Pharmaceutical composition for preventing or treating cancer comprising a TUT4 / 7 expression regulator

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating cancer, which comprises a TUT4 / 7 expression regulator. The pharmaceutical composition of the present invention can prevent cell division and inhibit cancer progression by suppressing the function of TUT4 / 7, and can increase the amount of miR-324-5p and suppress the function of miR-324-3p.1, so it can be effectively used in the prevention, treatment, or diagnosis of cancer.

Description

Detailed Description of the Invention

[0001] [Technical field] The present invention relates to a pharmaceutical composition for preventing or treating cancer, comprising a TUT4 / 7 expression regulator, and more specifically, to a pharmaceutical composition for preventing or treating cancer, comprising a nucleic acid sequence that regulates TUT4 / 7 expression.

[0002] This invention was made under the support of the Ministry of Health and Welfare of the Republic of Korea under project number 1711079098, the research management organization for this project is the Institute for Basic Science, the research project name is "Research on cell fate regulation by RNA", the sponsor organization is the Institute for Basic Science, and the research period is from 2018.01.01. to 2018.12.31.

[0003] This patent application claims priority to Korean Patent Application No. 10-2019-0022551, filed with the Korean Intellectual Property Office on February 26, 2019, the disclosure of which is incorporated herein by reference. [Background technology] The process of generating microRNA (miRNA) involves the selection of one of the two strands (5p and 3p) that compose double-stranded RNA through a cleavage process by Drosha and Dicer. The two strands have strictly different sequences and can regulate the expression of different genes, so the strand selection process that determines which strand is selected is biologically important.

[0004] On the other hand, the predominantly selected miRNA strand may change depending on the cell type, a phenomenon called alternative strand processing selection (or "arm switching"). Alternative strand selection can affect tissue differentiation and cancer development. However, the molecular mechanisms and physiological significance of such alternative strand selection, including how it is regulated, remain unclear. Summary of the Invention [Problem to be solved by the invention] The inventors confirmed that uridine addition by TUT4 and TUT7 (TUT4 / 7) regulates the Dicer cleavage site of pre-mir-324, thereby generating three types of microRNAs (5p and 23p isoforms) with different functions, and demonstrated that inhibiting the function of TUT4 / 7 can prevent cell division and inhibit cancer progression, and that increasing the amount of miR-324-5p and inhibiting the function of miR-324-3p.1 can produce the same effect, thereby completing the present invention.

[0005] Therefore, an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, comprising: a microRNA (miRNA) having the base sequences of SEQ ID NO: 1 and 2; a nucleic acid having the base sequence of SEQ ID NO: 4; and a small interfering RNA (siRNA) having one or more base sequences selected from the group consisting of SEQ ID NO: 5 to 20.

[0006] Another object of the present invention is to provide a method for treating cancer using microRNA (miRNA) comprising the nucleotide sequences of SEQ ID NO: 1 and 2; a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 4; and a small interfering RNA (siRNA) comprising one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 5 to 20.

[0007] It is still another object of the present invention to provide uses of microRNA (miRNA) comprising the nucleotide sequences of SEQ ID NO: 1 and 2; a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 4; and small interfering RNA (siRNA) comprising one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 5 to 20 in cancer treatment.

[0008] It is yet another object of the present invention to provide a composition for diagnosing cancer, comprising a preparation for measuring the expression level of miRNA, miR-324-5p or miR-324-3p.1.

[0009] It is yet another object of the present invention to provide a cancer diagnostic kit comprising a preparation for measuring the expression level of miRNA, miR-324-5p or miR-324-3p.1.

[0010] Yet another object of the present invention is to provide a composition for diagnosing cancer, comprising a preparation for measuring the level of TUT4 (Terminal uridylyl transferases 4) or TUT7 (Terminal uridylyl transferases 7) gene mRNA or its protein.

[0011] It is still another object of the present invention to provide a cancer diagnostic kit comprising a preparation for measuring the level of TUT4 or TUT7 gene mRNA or its protein. [Means for solving the problems] The inventors confirmed that uridine addition by TUT4 and TUT7 (TUT4 / 7) regulates the Dicer cleavage site of pre-mir-324, thereby generating three microRNAs (5p and 23p isoforms) with different functions, and demonstrated that inhibiting the function of TUT4 / 7 can prevent cell division and inhibit cancer progression, and that increasing the amount of miR-324-5p and inhibiting the function of miR-324-3p.1 can produce the same effect.

