one embodiment, the mRNA encoding the light chain of the anti-VEGF antibody is SEQ ID NO:7 as described herein. and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 9 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or or more, have a nucleotide sequence encoding an amino acid sequence identical or homologous thereto. .

[0081] In some embodiments, the mRNA provided herein comprises one or more modified nucleic acids. In some embodiments, the antibody comprises an anti-V The mRNA encoding the heavy and light chains of the EGF antibody contains all of the modifiable nucleotides of the sequence. At least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 8 0%, at least 85%, at least 90%, or at least 95% modified nucleotides. It may also contain .

[0082] As used herein, the term "identity" refers to the degree of identity between polymer molecules, e.g., between nucleic acid molecules. (e.g., DNA molecules and / or RNA molecules), and / or polypeptide molecules. Calculation of percent identity of two nucleic acid sequences refers to the relative relatedness of the two sequences, e.g., for optimal comparison. This can be done by aligning two sequences to find the optimal alignment (e.g., Gaps may be introduced into one or both of the first and second nucleic acid sequences for comparison purposes. (For purposes of comparison, non-identical sequences may be ignored.) In certain embodiments, The length of the aligned sequences for the target should be at least 30% of the length of the reference sequence, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100%. , and compare the nucleotides at corresponding nucleotide positions. If the corresponding position in sequence 2 is occupied by the same nucleotide, then the molecule The percent identity of two sequences is the number of identical positions they share. is a function of the number of gaps that need to be introduced for optimal alignment of two sequences. It takes into account the number and length of each gap. It compares the sequences and the percent identity between two sequences. The determination of the sequence can be performed using a mathematical algorithm. For example, The percent identity between the sequences was calculated using the Meyers and Miller algorithm ( BIOS, 1989, 4:11-17), which is 20 weight residue tables, 12 gap length penalties A gap length penalty of 4 ( The gap penalty was incorporated into the ALIGN program (version 2.0). Alternatively, the percent identity between two nucleotide sequences is calculated using the NWSga The GAP program in the GCG software package using the pdna.CMP matrix The determination can be made using the ram.

[0083] Delivery Vehicle In accordance with the present invention, mRNA (e.g., heavy and light chains) encoding the antibodies described herein are The mRNA encoding the marker is delivered either as naked RNA (unpackaged) or in a delivery vehicle. As used herein, the terms "delivery vehicle," "transfer vehicle," and Grammatical equivalents are used interchangeably.

[0084] In some embodiments, the mRNA encoding the heavy and light chains of the antibody are expressed by a single delivery vector. In some embodiments, the antibody may be delivered by a vehicle encoding the heavy and light chains of the antibody. The mRNAs may be delivered by separate delivery vehicles. For example, the heavy and light chains of an antibody may be delivered by separate delivery vehicles. The mRNA encoding the heavy chain of the antibody may be packaged separately and delivered simultaneously. The mRNA encoding the light chain and the mRNA encoding the light chain may be packaged separately and delivered sequentially.

[0085] According to various embodiments, suitable delivery vehicles include, but are not limited to, polyethylene glycol. Polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes Liposomes, ceramide-containing nanoliposomes, proteoliposomes, both natural and synthetically derived exosomes Chromosomes, natural, synthetic and semi-synthetic layered bodies, nanoparticles, calcium silicate phosphor nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly (D-arginine), sol-gel, nano-dendrimers, starch-based delivery systems, micelles, emulsions, Niosomes, multi-domain block polymers (vinyl polymers, polypropyl acrylate polymers -, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleases These include optides, aptamers, peptides, and other vector tags.

[0086] Liposomal Delivery Vehicles In some embodiments, a suitable delivery vehicle is a liposomal delivery vehicle, e.g., a lipid As used herein, liposomal delivery vehicles, e.g., lipid nanoparticles. Nanoparticles usually have an internal moisture content separated from the external medium by one or more bilayer membranes. Liposomes are considered to be tiny vesicles with spaces between them. The bilayer membrane of a liposome is typically Amphiphilic molecules, such as synthetic or naturally occurring lipids, contain hydrophilic and hydrophobic regions. (Lasic, Trends Biotechnol., 16:307-3 21, 1998). The liposome bilayer membrane is made of amphoteric polymers and surfactants (e.g., It can also be formed by polymerosomes, niosomes, etc. In the context of the present invention, the liposomal delivery vehicle typically contains a desired mRNA. A serves to transport the desired mRNA into the liposome. The process is often referred to as "insertion." An exemplary method is described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated by reference. The nucleic acid incorporated in the liposome is located within the interior space of the liposome. liposomes, whether embedded or located completely or partially within the bilayer membrane of the liposome. The incorporation of nucleic acids into liposomes is referred to herein as Also referred to as "encapsulation," this means that the nucleic acid is entirely contained within the interior space of the liposome. The purpose of incorporating mRNA into a transfer vehicle, such as a liposome, is often to transfer the nucleic acid Enzymes or chemicals that degrade and / or induce rapid excretion of nucleic acids The purpose of the ELISA is to protect the nucleic acid from the environment that may contain the receptor. In some embodiments, a suitable delivery vehicle may enhance the stability of the mRNA contained therein and facilitate targeting. This can facilitate delivery of mRNA to target cells or tissues.

[0087] In some embodiments, a suitable delivery vehicle is formulated as a lipid nanoparticle. As used herein, the term "lipid nanoparticle" refers to a nanoparticle that is a mixture of one or more lipids (e.g., lipid nanoparticles). These lipids include cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids. The lipid nanoparticles of interest refer to a delivery vehicle that contains one or more cationic lipids, non-cationic lipids, Multicomponent lipids with various ratios using thioic lipids, cholesterol-based lipids, and PEG-modified lipids Examples of suitable lipids include, for example, phosphatidylcholinesterase (PPS), ... Sphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, Sphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides , and gangliosides).

[0088] In certain embodiments of the invention, the carrier is a polymeric carrier, either alone or in combination with other carriers. Suitable polymers include, for example, polyacrylates, polyvinyl chlorides, polyisocyanates ... Polyalkycyanoacrylate, polylactic acid Acid, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin gelatin, alginate, collagen, chitosan, cyclodextrin, protamine , PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it is a branched polysaccharide with a molecular weight in the range of 10-40 kDA. EI may be, for example, 25 kDa branched PEI (Sigma #408727).

[0089] In some embodiments, a suitable delivery vehicle contains a cationic lipid. As used, the term "cationic lipid" refers to a lipid that has a net positive cationic group at a selected pH, such as physiological pH. Cationic lipids refer to any of a number of lipid species that bear an electrical charge. Several cationic lipids are described in the literature. Particularly suitable for use in the compositions and methods of the invention Suitable cationic lipids include those described in International Patent Publication WO2010 / 053572 (and in particular CI2-200 described in

[0225] and WO2012 / 170930 and the like, both of which are incorporated herein by reference. The compositions and methods of the present invention include, for example, (15Z,18Z)-N,N-dimethyl-6- (9Z,12Z)-Octadeca-9,12-dien-1-yl)tetracosa-15,18 -Dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6 -((9Z,12Z)-Octadeca-9,12-dien-1-yl)tetracosa-4,1 5,18-triene-l-amine (HGT5001) and (15Z,18Z)-N,N -Dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetradecanoate Lacosa-5,15,18-trien-1-amine (HGT5002), etc., March 2012 No. 61 / 617,468, filed on the 29th, which is incorporated herein by reference. The lipid nanoparticles used herein include ionizable cationic lipids as described in

