Treatment for diseases caused by dominant mutant genes

Abstract

Provided is a novel therapeutic agent for a disease caused by a dominant mutant gene (7). The therapeutic agent according to the present invention comprises a donor DNA (20) that contains a polynucleotide having the following sequences (a) to (c). (a) A normal gene (1); (b) a first inverted target sequence (2a) that is located upstream of the normal gene (1) and cleaved with a designer nuclease; and (c) a second inverted target sequence (2b) that is located downstream of the normal gene (1) and cleaved with a designer nuclease. The inverted target sequences (2a, 2b) each mean a sequence obtained by inverting a target sequence (6) that is present in genome and is cleaved with a designer nuclease.

Description

[Technical field]

[0001] The present invention relates to a therapeutic agent for a disease caused by a dominant mutant gene. [Background technology]

[0002] Diseases caused by gene mutations include those caused by recessive mutant genes and those caused by dominant mutant genes. The former disease occurs when a patient has a homozygous mutant gene, while the latter disease occurs even when a patient has a heterozygous mutant gene. This is because a protein derived from a recessive mutant gene does not inhibit the function of a protein derived from a normal gene, whereas a protein derived from a dominant mutant gene inhibits the function of a protein derived from a normal gene or acquires activity greater than that of a normal protein, causing an excessive cellular response. In addition, dominant mutations also include cases where a mutation causes a shortage of a protein derived from a normal gene (haploinsufficiency).

[0003] Due to these differences, the treatment strategies for gene therapy are different for diseases caused by recessive mutant genes and those caused by dominant mutant genes. For the former diseases, progress is being made in the development of treatments that introduce normal genes into patients. On the other hand, for the latter diseases, it is necessary to develop treatments that replace the mutated base sequence in the genome with a normal base sequence, and the development of such treatments is currently required.

[0004] Meanwhile, in the field of basic research, the development of genome editing technology has been attracting attention in recent years, and various genome editing technologies have been developed (see Patent Documents 1 and 2). Patent Document 1 discloses a method for regulating the transcription of a target nucleic acid by contacting the target nucleic acid with a Cas9 polypeptide and a DNA-targeting RNA. Patent Document 2 discloses a method for incorporating an exogenous DNA sequence into the genome of a non-dividing cell without relying on homology. There are also attempts to apply such genome editing technology to various fields. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2013 / 176772 Brochure [Patent Document 2] International Publication No. 2018 / 013932 Brochure Summary of the Invention [Problem to be solved by the invention]

[0006] Whether a gene mutation is recessive or dominant is determined by family analysis and genetic testing. However, previous diagnostic findings allow for the distinction between recessive and dominant types based on the causative gene of the disease (e.g., the rhodopsin gene is dominant, and the usherin gene is recessive). Even for diseases caused by the same causative gene, the mutation site often differs from patient to patient. Therefore, in the treatment of diseases caused by dominant mutant genes, it is necessary to replace the mutated base with a normal base for each patient. However, this task requires a huge amount of effort and cost, which is an obstacle to formulation.

[0007] The present invention has been made in consideration of the above-mentioned problems, and an object of the present invention is to provide a novel therapeutic agent for diseases caused by dominant mutant genes. [Means for solving the problem]

[0008] In order to solve the above problems, a therapeutic agent according to one aspect of the present invention comprises: A therapeutic agent for a disease caused by a dominant mutation gene in which a dominant mutation occurs in a normal gene in a genome, comprising: The therapeutic agent includes a donor DNA containing a polynucleotide having the following sequences (a) to (c): (a) the normal gene; (b) a first inverted target sequence located upstream of the normal gene and cleaved by the designer nuclease; (c) a second inverted target sequence located downstream of the normal gene and cleaved by the designer nuclease; (Here, the inverted target sequence refers to an inverted target sequence that is present in the genome and is cleaved by the designer nuclease.) Effect of the Invention

[0009] According to one aspect of the present invention, a novel therapeutic agent for a disease caused by a dominant mutant gene is provided. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 is a schematic diagram showing the function of a therapeutic agent according to one embodiment of the present invention. [Diagram 2] FIG. 1 is a schematic diagram showing an example in which a therapeutic agent according to one embodiment of the present invention is applied to repair of a rhodopsin gene. [Diagram 3] This figure shows the disadvantages of applying conventional genome editing technology to repair the rhodopsin gene. [Figure 4] FIG. 1 shows the three types of gRNAs examined in the rhodopsin gene repair experiment. [Diagram 5] This is a schematic diagram showing the structure of the donor DNA used in the rhodopsin gene repair experiment. [Figure 6] FIG. 1 is a schematic diagram showing an outline of an experimental procedure for a rhodopsin gene repair experiment. [Figure 7] 1 shows micrographs depicting the results of a rhodopsin gene restoration experiment, depicting rhodopsin expression in the retina. [Figure 8] 1 shows micrographs depicting the results of a rhodopsin gene restoration experiment, depicting rhodopsin expression in retinal sections. [Figure 9] 1 is a graph showing the results of a rhodopsin gene repair experiment, showing the knock-in efficiency for each gRNA. [Figure 10] 1 shows microscopic images representing the results of a rhodopsin gene repair experiment, and is a fluorescent staining image using an anti-rhodopsin antibody. [Figure 11] 1 shows micrographs depicting the results of an experiment to restore the rhodopsin gene by non-viral delivery (electroporation), demonstrating expression of rhodopsin in the retina. [Figure 12] 1 shows micrographs depicting the results of an experiment to restore the rhodopsin gene by viral delivery (AAV vector), depicting the expression of rhodopsin in the retina. [Figure 13] 1 shows micrographs depicting the results of an experiment to restore the rhodopsin gene by viral delivery (AAV vector), depicting the expression of rhodopsin in retinal sections. [Figure 14] 1 shows microscopic images showing the results of a rhodopsin gene restoration experiment, demonstrating that knock-in of the normal rhodopsin gene suppressed retinal degeneration. [Figure 15] 1 shows microscopic images showing the results of a rhodopsin gene repair experiment, in which rhodopsin expression was confirmed from fundus images. [Figure 16] 1 is a graph showing the results of a rhodopsin gene repair experiment. 2 is a graph showing the results of visual functional eye response (qOMR). [Figure 17] FIG. 1 shows the location of the gRNA recognition sequence selected upstream of exon 1 of the human rhodopsin gene. [Figure 18] FIG. 1 is a schematic diagram showing an outline of an SSA assay for verifying the cleavage efficiency of a gRNA recognition sequence. [Figure 19] 1 shows microscopic images depicting the results of an SSA assay, demonstrating EGFP expression. [Figure 20] FIG. 1 is a schematic diagram showing the structure of a donor DNA for a normal human rhodopsin gene. [Figure 21] FIG. 1 shows the locations of three types of gRNA recognition sequences examined in the peripherin gene repair experiment. [Figure 22]FIG. 2 is a schematic diagram showing the structure of the donor DNA used in the peripherin gene repair experiment. [Diagram 23] 1 shows microscopic images representing the results of a peripherin gene repair experiment, depicting peripherin expression. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] An embodiment of the present invention will be described below, but the present invention is not limited to each of the configurations described below, and various modifications are possible within the scope of the claims. Embodiments and examples obtained by appropriately combining the technical means disclosed in different embodiments and examples are also included in the technical scope of the present invention.

[0012] All of the journal and patent literature cited herein is hereby incorporated by reference.

[0013] Unless otherwise specified in this specification, "A to B" expressing a numerical range means "A or more, and B or less."

[0014] 1. Therapeutic agents for diseases caused by dominant mutant genes In one embodiment, the present invention provides a therapeutic agent for a disease caused by a dominant mutant gene in which a dominant mutation has occurred in a normal gene in a genome. The therapeutic agent comprises a donor DNA containing a polynucleotide having the following sequences (a) to (c): (a) a normal gene; (b) a first inverted target sequence located upstream of the normal gene and cleaved by a designer nuclease; and (c) a second inverted target sequence located downstream of the normal gene and cleaved by a designer nuclease.

[0015] [Mechanism of action of therapeutic agents] Hereinafter, the mechanism of action of a therapeutic agent according to one embodiment of the present invention will be described with reference to FIG. 1. FIG. 1 illustrates a genome 10 before treatment, a donor DNA 20, and a genome 30 after treatment. A therapeutic agent according to one embodiment of the present invention includes donor DNA 20. Donor DNA 20 includes a normal gene 1, and knocking in the normal gene 1 into the genome knocks out a dominant mutant gene 7. As a result, a disease caused by the dominant mutant gene 7 is treated.

[0016] In FIG. 1, the pre-treatment genome 10, the donor DNA 20, and the post-treatment genome 30 are all drawn in the direction from upstream A to downstream B. In the pre-treatment genome 10 and the post-treatment genome 30, the 5' side is "upstream" and the 3' side is "downstream" with respect to the nucleotide chain in which the endogenous dominant mutant gene 7 is encoded. With respect to the nucleotide chain complementary to the above nucleotide chain, the 3' side is "upstream" and the 5' side is "downstream".

[0017] On the other hand, in the donor DNA 20, with respect to the nucleotide chain encoding the normal gene 1, the 5' side is "upstream" and the 3' side is "downstream". With respect to the nucleotide chain complementary to the above nucleotide chain, the 3' side is "upstream" and the 5' side is "downstream". The donor DNA 20 may be a single-stranded DNA that does not have a complementary nucleotide chain.