[0012] The present invention will now be described in more detail.

[0013] One aspect of the present invention is a microRNA (miRNA) comprising the base sequences of SEQ ID NOs: 1 and 2; A nucleic acid consisting of the base sequence of SEQ ID NO: 4; and The present invention relates to a pharmaceutical composition for preventing or treating cancer, comprising one or more types selected from the group consisting of small interfering RNA (siRNA); which comprises one or more base sequences selected from the group consisting of SEQ ID NOs: 5 to 20.

[0014] The cancer may be, but is not limited to, brain cancer, colon cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, breast cancer, thyroid cancer, brain cancer, head and neck cancer, and / or malignant melanoma.

[0015] In the present invention, "microRNA (miRNA)" refers to a non-translated RNA of approximately 22 nt that acts as a post-transcriptional inhibitor by binding to the 3' untranslated region (UTR) of mRNA, and plays a role in regulating gene expression.

[0016] The microRNA of the present invention may comprise the base sequences of SEQ ID NOs: 1 and 2.

[0017] Specifically, the microRNA (5p duplex miRNA) may be a complex (duplex) in which a microRNA (miR-324-5p) having the base sequence of SEQ ID NO: 1 and a microRNA (miR-324-3p.2) having the base sequence of SEQ ID NO: 2 are bound to each other.

[0018] The base sequences of SEQ ID NOs: 1 and 2 may have a phosphate (5phos) at the 5' end.

[0019] In the present invention, "nucleic acid" is meant to include any DNA or RNA, such as chromosomal, mitochondrial, viral and / or bacterial nucleic acid present in a tissue sample, including one or both strands of a double-stranded nucleic acid molecule, and including any fragment or portion of an intact nucleic acid molecule.

[0020] The nucleic acids of the present invention are understood to include chemically modified DNA or RNA. Those skilled in the art can synthesize and modify said nucleic acids in a desired manner using methods known in the art.

[0021] The nucleic acid of the present invention may consist of the base sequence of SEQ ID NO: 4 (CAGCAGCACCTGGGGCAG).

[0022] In the present invention, "short interfering RNA (siRNA)" refers to small RNA fragments of 18 to 23 nucleotides in size that are generated when double-stranded RNA is cleaved by Dicer, and they specifically bind to mRNA having a complementary sequence and play a role in suppressing the expression of the protein.

[0023] The siRNA of the present invention is understood to include siRNAs that have been chemically modified to prevent rapid degradation by endogenous nucleases. Those skilled in the art can synthesize and modify the siRNAs in a desired manner using methods known in the art.

[0024] The composition of the present invention may be introduced into cells together with a known nucleic acid carrier to enhance the efficiency of introduction into cells.

[0025] The short interfering RNA of the present invention may comprise any of the base sequences of SEQ ID NOs:5-20.

[0026] Specifically, the short interfering RNA (siTUT4) may be a complex in which a short interfering RNA containing any one of the base sequences of SEQ ID NOs: 5 to 8 and a short interfering RNA containing any one of the base sequences of SEQ ID NOs: 9 to 12 are bound to each other.

[0027] Specifically, the short interfering RNA (siTUT7) may be a complex in which a short interfering RNA containing any one of the base sequences of SEQ ID NOs: 13 to 16 and a short interfering RNA containing any one of the base sequences of SEQ ID NOs: 17 to 20 are bound to each other.

[0028] In the present invention, the effective amount of the miRNA, nucleic acid and / or siRNA in the treatment means the amount required for administration to expect a cancer treatment effect, and may be adjusted according to various factors including the type of disease, the severity of the disease, the type of nucleic acid administered, the dosage form, the age, weight, general health condition, sex, diet, administration time, administration route and treatment period of the patient, and drugs such as chemotherapeutic drugs used simultaneously.

[0029] The compositions of the present invention can be administered by various routes, including orally, transdermally, subcutaneously, intravenously or intramuscularly, and therefore may further contain other additives in addition to the miRNA, nucleic acid and / or siRNA according to the present invention.

[0030] The composition according to the present invention may be in the form of a tablet, pill, powder, sachet, elixir, suspension, emulsion, solution, syrup, aerosol, capsule, sterile injection, sterile powder, etc., and is preferably formulated into an injection for intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, etc.