[0090] In some embodiments, the cationic lipid N-[1-(2,3-dioleyloxy)propane] propyl]-N,N,N-trimethylammonium chloride or "DOTMA" is used (Feigner et al.(Proc.Nat'l Acad.Sci.84,7 413 (1987); U.S. Patent No. 4,897,355). DOTMA is formulated alone. or a neutral lipid, dioleoylphosphatidyl-ethanolamine, or "DOPE"; or in combination with other cationic or non-cationic lipids to form liposomal transfer vehicles. The liposomes can be formulated into pharmaceutical agents or lipid nanoparticles, and such liposomes can be used to deliver nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-cal Boxyspermylglycine dioctadecylamide or "DOGS", 2,3-dioleyl Oxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1- Propanaminium, or "DOSPA" (Behr et al. Proc. Nat. Acad. Sci. 86, 6982 (1989); U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium -Propane or "DODAP", 1,2-dioleoyl-3-trimethylammonium- Cationic lipids of interest also include 1, 2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA"; 1,2-Dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA" 1,2-Dilinoleyloxy-N,N-dimethyl-3-aminopropane, i.e., "DLin DMA, 1,2-diaminolinyloxy-N,N-dimethyl-3-aminopropane, i.e. DLenDMA, N-dioleyl-N,N-dimethylammonium chloride, or DODA C”, N,N-distearyl-N,N-dimethylammonium bromide, or “DDAB”, N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydride Dimethylamino-2-(cholest- 5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-oxy) 2-[5'-(cholest-5 -en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-( cis,cis-9',1-2'-octadecadienoxy)propane, i.e. CpLinDM A, N,N-Dimethyl-3,4-dioleyloxybenzylamine, or DMOBA 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane, i.e. "DOc arbDAP, 2,3-dilinoleoyloxy-N,N-dimethylpropylamine, i.e. "DLinDAP", 1,2-N,N'-dilinoleylcarbamyl-3-dimethylamino Propane or "DLincarbDAP", 1,2-dilinoleoylcarbamyl-3-di Methylaminopropane or "DLinCDAP", 2,2-Dilinoleyl-4-dimethyl Aminomethyl-[1,3]-dioxolane or "DLin-DMA", 2,2-dilinol Leyl-4-dimethylaminoethyl-[1,3]-dioxolane, or "DLin-KX TC2-DMA" and 2-(2,2-di((9Z,12Z)-octadeca-9,12- Dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethaneamine (DLin-KC2-DMA))(WO2010 / 042877;Semple et See, e.g., Nature Biotech. 28:172-176 (2010). (Heyes, J., et al., J Co. ntrolled Release 107:276-287(2005);Morri ssey,DV.,et al.,Nat.Biotechnol.23(8):100 3-1007(2005); PCT Publication WO2005 / 121348A1).

[0091] In some embodiments, the one or more cationic lipids present in such compositions are , imidazole, dialkylamino, or guanidinium moieties.

[0092] In some embodiments, the one or more cationic lipids present in such compositions are , XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxola MC3 (((6Z,9Z,28Z,31Z)-Heptatriaconta-6,9,28 ,31-Tetraen-19-yl 4-(dimethylamino)butanoate),ALNY-1 00((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)- Octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3 ]dioxol-5-amine), NC98-5 (4,7,13-tris(3-oxo-3 -(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13 -Tetraazahexadecane-1,16-diamide, DODAP (1,2-dioleyl- 3-Dimethylammoniumpropane), HGT4003 (WO2012 / 170889, The teachings of this document are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), H.G. T5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety). or HGT5001 (cis or trans) (provisional patent application Ser. No. 2002 / 0136662, which is incorporated herein by reference). Patent Application No. 61 / 617,468, and those disclosed in WO2010 / 053572, etc. Amino alcohol lipidoid, DOTAP (1,2-dioleyl-3-trimethylammonium niumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylan moniumpropane), DLinDMA (Heyes, J.; Palmer, L.; Bre mner, K.; MacLachlan, I. “Cationic lipid sat uration influences intracellular delivery y of encapsulated nucleic acids”J.Contr. Rel.2005,107,276-287), DLin-KC2-DMA(Sempl e,SCet al. “Rational Design of Cationic Lipids for siRNA Delivery”Nature Biotec h.2010,28,172-176), C12-200(Love,KTet a l. “Lipid-like materials for low-dose in “vivo gene silencing”PNAS 2010,107,1864-1 869) are selected.

[0093] In some embodiments, the one or more cationic lipids present in such compositions are , WO2013063468, and U.S. Provisional Application No. 61 / 8 filed on October 22, 2013. Issue 94,299 “Lipid Formulations for Delivery” of Messenger RNA, both of which are incorporated herein by reference. In some embodiments, the cationic lipid is represented by formula Ic 1-a: [ka] or a pharma- ceutically acceptable salt thereof, In the formula, each R 2 are independently hydrogen or C 1~3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1~3 is alkyl; Each R L is independently C 8~12 It is an alkyl.

[0094] In some embodiments, each R 2 are independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. is each R 2 is hydrogen.

[0095] In some embodiments, each q is independently 3 to 6. q is independently 3 to 5. In some embodiments, each q is 4.

[0096] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. wherein each R' is independently hydrogen.

[0097] In some embodiments, each R L is independently C 8~12 It is an alkyl group. In the embodiment, each R L are independent of nC 8~12 In some embodiments, , each R L is independently C9~11 In some embodiments, each R L is independent nC 9~11 In some embodiments, each R L is independently C 10 In some embodiments, each R L are independent of nC 10 Alkyl .

[0098] In some embodiments, each R 2 is independently hydrogen or methyl; each q is independently 3 to 5; R' is independently hydrogen or methyl; each R L is independently C 8~12 a It's Rukiru.

[0099] In some embodiments, each R 2 is hydrogen; each q is independently 3 to 5; each R' is hydrogen; each R L is independently C 8~12 It is an alkyl.

[0100] In some embodiments, each R 2 is hydrogen, each q is 4; each R' is hydrogen , each R L is independently C 8~12 It is an alkyl.

[0101] In some embodiments, the cationic lipid has formula Ig: [ka] or a pharma- ceutical acceptable salt thereof, wherein each R L is independently C 8~12 a In some embodiments, each R L are independent of nC 8~12 Alkyl In some embodiments, each R L is independently C 9~11 It is an alkyl group. In an embodiment, each R L are independent of nC 9~11 In some embodiments, is each R L is independently C 10 In some embodiments, each R L nC 10 It is an alkyl.

[0102] In certain embodiments, the compositions provided include cationic lipid cKK-E12, or or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine The structure of cKK-E12 is shown below. TIFF0007607694000005.tif6697

[0103] In some embodiments, a suitable delivery vehicle comprises one or more non-cationic lipids. In some embodiments, the non-cationic lipid is a neutral lipid, i.e., the composition contains Exemplary such lipids are lipids that carry no net charge under the conditions in which they are synthesized and / or administered. The non-cationic or neutral lipid is DSPC (1,2-distearoyl-sn-glycero- 3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phospho Choline), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine) DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine) DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac -glycerol), and cholesterol.

[0104] The use of cholesterol-based cationic lipids is also contemplated by the present invention. The cationic lipids of the roll system can be used alone or in combination with other cationic or non-cationic lipids. It may also be used in combination with lipids. Suitable cholesterol-based cationic lipids Examples of such compounds include DC-Choi (N,N-dimethyl-N-ethylcarboxamide copolymers). esterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Ga o,et al.Biochem.Biophys.Res.Comm.179,280 (1991);Wolf et al.BioTechniques23,139(19 97); U.S. Patent No. 5,744,335), or ICE.

[0105] In other embodiments, suitable lipid nanoparticles are disclosed in U.S. Provisional Application No. 61 / 494,745. one or more cleavable disulfide (SS) functional groups, as described in Cationic lipids or compounds (e.g., HGT4001, HGT4002, HGT4 HGT4003, HGT4004, and HGT4005) No. 6,399,633, the teachings of which are incorporated herein by reference in their entirety.

[0106] In addition, several reagents that can improve transfection efficiency are commercially available. A good example is LIPOFECTIN(DOTMA:DOPE)(In vitrogen, Carlsbad, Calif.), LIPOFECTA INE( DOSPA:DOPE) (Invitrogen), LIPOFECTAMINE200 0.(Invitrogen), FUGENE, TRANSFECTAM(DOGS), and EFFECTENE.

[0107] In some embodiments, the cationic lipid is present in the transfer vehicle in a molar ratio of 1:1 to the total lipid present in the transfer vehicle. Approximately 1% to 90%, approximately 2% to 70%, approximately 5% to 50%, approximately 10% to 40%, or Preferably, the lipid composition may comprise from about 20% to about 70% of the total lipids present in the transfer vehicle.

[0108] The use of polyethylene glycol (PEG)-modified phospholipids, e.g., N-octyl phospholipids, Tanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2 000] (C8PEG-2000 ceramide) and other derivatized ceramides (PEG-CER) The present invention also contemplates the use of derivatized lipids, either alone or preferably as a transfer excipient ( For example, in combination with other lipids, including lipid nanoparticles. The lipids that can be used include, but are not limited to, those having a length of C 6~20 Covalently bonded to lipids via alkyl chains The addition of such components includes polyethylene glycol chains up to 5 kDa in length. may prevent complex aggregation, and may also extend circulatory life and facilitate delivery of lipid-nucleic acid complexes to target cells. It may also provide a means to increase the delivery of drugs (Klibanov et al. 990)FEBS Letters,268(1):235-237) or The hydroxypropyl ester may be selected to be rapidly exchanged out of the formulation in vivo (see U.S. Patents 5, 8 85,613).