[0018] The first row of Fig. 1 is a schematic diagram showing a genome 10 before treatment with a therapeutic agent according to one embodiment of the present invention. The genome 10 before treatment contains a promoter sequence 5 and a dominant mutation gene 7. As a result, a translation product of the dominant mutation gene 7 is produced, resulting in various diseases.

[0019] Between the promoter sequence 5 and the dominant mutant gene 7, there is a target sequence 6, and the target sequence 6 contains a cleavage site C. In one embodiment, at least a part of the target sequence 6 is recognized by a properly designed nucleic acid binding site of a designer nuclease, and the cleavage site C is cleaved by the nuclease site of the designer nuclease. The designer nuclease in this embodiment includes a TALE nuclease (TALEN), a zinc finger nuclease (ZFN), and the like. In another embodiment, at least a part of the target sequence 6 is recognized by a properly designed gRNA, and the cleavage site C is cleaved by the nuclease site of the designer nuclease. The designer nuclease in this embodiment includes a Cas nuclease, and the like. In this case, it is preferable that the end of the DNA cleaved by the designer nuclease is blunt. This is because if the cut end of the DNA is blunt, it is easy to insert a normal gene by DNA repair by NHEJ after cleavage.

[0020] Designer nucleases that meet these criteria include Cas nucleases (CRISPR-associated nucleases; including naturally occurring Cas nucleases (e.g., Cas9) and engineered variants (e.g., dCas)), TALE nucleases (TALENs), zinc finger nucleases (ZFNs), and pentatricopeptide repeat (PPR) proteins.

[0021] The position of the target sequence 6 is not particularly limited as long as the normal gene 1 can be controlled by the promoter sequence 5 when the normal gene 1 is inserted at the cleavage site C. The position of the target sequence 6 may be, for example, (i) between the promoter sequence 5 and the dominant mutant gene 7, or (ii) inside the dominant mutant gene 7 (for example, inside exon 1).

[0022] The second row of Fig. 1 is a schematic diagram showing a donor DNA 20 contained in a therapeutic agent according to one embodiment of the present invention. The donor DNA 20 contains a polynucleotide having the sequences of a normal gene 1, a first inverted target sequence 2a, and a second inverted target sequence 2b. The order of these sequences from upstream is the first inverted target sequence 2a, the normal gene 1, and the second inverted target sequence 2b.

[0023] Normal gene 1 means a gene encoding a protein that functions substantially normally. Here, when a protein has multiple functions, if at least one of the functions is substantially normal, it can be considered as a "protein that functions substantially normally". For example, when the function of the protein is some activity (such as gene expression activity), the intensity of the activity measured by an appropriate assay can be 80% or more, 90% or more, or 95% or more of the activity of the wild-type protein (the upper limit can be 120% or less, 110% or less, or 105% or less). In one embodiment, normal gene 1 is a wild-type gene.

[0024] The sequences of the first reverse target sequence 2a and the second reverse target sequence 2b are the inverted sequences of the target sequence 6. In other words, the base sequence of the target sequence 6 when read from the upstream side coincides with the base sequence of the first reverse target sequence 2a and the second reverse target sequence 2b when read from the downstream side. Therefore, the first reverse target sequence 2a and the second reverse target sequence 2b also contain the cleavage site C.

[0025] The third row of FIG. 1 is a schematic diagram showing a genome 30 after treatment with a therapeutic agent according to one embodiment of the present invention. Due to the action of a designer nuclease (not shown), the normal gene 1 in the donor DNA is inserted between the promoter sequence 5 and the dominant mutant gene 7 by utilizing non-homologous end repair (NHEJ). By inserting the dominant mutant gene 7 downstream of the promoter sequence 5, the product of the normal gene 1 is produced by the promoter sequence 5 (knock-in). On the other hand, since at least a stop codon is located at the end of the normal gene 1, leakage (expression leakage) of the dominant mutant gene 7 accompanying transcription of the normal gene 1 does not occur.

[0026] In addition, in the above mechanism, gRNA (not shown) may be involved. For example, when the designer nuclease is a Cas nuclease, the Cas nuclease and the gRNA cooperate to cleave the double-stranded DNA.

[0027] Here, the target sequence 6, which was present in the genome 10 before the treatment, disappears after the treatment (9a, 9b). Therefore, once the normal gene 1 is inserted, this normal gene 1 is not removed by the action of the designer nuclease.

[0028] In NHEJ, the inserted sequence may be inserted in the reversed position from the intended direction (fourth row in Figure 1). The inverted inserted genome 30' contains the normal gene (inverted) 1'. When such an insertion occurs, the normal product of the normal gene 1 is not produced. However, the inverted inserted genome 30' has the target sequence 6 located upstream and downstream of the normal gene (inverted) 1'. Therefore, the normal gene (inverted) 1' is excised by the action of the designer nuclease, and the genome is repaired again using NHEJ.

[0029] In this way, the therapeutic agent according to one embodiment of the present invention can insert normal gene 1 in the correct orientation while utilizing NHEJ.

[0030] [Various aspects of the therapeutic agent] In one embodiment, the therapeutic agent comprises a gRNA and / or a designer nuclease. The gRNA and / or the designer nuclease may be contained in the therapeutic agent in the form of an expression vector, an RNA, or a protein. The gRNA and the designer nuclease may also be fused to each other to form a single structure.

[0031] In the above embodiment, the main elements required for genome editing are contained in the therapeutic agent, and therefore, the disease caused by the dominant mutant gene can be more efficiently treated by using only the therapeutic agent.

[0032] In one embodiment, the donor DNA 20 includes a transcription control sequence between the normal gene 1 and the second reverse target sequence 2b. The transcription control sequence is a sequence that controls (e.g., enhances or suppresses) the production of a transcription product (mRNA) from a gene. In one embodiment, the transcription control sequence is a transcription suppression sequence. In one embodiment, the transcription control sequence is a non-translated sequence (3' non-translated region) located on the 3' end side of a gene. Other specific examples of the transcription control sequence include polyA addition sequences (SV40pA, rabbit globin polyA, bGH polyA). In addition, a sequence that combines a polyA addition sequence and an insulator sequence (a border sequence; a sequence that prevents effects caused by sequences outside the inserted gene) can also be used as the transcription control sequence.

[0033] In the above embodiment, the transcription control sequence is located between the normal gene 1 and the dominant mutant gene 7 in the post-treatment genome 30. Therefore, for example, leakage (expression leakage) of the dominant mutant gene 7 accompanying the transcription of the normal gene 1 can be more reliably inhibited. In cells in which the dominant mutant gene 7 is strongly expressed, such an embodiment is particularly advantageous.

[0034] In one embodiment, the therapeutic agent is used for non-dividing cells. As described above, the therapeutic agent according to one embodiment of the present invention utilizes NHEJ. Therefore, it is preferable to apply the therapeutic agent to cells that have a high efficiency of repairing DNA strand breaks caused by NHEJ. Generally, non-dividing cells use NHEJ more frequently to repair DNA strand breaks than dividing cells. Therefore, it is preferable to use the therapeutic agent for non-dividing cells. Examples of non-dividing cells include photoreceptor cells (rod photoreceptor cells, cone photoreceptor cells), retinal pigment epithelial cells, and optic nerve cells.

[0035] In one embodiment, the normal gene 1 is one or more selected from the group consisting of a rhodopsin gene, a peripherin gene, a BEST1 gene, and an OPTN gene. In one embodiment, the normal gene 1 is a rhodopsin gene, a peripherin gene, a BEST1 gene, or an OPTN gene.

[0036] In one embodiment, the disease caused by the dominant mutant gene is one or more selected from the group consisting of retinitis pigmentosa, macular dystrophy and hereditary glaucoma.In one embodiment, the disease caused by the dominant mutant gene is retinitis pigmentosa, macular dystrophy or hereditary glaucoma.

[0037] The structure of the normal gene 1 is not particularly limited as long as a normal gene product can be obtained. The normal gene 1 may or may not have an internal untranslated region. In one embodiment, the normal gene 1 is a cDNA of a normal gene product. In one embodiment, the normal gene 1 is a cDNA of a wild-type gene product.

[0038] When the normal gene 1 does not have an untranslated region, the genome size of the donor DNA 20 can be reduced, which is advantageous when the donor DNA 20 is incorporated into a vector (plasmid vector, viral vector, etc.).

[0039] When the components contained in the therapeutic agent are introduced into cells by a vector, the vector used is not particularly limited. The therapeutic agent components that can be introduced by a vector include donor DNA20, gRNA expression vectors, and designer nuclease expression vectors. The introduction method into cells using various vectors may be performed using known techniques.

[0040] At least two components selected from the group consisting of donor DNA 20, gRNA, and designer nuclease may be configured as one vector. For example, (i) gRNA and designer nuclease, (ii) donor DNA 20 and gRNA, (iii) donor DNA 20 and designer nuclease, or (iv) donor DNA 20, gRNA, and designer nuclease may be configured as one vector.

[0041] Specific examples of vectors include phage vectors, plasmid vectors, virus vectors, retrovirus vectors, chromosome vectors, episomal vectors, virus-derived vectors (bacterial plasmids, bacteriophages, yeast episomes, etc.), yeast chromosome elements, viruses (baculoviruses, papovaviruses, vaccinia viruses, adenoviruses, adeno-associated viruses, avian poxviruses, pseudorabies viruses, herpes viruses, lentiviruses, retroviruses, etc.), and vectors derived from combinations thereof (cosmids, phagemids, etc.). Among the above, plasmid vectors are preferred from the viewpoint of high versatility. Furthermore, from the viewpoint of progress in clinical applications, virus vectors are preferred, and adeno-associated virus vectors (AAV vectors) are more preferred.