[0031] The pharmaceutical composition of the present invention may be prepared in the form of a unit dose by formulating it with a pharma- ceutically acceptable carrier and / or excipient, or may be prepared by placing it in a multi-dose container, by a method that can be easily carried out by a person having ordinary skill in the art to which the invention pertains. In this case, the dosage form may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, suppository, powder, granule, tablet or capsule, and may further contain a dispersant or stabilizer.

[0032] The pharma- ceutically acceptable carriers that may be included in the pharmaceutical composition of the present invention are those that are commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like. Suitable pharma- ceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0033] The pharmaceutical compositions of the present invention can be administered orally and parenterally, for example, by intravenous, subcutaneous, intramuscular, intraperitoneal, topical, intranasal, pulmonary, rectal, intrathecal, ocular, dermal and transdermal administration.

[0034] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, weight, sex, pathology, food, administration time, administration route, excretion rate and reaction sensitivity of the patient, and a physician of ordinary skill can easily determine and prescribe an effective dosage for the desired treatment or prevention.

[0035] Another aspect of the present invention relates to a composition for diagnosing cancer, comprising a preparation for measuring the expression level of one or more miRNAs selected from the group consisting of miR-324-5p and miR-324-3p.1.

[0036] The microRNA (miR-324-5p) may include the base sequence of SEQ ID NO: 1, and the microRNA (miR-324-3p.1) may include the base sequence of SEQ ID NO: 3 (ACUGCCCCAGGUGCUGCUGG).

[0037] Specifically, the microRNA (miR-324-3p.1) contains the base sequence of SEQ ID NO: 3, and may further contain one or more uracils (U) at the 3' end.

[0038] The microRNA may also be produced by cleavage by Drosha and Dicer from a single transcript produced from the MIR324 gene (GenBank Number: 442898).

[0039] As used herein, "diagnosis" includes determining an individual's susceptibility to a particular disease or disorder, determining whether an individual currently has a particular disease or disorder, determining the prognosis of an individual with a particular disease or disorder, or therametrics (e.g., monitoring an individual's condition to provide information regarding the efficacy of a treatment).

[0040] As used herein, "individual," "subject," or "patient" refers to any single individual requiring treatment, including humans, cows, dogs, guinea pigs, rabbits, chickens, insects, etc. Also included is any subject participating in a clinical research trial that does not show any clinical signs of disease or a subject participating in an epidemiological study or used as a control group.

[0041] Unless otherwise specified herein, the expression "measuring the expression level of miRNA" as used herein means detecting the target of interest in a sample.

[0042] The object to be detected in the present invention is the corresponding miRNA in a sample, that is, the presence or absence of the cancer can be confirmed by detecting the miRNA.

[0043] For example, the expression levels of the miRNAs can be measured from biological samples of patients suspected of having cancer.

[0044] The present invention is based on the finding that the expression level of miR-324-5p in vivo is significantly decreased and the expression level of miR-324-3p.1 is significantly increased in cases of cancer compared to cases of no cancer, and therefore miR-324-5p and miR-324-3p.1 can be used as diagnostic markers for the presence or absence of cancer.

[0045] The preparation for measuring the expression level of miRNA of the present invention means a molecule that can be used to detect markers by confirming the expression levels of marker miRNAs whose expression levels decrease and marker miRNAs whose expression levels further increase in a specimen of a subject's biological sample when cancer develops.

[0046] Specifically, the preparation for measuring the expression level of the miRNA may be a primer or a probe that specifically binds to the miRNA.

[0047] Thus, detection of the nucleic acid can be carried out by an amplification reaction using one or more oligonucleotide primers hybridized to the nucleic acid molecule encoding the gene or to the complement of said nucleic acid molecule.

[0048] For example, detection of miRNA using primers can be carried out by amplifying the gene sequence using an amplification method such as PCR, and then confirming whether or not the gene has been amplified using a method known in the art.

[0049] A primer is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template and act as a starting point for template strand copying. The primer may initiate DNA synthesis in the presence of a polymerization reaction reagent (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature. In the present invention, the presence or absence of cancer can be diagnosed by confirming the expression level by performing PCR amplification using sense and antisense primers that specifically bind to one or more of the above miRNAs. The PCR conditions and the lengths of the sense and antisense primers can be modified based on those known in the art.

[0050] The probe means a nucleic acid fragment such as RNA or DNA corresponding to a few bases as short as a few bases and a few dozen bases as long as a few bases, and is labeled. The probe can be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, etc. In the present invention, the presence or absence of cancer can be diagnosed by hybridizing with a probe complementary to one or more of the above miRNAs and confirming the expression level. The selection of an appropriate probe and the hybridization conditions can be modified based on those known in the art.