[0109] Particularly useful exchangeable lipids have shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention are The molar ratio of the total lipids present in the liposomal transfer vehicle is about 0% to about 20%, about 0.5% to about It may contain about 20%, about 1% to about 15%, about 4% to about 10%, or about 2%.

[0110] The present invention also contemplates the use of non-cationic lipids. "Non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, the term "anionic lipid" refers to an anionic lipid that is positive at a selected pH, such as physiological pH. Cationic lipids are any of several types of lipids that carry a negative charge. Examples of such phosphatidylcholine include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DPC), Phosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), Dioleoylphosphatidylglycerol (DOPG), Dipalmitoylphosphatidyl Glycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE) , Palmitoyl oleoyl phosphatidylcholine (POPC), Palmitoyl oleoyl -Phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine D-maleimidomethyl-4-cyclohexane-1-carboxylate (D OPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimy Ristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethyl D-disperse amine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 1 8-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine phosphatidyethanolamine (SOPE), cholesterol Such non-cationic lipids may be used alone or in combination with other lipids. Preferably, it is used in combination with other excipients, such as cationic lipids. When used in combination with a lipid, the non-cationic lipid should be in a molar ratio that is less than or equal to the total lipid present in the transfer vehicle. It contains 5% to about 90% of lipids, or preferably about 10% to about 70%.

[0111] In certain embodiments, suitable transfer vehicles (e.g., lipid nanoparticles) include multi-layered lipids and / or or polymer components. For example, the transition excipients are C12-200, DOP E, cholesterol, DMG-PEG2K in a molar ratio of 40:30:25:5; or D ODAP, DOPE, cholesterol, and DMG-PEG2K were mixed in a ratio of 18:56:20:6. or HGT5000, DOPE, cholesterol, and DMG-PEG2K in a ratio of 40 or HGT5001, DOPE, cholesterol, DM at a molar ratio of 20:35:5 It may be prepared using G-PEG2K in a molar ratio of 40:20:35:5. Selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids comprising nanoparticles The relative molar ratios of such lipids to one another will depend on the properties of the lipids selected, the intended target cell, The nature of the cells and the properties of the mRNA to be delivered. Additional considerations include, for example, The saturation of the chains and the size, charge, pH, pKa, and fusogenicity of the selected lipids are considered. enicity, and toxicity. Thus, the molar ratio should be adjusted accordingly. For example, in embodiments, the percentage of cationic lipid in the lipid nanoparticles may be is more than 10%, more than 20%, more than 30%, more than 40%, more than 50% The non-cationic lipid in the lipid nanoparticles may be less than 60%, more than 70%, or more than 80%. Quality percentage is more than 5%, more than 10%, more than 20%, more than 30% , or more than 40%. The percentage of cholesterol in the lipid nanoparticles is It may be greater than 10%, greater than 20%, greater than 30%, or greater than 40%. The percentage of PEG-modified lipid in the nanoparticles is more than 1%, more than 2%, It may be greater than 5%, greater than 10%, or greater than 20%.

[0112] In certain embodiments, suitable lipid nanoparticles of the present invention comprise at least one of the following cationic lipids: Including one of: C12-200, DLin-KC2-DMA, DODAP, HGT4003 , ICE, HGT5000, or HGT5001. In some embodiments, a suitable transcription factor is The transfer excipients include cholesterol and / or PEG-modified lipids. In some embodiments, a suitable transfer vehicle includes DMG-PEG2K. Suitable transfer excipients include one of the following lipid combinations: C12-200, DOPE, cholesterol. DODAP, DOPE, cholesterol, DMG-PEG2 K;HGT5000, DOPE, cholesterol, DMG-PEG2K;HGT5001 , DOPE, cholesterol, DMG-PEG2K; XTC, DSPC, cholesterol , PEG-DMG; MC3, DSPC, cholesterol, PEG-DMG; and ALNY -100, DSPC, cholesterol, PEG-DSG.

[0113] The liposomal transfer vehicles used in the compositions of the present invention can be prepared using a variety of techniques currently known in the art. Multilamellar vesicles (MLVs) can be prepared by conventional techniques, e.g., by dissolving the lipid in a suitable solvent. by dissolving the substances and then evaporating the solvent inside the container to leave a thin film. The lipids are prepared by depositing the lipid of choice onto the inner walls of a suitable container by means of either spray drying or spray drying. The aqueous phase may then be added to the vessel with vortexing, which results in the formation of MLVs. The unilamellar vesicles (ULVs) may then be homogenized, sonicated, or otherwise processed into multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques. It can be achieved.

[0114] In certain embodiments of the invention, the compositions of the invention comprise a transfer vehicle, and the mRNA is transferred to a transfer vehicle. They may also be associated with the surface of the vehicle and may also be encapsulated within the same vehicle. During preparation, cationic liposomal transfer vehicles associate with mRNA through electrostatic interactions. For example, during the preparation of the compositions of the present invention, the cationic liposomal transfer excipient may be electrostatically It may associate with the mRNA through interactions.

[0115] Suitable liposomal delivery vehicles according to the present invention may be made in a variety of sizes. The size selection depends on the location of the target cell or tissue and, to some extent, on the type of liposome being produced. In some embodiments, the suitability of the liposomal delivery vehicle may be taken into consideration. An appropriate size is selected to promote systemic distribution of the antibody encoded by the mRNA. In some embodiments, transfection of mRNA is performed in a given cell or tissue. For example, it may be desirable to limit the size of the liposomal transfer vehicle to the liver. The size of the liposomal transfer vehicle was adjusted so that it was smaller than the fenestrations in the endothelial layer covering the hepatic sinusoids. may be tailored to target hepatocytes; accordingly, liposomal transfer vehicles may be used to target such endothelial The fenestrations can easily penetrate the target hepatocytes. The vehicle is selected so that the size of the liposomes is of sufficient diameter to restrict distribution to a given cell or tissue. For example, liposomal transfer vehicles may be sized to specifically avoid or Its dimensions are larger than the fenestrations in the endothelial layer lining the hepatic sinusoids, thereby allowing liposomes to reach hepatocytes. The particles may be sized to limit the distribution of the mucosal transfer excipient.

[0116] In some embodiments, suitable liposomal delivery vehicles are those having a diameter of about 250 nm (e.g., about 225nm, 200nm, 175nm, 150nm, 125nm, 100nm, 75nm In some embodiments, the suitable liposomes have a size of less than or equal to 50 nm. The somatic delivery vehicle may be in the range of about 250-10 nm (e.g., about 225-10 nm, 20 0~10nm, 175~10nm, 150~10nm, 125~10nm, 100~10 Some of the particles have sizes ranging from 10 to 75 nm, 10 to 75 nm, or 10 to 50 nm. In embodiments, suitable liposomal delivery vehicles have a particle size in the range of about 250 to 100 nm (e.g., Approximately 225~100nm, 200~100nm, 175~100nm, 150~100nm In some embodiments, suitable liposomal delivery vehicles include In the range of about 100 to 10 nm (e.g., about 90 to 10 nm, 80 to 10 nm, 70 to 10 nm The nanoparticles have sizes ranging from 100 to 200 nm, 60 to 10 nm, or 50 to 10 nm.

[0117] To adjust the population size of the liposomal transfer vehicle, various alternatives known in the art can be used. Alternative methods are available. One such sizing method is described in U.S. Pat. No. 4,737,323. and is incorporated herein by reference. (Probe) By sonicating the liposome suspension, the diameter of the liposomes was approximately 0. A gradual reduction in size occurs down to small ULVs smaller than .05 microns. Homogenization is performed on large Another method relies on shear energy to break down vesicles into smaller ones. A typical homogenization procedure produces a homogenized sample of selected liposomes, typically about 0.1 to 0.5 microns in size. Recirculate the MLVs through a standard emulsion homogenizer until size is observed. The size of somatic vesicles is determined by the method described in Bloomfield, An n.Rev.Biophys.Bioeng.,10:421-150(1981). As described in the publication, quasi-electric light scattering (QLS) The average liposome diameter may be determined by the quantification of liposome size (QELS). This can be reduced by sonication of the liposomes. Thus, intermittent sonication cycles may be alternated with QELS assessments.