[0042] Alternatively, the components contained in the therapeutic agent may be introduced into cells without using a vector. For example, donor DNA may be introduced into cells as DNA molecules, gRNA as RNA molecules, and designer nuclease as proteins. Such introduction methods include electroporation, microinjection, sonoporation, laser irradiation, and transfection using complexation with cationic substances (cationic polymers, cationic lipids, calcium phosphate, etc.).

[0043] [kit] One aspect of the present invention is a kit for treating a disease caused by a dominant mutant gene in which a dominant mutation has occurred in a normal gene in a genome. The kit includes the above-mentioned donor DNA.

[0044] When the kit includes a gRNA (or its expression vector) and / or a designer nuclease (or its expression vector), the donor DNA, gRNA, and designer nuclease may be formulated as a single reagent, or may be formulated as two or more separate reagents (e.g., the donor DNA, the gRNA, and the designer nuclease may be formulated as separate reagents), and the two or more reagents may be stored in different containers.

[0045] In one embodiment, a "kit" refers to any combination of reagents and the like for any purpose, which may be medical or experimental.

[0046] [Formulation, dosage form, prescription] The therapeutic agent according to one embodiment of the present invention can be formulated according to a conventional method, more specifically, by mixing the above-mentioned donor DNA, optionally a gRNA and / or a designer nuclease (or an expression vector thereof), and optionally a pharmaceutical additive.

[0047] As used herein, pharmaceutical additives refer to substances other than the active ingredient contained in the formulation. Pharmaceutical additives are contained in the formulation for the purpose of facilitating formulation, stabilizing quality, enhancing usefulness, and the like. Examples of pharmaceutical additives include excipients, binders, disintegrants, lubricants, flow agents (solid prevention agents), colorants, capsule coatings, coating agents, plasticizers, flavoring agents, sweeteners, flavoring agents, solvents, dissolution aids, emulsifiers, suspending agents (adhesives), thickeners, pH adjusters (acidifiers, alkalizers, buffers), wetting agents (solubilizers), antibacterial preservatives, chelating agents, suppository bases, ointment bases, hardeners, softeners, medical water, propellants, stabilizers, and preservatives. These pharmaceutical additives can be easily selected by those skilled in the art according to the intended dosage form and route of administration, as well as standard pharmaceutical practice.

[0048] The therapeutic agent according to one embodiment of the present invention may contain an active ingredient other than the donor DNA, gRNA, and designer nuclease. The active ingredient may have an effect related to the treatment of a disease caused by a dominant mutant gene, or may have other effects.

[0049] Specific examples of the active ingredients and pharmaceutical additives described above can be found in standards established by, for example, the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA), the Ministry of Health, Labor and Welfare of Japan, and the like.

[0050] The therapeutic agent according to one embodiment of the present invention may be in any dosage form, including, for example, eye drops, tablets, capsules, internal preparations, external preparations, suppositories, injections, and inhalants.

[0051] The therapeutic agent according to one embodiment of the present invention may be prescribed as appropriate based on the judgment of a doctor or medical professional. The dosage and administration schedule of the therapeutic agent according to one embodiment of the present invention may also be determined as appropriate based on the judgment of a doctor or medical professional.

[0052] The administration route of the therapeutic agent according to one embodiment of the present invention is appropriately selected depending on factors such as the dosage form of the therapeutic agent, the type and severity of the disease to be treated, etc. Examples of the administration route include ophthalmic administration, parenteral administration, intradermal administration, intramuscular administration, intraperitoneal administration, intravenous administration, subcutaneous administration, intranasal administration, epidural administration, oral administration, sublingual administration, intranasal administration, intracerebral administration, intravaginal administration, transdermal administration, intrarectal administration, inhalation, and topical administration.

[0053] The "subject" to which the therapeutic agent according to one embodiment of the present invention is administered is not limited to humans. It can also be applied to non-human mammals. The non-human mammals include ungulates (cattle, wild boar, pig, sheep, goat, etc.), perissodactyls (horses, etc.), rodents (mice, rats, hamsters, squirrels, etc.), lagomorphs (rabbits, etc.), and carnivores (dogs, cats, ferrets, etc.). The non-human mammals mentioned above include livestock or companion animals (pets), as well as wild animals.

[0054] The therapeutic agent according to one embodiment of the present invention can also be used in systems other than living organisms, for example, systems derived from living organisms (such as excised tissues and cultured cells).

[0055] 2. Therapeutic agents for diseases caused by dominant mutations in the rhodopsin gene In one embodiment, the present invention provides a therapeutic agent for a disease caused by a dominant mutant rhodopsin gene in which a dominant mutation has occurred in a normal rhodopsin gene in a genome. The therapeutic agent comprises a donor DNA containing a polynucleotide having the following sequences (a) to (c): (a) a normal rhodopsin gene; (b) a first inverted target sequence located upstream of the normal rhodopsin gene and cleaved by a designer nuclease; and (c) a second inverted target sequence located downstream of the normal rhodopsin gene and cleaved by a designer nuclease.

[0056] An example of the configuration of such a donor DNA is shown in the first row of Figure 2. In the figure, "Rho cDNA" is the cDNA of normal rhodopsin protein, and corresponds to the "normal rhodopsin gene". In addition, the "reverse gRNA sequence" corresponds to the first and second reverse target sequences. In the example of Figure 2, Cas9 is used as the designer nuclease, so the first and second reverse target sequences are sequences recognized by the gRNA. AcGFP is a marker protein that determines whether the insertion of the normal rhodopsin gene was successful, and does not need to be included in the therapeutic agent.

[0057] The above-mentioned therapeutic agent knocks in the normal rhodopsin gene between the promoter of the endogenous rhodopsin gene and exon 1 of the dominant mutant rhodopsin gene, resulting in the knockout of the dominant mutant rhodopsin gene (middle and bottom panels of FIG. 2).

[0058] In one embodiment, the therapeutic agent contains a gRNA and / or a designer nuclease. The gRNA and / or the designer nuclease may be contained in the therapeutic agent in the form of an expression vector. The gRNA and the designer nuclease may be fused to each other to form a single structure. In one embodiment, the donor DNA contains a transcription control sequence between the normal rhodopsin gene and the second inverted target sequence (this corresponds to "3'UTR" in FIG. 2). These points are as described in Section [1], so further explanation will be omitted.

[0059] In one embodiment, the donor DNA further contains a sequence that enhances the expression of a normal rhodopsin gene. In FIG. 2, this corresponds to a "chimeric intron." This sequence is a chimeric intron derived from a human β-globin gene and an immunoglobulin gene, and is known to improve the expression level of a protein in a cultured cell system (Choi T et al. (1991) "A Generic Intron Increases Gene Expression in Transgenic Mice," Molecular and Cellular Biology, Vol.11(No.6), pp.3070-3074; Sakurai K et al. (2007) "Physiological Properties of Rod Photoreceptor Cells in Green-sensitive Cone Pigment Knock-in Mice," Journal of General Physiology, Vol.130(No.1), pp.21-40.).

[0060] In one embodiment, the expression cassette of the normal rhodopsin gene is inserted into a pLeaklessIII plasmid. That is, the donor DNA is inserted into a pLeaklessIII plasmid. The pLeaklessIII plasmid is a vector in which the effect of endogenous factors of the plasmid on the transcription activity of the insert is reduced (for details, see Tunekawa Y et al. (2016) "Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain," Deveopment, Vol.143(Issue 17), pp.3216-3222.).

[0061] The above-mentioned configuration can increase the probability of inserting the normal rhodopsin gene from the donor DNA into the genomic DNA, and the expression efficiency of the normal rhodopsin gene (for details, see the Examples of the present application and FIG. 11).

[0062] In one embodiment, the therapeutic agent further comprises an expression vector for gRNA and an expression vector for designer nuclease, which are delivered into the cell by non-viral delivery. In this case, the expression cassette for gRNA is placed on a different vector from the expression cassette for normal rhodopsin gene and / or the expression cassette for designer nuclease. For example, the expression cassette for gRNA and the expression cassette for normal rhodopsin gene and / or the expression cassette for designer nuclease are inserted into different plasmids.

[0063] The above-mentioned configuration can increase the expression efficiency of the normal rhodopsin gene (for details, see the Examples and FIG. 11 of the present application). This effect is exhibited when non-viral delivery is employed (electroporation, etc.). When viral delivery is employed, the preferred conditions are different.

[0064] In one embodiment, the therapeutic agent further comprises an expression vector for gRNA and an expression vector for designer nuclease, which are delivered into cells by viral delivery. In this case, the donor DNA, the expression vector for gRNA and the expression vector for designer nuclease are preferably composed of AAV vectors. In addition, the AAV vector is preferably one or more selected from the group consisting of AAV2, AAV5, AAV8 and AAV9. These AAV vectors have high affinity for photoreceptor cells, and therefore can efficiently deliver the active ingredient of the therapeutic agent to photoreceptor cells.

[0065] In an embodiment using an AAV vector, it is preferable that the donor DNA, the gRNA expression vector, and the designer nuclease expression vector are each constructed using different AAV vectors.