[0051] Such primers or probes can be appropriately designed by those skilled in the art based on the known sequences.

[0052] For example, a primer or probe can be chemically synthesized using the phosphoramidite solid support method, or other widely known methods. Additionally, such nucleic acid sequences can be modified using a variety of means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution of one or more analogues of a natural nucleotide, and internucleotide modifications, such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

[0053] The expression level of miRNA can be measured by a method commonly used in the field of biokits, including, but not limited to, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting, or gene chips.

[0054] Yet another aspect of the present invention relates to a cancer diagnostic kit comprising the cancer diagnostic composition.

[0055] The kit may contain, in addition to a preparation for measuring the expression level of the miRNA, general tools, reagents, and the like in the art that are preferably used in cancer diagnostic kits.

[0056] Examples of the tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, chromophores, dissolving agents, detergents, buffers, stabilizers, etc. When the labeling substance is an enzyme, it may include a substrate capable of measuring the enzyme activity and a reaction stopper. The carrier may be a soluble carrier or an insoluble carrier. An example of a soluble carrier is a physiologically acceptable buffer solution known in the art, such as PBS, and an example of an insoluble carrier may be a polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharide, magnetic particles formed by plating metal on latex, as well as paper, glass, metal, agarose, and combinations thereof.

[0057] For example, the diagnostic kit of the present invention may be a kit containing essential elements required for performing RT-PCR. In addition to each primer pair specific to the marker miRNA, the RT-PCR kit may include test tubes or other suitable containers, reaction buffers (variable in pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC water, sterile water, etc.

[0058] Since the kit of the present invention comprises the above-mentioned compositions as its components, the description of the overlapping contents will be omitted in order to avoid excessive complexity of this specification.

[0059] Yet another aspect of the present invention relates to a composition for diagnosing cancer, comprising a preparation for measuring the level of mRNA or protein of one or more genes selected from the group consisting of TUT4 (Terminal uridylyl transferases 4) (GenBank Number: 23318) and TUT7 (Terminal uridylyl transferases 7) (GenBank Number: 79670).

[0060] The nucleotide sequence of the TUT4 gene is shown in SEQ ID NO:21, and the nucleotide sequence of the TUT7 gene is shown in SEQ ID NO:22.

[0061] As used herein, "diagnosis" includes determining an individual's susceptibility to a particular disease or disorder, determining whether an individual currently has a particular disease or disorder, determining the prognosis of an individual with a particular disease or disorder, or therametics (e.g., monitoring an individual's condition to provide information regarding the efficacy of a treatment).

[0062] As used herein, "individual," "subject," or "patient" refers to any single individual requiring treatment, including humans, cows, dogs, guinea pigs, rabbits, chickens, insects, etc. Also included is any subject participating in a clinical research trial that does not show any clinical signs of disease or a subject participating in an epidemiological study or used as a control group.

[0063] Unless otherwise specified in the present specification, the expression "measuring the level of a gene mRNA or its protein" as used herein means detecting the target gene to be detected in the sample of interest.

[0064] The object to be detected in the present invention is the mRNA or protein of the corresponding gene in a sample, that is, the presence or absence of the onset of the cancer can be confirmed by detecting the mRNA or protein.

[0065] For example, the levels of the mRNA or its protein can be measured from a biological sample of a patient suspected of having cancer.

[0066] The present invention confirms that the expression levels of TUT4 and TUT7 in vivo are significantly increased in cancerous cases compared to non-cancer cases, and based on this, TUT4 and TUT7 can be used as diagnostic markers for the presence or absence of cancer.

[0067] As used herein, "gene" refers to any nucleic acid sequence or portion thereof that has a functional role in protein coding or in transcription or in regulating the expression of other genes. A gene may consist of all the nucleic acid that codes for a functional protein or only a portion of the nucleic acid that codes for or expresses a protein. A nucleic acid sequence may contain genetic abnormalities within exons, introns, start or end regions, promoter sequences, other regulatory sequences, or unique sequences adjacent to the gene.

[0068] The formulation for measuring the expression level of gene mRNA of the present invention means a molecule that can be used to detect a marker by confirming the expression level of mRNA, which is a marker whose expression level increases in a specimen of a subject's biological sample when cancer occurs.