[0118] In vivo expression of RNA-encoded antibodies In accordance with the present invention, the mRNA encoding the antibodies (e.g., heavy and The mRNA encoding the light chain and the light chain are then synthesized to produce the complete desired antibody in vivo. Thus, the compound may be delivered to a subject in need thereof with or without a delivery vehicle.

[0119] In some embodiments, the desired antibody encoded by the mRNA is expressed systemically in the subject. This means that the cells or tissues that initially express the antibody and enter the circulatory system of the subject are This can be achieved by secreting the fully assembled antibody from the cell. The composition of the present invention, which contains the mRNA and a liposomal excipient, distributes in the cells of the liver. and delivering the mRNA contained in the composition by cells of the liver (e.g., hepatocytes). The target hepatocytes produce the fully assembled desired antibody. The biological "reservoir" or "antibody" can be produced and secreted to produce systemic distribution of antibodies. In other embodiments, cells other than hepatocytes (e.g., lung cells) may function as a "reservoir." cells of the spleen, heart, eye, or central nervous system serve as reservoirs for protein production. Typically, the antibody can act as a continuous release agent for fully assembled antibodies from a reservoir or reservoir cells. Production and secretion results in efficient systemic distribution.

[0120] In some embodiments, mRNA encoding the desired antibody is administered systemically to the patient's serum (i.e. The expression of the drug in the blood is more than 1 hour, more than 4 hours, or more than 6 hours after administration. longer, longer than 12 hours, longer than 18 hours, longer than 24 hours, longer than 30 hours , more than 36 hours, more than 42 hours, more than 48 hours, more than 54 hours, more than 60 hours longer than 66 hours, longer than 72 hours, longer than 96 hours, longer than 120 hours Longer, longer than 144 hours, longer than 168 hours, longer than 2 weeks, longer than 3 weeks, In some embodiments, the mRNA can be detected for more than one month, or for more than two months. The serum concentrations of the antibody encoded by the antibody were measured at approximately 6, 12, 18, and 24 hours after administration. 30 hours, 36 hours, 42 hours, 48 ​​hours, 54 hours, 60 hours, 66 hours, 72 hours Peak levels are reached at 78, 84, 90, or 96 hours. In this embodiment, sustained circulation of the desired antibody encoded by the mRNA is observed. For example, the antibody encoded by the mRNA may be expressed systemically in the serum (i.e., blood) of a patient. What is happening is after administration, 1 day, 2 days, 3 days, 4 days, 5 days, 1 week, 2 weeks, 3 weeks, It may be detectable for a month, two months, or longer.

[0121] In some embodiments, the mRNA encoding the heavy and light chains of the antibody is expressed intracellularly in the antibody. It may be delivered to a target cell or tissue for expression or local distribution. Typically, The antibodies produced in the target cells are released into the surrounding extracellular fluid without entering the bloodstream or other circulatory systems. As used herein, the term "target cell" refers to a molecule that is secreted into or distributed locally to the target cell. "Target tissue" or "cell" refers to the cell or tissue to which the mRNA encoding the antibody is directed. For example, if it is desired to deliver mRNA to liver cells, then liver cells may be The mRNA encoding the antibody (e.g., heavy and light chains) described herein is used to target cells. The mRNA encoding the , hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal Cells, nerve cells (e.g., meninges, astrocytes, motor neurons, dorsal root ganglia and anterior horn motor neurons) Neuronal cells), photoreceptor cells (e.g., rods and cones), retinal pigment epithelial cells, secretory cells alveolar cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiac muscle cells, skeletal muscle cells, β cells, pituitary cells , synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, white blood cells The antibody may be delivered to lymphocytes, granulocytes, and tumor cells.

[0122] Delivery of mRNA to target cells or tissues can be achieved through both passive and active targeting techniques. This may be achieved by a number of steps. The phenomenon of passive targeting occurs when a metastatic vehicle is introduced by a target cell. The present invention provides a method for enhancing metastatic potential in vivo without resorting to the use of additional excipients or means for enhancing the recognition of the metastatic potential. Take advantage of the vehicle's natural distribution pattern, e.g., by being phagocytosed by cells of the reticuloendothelial system The metastatic excipients tend to accumulate in the liver or spleen and therefore are highly sensitive to the delivery of the composition to such target cells. The therapeutic agent may provide a means for passively directing the delivery of the therapeutic agent.

[0123] Alternatively, delivery of mRNA to target cells or tissues can be achieved by active targeting. This may be achieved by binding (either covalently or non-covalently) to a transfer vehicle. "Targeting" agents that can facilitate the localization of such metastatic vehicles in a given target cell or tissue. These include the use of additional excipients referred to herein as "targeting ligands." The targeting comprises the introduction of one or more endogenous targeting ligands in or on the transfer vehicle. The drug is delivered to target cells or tissues via the inclusion of a phosphodiesterase (e.g., apolipoprotein E). The recognition of the targeting ligand by the target tissue may facilitate the distribution of the target cells and Actively assess the tissue distribution and cellular uptake of the transfer vehicle and / or its contents in tissues promotes the transfer of apolipoprotein E targeting to the metastatic vehicle (e.g., The inclusion of the binding ligand binds to endogenous low-density lipoproteins expressed by hepatocytes. (facilitating recognition and binding of the transfer vehicle to the receptor). As described herein, The composition may include a ligand that can increase the affinity of the composition to a target cell. The targeting ligand can be attached to the outer bilayer of the lipid particle during or after formulation. These methods are well known in the art. In addition, some lipid particles The formulation may be a fusogenic polymer, such as PEAA, hemagglutinin, or other lipopeptides (U.S. Pat. No. 6,313,621). See U.S. Patent Application Nos. 08 / 835,281 and 60 / 083,294, which are incorporated herein by reference in their entirety. the disclosures of which are incorporated herein by reference), and are useful for in vivo and / or intracellular delivery. In some other embodiments, the compositions of the present invention may be used. The present invention provides a method for improving transfection efficiency and / or enhancing the transfection efficiency of a target cell or tissue of interest. Thus, the composition and its components can be used to target cells or tissues. One or more ligands (e.g., peptides) that can improve the affinity of the nucleic acid to the target nucleic acid. Compositions containing the agonist, aptamer, oligonucleotide, vitamin, or other molecule are contemplated. The suitable ligand may optionally be bound or coupled to the surface of the transfer vehicle. In some embodiments, the targeting ligand may coat the surface of the metastatic vehicle, but not the metastatic vehicle. The appropriate ligand may be encapsulated in a vehicle, depending on its physical, chemical, or biological properties. Physical properties (e.g., selective affinity and / or recognition of target cell surface markers or features) The cell-specific target sites and their corresponding targeting ligands are selected based on a wide range of Suitable targeting ligands are chosen based on the unique characteristics of the target cells. , so that the composition is selected to be able to distinguish between target cells and non-target cells. For example, the composition of the present invention includes a compound that selectively enhances recognition of or affinity for hepatocytes. A surface label that allows for the uptake of the antibody (e.g., apolipoprotein B or apolipoprotein E) ( The improvement can be achieved, for example, by using receptor-mediated recognition and binding to such surface labels. In addition, galactose was used as a targeting ligand. The presence of a sugar moiety is believed to target the composition of the present invention to hepatocytes. When mannose, which is a targeting ligand, is used, the composition of the present invention can be used to target the liver endothelium. It is thought that the receptors target the asialoglycoproteins present in hepatocytes. or mannose containing sugar residues that can preferentially bind to the mannose receptor). llery AM, et al.“Drug Delivery and Targe ting: For Pharmacists and Pharmaceutical Scientists” (2002) Taylor & Francis, Inc. Such conjugated components present in the transfer vehicle (e.g., lipid nanoparticles) may be used. Presentation of the targeting ligand thus results in the expression of the compositions of the invention in target cells and tissues. Examples of suitable targeting ligands include one or more or multiple peptides, proteins, aptamers, vitamins, and oligonucleotides. Can be obtained.

[0124] As used herein, the term "subject" refers to any animal (e.g., a mammal). Also refers to mammals, including but not limited to humans, non-human primates, rodents, and their analogs. The subject is a mammalian animal to which the mRNA and compositions of the present invention are administered. and "patient" are used interchangeably herein in reference to a human subject.