[0066] By adopting the above-mentioned configuration, the expression efficiency of the normal rhodopsin gene can be increased (for details, see the Examples of the present application and FIG. 12).

[0067] In one embodiment, the sequence recognized by the gRNA is SEQ ID NO: 6 (gRNA1: TCTGTCTACGAAGAGCCCGTGGG) or SEQ ID NO: 8 (gRNA3: CTGAGCTCGCCAAGCAGCCTTGG). According to the above configuration, the efficiency of knock-in by NHEJ can be improved.

[0068] For example, when the therapeutic agent according to one embodiment of the present invention is applied to the treatment of eye diseases in humans, the administration method of the therapeutic agent is preferably subretinal injection, vitreous injection, and suprachoroidal injection. In addition, by administering the therapeutic agent, for example, in patients with retinitis pigmentosa, the following effects can be achieved: (i) prevention of degeneration of photoreceptor cells and / or recovery of degenerated photoreceptor cells, (ii) prevention of deterioration of photoreceptor function and / or recovery of deteriorated photoreceptor function, and (iii) prevention of deterioration of visual function and / or recovery of deteriorated visual function.

[0069] [Advantages of treatment for dominant mutant rhodopsin gene] Hereinafter, the advantages of applying a therapeutic agent according to one embodiment of the present invention to the treatment of a dominant mutant rhodopsin gene will be described with reference to Figures 2 and 3. An example of a disease caused by a dominant mutant rhodopsin gene is retinitis pigmentosa. This disease can be a hereditary blindness disease caused by cell death of photoreceptor cells (rod photoreceptor cells). Patients with retinitis pigmentosa caused by mutations in the rhodopsin gene account for approximately 6% of all patients with retinitis pigmentosa.

[0070] Human rhodopsin protein is a light-sensitive G protein-coupled receptor (GPCR) specific to rod photoreceptors, consisting of approximately 348 amino acids. This protein is localized in the disc membrane of the rod photoreceptor outer segment. The rhodopsin gene (Rho), which encodes the rhodopsin protein, contains five exons and is composed of a coding region (CDS; 10 kb) that is translated into protein, a 5' untranslated region (1.5 kb), and a 3' untranslated region (poly A addition sequence, etc.; approximately 2 kb) (Figure 2). According to previous reports, genetic diagnosis of retinitis pigmentosa patients with mutations in the rhodopsin gene has revealed 110 types of gene mutations, including overt mutations (Figure 3).

[0071] Conventional genome editing technology is based on the strategy of "deleting the mutation and inserting the correct gene," so it is necessary to design appropriate gRNA and donor DNA for each of these 110 types of gene mutations. In addition, many genome editing technologies utilize homologous recombination repair (HDR). HDR occurs frequently in dividing cells, but occurs less frequently in non-dividing cells. In this regard, photoreceptor cells expressing the dominant mutant rhodopsin gene are non-dividing cells. In other words, it is difficult to efficiently treat photoreceptor cells with the mainstream of conventional genome editing technology.

[0072] In contrast, the therapeutic agent according to one embodiment of the present invention knocks out the dominant mutant rhodopsin gene by knocking in the normal rhodopsin gene between the promoter sequence and the dominant mutant rhodopsin gene. In other words, the same gRNA and donor DNA can be used regardless of the genetic mutation contained in the dominant mutant rhodopsin gene (even if it is an unknown mutation). In addition, since this therapeutic agent utilizes NHEJ, genome editing can be efficiently performed even in photoreceptor cells, which are non-dividing cells.

[0073] 〔others〕 The present invention also includes the following aspects.

[0074] [1] A therapeutic agent for a disease caused by a dominant mutant rhodopsin gene in which a dominant mutation has occurred in a normal rhodopsin gene in a genome, comprising: The therapeutic agent includes a donor DNA containing a polynucleotide having the following sequences (a) to (c): (a) the normal rhodopsin gene; (b) a first inverted target sequence located upstream of the normal rhodopsin gene and cleaved by the designer nuclease; (c) a second inverted target sequence located downstream of the normal rhodopsin gene and cleaved by the designer nuclease; (where: The inverted target sequence refers to an inverted version of the target sequence present in the genome and cleaved by the designer nuclease.

[0075] [2] The therapeutic agent according to [1], wherein the donor DNA further contains the following sequence (d): (d) a transcriptional control sequence located between the normal gene and the second inverted target sequence.

[0076] [3] The therapeutic agent according to [1] or [2], further comprising the following (i) and / or (ii): (i) gRNA or an expression vector for said gRNA (ii) The designer nuclease described above, or an expression vector for the designer nuclease.

[0077] [4] The therapeutic agent according to any one of [1] to [3], wherein the donor DNA further comprises a sequence that highly expresses the normal rhodopsin gene.

[0078] [5] The donor DNA is delivered into the cell by non-viral delivery; The therapeutic agent according to any one of [1] to [4], wherein the expression cassette for the normal rhodopsin gene is inserted into a pLeaklessIII plasmid.

[0079] [6] the therapeutic agent further comprises an expression vector for the gRNA and an expression vector for the designer nuclease; the donor DNA, the gRNA expression vector and the designer nuclease expression vector are delivered into a cell by non-viral delivery; The therapeutic agent according to [5], wherein the expression cassette of the gRNA is placed on a vector different from the expression cassette of the normal rhodopsin gene and / or the expression cassette of the designer nuclease.

[0080] [7] the therapeutic agent further comprises an expression vector for the gRNA and an expression vector for the designer nuclease; the donor DNA, the gRNA expression vector, and the designer nuclease expression vector are comprised of an AAV vector; The therapeutic agent according to any one of [1] to [4], wherein the AAV vector is one or more types selected from the group consisting of AAV2, AAV5, AAV8 and AAV9.

[0081] [8] The therapeutic agent described in [7], wherein the donor DNA, the expression vector for the gRNA, and the expression vector for the designer nuclease are each composed of different AAV vectors.

[0082] [9] The therapeutic agent according to any one of [1] to [9], wherein the sequence recognized by the gRNA is SEQ ID NO: 6 or SEQ ID NO: 8.

[0083] <1> The method includes a step of administering the therapeutic agent to a subject (e.g., a human or a non-human mammal (such as a cow, pig, sheep, goat, horse, dog, cat, rabbit, mouse, or rat)), The above-mentioned therapeutic agent contains a donor DNA including a polynucleotide having the following sequences (a) to (c): (a) the normal gene; (b) a first inverted target sequence located upstream of the normal gene and cleaved by the designer nuclease; (c) a second inverted target sequence located downstream of the normal gene and cleaved by the designer nuclease; (Here, the inverted target sequence refers to an inverted target sequence that is present in the genome and is cleaved by the designer nuclease.)

[0084] <2> The donor DNA further comprises the following sequence (d): <1> The treatment method described herein is as follows: (d) a transcriptional control sequence located between the normal gene and the second inverted target sequence.

[0085] <3> The therapeutic agent further comprises the following (i) and / or (ii): <1> or <2> The treatment method described herein is as follows: (i) a gRNA or an expression vector for the gRNA; (ii) The designer nuclease described above, or an expression vector for the designer nuclease.

[0086] <4> The therapeutic agent is used for non-dividing cells. <1> ~ <3> 2. The method of treatment according to claim 1 ,

[0087] <5> The normal gene is one or more selected from the group consisting of a rhodopsin gene, a peripherin gene, a peripherin gene, a BEST1 gene, and an OPTN gene. <1> ~ <4> 2. The method of treatment according to claim 1 ,

[0088] <6> The disease is one or more selected from the group consisting of retinitis pigmentosa, macular dystrophy and hereditary glaucoma; <1> ~ <5> 2. The method of treatment according to claim 1 ,

[0089] (1) A therapeutic agent for a disease caused by a dominant mutation gene in which a dominant mutation occurs in a normal gene in a genome, comprising: The therapeutic agent includes a donor DNA containing a polynucleotide having the following sequences (a) to (c): (a) the normal gene; (b) a first inverted target sequence located upstream of the normal gene and cleaved by the designer nuclease; (c) a second inverted target sequence located downstream of the normal gene and cleaved by the designer nuclease; (Here, the inverted target sequence refers to an inverted target sequence that is present in the genome and is cleaved by the designer nuclease.)

[0090] (2) The therapeutic agent according to (1), wherein the donor DNA further comprises the following sequence (d): (d) a transcriptional control sequence located between the normal gene and the second inverted target sequence.

[0091] (3) The therapeutic agent according to (1) or (2), further comprising the following (i) and / or (ii): (i) gRNA or an expression vector for said gRNA (ii) The designer nuclease described above, or an expression vector for the designer nuclease.

[0092] (4) The therapeutic agent according to any one of (1) to (3), which is used on non-dividing cells.

[0093] (5) The therapeutic agent according to any one of (1) to (4), wherein the normal gene is one or more selected from the group consisting of a rhodopsin gene, a peripherin gene, a BEST1 gene, and an OPTN gene.

[0094] (6) The therapeutic agent according to any one of (1) to (5), wherein the disease is one or more selected from the group consisting of retinitis pigmentosa, macular dystrophy, and hereditary glaucoma. EXAMPLES

[0095] 〔material〕 [Expression cassette] The following expression cassettes to be incorporated into the vector were prepared according to standard methods.