[0069] Specifically, the preparation for measuring the expression level of the mRNA may be a primer or a probe that specifically binds to the mRNA.

[0070] The contents overlapping with the above-mentioned "cancer diagnostic composition comprising a preparation for measuring the expression levels of miRNAs miR-324-5p and miR-324-3p.1" are omitted here to avoid overly complicating this specification.

[0071] As used herein, "protein" can also include protein fragments, analogs and derivatives that retain essentially the same biological activity or function as the reference protein.

[0072] The protein level measuring agent of the present invention refers to a molecule that can be used to detect a marker by determining the expression level of a marker protein whose level increases in a specimen of a subject's biological sample when cancer develops.

[0073] Specifically, the agent for measuring the level of said protein may be an antibody that specifically binds to said protein.

[0074] In the present invention, the term "antibody" is used in the broadest sense and specifically includes intact monoclonal (single clone) antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies, and antibody fragments that exhibit the desired biological activity.

[0075] Yet another aspect of the present invention relates to a cancer diagnostic kit comprising the cancer diagnostic composition.

[0076] The kit may contain, in addition to a preparation for measuring the level of the gene mRNA or its protein, conventional tools and reagents in the art that are preferably used in cancer diagnostic kits.

[0077] The contents overlapping with the above-mentioned "cancer diagnostic composition comprising a preparation for measuring the expression levels of miRNAs miR-324-5p and miR-324-3p.1; and a cancer diagnostic kit comprising the same" are omitted in order to avoid overly complicating this specification. [Effects of the Invention] The present invention relates to a pharmaceutical composition for preventing or treating cancer, which comprises a TUT4 / 7 expression regulator. The pharmaceutical composition of the present invention can prevent cell division and inhibit cancer progression by suppressing the function of TUT4 / 7, increase the amount of miR-324-5p, and suppress the function of miR-324-3p.1, so that it can be effectively used in the prevention, treatment, or diagnosis of cancer. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: mir-324 arm switching results. 1A shows the scattergram of median absolute deviation of 5p ratios to miRNAs (abundant and ubiquitous miRNAs (>100 median RPM in both datasets, >0 RPM in all samples) were included in the analysis). 1B shows the isomiR profile of miR-324 in HEK293T as measured by AQ-seq (RPM-normalized read counts are on the left, 5p and 3p reference sequences are shaded grey). 1C shows the strand ratios of mir-324 (5p / 3p.1) for the indicated panel of mouse tissues as measured by AQ-seq. 1D shows the conservation of miR-324 5'-isomiR in mammals.

[0078] [Figure 2] Results of mir-324 arm switching regulated by TUT4 / 7. Figure 2A shows the negative correlation between the uridine transcription frequency of miR-324-3p and the 5p / 3p.1 ratio of mir-324 in nine human cell lines and 15 mouse tissues (linear regression line shown). s : Spearman correlation coefficient), and Figure 2B shows the relative TUT4 / 7 levels and 5p / 3p.1 ratio of mir-324 in the indicated panel of mouse tissues (TUT4 / 7 mRNA levels and 5p / 3p.1 ratios were quantified by RT-qPCR and AQ-seq, respectively. r s: Spearman correlation coefficient), Figure 2C shows the AQ-seq results after knockdown of TUT4 / 7 in HEK293T (left and middle: uridine ion production frequency and 5p ratio scatter of miRNAs. miRNAs that were abundant in siNC-transfected samples (>100 RPM) were included in the analysis. Right: relative abundance of three 5'-isomiRs and log2-transformed 5p / 3p ratio of mir-324). Figure 2D shows the AQ-seq results after knockdown of TUT4 / 7 in HEK293T (left and middle: uridine ion production frequency and 5p ratio scatter of miRNAs. miRNAs that were abundant in siNC-transfected samples (>100 RPM) were included in the analysis. Right: relative abundance of three 5'-isomiRs and log2-transformed 5p / 3p ratio of mir-324). Northern blots of miR-24-5p and miR-324-3p (synthetic mir-324 duplex was used as size standard), and Fig. 2E shows sRNA-seq results after Tut4 / 7 double knockout in mice (Left: 5'-isomiR abundance changes due to TUT4 / 7 depetion in bone marrow. 5'-isomiRs with RPM > 10 in control samples were included in the analysis. P-values ​​by two-sided Student's t test. Right: log2-modified 5p / 3p.1 ratio of mir-324. Bars are mean ± sd. Bone marrow n = 2; embryonic fibroblasts n = 2; embryonic stem cells n = 3; control and Tut4 / 7 dKO in liver n = 4 and 3, respectively. *p<0.05, ***p<0.001 RPM by two-sided Student's t test. RPM: reads per million).