[0125] Pharmaceutical Compositions and Administration In order to promote the expression of the antibody in vivo, the mRNA encoding the antibody (e.g., heavy chain and The mRNA encoding the light chain and the delivery vehicle may include one or more additional nucleic acids, carriers, tags, in combination with a targeting ligand, or a stabilizing reagent, or in a pharmacological composition. It can be formulated by mixing with suitable excipients. The technology of drug formulation and administration is described in " Remington's Pharmaceutical Sciences,”Mac K Publishing Co., Easton, Pa., latest edition, do.

[0126] The mRNA encoding the antibody and the composition containing the same are selected based on the clinical symptoms of the subject, the site of administration, and the like. and method of administration, administration schedule, age, sex, weight of the subject, and any other factors appropriate to the practitioner of ordinary skill in the art. Taking other factors into consideration, the dosage and administration may be in accordance with current medical practice. For purposes of description, an "effective amount" is defined as an amount that is consistent with experimental clinical studies, pharmacological, clinical, and medical techniques. This may be determined by reasonable considerations as would be known to one of ordinary skill in the art. In some embodiments, the amount administered is determined as a measure of progression, regression, or improvement of the disease. At least some stabilization, amelioration, or reduction of symptoms and other indicators as selected by one of skill in the art. For example, a suitable amount and dosage regimen may be effective to achieve at least a temporary relief of symptoms. It causes sexual antibody production.

[0127] Suitable routes of administration include, for example, oral, rectal, vaginal, transmucosal, and inhalation. pulmonary administration, such as intraductal or inhalation administration, or enteral administration; parenteral delivery, e.g., intramuscular Intravenous injection, subcutaneous injection, intramedullary injection, intrathecal injection, direct intraventricular injection, intravenous injection, intraperitoneal injection injection, intranasal injection, or intraocular injection.

[0128] Alternatively, the mRNA and compositions of the invention can be administered in a local rather than systemic manner. For example, by injecting the pharmaceutical composition directly into the target tissue, preferably sustained The localized delivery may be administered in a targeted release formulation, depending on which tissue is to be targeted. For example, the aerosol containing the composition of the present invention may be The drug may be inhaled (for delivery via the nose, trachea, or bronchi); The composition can be injected, for example, at the site of injury, disease manifestation, or pain; Can be provided in lozenges for application via the mouth, trachea, or esophagus; It can be supplied in liquid, tablet, or capsule form for administration rectally or It can be supplied in suppository form for vaginal application; or as creams, drops, or The compositions of the invention can even be delivered to the eye by use of an injection. The composition is complexed with a ligand to deliver the composition to surrounding cells at the site of delivery, for example. and / or attached to a polymer or other structure or material that can allow the drug to diffuse into the Alternatively, they can be administered surgically without the use of polymers or supports. It can be used.

[0129] In one embodiment, the composition of the present invention is suitable for sustained release of the mRNA contained therein. Such sustained release compositions are formulated to provide a sustained release effect even when administered to a subject at extended intervals. For example, in one embodiment, the compositions of the present invention can be administered twice a day or once a day. In a preferred embodiment, the compositions of the invention are administered to a subject twice a week. once a week, once every 10 days, once every 2 weeks, once every 3 weeks, or more preferably once every 4 weeks Every month, every 6 weeks, every 8 weeks, every other month, every 3 months, every 4 months, every 6 months The drug is administered to subjects every 10 days, 8 months, 9 months, or yearly. Depot administration (e.g., intramuscular, subcutaneous, intravenous) may be used to deliver or release the mRNA over a wide range of Also contemplated are compositions formulated for intrauterine administration and liposomal vehicles. The sustained release means used, in combination with modifications made to the mRNA, enhances stability. do.

[0130] Also contemplated herein is one or more of the liposomal nanoparticles disclosed herein. The present invention relates to a lyophilized pharmaceutical composition comprising a plurality of lyophilized pharmaceutical compositions, for example, as described in U.S. Provisional Application No. 2005 / 0133664 filed on June 8, 2011. Related methods for the use of such lyophilized compositions as disclosed in US Pat. No. 61 / 494,882. and, the teachings of which are incorporated herein by reference in their entirety. The lyophilized pharmaceutical composition according to the invention may be reconstituted prior to administration or may be reconstituted in vivo. For example, the lyophilized pharmaceutical composition can be formulated into a suitable dosage form (e.g., a disk, a rod, or intradermal administration dosage form such as a membrane, and the dosage form is absorbed in vivo by the body fluids of an individual. The drug can be administered in a 25 mg / kg / day dose such that it rehydrates over time.

[0131] In vitro expression of RNA-encoded antibodies In some embodiments, the mRNA encoding the antibody (e.g., encoding the heavy and light chains) is The mRNA for the antibody may be used to produce antibodies in vitro. For example, cells may be transformed into Transducers are provided by mRNAs encoding the heavy and light chains of the The cells may be transfected with the antibody and cultured under cell culture conditions that allow the production of the antibody by the cells. In some embodiments, the antibody is expressed intracellularly. It is secreted by the cells so that it can be harvested from the supernatant.

[0132] In some embodiments, mammalian cells are used in accordance with the present invention. Non-limiting examples include the BALB / c mouse myeloma line (NSO / 1, ECACC No: 85110503); Human retinoblastoma cells (PER.C6, CruCell, Netherlands, Raleigh transformed with SV40 (COS-7, ATCC CRL 1651) monkey kidney CV1 line; human embryonic kidney line (HEK293, or SV400) adapted to grow in suspension culture; Cloned 293 cells, Graham et al., J. Gen Viro l.,36:59,1977);human fibrosarcoma cell lines (e.g., HT1080);Baby Hamster kidney cells (BHK21, ATCC CCL 10); Chinese hamster Ovarian cells + / - DHFR(CHO, Urlaub and Chasin, Proc.N atl. Acad. Sci. USA, 77:4216, 1980); mouse Sertoli cells (TM4,Mather,Biol.Reprod.,23:243-251,1980 ); Monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells ( VERO-76, ATCC CRL-1 587); human cervical cancer cells (HeLa, A TCC CCL 2); Canine kidney cells (MDCK, ATCC CCL 34); Buffer Rowe rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W1 38, ATCC CCL 75); human liver cells (HepG2, HB 8065); mouse breast tumor (MMT 060562, ATCC CCL 51); TRI cells (Math er et al.,Annals NYAcad.Sci.,383:44-68 , 1982); MRC5 cells; FS4 cells; and a human hepatoma line (Hep G2). can be done.

[0133] Culture the transfected cells using standard cell culture media and conditions to allow the mRNA to encode. It is possible to produce the desired antibody that inhibits the transcription of the IL-11 gene. EXAMPLES

[0134] Example 1 Production of mRNA Heavy chain of anti-chemokine (CC motif) ligand 2 (HC-αCCL2, SEQ ID NO:1) and the light chain of anti-CCL2 (LC-αCCL2, SEQ ID NO: 2) was synthesized using a gene encoding The plasmid was synthesized by in vitro transcription from a mide DNA template and subsequently purified by known methods (Fech ter,P.;Brownlee,GG“Recognition of mRNA cap structures by viral and cellular pr oteins”J.Gen.Virology 2005,86,1239-1249 The 5' cap structure (Cap1) was added according to the method described in (see below), and the length was determined by gel electrophoresis. A 3' poly(A) tail of approximately 200 nucleotides was added as determined by electrophoresis. The sequences for LC-αCCL2 and LC-αCCL2 are shown below, and the sequences present in each mRNA product are The 5' and 3' untranslated regions are designated as X and Y, respectively, and are defined below: Anti-CCL2 (HC-αCCL2) heavy chain mRNA: [ka] Anti-CCL2 (LC-αCCL2) light chain mRNA: [ka] 5' and 3' UTR sequences: X1= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCG GGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG Y1= CGGGUGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCC UAAUAAAAUUAAGUUGCAUCAAGCU

[0135] Example 2 In vitro mRNA transfection materials and conditions A. Exemplary Lipid Materials The lipid formulations used for transfection in the examples herein are one or more The lipids may be composed of multiple lipids or one or more lipids designed to encapsulate various nucleic acid-based materials. Multicomponent lipid mixtures using multiple cationic lipids, helper lipids, and PEGylated lipids in various ratios The cationic lipids were (but were not limited to) DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP(1,2- Dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octyl tadecenyl-3-trimethylammoniumpropane), DLinDMA (Heyes, J .;Palmer,L.;Bremner,K.;MacLachlan,I.“Cat ionic lipid saturation influences intrac ellular delivery of encapsulated nucleic See "Acids" J. Contr. Rel. 2005, 107, 276-287. ), DLin-KC2-DMA (Semple, SC et al. “Ratio al Design of Cationic Lipids for siRNA D delivery” Nature Biotech. 2010, 28, 172-176. C12-200 (Love, KT et al. “Lipid-like materials for low-dose in vivo gene sil encing”PNAS 2010,107,1864-1869), HGT4003, ICE, dialkylamino-based, imidazole-based, guanidinium-based, etc. Perlipids include (but are not limited to) DSPC (1,2-distearoyl-sn-glyceryl ether). glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3 -phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanoic acid dipalmitoyl-sn-glycero-3-phosphoethanoylamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanoylamine), amine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanoyl diolamine), DOPG (2-dioleoyl-sn-glycero-3-phospho-(1'-r ac-glycerol), cholesterol, etc. PEGylated lipids (without excluding others) Iga), C6~C 20 Covalently attached to lipids with alkyl chains up to 5k in length The poly(ethylene) glycol chain may comprise 1 Da.