[0096] 1. Nuclease Expression Cassette The nuclease used was Cas9 (SpCas9) derived from Streptococcus pyogenes (Sequence encoding SpCas9: SEQ ID NO: 1, Uniprot Accession No. Q99ZW2). To express nuclease specifically in rod photoreceptors, a 300 bp (SEQ ID NO: 2, gene location: chr22:56,231,474-56,231,769) or 2.2 kbp (SEQ ID NO: 3, gene location: chr22:56,231,473-56,233,726) region in the bovine rhodopsin promoter was used as a promoter (Gouras P et al. (1994) "Reporter gene expression in cones in transgenic mice carrying bovine rhodopsin promoter / lacZ transgenes," Visual Neuroscience, Vol.11(Issue 6), pp.1227-1231; Matsuda T & Cepko CL (2007) "Controlled expression of transgenes introduced by in vivo electroporation," PNAS, Vol.104(No.3), pp.1027-1032; Onishi A et al. (2010) "The orphan nuclear hormone receptor ERRβ controls rod photoreceptor survival," PNAS, Vol.107(No.25), pp.11579-11584.). In addition, the poly A addition sequence used was the rabbit β-globin poly A addition sequence (SEQ ID NO:4, gene location: chr1:146,236,661-146,237,138). The poly A addition sequence may be changed to other general poly A addition sequences (SV40pA, HGH pA, etc.).

[0097] An expression cassette in which, from upstream to downstream, a 300 bp region of the bovine rhodopsin promoter, a sequence encoding SpCas9, and a polyA addition sequence are arranged is referred to as "Rho300-Cas9." Similarly, an expression cassette in which, from upstream to downstream, a 2.2 kbp region of the bovine rhodopsin promoter, a sequence encoding SpCas9, and a polyA addition sequence are arranged is referred to as "Rho2k-Cas9."

[0098] 2. gRNA Expression Cassette The gRNA sequence is composed of a complex of crRNA, which is a recognition sequence for the target nucleic acid, and tracerRNA, which activates cleavage. To select the sequence recognized by the crRNA, we used the gRNA search engine for the SpCas9 PAM sequence (NGG) (http: / / crispr.technology / ). The sequence of the tracerRNA was 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-3' (SEQ ID NO: 5). The search range was within 100 bp upstream from the translation start point of exon 1. This region is located upstream of exon 1 of the rhodopsin gene and is not evolutionarily conserved. Among the highly specific candidate regions presented by the search, three regions with non-overlapping base sequences were selected. The sequences of each are as follows (see Figure 4 for the positional relationship of the recognition sequences by each gRNA). Recognition sequence of gRNA1: SEQ ID NO: 6 (TCTGTCTACGAAGAGCCCGTGGG; score: high (800)) gRNA2 recognition sequence: SEQ ID NO: 7 (GGCTCTCGAGGCTGCCCCACGGG; score: high (800)) Recognition sequence of gRNA3: SEQ ID NO:8 (CTGAGCTCGCCAAGCAGCCTTGG; score: moderate (600)).

[0099] The expression cassettes containing, from upstream to downstream, the human U6 promoter sequence (gene position chr15: 67,840,082-67,840,309), the sequence of each crRNA, and the tracerRNA sequence are referred to as "U6-gRNA1," "U6-gRNA2," and "U6-gRNA3."

[0100] 3. Normal rhodopsin gene As the normal rhodopsin gene, cDNA of normal mouse rhodopsin protein (SEQ ID NO: 9, Accession No. NM_145383.2) was used.

[0101] Since rhodopsin protein occupies more than 90% of the photoreceptor outer segments, high expression is required for the normal rhodopsin gene to be knocked in. Therefore, a chimeric intron sequence (228 bp (SEQ ID NO: 10), Choi op cit.; Sakurai op cit.) derived from human β-globin gene and immunoglobulin gene was placed upstream of the normal rhodopsin gene. This chimeric intron sequence is used to increase the expression level in protein expression experiments in cultured cells.

[0102] In addition, downstream of the normal rhodopsin gene, the stop codon of the normal rhodopsin gene was deleted. Furthermore, a Furin sequence and a P2A sequence (78 bp; both are autolytic peptide sequences; SEQ ID NO: 11), an AcGFP gene (720 bp; SEQ ID NO: 12), and the 3' untranslated region of the rhodopsin gene (al-Ubaidi MR et al. (1990) "Mouse Opsin: Gene structure and molecular basis of multiple transcripts," Journal of Biological Chemistry, Vol. 265 (No. 33), pp. 20563-20569.) and a 100 bp sequence downstream of the 3' untranslated region (total 2158 bp, SEQ ID NO: 13, gene position: chr6: 115,936,720-115,938,976) were arranged in this order. The Furin and P2A sequences link the expression of the rhodopsin protein and the AcGFP protein (these sequences are cleaved at the C-terminus of the rhodopsin protein and the N-terminus of the AcGFP protein, so they do not affect other proteins). The AcGFP gene is also a reporter for visualizing knock-in and expression of the donor gene.

[0103] Furthermore, reverse target sequences were placed upstream and downstream of the obtained sequence. The reverse target sequence is a sequence (inverted sequence) in which the upstream and downstream of the base sequence of the above-mentioned gRNA are reversed. The expression cassette in which the reverse target sequence corresponding to gRNA1 was selected is called "mRho-HITI-Donor[gRNA1]". The expression cassette in which the reverse target sequence corresponding to gRNA2 was selected is called "mRho-HITI-Donor[gRNA2]". The expression cassette in which the reverse target sequence corresponding to gRNA3 was selected is called "mRho-HITI-Donor[gRNA3]".

[0104] Figure 5 shows a schematic diagram of the structure of the donor gene containing the expression cassette (approximately 4.4 kb) of the normal rhodopsin gene prepared above. If the normal rhodopsin gene is inserted in the reverse direction due to the presence of the reverse target sequence, the inserted sequence is cut again by Cas9. Then, cutting and insertion are repeated until the normal rhodopsin gene is inserted in the forward direction.

[0105] 4.mCherry As a reporter for whether or not a gene has been introduced, a red fluorescent protein, mCherry, was used (sequence encoding mCherry: SEQ ID NO: 14). As a promoter, a CAG promoter (SEQ ID NO: 15) or a 300 bp region of a bovine rhodopsin promoter (SEQ ID NO: 16) was used. As a poly A addition sequence, a rabbit β-globin poly A addition sequence was used. The reporter may be changed to another red fluorescent protein (mRFP, DsRed2, tdTomato, etc.). In addition, the poly A addition sequence may be changed to another general-purpose poly A addition sequence (SV40pA, HGH pA, etc.).

[0106] An expression cassette in which, from upstream, a CAG promoter, a sequence encoding mCherry, and a poly A addition sequence are arranged is called "CAG-mCherry." Similarly, an expression cassette in which, from upstream, a 300 bp region of the bovine rhodopsin promoter, a sequence encoding mCherry, and a poly A addition sequence are arranged is called "Rho300-mCherry."

[0107] In addition, since the mCherry expression cassette is not necessary for therapy based on genome editing, it does not need to be included in the therapeutic agent according to one embodiment of the present invention.

[0108] [Plasmid vector] A plasmid vector having the above-mentioned expression cassette was prepared according to a conventional method. The specific structure of the plasmid vector is as follows.

[0109] 1. Cas9 expression vector The region from the CAG promoter to the polyA sequence of the plasmid pCAGIG (Addgene #11159) was replaced with Rho300-Cas9 or Rho2k-Cas9 to generate the expression vectors “pRho300-Cas9” and “pRho2k-Cas9.”

[0110] 2. gRNA expression vector U6-gRNA1, U6-gRNA2, or U6-gRNA3 was inserted into the multiple cloning site (MCS) of the plasmid pBluescriptII to create the expression vectors “pU6-gRNA1,” “pU6-gRNA2,” and “pU6-gRNA3.”

[0111] 3. Expression vector for normal rhodopsin gene mRho-HITI-Donor[gRNA1], mRho-HITI-Donor[gRNA2], or mRho-HITI-Donor[gRNA3] was inserted into the MCS of the plasmid pLeaklessIII (Tunekawa Y et al. (2016) "Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain," Deveopment, Vol.143(Issue 17), pp.3216-3222.). This resulted in the creation of the expression vectors "pLeaklessIII-mRho-HITI-Donor[gRNA1]," "pLeaklessIII-mRho-HITI-Donor[gRNA2]," and "pLeaklessIII-mRho-HITI-Donor[gRNA3]."

[0112] Here, pLeaklessIII is a plasmid that reduces the effect of the endogenous transcription activity of the plasmid on the insert. In this plasmid, a CMV promoter and three SV40-polyA fragments are placed upstream of the MCS. Therefore, the endogenous transcription activity derived from the plasmid is stopped before the MCS sequence where the insert is inserted.

[0113] 4. mCherry expression vector The GFP sequence was removed from the CAG promoter of the plasmid pCAGIG by restriction enzyme digestion, and then CAG-mCherry or Rho300-mCherry was inserted, to generate the expression vectors "pCAG-mCherry" and "pRho300-mCherry."

[0114] [Example 1: Examination of knock-in efficiency by gRNA used] The knock-in efficiency of the normal rhodopsin gene was examined for each of the above-mentioned gRNA1, gRNA2, and gRNA3.

[0115] The solutions containing the above-mentioned expression vectors were mixed in the ratios shown in Table 1 to prepare three types of knock-in solutions.