[0079] Figure 3: Alternative Dicer cleavage of pre-mir-324 induced by uridylation. Fig. 3A shows in vitro processing of unmodified, mono- or di-uridylated forms of pre-mir-324 by immunopurified Dicer (synthetic miR-324-5p (23nt) shown in blue was used as a size standard. Major cleavage products and corresponding cleavage sites are indicated by arrowheads. *: radiolabeled 5' phosphate). Fig. 3B shows the 5'-isomiR composition of miR-324-3p in HEK293T, and Fig. 3C shows the 5'-isomiR composition of miR-324-3p in mice (bars are averages; bone marrow n=2; embryonic fibroblasts n=2; embryonic stem cells n=3; control and Tut4 / 7dKO in liver n=4 and 3, respectively).

[0080] Figure 4: Results of alternative Dicer cleavage promoted by the double stranded RNA-binding domain (dsRBD). Figure 4A shows in vitro cleavage of the unmodified, mono-, or di-uridylated forms of wild-type or no-bulge mutant pre-mir-324 by immunopurified Dicer. Figures 4B and 4C show in vitro cleavage of the unmodified, mono-, or di-uridylated forms of pre-mir-324 by immunopurified pocket Dicer mutants (Figure 4B) or dsRBD-deleted mutants (Figure 4C). (Major cleavage products and relevant cleavage sites are indicated by arrowheads. *: radiolabeled 5' phosphate. †: nicked product at 3p position.) Figure 4D shows a proposed model for uridineylation-mediated alternative Dicer cleavage of pre-mir-324.

[0081] Fig. 5: Arm switching results induced by alternative Dicer cleavage. Fig. 5A shows a schematic of strand selection of mir-324 double complexes generated from unmodified and uridineylated pre-mir-324 (dotted boxes indicate the ends directing strand selection of each double complex) and Fig. 5B shows luciferase reporter assays using two mir-324 double complexes (Left: Diagram of firefly reporter mRNA with three 8mer target sites of miR-324-5p or 3p.1. Right: Relative reporter activity of firefly luciferase for two mir-324 double complexes in HEK293T. Renilla luciferase reporter activity was used as a control. Bars show mean ± sd. (n = 2 biological replicates). **p < 0.01 by two-sided Student's t test).

[0082] [Figure 6] Results of cell cycle progression regulated by mir-324 arm switching. Figure 6A shows the ratio of 5'-isomiR composition of miR-324-3p in glioblastoma and normal brain tissues (normal brain n = 3; glioblastoma n = 6). Figure 6B shows the expression levels of TUT4 / 7 in normal, low-grade glioma and glioblastoma tissues from the Oncopression database (normal n = 723; grade 1 n = 74; grade 2 n = 133; grade 3 n = 132; glioblastoma n = 865. ***p < 0.001 by one-way ANOVA with Tukey's post hoc test for multiple comparisons). Figure 6C shows the negative correlation between TUT4 / 7 expression levels and miR-324-5p / 3p ratios in glioblastoma (black) and matched normal brain tissue (white) (linear regression is shown by dotted line. r s : Spearman correlation coefficient), Figure 6D shows western blots and cell cycle profiles of the indicated cyclin proteins after overexpressing synthetic 5p duplex (long duplex) or 3p.1 duplex (short duplex) of mir-324 in A172 cells, Figure 6E shows western blots and cell cycle profiles of the indicated cyclin proteins after suppressing miR-324 by locked nucleic acid antisense oligonucleotides in A172 cells, and Figure 6F shows western blots and cell cycle profiles of the indicated proteins after knockdown of TUT4 / 7 in A172 cells (*: cross-reactive bands; PI: propidium iodide; BrdU: bromodeoxyuridine).

[0083] FIG. 7 is a schematic diagram of the mir-324 arm switching mechanism model. [Mode for carrying out the invention] The present invention will now be described in more detail with reference to the following examples, but these examples are merely for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention.

[0084] Throughout this specification, "%" used to indicate the concentration of a particular substance is, unless otherwise specified, % (wt / wt) for solid / solid, % (wt / volume) for solid / liquid, and % (volume / volume) for liquid / liquid. [Preparation example] 1.AQ-seq Library AQ-seq (bias-minimized sRNA-seq) libraries were constructed using total RNA from 15 mouse tissues as described in a previous study ( Kim et al., 2019 ).