[0136] B. Experimental Preparations In these experiments, C12-200, DOPE, cholesterol, and DMG-P Mix aliquots of 50 mg / mL ethanol solution of EG2K and dilute with ethanol. The final volume was adjusted to 3 mL. RNA (1:1 by weight:weight) mRNA in aqueous buffer (10 mM citric acid / 150 mM NaCl, pH 4.5) and 500 micrograms of each construct were added to a stock solution of 1 mg / mL. The lipid solution was quickly injected into the aqueous mRNA solution and shaken. The final suspension in 20% ethanol was obtained. The resulting nanoparticle suspension was filtered and diluted with 1 Diafiltrate with ×PBS (pH 7.4) and concentrate. The final concentration was 1.35 mg / mL αCCL2 mRNA (subject package). Z ave =89.2nm(Dv (50) = 64.0 nm; Dv (90) =115n m).

[0137] Example 3 Detection of antibodies after in vitro mRNA transfection A. By ELISA In this example, F96 MaxiSorp Nunc-Immuno Plates 1 μg / ml goat anti-mouse IgG1 (Inv 100 μl of FabA (A10538) was coated onto the plate and incubated at 37°C for 1 hour. After washing three times with washing buffer (1x PBS, 0.05% Tween 20), The wells were incubated with blocking buffer (1x PBS, 0.05% Tween 20) for 1 h at 37 °C. Blocking was performed with 320 μl of 2% BSA. Dilutions were prepared in blocking buffer ranging from 250 to 10 ng / ml. The dilutions were diluted with blocking buffer to fall within the range of the standard curve (1:100 to 1:10,000). Both samples and standards were incubated at 37°C for 1 hour in wash buffer. After washing three times, goat anti-mouse IgG Fc HRP-conjugated secondary antibody (Pierce 31 439) was used at a dilution of 1:40,000 and incubated at 37°C for 1 hour. After washing three times with buffer, the TMB EIA substrate reagent was prepared according to the manufacturer's instructions. After incubation at 7°C for 15 min, the reaction was stopped by adding 2N H2SO4 and the plates were The rates were read at 450 nm.

[0138] B. By Western blot In this example, conditioned medium from transfected 293T cells or electroporated HCL2 cells was used. Culture media was fractionated by SDS-PAGE and purified according to the manufacturer's instructions (Invitrogen). The samples were transferred to a polyvinylidene difluoride membrane using a transfer device. 5% skim milk powder in H8.0, 150 mM NaCl, 0.5% Tween 20 for 1 hour After incubation, the membrane was washed three times with PBST and incubated for 1 h at room temperature with goat anti-mouse Ig G1 (Invitrogen A10538). The membrane was incubated for 3 h in PBST. After washing twice, the cells were incubated with horseradish peroxidase-conjugated anti-mouse secondary antibody (Promega W40 21) at a 1:5000 dilution for 1 hour at room temperature. Blots were rinsed with PBS Wash three more times with T and then use the ECL system (Amersham Biosciences) according to the manufacturer's instructions. The film was developed using a spectrophotometer.

[0139] Example 4 Produced by transfection of HC-αCCL2 and LC-αCCL2 In vitro analysis of selected αCCL2 antibodies Both HC-αCCL2 and LC-αCCL2 mRNA were produced as described above in Example 1. Subsequently, according to Examples 2A and B, HC-αCCL2 and LC-αCCL2 were The mRNA was transformed into HCL1 (i.e., human cell line) at various ratios (wt:wt) according to known methods. Strain 1) cells or HCL2 cells were transfected.

[0140] The results of these tests on HCL1 and HCL2 cells are shown in Figures 1 and 2, respectively. α-CCL2 (chemokine (CC motif) ligand 2) heavy and light chain mRNA The various mixtures of constructs were mixed (wt:wt) and incubated with HCL1 cells (Figure 1) or HCL2 cells. Cell supernatants were collected at selected time points post-transfection. and analyzed by anti-mouse IgG using an ELISA-based method as described above in Example 3A. We analyzed whether there was

[0141] As shown in Figures 1 and 2, varying the ratio of heavy chain to light chain (weight:weight) resulted in an improved ELISA There was a significant difference in protein production measured by the A 1:1 (wt:w) mixture of heptagonist:light chains gave a strong signal in HCL2 cells, 4 A ratio of 0.1:1 (wt:wt) resulted in improved protein production in HCL1 cells. Although there were differences depending on the ratio, strong protein production was observed at all ratios tested. In both cases, 48 ​​hours after transfection (Day 2 or Day 2) (D2)) gave the strongest signal for the desired protein in this example.

[0142] To further confirm the presence of exogenous mRNA-derived antibodies, immunoblots (Western) were performed. The method was used to further characterize HCL1-derived samples (see FIG. 3). Fragments of the heavy and light chains were analyzed by Western blotting using the method described above. The α-CCL2 heavy chain mRNA construct and 24 h of transfection with various mixtures of IgG and light chain mRNA constructs (wt:wt). The samples were analyzed after 48 hours and 48 hours. The observed absorption band intensities were Reflects the A ratio.

[0143] Example 5 Biological activity of αCCL2 antibody produced from intravenously administered mRNA-loaded nanoparticles Internal Analysis In this example, we demonstrate the ability of exogenous messenger RNA to mediate the production of fully engineered antibodies. Therefore, the present invention aims to achieve this in vivo, specifically, the mRNA constructs of the α-CCL2 heavy and light chains. (HC-αCCL2 mRNA:LC-αCCL2 mRNA is 1:1 (weight:weight)) was encapsulated in cationic lipid nanoparticles as described in Example 2A and administered as a single bolus intravenous injection. The drug was delivered to mice as an intravenous injection.

[0144] Briefly, male CD-1 mice were used that were approximately 6–8 weeks old at the start of each experiment. The mRNA of HC-αCCL2 and the mRNA of LC-αCCL2 were encapsulated (weight:weight:1: 1) The samples were administered by single bolus tail vein injection of an equivalent total dose of 30 micrograms. Mice were sacrificed and perfused with saline at multiple time points.

[0145] The liver and spleen of each mouse are harvested, divided into three portions, and stored in 10% neutral buffered formalin. or snap-frozen and stored at -80°C until analysis.

[0146] All animals were euthanized by CO2 asphyxiation at multiple time points after dose administration, followed by , thoracotomy and terminal cardiac blood collection Euthanized animals were then subjected to cardiac puncture to remove whole blood (maximum amount available). The blood was collected in serum separator tubes (volumes in each case) and allowed to clot at room temperature for at least 30 minutes, then subjected to a centrifugation test at 9300 g and 22°C. The serum was extracted by centrifugation at ±5°C for 10 minutes. Whole blood from L was collected by facial vein puncture or tail cut. Samples collected from untreated animals was used as a baseline level for comparison with the test animals.