[0116] [Table 1] 0.3-0.4 μL of HITI-gRNA1, HITI-gRNA2, and HITI-gRNA3 were injected into the subretina of six mice on postnatal day 0 (P0). The head of the mouse was clamped with tweezers (CUY650-7, Nepa Gene Co., Ltd.) so that the retina side was the anode, and an electric pulse was applied with an electroporator (NEPA21, Nepa Gene Co., Ltd.) to introduce the expression vector into the cells (for details, see previous reports (Matsuda op cit.; Onishi op cit.; de Melo J & Blackshaw S (2011) "In vivo Electroporation of Developing Mouse Retina," Journal of Visualized Experiments, (57), e2847.)). Figure 6 shows a schematic overview of the above-mentioned method.

[0117] The rhodopsin promoter incorporated into Rho2k-Cas9 begins to be activated at P7 to P10 after differentiation into rod photoreceptor cells. In other words, Cas9 begins to be expressed in rod photoreceptor cells, which are non-dividing cells.

[0118] At P21, six eyeballs were collected (at this point, retinal cell differentiation was almost complete). The eyeballs were fixed in a 4% paraformaldehyde solution (Nacalai Tesque, Inc.) at room temperature for 1 hour with the sclera removed from the outside of the eyeball (eyecup). After that, fluorescent images of GFP and mCherry were taken using a fluorescent stereomicroscope. The results are shown in Figure 7.

[0119] In the overlay image shown in the upper part of Fig. 7, the dashed circle indicates one eyeball. The middle part of Fig. 7 shows a fluorescent image of AcGFP, indicating a cell into which a normal rhodopsin gene was knocked in. The lower part shows a fluorescent image of mCherry, indicating a cell into which an expression vector was introduced.

[0120] As shown in Figure 7, green light was observed when gRNA1 and gRNA3 were used. This result suggests that selecting gRNA1 or gRNA3 as the gRNA is preferable from the viewpoint of improving the knock-in efficiency of the normal rhodopsin gene.

[0121] Next, retinal sections were prepared from the same eyecups as above, and the fluorescent images of AcGFP and mCherry were observed. The results are shown in Figure 8.

[0122] As shown in the fluorescent image of the retinal section in Figure 8, cells expressing AcGFP were found only in the outer nuclear layer (ONL) where rod photoreceptors are located. On the other hand, cells expressing mCherry were also found in the inner nuclear layer (INL) where horizontal cells, bipolar cells, and amacrine cells are distributed. This result indicates that knock-in of the normal rhodopsin gene occurred specifically in rod photoreceptors.

[0123] Next, the ratio of "AcGFP-expressing cells / mCherry-expressing cells" in the retinal outer nuclear layer (ONL) was calculated from the fluorescent images of the retinal sections obtained above. The results are shown in Figure 9.

[0124] As shown in Figure 9, when gRNA1 or gRNA3 was used, knock-in occurred with a high probability of approximately 80 to 90%.

[0125] Next, retinal sections from mice in which the normal rhodopsin gene was knocked in using gRNA1 were stained with an anti-rhodopsin antibody. The results are shown in Figure 10.

[0126] As shown in Figure 10, binding of the anti-rhodopsin antibody was confirmed in the cells expressing AcGFP, which indicates that rhodopsin protein was expressed in the cells in which the normal rhodopsin gene was knocked in.

[0127] Example 2: Examination of knock-in efficiency depending on the expression vector configuration We investigated the effect of the expression vector configuration on knock-in efficiency. Specifically, we changed the type of plasmid into which the expression cassette was incorporated and the combination of expression cassettes incorporated into one plasmid to investigate the effect of these on knock-in efficiency. To this end, in addition to the expression vectors mentioned above, we constructed the following expression vectors.

[0128] These expression vectors were constructed using a plasmid-type adeno-associated virus (AAV) vector (pAAV) with ITR sequences at both ends. Since pAAV has a packaging limit of about 5 kb, the expression cassette was designed to fit within this limit.

[0129] 1.pAAV-U6-gRNA1:Rho300-mCherry U6-gRNA1 (gRNA1 expression cassette) and Rho300-mCherry (mCherry expression cassette) were inserted into pAAV, thus creating the tandem expression vector "pAAV-U6-gRNA1:Rho300-mCherry."

[0130] 2.pAAV-U6-gRNA1:mRho-HITI-Donor[gRNA1] U6-gRNA1 (expression cassette of gRNA1) and mRho-HITI-Donor[gRNA1] (expression cassette of normal rhodopsin gene) were inserted into pAAV to create the tandem expression vector "pAAV-U6-gRNA1:mRho-HITI-Donor[gRNA1]".

[0131] 3. pAAV-mRho-HITI-Donor[gRNA1] mRho-HITI-Donor[gRNA1] (expression cassette of normal rhodopsin gene) was inserted into pAAV to create the expression vector "pAAV-mRho-HITI-Donor[gRNA1]".

[0132] 4. pAAV-Rho2k-Cas9 Rho2k-Cas9 (Cas9 expression cassette) was inserted into pAAV to create the expression vector "pAAV-Rho2k-Cas9."

[0133] 5. pAAV-Rho300-Cas9 Rho300-Cas9 was inserted into pAAV to create the expression vector "pAAV-Rho300-Cas9."

[0134] Solutions containing the above-mentioned expression vectors were mixed in the ratios shown in Table 2 to prepare knock-in solutions (1) to (8). The characteristics of each solution are as follows:

[0135] (1) Control (2) Shortening the Rho promoter from 2 kb to 300 bp (3) Tandem expression cassettes for gRNA and mCherry (4) Insertion of an expression cassette for the normal rhodopsin gene into pAAV (5) Combination of conditions (3) and (4) (6) Combination of conditions (2) to (4) (7) The expression cassette of gRNA and the expression cassette of normal rhodopsin gene are tandemly (8) Combination of conditions (2) and (7)

[0136] [Table 2] Using the above knock-in solution, the expression vector was introduced into the cells by electroporation in the same manner as in Example 1.

[0137] At P21, the eyeballs were collected. After dissecting the eyeballs into eyecups, fluorescent images of AcGFP and mCherry were taken using a fluorescent stereomicroscope. The results are shown in FIG. 11.

[0138] Comparing the results of (1) and (2), the expression intensity of AcGFP did not change whether Rho2k or Rho300 was used as the rhodopsin promoter, suggesting that shortening the rhodopsin promoter to 300 bp does not affect the knock-in efficiency.

[0139] Comparing the results of (1), (3), and (7), the expression vector in which the gRNA expression cassette was complexed with other cassettes showed a lower AcGFP expression intensity than the expression vector in which the gRNA expression cassette was not complexed with other cassettes, suggesting that the knock-in efficiency is higher when the gRNA expression cassette is not complexed with other cassettes.

[0140] Comparing (1) and (4), the expression vector in which the expression cassette of the normal rhodopsin gene was inserted into pAAV showed a lower AcGFP expression intensity than the expression vector in which it was inserted into pLeaklessIII, suggesting that inserting the expression cassette of the normal rhodopsin gene into pLeaklessIII would increase the knock-in efficiency.

[0141] Example 3: Examination of knock-in efficiency in viral delivery We investigated the knock-in efficiency of viral delivery. Specifically, we constructed AAV8 vectors using AAV type 8, which has been confirmed to infect adult rod photoreceptors, and investigated the knock-in efficiency of these vectors. To this end, we constructed the following recombinant AAV8 viruses.

[0142] 1. AAV8-Rho300-Cas9 Rho300-Cas9 (Cas9 expression cassette) was inserted into pAAV, and then the recombinant AAV8 virus "AAV8-Rho300-Cas9" was produced using the AAV helper-free expression system.

[0143] 2.scAAV8-U6-gRNA1-WPRE-U6-gRNA1 To improve the expression efficiency of gRNA, we created a tandem repeat expression cassette "U6-gRNA1-WPRE-U6-gRNA1" sandwiching the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). To improve the expression efficiency, we inserted this expression cassette into a self-complementary pscAAV. Then, we created a recombinant scAAV8 virus "scAAV8-U6-gRNA1-WPRE-U6-gRNA1" using the AAV helper-free expression system. WPRE is a sequence that enhances the stability and maturation of mRNA delivered from the nucleus to the cytoplasm, improving packaging into the virus, viral titer, and expression of the introduced gene.

[0144] 3.AAV8-mRho-HITI-Donor[gRNA1] mRho-HITI-Donor[gRNA1] (expression cassette of normal rhodopsin gene) was inserted into pAAV. Then, recombinant AAV8 virus "AAV8-mRho-HITI-Donor[gRNA1]" was produced using AAV helper-free expression system.

[0145] 4. AAV8-CAG-mCherry-WPRE CAG-mCherry (an expression cassette for mCherry) and WPRE were inserted into pAAV, and then the recombinant AAV8 virus "AAV8-CAG-mCherry-WPRE" was generated using the AAV helper-free expression system.

[0146] These recombinant AAV8 viruses were used to introduce the normal rhodopsin gene into mice. The expression vectors and gene copy numbers used for the introduction are shown in Table 3.

[0147] [Table 3] The recombinant AAV8 viruses of Test Example 1 and Test Example 2 were injected subretinaly into 3-month-old mice to cause infection. The retinas were collected 1 month and 2 months after infection to prepare flat-mount specimens. Then, fluorescent images of AcGFP and mCherry were taken in the same manner as in Example 2. The results are shown in FIG.