[0085] Specifically, 5 μg of total RNA was mixed with 30 equimolar spike-in RNAs (10 fmole of miRNA-like non-human / mouse / frog / fish RNAs used for bias assessment). Small RNAs were enriched by size fractionation using 15% urea-polyacrylamide gel electrophoresis and sequentially ligated to randomized adapters at the 3' and 5' ends. The ligated RNAs were reverse transcribed using SuperScript III reverse transcriptase (Invitrogen), amplified using Phusion High-Fidelity DNA polymerase (Thermo Scientific), and subjected to high-throughput sequencing (HTS) on the MiSeq platform (Illumina).

[0086] 2. High-throughput sequencing analysis of miRNA Data were processed as described in a previous study ( Kim et al., 2019 ), except that reads from sRNA-seq results in mouse were mapped to the mouse genome (mm10).

[0087] Specifically, 3' adapters were clipped from reads using cutadapt (Martin, 2011). For AQ-seq data, 4-nt degenerate sequences were further removed using FNTX-Toolkit (http: / / hannonlab.cshl.edu / fastx toolkit / ). After filtering short and low-quality artificial reads using FASTX-Toolkit, AQ-seq data were first aligned to spike-in sequences, and unaligned reads were then mapped to genomes, while other sRNA-seq data were mapped to genomes using BWA (Li and Durbin, 2010). Then, the alignment results with the best alignment scores, which only allowed 3'-end mismatches, were selected. miRNA annotations were retrieved from miRBase release 21 with the intersection tool of BEDTools (Cozomara and Griffiths-Jones, 2014; Quinlan and Hall, 2010).

[0088] For quantitative analysis of miRNA strand ratio, we first identified the most abundant 5'-isomiR for a given mature miRNA in the most abundantly expressed cell lines or tissues. Then, we calculated the ratio between the top 5'-isomiRs from 5p and 3p for all cell lines or tissues. Nonrepetitive miRNA genes with both strands annotated in miRBase release 21 were included in this analysis.

[0089] 3.Targetome analysis Results from modified versions of AGO CLIP-seq (CLEAR-CLIP and CLASH) were analyzed to identify miR-324 targets (Helwak et al., 2013; Moore et al., 2015).

[0090] First, for CLEAR-CLIP analysis, reads containing miR-324 sequences were extracted after clipping the 3' and 5' adapters using cutadapt. Target RNA sequences were then mapped to the mouse genome (mm10). Annotations were retrieved from GENCODE release M19 with the BEDTools intersection tool.

[0091] Next, the supplemental files of CLASH data generated by protocol E4 were used for CLASH analysis. Target genes of miR-324-3p were subdivided according to the 5′ end of the miR-324-3p sequence.

[0092] 4. Plasmid Construction To construct plasmids for the expression of wild type, 5' pocket Dicer mutants, and 3' pocket Dicer mutants, the coding sequence of the human Dicer reference (RefSeq NM_030621) was amplified in the presence or absence of mutations introduced in a previous study (Park et al. 2011). The amplified DNA was subcloned into pCK-FLAG vector (CMV promoter-driven vector) at the BamHI and XhoI sites using the In-Fusion HD Cloning Kit (Clontech).

[0093] For double stranded RNA-binding domain (dsRBD)-deleted Dicer, the coding region except for the sequence corresponding to amino acids V1849-S1922 was amplified and subcloned into the pCK-FLAG vector using the same strategy.

[0094] For TRBP, the coding sequence of human TRBP reference (RefSeq NM_134323) was amplified and subcloned into the pcDNA3-cMyc vector (Invitrogen) at the BamHI and XhoI sites.

[0095] Finally, to construct plasmids for luciferase analysis, synthetic DNA oligos containing three 8-mer target sites of miR-1-3p, miR-324-5p, or miR-324-3p.1 were amplified and inserted into pmirGLO (Promega) at the XhoI and XbaI sites. The sequences of the synthetic DNA oligos and PCR primers are shown in Table 1 below.

[0096] [Table 1]

[0097] 5. Cell culture and transfection A172 and U87MG were obtained from the Korea Cell Line Bank. HEK293T, A172 and U87MG were maintained in DMEM (WELGENE) supplemented with 10% fetal bovine serum (WELGENE). Primary tumor cells derived from a glioblastoma patient (TS13-64) were established from fresh glioblastoma tissue specimens as approved by the Institutional Review Board of Yonsei University College of Medicine (4-2012-0212, 4-2014-0649).