[0147] For ELISA analysis of αCCL2 antibody production, F96 MaxiSorp Nunc - Immuno Plate: 1 mg / ml MCP-1 in carbonate buffer (pH 9.6) 100 ml of recombinant rabbit purified monoclonal antibody was coated and incubated at 37°C for 1 hour. The cells were incubated for 3 hours and then washed three times with washing buffer (1x PBS, 0.05% Tween 20). Afterwards, the wells were blocked with blocking buffer (1x PBS, 0.05% Tween 100) for 1 hour at 37°C. The plate was blocked with 320 ml of 2% BSA. Human or mouse recombinant proteins were added to each well and incubated at 37°C for 1 hour. After washing three times with washing buffer, serial dilutions of the samples (1:5 to 1:200) were added and incubated for 3 h. The plate was incubated at 37°C for 1 hour. The plate was washed three times with washing buffer and then incubated with goat anti-mouse IgG F c HRP-conjugated secondary antibody was used at a dilution of 1:40,000 and incubated for 1 h at 37°C. After washing three times with washing buffer, the TMB EIA substrate reagent was added according to the manufacturer's instructions. After incubation at 37°C for 15 minutes, the reaction was stopped by adding 2N H2SO4. The reaction was stopped and the plate was read at 450 nm.

[0148] Serum levels of treated mice were measured at selected time points after administration (6 hours, 24 hours, and 48 hours). The fully formed α-human CCL in mouse serum was monitored at 1 h after injection (after 72 h). The levels of the two antibodies were quantified using an ELISA-based method (see Figure 4). The antibody response to α-CCL2 mRNA was significantly increased within 6 hours after administration, and increased after 24 hours. A peak can be observed.

[0149] Example 6 In vivo production of α-VEGF antibodies In this example, the production of fully processed α-VEGF antibody was determined by the exogenous messenger This was achieved in vivo by delivery of RNA.

[0150] The sequences of HC-αVEGF and LC-αVEGF are shown below. The 5' and 3' untranslated regions present in the product are designated as X and Y, respectively, and are defined below: Anti-VEGF (HC-αVEGF) heavy chain mRNA: [ka] Anti-VEGF (LC-αVEGF) light chain mRNA: [ka] 5' and 3' UTR sequences: X1 (5'UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCG GGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG Y1 (3'UTR sequence) = CGGGUGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCC UAAUAAAAUUAAGUUGCAUCAAGCU

[0151] α-VEGF heavy and light chain mRNA constructs (HC-αVEGF mRNA:LC-α VEGF mRNA was mixed with cationic lipid nanoparticles (1:1 (wt:wt)) as described below. The child was encapsulated.

[0152] In these experiments, cKK-E12, DOPE, cholesterol, and DMG-P Mix aliquots of 50 mg / mL ethanol solution of EG2K and dilute with ethanol. The final volume was adjusted to 3 mL. mRNA (1:1 by weight:weight) in aqueous buffer (10 mM citric acid / 150 mM 500 micrograms of each construct were cultured in 1 mM NaCl, pH 4.5 from a 1 mg / mL stock solution. The lipid solution was quickly injected into the aqueous mRNA solution and shaken, resulting in a 20% ethanol solution. The final suspension in ethanol was obtained. The resulting nanoparticle suspension was filtered and diluted with 1× PBS (pH 7 4) Diafiltrate, concentrate and store at 2-8°C. The final concentration was 0.20 mg / mL αVEGF mRNA (encapsulated). ave = 81.0 nm (PDI=0.16).

[0153] Lipid nanoparticles containing HC-α-VEGF and LC-α-VEGF mRNA were prepared in 1 Delivered to wild-type mice at a dose of 0.0 mg / kg by a single intravenous tail vein injection or subcutaneous injection. The production of anti-VEGF antibodies in serum was monitored over time by ELISA. .

[0154] Briefly, male CD-1 mice were used that were approximately 6–8 weeks old at the start of each experiment. The mRNA of HC-α-VEGF and LC-α-VEGF (weight:weight) The samples were then mixed in a 1:1 ratio and administered a single dose of 1.0 mg / kg (approximately 30 micrograms) equivalent total dose. The mice were sacrificed and cultured at multiple time points (p.i., p.i.). 0.50 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, The rats were perfused with saline for 1, 2, or 3 weeks.

[0155] All animals were euthanized by CO2 asphyxiation at multiple time points after dose administration, followed by , thoracotomy and terminal cardiac blood collection Euthanized animals were then subjected to cardiac puncture to remove whole blood (maximum amount available). The blood was collected in serum separator tubes (volumes 1000 and 1000 g) and allowed to clot at room temperature for at least 30 minutes. The blood was centrifuged at ℃±5℃ for 10 minutes to extract serum. 1 μL of whole blood was collected by facial vein puncture or tail cut. The dose was used as a baseline level for comparison to the test animals.

[0156] For ELISA analysis of α-VEGF antibody production, F96 MaxiSorp Nunc -Immuno Plate was filled with coating buffer (50 mM NaHCO3, pH 9 0.50 micrograms / mL / well of recombinant human VEGF protein (In 100 microliters of Vitrogen #PHC9391 was coated on the plate. After washing three times with washing buffer, the wells were filled with blocking buffer (1x DPBS, 2% BSA The plate was blocked with 0.05% Tween-20 at 37°C for 1 hour. After further washing, mouse serum collected from the injected mice was added to each well, and rabbit anti- Human IgG Fc HRP (Pierce #PA-28587) conjugated secondary antibody 1:1 The plate was used at a dilution of 0,000 and incubated for 1 hour at 37°C. Washed 3 times with wash buffer. The TMB EIA substrate reagent was prepared according to the manufacturer's instructions. Incubate at 37°C for 10 min. After incubation, the reaction was stopped by adding 2N H2SO4 and the plate was read at 450 nm. Serum levels of treated mice were measured at selected time points after dosing (e.g., 0.5 hours, 3 Hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 8 days, and 15 days ) were monitored. Figure 5 shows the mRNA levels of HC-α-VEGF and LC-α-VEGF. α-VEGF antibodies detected in the serum of wild-type mice after a single administration of A-loaded nanoparticles. Illustrative results are shown in Figure 1. The desired antibody was derived from exogenous α-VEGF mRNA. A significant increase was observed within 6 hours after administration, with a peak observed after 24 hours. Figure 6 shows the same exemplary results as Figure 5, but with specific Figure 7 shows the results of the mouse number plotted against the number of mice injected intravenously or subcutaneously. 4 shows a comparison of the levels of α-VEGF antibodies present in the serum of mice 24 hours later.

[0157] This example further demonstrates that mRNA-based therapy can be used for effective in vivo antibody production. Provide further confirmation.