[0148] The left column of Fig. 12 shows fluorescent images of the retina of a mouse infected with the recombinant AAV8 virus of Test Example 1 (upper row: 1 month after infection, lower row: 2 months after infection). The right column of Fig. 12 shows fluorescent images of the retina of a mouse infected with the recombinant AAV8 virus of Test Example 2 (upper row: 1 month after infection, lower row: 2 months after infection). The arrowheads in the figures indicate the sites where the recombinant AAV8 virus was subretinal injected.

[0149] The dotted area in the bottom left column indicates the area where trace amounts of AcGFP expression were observed. Test Example 1 is a negative control in which no gRNA expression vector was introduced, and it is believed that the AcGFP observed was due to the transcription activity of the AAV ITR. In other words, it is believed that knock-in of the normal rhodopsin gene did not actually occur in Test Example 1.

[0150] As shown in Figure 12, the area expressing AcGFP was 1 / 4 of the retina 1 month after infection, and expanded to about 2 / 3 of the retina 2 months after infection, which correlates with the time required for AAV virus infection, translocation into the nucleus, and expression of the introduced gene.

[0151] Next, retinal sections were prepared two months after infection, and the fluorescent images of AcGFP and mCherry were observed. The results are shown in FIG. 13. The left column of FIG. 13 shows fluorescent images of the retina of a mouse infected with the recombinant AAV8 virus of Test Example 1. The right column shows fluorescent images of the retina of a mouse infected with the recombinant AAV8 virus of Test Example 2.

[0152] As shown in Figure 13, cells expressing AcGFP were observed in the retinal sections two months after infection with the recombinant AAV8 virus of Test Example 2, to the same extent as in Example 2 (Figure 8). Note that cells expressing AcGFP were also observed in the retinal sections two months after infection with the recombinant AAV8 virus of Test Example 1, which is believed to be due to the transcriptional activity of the AAV ITR.

[0153] Example 4: Rho P23H Gene therapy for retinitis pigmentosa model mice As a mouse model of retinitis pigmentosa, we have developed Rho, the most common human Rho mutation. P23H A knock-in mouse was used (see Sakami S et al. (2011) "Probing Mechanisms of Photoreceptor Degeneration in a New Mouse Model of the Common Form of Autosomal Dominant Retinitis Pigmentosa due to P23H Opsin Mutations," Journal of Biological Chemistry, Vol. 286 (No. 12), pp 10551-10567.). In the knock-in mouse, the 23rd proline residue in exon 1 of the Rho gene is replaced with a histidine residue. In these knock-in mice, retinal degeneration occurs due to endoplasmic reticulum stress caused by the rhodopsin protein not folding into the correct structure (see Chiang WC et al. (2015) "Robust Endoplasmic Reticulum-Associated Degradation of Rhodopsin Precedes Retinal Degeneration," Molecular Neurobiology, Vol.52(Issue 1), pp.679-695.).

[0154] Mice homozygous for this mutation (Rho P23H / P23HIn mice with glaucoma, most of the rod photoreceptors degenerate and die between P10 and P20. At one month of age, the neuronal layer (external nuclear layer: ONL) in which the photoreceptors reside thins. This makes these mice useful for detecting rod photoreceptors that survive treatment.

[0155] On the other hand, mice heterozygous for this mutation (Rho + / P23H In mice with glaucoma, the ONL thickness is reduced to about half by P30, but thereafter retinal degeneration slows down. At this time, the fine morphology of photoreceptors (e.g., the length of photoreceptor outer segments) and electroretinogram responses are about half those of normal mice. Therefore, these mice are useful for evaluating the function of rod photoreceptors that survive treatment.

[0156] [4-1.Rho P23H / P23H Mouse gene therapy Rho in P0 P23H / P23H An expression vector was introduced into one eye of the mouse using the knock-in solution (1) used in Example 2. The expression vector was introduced by electroporation, as in Example 4. The other eye was not subjected to electroporation and served as a control.

[0157] Retinal sections were prepared at time points P14, P21, and P50. The sections were subjected to histological staining with anti-rhodopsin antibody and DAPI. The results are shown in FIG.

[0158] As shown in Figure 14, at P14, the thickness of the ONL in the retinas with the normal rhodopsin gene knocked in was equivalent to that of the control retinas. However, at P21 and P50, in the retinas with the normal rhodopsin gene knocked in, cells expressing AcGFP were present, ONL thinning was suppressed, and rhodopsin expression was observed in the outer segment. In contrast, the ONL in the control retinas was thinned. In other words, knocking in the normal rhodopsin gene enhanced the expression of Rho P23H / P23HDegeneration of rod photoreceptor cells was suppressed in mice, suggesting that knock-in of the normal rhodopsin gene and knock-out of P23H rhodopsin resulted in the expression of normal rhodopsin, thereby preventing photoreceptor cell death.

[0159] [4-2.Rho + / P23H Mouse gene therapy One-month-old Rho + / P23H Two mice were prepared, and the recombinant AAV8 virus used in Test Example 2 of Example 3 was injected into the left eye of each mouse. The AAV8 virus was injected in the same manner as in Example 3. The right eye was not injected with the AAV8 virus and served as a control.

[0160] One month after infection, AcGFP fluorescence was confirmed by fluorescent fundus angiography. The results are shown in Figure 15. The upper row of Figure 15 shows a fluorescent image of the right eye, and the lower row shows a fluorescent image of the left eye. The left column shows fluorescent images of wild-type mice injected with the AAV8 virus and subjected to fluorescent fundus angiography one month after infection.

[0161] As shown in Figure 15, Rho + / P23H Although there were individual differences between the two mice, both mice had cells expressing AcGFP, suggesting that the knock-in of the normal rhodopsin gene resulted in the expression of normal rhodopsin in place of the P23H mutant rhodopsin in these photoreceptor cells.

[0162] Next, three months after infection, a photomechanical eye response test was performed using a qOMR visual motor response quantification system (Phenosys) to quantify the photomechanical eye response of the right and left eyes. In this test, the mouse is placed in an examination box surrounded by monitors on all sides. Stripes of different thicknesses are displayed on the monitor, and they move left and right at a certain time. If the mouse in the examination box can recognize the stripes, it moves its head in accordance with the movement of the stripes (photomechanical eye response). Clockwise rotation as viewed from above indicates a photomechanical eye response originating from the left eye, and counterclockwise rotation indicates a photomechanical eye response originating from the right eye. The head position was tracked by a camera above the mouse's head, and the photomechanical eye response was quantified. The results are shown in Figure 16.

[0163] The left panel of Figure 16 shows untreated Rho + / P23H Graphs showing the results of mouse tests. The center and right panels show the results of two Rho mice injected with the AAV8 virus into the left eye. + / P23H 1 is a graph showing the results of a mouse test.

[0164] In wild-type mice, both eyes showed the highest response to the 0.2 cyc / deg stripe pattern, with a mean optomotor response of around 2.0 (not shown). In contrast, as shown in Figure 16, untreated Rho + / P23H In the mouse (left), both eyes showed the highest response to the 0.2 cyc / deg stripe pattern, as in the wild type, but the correct response rate was lower than that of the wild type, at around 1.5. On the other hand, the two Rho mice injected with AAV8 virus in the left eye showed the highest response to the 0.2 cyc / deg stripe pattern in both eyes. + / P23H In the mice (center and right), the rate of correct responses was significantly higher in the left eye than in the right eye. These results suggest that knock-in of the normal rhodopsin gene enhances the Rho + / P23H It was revealed that the functional decline of rod photoreceptors in mice was suppressed. This is thought to be because the normal rhodopsin gene was knocked in and P23H rhodopsin was knocked out, and the expression of normal rhodopsin restored visual function or suppressed the decline in visual function.

[0165] [Example 5: Verification of gene therapy for human rhodopsin gene] [5-1.gRNA] To verify the feasibility of gene therapy for the human rhodopsin gene, we investigated the recognition sequence of gRNA effective in human cells.

[0166] Using the gRNA search engine for SpCas9 (http: / / crispr.technology / ), a search was conducted for gRNA recognition sequences within a region within 100 bp upstream from the translation start point of exon 1 of the human rhodopsin gene. As a result, a sequence recognized by gRNA (hs086172148) was found (SEQ ID NO: 17: TCAGGCCTTCGCAGCATTCTTGG; score: high (800)). The position of the recognition sequence by gRNA (hs086172148) is shown in FIG. 17. In FIG. 17, the arrow indicates the Cas9 cleavage site.

[0167] [5-2.SSA Assay] The cleavage efficiency of the recognition sequence by gRNA (hs086172148) was verified by a single strand annealing (SSA) assay. Figure 18 shows a schematic overview of the SSA assay.

[0168] As shown in Figure 18, a gRNA (hs086172148) recognition sequence was inserted into the EGFP gene sequence of an enhanced green fluorescent protein (EGFP) gene expression plasmid for SSA assay to prepare a modified EGFP gene expression plasmid. The base sequence encoding EGFP contained in this plasmid partially overlaps with the gRNA (hs086172148) recognition sequence at a position adjacent to the sequence. In other words, the base sequence has a partial overlap upstream and downstream of the gRNA (hs086172148) recognition sequence.

[0169] Therefore, when the gRNA (hs086172148) recognition sequence is cleaved by Cas9, the overlapping sequences located upstream and downstream of the cleavage site undergo homologous recombination or single-strand annealing, which completes the base sequence encoding the full-length EGFP, resulting in the expression of EGFP.

[0170] The modified EGFP gene expression plasmid, the expression vector for gRNA (hs086172148), and the expression vector for Cas9 were mixed to prepare a transfection mixture. HEK293 cells were transfected using this transfection mixture. The transfected HEK293 cells were incubated at 37°C, 5% CO 2 After culturing for 72 hours under the above conditions, the expression of EGFP was detected. As a control, a similar experiment was also performed in a system that did not contain the gRNA (hs086172148) expression vector. The results are shown in FIG.

[0171] As shown in Figure 19, EGFP signals were detected in cells transfected with both the modified EGFP gene expression plasmid and the gRNA(hs086172148) expression vector, indicating that the gRNA(hs086172148) recognition sequence was actually cleaved by the action of gRNA(hs086172148) and Cas9.

[0172] [5-3. Preparation of donor DNA containing normal human rhodopsin gene] A donor DNA of the normal human rhodopsin gene was prepared using the gRNA (hs086172148) recognition sequence. Figure 20 shows the structure of the expression cassette (about 4.1 kb) of the donor DNA prepared.

[0173] The normal rhodopsin gene was a sequence obtained by deleting the stop codon from the cDNA (1044 bp, Accession NO. NM_000539.3) of the normal human rhodopsin gene. As shown in FIG. 20, a chimeric intron sequence (228 bp, SEQ ID NO: 10) was placed upstream of the normal human rhodopsin gene. Downstream of the normal human rhodopsin gene, a Furin sequence and a P2A sequence (78 bp; SEQ ID NO: 11), an AcGFP gene (720 bp; SEQ ID NO: 12), and the 3' untranslated region of the human rhodopsin gene and a 100 bp sequence downstream of it (total 1725 bp, SEQ ID NO: 18) were placed in this order. Furthermore, a reverse target sequence corresponding to gRNA (hs086172148) was placed upstream and downstream of the obtained sequence to prepare an expression cassette of the donor DNA of the normal human rhodopsin gene.

[0174] The expression cassette prepared above can be inserted into a viral or non-viral plasmid to prepare an expression vector for the normal human rhodopsin gene. The expression vector for the normal human rhodopsin gene thus prepared can be introduced into organ cultured human retina, human retinal organoids, etc., to evaluate in detail the gene transfer efficiency of the donor DNA in human photoreceptor cells.

[0175] [Example 6: Verification of gene therapy for genes that cause dominant mutations other than the rhodopsin gene] We investigated the possibility of gene therapy for genes other than the rhodopsin gene that cause dominant mutations. Specifically, we examined the knock-in efficiency of the normal peripherin (Prph2) gene in mice. The dominant mutant peripherin gene is the causative gene for retinitis pigmentosa and macular dystrophy, and more than 90 different disease mutations have been reported to date.

[0176] [6-1.gRNA] Using the gRNA search engine for SpCas9 (http: / / crispr.technology / ), we searched for gRNA recognition sequences within an evolutionarily unconserved region within 100 bp upstream from the translation start point of exon 1 of the mouse peripherin gene. As a result, three gRNA recognition sequences were found. The sequences are as follows (see Figure 21 for the positional relationship of the gRNA recognition sequences to each gRNA). gRNA4 recognition sequence: SEQ ID NO: 19 (TGCTCTTCCCTAGACCCTAGCGG; score: high (800)) gRNA5 recognition sequence: SEQ ID NO: 20 (GGGCTGGACCGCTAGGGTCTAGG; score: high (900)) Recognition sequence of gRNA6: SEQ ID NO: 21 (GAGCTCACTCGGATTAGGAGTGG; score: high (800)).

[0177] For each of gRNA4 to 6, an expression cassette was prepared in which the human U6 promoter sequence, the crRNA sequence for each recognition sequence, and the tracerRNA sequence were arranged in that order from upstream to downstream. The expression cassette was inserted into the MCS of the plasmid pBluescriptII to prepare expression vectors for gRNA4 to 6 (pU6-gRNA4, pU6-gRNA5, and pU6-gRNA6).

[0178] [6-2. Normal peripherin gene] A donor DNA for the normal peripherin gene was prepared in the same manner as the donor DNA for the normal mouse rhodopsin gene. Figure 22 shows a schematic structure of the expression cassette (approximately 3.6 kb) of the donor DNA thus prepared.

[0179] As the normal peripherin gene, a sequence in which the stop codon was deleted from the cDNA (Accession No. NM_008938.2) of the normal mouse peripherin protein was used. A chimeric intron sequence (228 bp, SEQ ID NO: 10) was placed upstream of the normal peripherin gene. Downstream of the normal peripherin gene, a Furin sequence and a P2A sequence (78 bp; SEQ ID NO: 11), an AcGFP gene (720 bp; SEQ ID NO: 12), and the 3' non-translated region of the peripherin gene and a 100 bp sequence downstream of it (total 1486 bp, SEQ ID NO: 22, gene position: chr17: 46,923,548-46,925,033) were placed in this order. Furthermore, upstream and downstream of the obtained sequence, reverse target sequences corresponding to each of gRNA4 to 6 were placed to prepare an expression cassette of the donor DNA of the normal peripherin gene.

[0180] By inserting the expression cassettes prepared above into the MCS of the plasmid pLeaklessIII, expression vectors for normal peripherin genes corresponding to gRNAs 4 to 6 (pLeaklessIII-mPrph2-HITI-Donor[gRNA4], pLeaklessIII-mPrph2-HITI-Donor[gRNA5], and pLeaklessIII-mPrph2-HITI-Donor[gRNA6]) were created.

[0181] [6-3. Examination of knock-in efficiency] The knock-in efficiency of the normal peripherin gene was examined in the same manner as in Example 1, which was carried out for the mouse rhodopsin gene.

[0182] Three types of knock-in solutions were prepared by mixing expression vectors for gRNA4 to 6 (pU6-gRNA4, pU6-gRNA5, or pU6-gRNA6), expression vectors for normal peripherin genes (pLeaklessIII-mPrph2-HITI-Donor[gRNA4], pLeaklessIII-mPrph2-HITI-Donor[gRNA5], or pLeaklessIII-mPrph2-HITI-Donor[gRNA6]), expression vector for Cas9 (pRho2k-Cas9), and expression vector for mCherry (pCAG-mCherry) in the same ratios as in Example 1.

[0183] 0.3-0.4 μL of the knock-in solution was injected subretinaly on postnatal day 0 (P0) of four mice, and the expression vector was introduced into the cells by electroporation. At P21, four eyeballs were collected, and the sclera on the outside of the eyeball was peeled off (eyecup), and the eyeballs were fixed in 4% paraformaldehyde solution (Nacalai Tesque, Inc.) at room temperature for 1 hour. Then, fluorescent images of GFP and mCherry were taken using a fluorescent stereomicroscope. In addition, retinal sections were prepared from the same eyecups as above, and fluorescent images of AcGFP and mCherry were observed. The results are shown in Figure 23 (upper row: eyecup, lower row: retinal section).

[0184] As shown in FIG. 23, green light was observed when gRNA4 and gRNA6 were used. This result suggests that the normal peripherin gene can be knocked in by using gRNA4 or gRNA6. In addition, as shown in the lower part of FIG. 23, cells expressing AcGFP were only observed in the outer nuclear layer (ONL) of the retina, where rod photoreceptors are located. Meanwhile, cells expressing mCherry were also observed in the inner nuclear layer (INL), where horizontal cells, bipolar cells, and amacrine cells are distributed. This result indicates that the knock-in of the normal peripherin gene occurred specifically in rod photoreceptors. [Industrial Applicability]

[0185] The present invention can be used, for example, in the treatment of diseases caused by dominant mutant genes. [Explanation of symbols]

[0186] 1: Normal gene 2a: First reverse target sequence 2b: second reverse target sequence 6: Target sequence 7: Dominant mutant gene 20: Donor DNA A: Upstream B: Downstream

Claims

1. A therapeutic agent for a disease caused by a dominant mutation gene in which a dominant mutation occurs in a normal gene in a genome, comprising: The therapeutic agent includes a donor DNA comprising a polynucleotide having the following sequences (a) to (c): (a) the normal gene; (b) a first inverted target sequence located upstream of the normal gene and cleaved by the designer nuclease; (c) a second inverted target sequence located downstream of the normal gene and cleaved by the designer nuclease; (where: An inverted target sequence refers to an inverted target sequence that is present in the genome and is cleaved by the designer nuclease; The normal gene encodes a full-length normal gene product, and a stop codon is located at the end of the gene product. The target sequence is located in the genome between the dominantly mutated gene and the promoter sequence of the dominantly mutated gene.

2. The therapeutic agent of claim 1, wherein the donor DNA further comprises the following sequence (d): (d) a transcription control sequence located between the normal gene and the second inverted target sequence.

3. The therapeutic agent according to claim 1 or 2, further comprising the following (i) and / or (ii): (i) gRNA, or an expression vector for the gRNA (ii) The designer nuclease described above, or an expression vector for the designer nuclease.

4. The therapeutic agent according to any one of claims 1 to 3, which is used on non-dividing cells.

5. The therapeutic agent according to any one of claims 1 to 4, wherein the normal gene is one or more selected from the group consisting of a rhodopsin gene, a peripherin gene, a BEST1 gene and an OPTN gene.

6. The method according to any one of claims 1 to 5, wherein the disease is one or more selected from the group consisting of retinitis pigmentosa, macular dystrophy and hereditary glaucoma.

Images