[0158] Equivalents and scope Those skilled in the art will recognize many equivalents to the specific embodiments of the invention described herein, and may readily appreciate that these equivalents are merely exemplary of the invention. This can be ascertained using routine experimentation. It is not intended to be limited to the specification, but rather to the following claims: That is correct. For example, in certain embodiments of the present invention, the following items are provided: (Item 1) A method for delivering an antibody in vivo, the method comprising: administering one or more mRNAs to a subject in need thereof, wherein the antibody The method wherein the subject is expressed systemically. (Item 2) The one or more mRNAs include a first mRNA encoding the heavy chain of the antibody; and a second mRNA encoding the light chain of the antibody. (Item 3) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio ranging from about 10:1 to 1:10. (Item 4) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio ranging from about 4:1 to 1:4. (Item 5) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio of about 4:1. (Item 6) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 6. The method according to any one of items 2 to 5, wherein and are present in a ratio of greater than 1. (Item 7) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio of about 1:1. (Item 8) The one or more mRNAs encode both the heavy and light chains of the antibody. 3. The method according to item 1 or 2, comprising a single mRNA comprising (Item 9) The one or more mRNAs encoding the heavy and light chains of the antibody The method according to any one of items 1 to 8, wherein the liposome is encapsulated in one or more liposomes. (Item 10) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 10. The method according to item 9, wherein the and are encapsulated in separate liposomes. (Item 11) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 11. The method according to item 10, wherein the and are encapsulated in the same liposome. (Item 12) The one or more liposomes may be composed of cationic lipids, neutral lipids, cholesterol-based lipids, 12. The method according to any one of items 9 to 11, comprising one or more of: The method described. (Item 13) Items 9 to 12. The one or more liposomes have a size of about 150 nm or less. 2. The method according to claim 1 . (Item 14) The one or more liposomes have a size of about 100 nm or less. 2. The method according to claim 1 . (Item 15) The one or more liposomes have a size of about 75 nm or less. 2. The method according to any one of claims 1 to 11. (Item 16) Item 1 to 1, wherein the one or more mRNAs are modified to increase stability. 6. The method according to any one of claims 5 to 5. (Item 17) The one or more mRNAs may contain modified nucleotides, a cap structure, a polyA tail, 16. The method according to claim 15, further comprising: Method of posting. (Item 18) 16. The method according to any one of items 1 to 15, wherein the one or more mRNAs are unmodified. method. (Item 19) 19. The method according to any one of items 1 to 18, wherein the one or more mRNAs are administered intravenously. Method of posting. (Item 20) 19. The method according to any one of items 1 to 18, wherein the one or more mRNAs are administered intraperitoneally. Method of posting. (Item 21) The systemic expression of the antibody is at least about 6 hours, 12 hours, 24 hours, 36 hours, or 40 hours after administration. Detectable at 48, 72, 96, or 120 hours, items 1-2 10. The method of any one of claims 0 to 9. (Item 22) The antibody may be an intact immunoglobulin, (Fab)2, (Fab')2, Fab, Fab', or scFv. (Item 23) 23. The method of claim 22, wherein the antibody is an IgG. (Item 24) The antibody is anti-CCL2, anti-lysyl oxidase-like 2 (LOXL2), anti-Flt-1, Anti-TNF-α, anti-interleukin-2Rα receptor (CD25), anti-TGF β , anti-B-thin Cell-activating factor, anti-alpha-4 integrin, anti-BAGE, anti-β-catenin / m, anti-Bc r-abl, anti-C5, anti-CA125, anti-CAMEL, anti-CAP-1, anti-CASP-8, anti- CD4, anti-CD19, anti-CD20, anti-CD22, anti-CD25, anti-CDC27 / m, anti-CD 30, anti-CD33, anti-CD52, anti-CD56, anti-CD80, anti-CDK4 / m, anti-CEA, Anti-CT, anti-CTL4, anti-Cyp-B, anti-DAM, anti-EGFR, anti-ErbB3, anti-ELF2 M, anti-EMMPRIN, anti-EpCam, anti-ETV6-AML1, anti-HER2, anti-G250 , anti-GAGE, anti-GnT-V, anti-Gp100, anti-HAGE, anti-HER-2 / neu, anti-H LA-A * 0201-R170I, anti-IGF-1R, anti-IL-2R, anti-IL-5, anti-MC 1R, anti-myosin / m, anti-MUC1, anti-MUM-1, -2, -3, anti-proteinase-3 , anti-p190 minor bcr-abl, anti-Pml / RARα, anti-PRAMS, anti-PSA, Anti-PSM, anti-PSMA, anti-RAGE, anti-RANKL, anti-RU1 or RU2, anti-SAGE , anti-SART-1 or anti-SART-3, anti-survivin, anti-TEL / AML1, anti-TPI / m, anti-TRP-1, anti-TRP-2, anti-TRP-2 / INT2, anti-VEGF, and anti-VE 24. The method according to any one of items 1 to 23, wherein the GF receptor is selected from the group consisting of GF receptors. (Item 25) A method for producing an antibody, the method comprising: and a second mRNA encoding a light chain, wherein the antibody binds to the cell. The method according to claim 1, (Item 26) 26. The method of item 25, wherein the cell is a mammalian cell. (Item 27) 27. The method of item 25 or 26, wherein the cell is a human cell. (Item 28) 28. The method according to any one of items 25 to 27, wherein the cells are cultured cells. (Item 29) 28. The method according to any one of items 25 to 27, wherein the cell is an in vivo cell. (Item 30) 30. The method of any one of items 25 to 29, wherein the antibody is expressed intracellularly. (Item 31) 31. The method according to any one of items 25 to 30, wherein the antibody is secreted by the cell. . (Item 32) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio ranging from about 10:1 to 1:10. How to. (Item 33) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain Item 33. The method according to item 32, wherein the and are present in a ratio ranging from about 4:1 to 1:4. (Item 34) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 34. The method of claim 33, wherein said α-aminobutyric acid and α-aminobutyric acid are present in a ratio of about 4:1. (Item 35) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 35. The method according to any one of items 25 to 34, wherein and are present in a ratio of greater than 1. (Item 36) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 35. The method according to any one of items 25 to 34, wherein and are present in a ratio of about 1:1. (Item 37) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 37. The method according to any one of items 25 to 36, wherein the compound is encapsulated in one or more liposomes. method. (Item 38) Item 3. The first mRNA and the second mRNA are encapsulated in separate liposomes. 7. The method according to claim 7. (Item 39) Item 37. The first mRNA and the second mRNA are encapsulated in the same liposome. The method according to (Item 40) The one or more liposomes may be composed of cationic lipids, neutral lipids, cholesterol-based lipids, 40. The method according to any one of items 37 to 39, comprising one or more of: How to. (Item 41) a first mRNA encoding a heavy chain and a second mRNA encoding a light chain of the antibody, The first mRNA and the second mRNA are encapsulated in one or more liposomes. , composition. (Item 42) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 42. The composition according to item 41, wherein the and are present in a ratio ranging from about 10:1 to 1:10. (Item 43) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain Item 43. The composition according to item 42, wherein the and are present in a ratio ranging from about 4:1 to 1:4. (Item 44) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain and are present in a ratio of about 4:1. (Item 45) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 45. The composition according to any one of items 41 to 44, wherein and are present in a ratio of greater than 1. (Item 46) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 45. The composition according to any one of items 41 to 44, wherein said and are present in a ratio of about 1:1. (Item 47) the first mRNA encoding the heavy chain and the second mRNA encoding the light chain 47. The method according to any one of items 41 to 46, wherein the compound is encapsulated in one or more liposomes. composition. (Item 48) Item 4. The first mRNA and the second mRNA are encapsulated in separate liposomes. 8. The composition described in 7. (Item 49) Item 47. The first mRNA and the second mRNA are encapsulated in the same liposome. The composition described in (Item 50) The one or more liposomes may be composed of cationic lipids, neutral lipids, cholesterol-based lipids, 50. The method according to any one of items 41 to 49, comprising one or more of: Composition of. (Item 51) The one or more liposomes are about 250 nm, 225 nm, 200 nm, 175 nm m, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less in size The composition according to any one of Items 41 to 50,

Claims

1. 1. A composition for in vivo delivery of an antibody to a subject in need thereof, comprising: the composition comprises a first mRNA polynucleotide encoding a heavy chain of the antibody and a second mRNA polynucleotide encoding a light chain of the antibody; the first mRNA polynucleotide and the second mRNA polynucleotide are separate and each comprises a sequence represented by SEQ ID NO:9 encoding a signal peptide; the first mRNA and the second mRNA are encapsulated in liposomes, each liposome comprising a cationic lipid, a non-cationic lipid, and a PEG-modified lipid; The composition, wherein the antibody is detectable in the serum of the subject for greater than 72 hours after administration.

2. 2. The composition of claim 1, wherein the first and second mRNA polynucleotides are present in a ratio ranging from 10:1 to 1:

10.

3. 3. The composition of claim 2, wherein the first mRNA polynucleotide and the second mRNA polynucleotide are present in a ratio of 4:

1.

4. The composition of claim 2 , wherein the first mRNA polynucleotide and the second mRNA polynucleotide are present in a 1:1 ratio.

5. The composition of claim 1 , wherein each of the liposomes comprises a cationic lipid, a neutral lipid, a cholesterol-based lipid, and a PEG-modified lipid.

6. The composition of claim 1 , wherein the liposomes have an average size of 150 nm or less, 100 nm or less, or 75 nm or less.

7. 2. The composition of claim 1, wherein the first mRNA polynucleotide and the second mRNA polynucleotide are modified to include modified nucleotides.

8. The first mRNA polynucleotide and the second mRNA polynucleotide are The composition of claim 1 which is a modification.

9. The composition of claim 1 , which is administered intravenously or intraperitoneally.

10. The composition of claim 1 , wherein the antibody is detectable in the serum of the subject for greater than 96 hours or 120 hours after administration.

11. The composition of claim 1 , wherein the antibody is an intact immunoglobulin.

12. The composition of claim 1 , wherein the first mRNA polynucleotide and the second mRNA polynucleotide are encapsulated in the same liposome.

13. The composition of claim 1 , wherein the first mRNA polynucleotide and the second mRNA polynucleotide are encapsulated in separate liposomes.

14. The composition of claim 1 , wherein the cationic lipid comprises 5% to 50% of the total lipid in the liposome.

15. The composition of claim 1 , wherein the cationic lipid comprises 10% to 40% of the total lipid in the liposome.

16. The composition of claim 1 , wherein the PEG-modified lipid comprises 0.5% to 20% of the total lipid in the liposome.

17. The composition of claim 1 , wherein the PEG-modified lipid comprises 4% to 10% of the total lipid in the liposome.

Images