[0098] For tumorsphere culture, TS13-64 cells were grown in DMEM (WELGENE) supplemented with 1X B-27 (Thermo Scientific), 20 ng / mL bFGF (R&D Systems) and 20 ng / mL EGF (Sigma-Aldrich) (Sigma-Aldrich) (Kong et al., 2013).

[0099] To knockdown TUT4 / 7, cells were transfected twice with 20-22 nM siRNA using Lipofectamine 3000 (Thermo Scientific) and harvested 4 days after the first transfection.

[0100] For Dicer overexpression, HEK293T cells were transfected with pCK-FLAG-DICER using Lipofectamine 3000 and harvested 2 days after transfection.

[0101] To deliver synthetic miRNA or inhibitors, cells were transfected with 20 nM synthetic miRNA duplex or 80 nM LNA miRNA inhibitors using Lipofectamine 3000 and harvested 2 days after transfection.

[0102] Control siRNA (AccuTarget negative control siRNA), siRNA, control miRNA and synthetic mir-324 duplex were obtained from Bioner. Control miRNA inhibitors (miRCURY LNA miRNA inhibitor negative control A) and miR-324 inhibitors (hsa-miR-324-5p and hsa-miR-324-3p miRCURY LNA miRNA inhibitors) were obtained from QIAGEN. The sequences of synthetic siRNA and miRNA are shown in Table 2 below.

[0103] [Table 2]

[0104] 6. Northern blot Total RNA was isolated using TRIzol (Invitrogen) and small RNA (<200 nt) was enriched using the mirVana miRNA Isolation Kit (Ambion). RNA was then analyzed on a 15% urea-polyacrylamide gel. Synthetic mir-324 duplex and the Decade Markers System (Ambion) were used as size markers. RNA was transferred to a Hybond-NX membrane (Amersham) and crosslinked to the membrane with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide. The 5' end of the antisense probe was probed with [γ -32The membranes were radiolabeled with [P]ATP and purified using a Performa Spin column (Edge BioSystems). The membranes were incubated with UltraPure Salmon Sperm DNA solution (Thermo Scientific) denatured with PerfectHyb Plus hybridization buffer, hybridized with the antisense probe, washed with mild wash buffer (0.05% SDS and 2X SSC) and then with stringent wash buffer (0.1% SDS and 0.1X SSC). Radioactive signals were detected by a Typhoon FLA 7000 (GE Healthcare) and analyzed by Multi Gauge software (FujiFilm).

[0105] miR-324-3p was detected first, and after stripping the probe, miR-324-5p was detected. To remove the probe from the blot, the membrane was soaked in pre-boiled 0.5% SDS for 15 minutes. Synthetic mir-324 duplex (AccuTarget) was obtained from Bioneer. The sequences of the probes are shown in Table 3 below.

[0106] [Table 3]

[0107] 7. Quantitative real-time PCR (RT-qPCR) To measure mRNA levels in mouse tissues, RNA from Mouse Total RNA Master Panel (Takara) was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) and quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System (Thermo Scientific) with Power SYBR Green PCR Master Mix (Thermo Scientific). GAPDH was used as an internal control, and the sequences of the qPCR primers are shown in Table 4 below.

[0108] [Table 4]

[0109] To quantify the miR-324-5p / 3p strand ratio, total RNA was isolated using TRIzol. cDNA was then synthesized using the TaqMan miRNA Reverse Transcription Kit (Applied Biosystems) and quantitative real-time PCR was performed using the TaqMan Gene Expression Analysis Kit (Applied Biosystems) on a StepOnePlus Real-Time PCR system. U6 snRNA was used as an internal control.

[0110] 8. In vitro Dicer cleavage analysis Pre-mir-324 and its mutants were induced by T4 polynucleotides [γ -32 P]ATP was radiolabeled and purified using Oligo Clean & Concentrator (Zymo Research) according to the manufacturer's instructions.

[0111] For immunoprecipitation of FLAG-DICER, HEK293T cells overexpressing Dicer protein were lysed with lysis buffer (500 mM NaCl, 20 mM Tris (pH 8.0), 1 mM EDTA, 1% Triton X-100) and sonicated using a Bioruptor Standard (Diagenode). After centrifugation, the supernatant was incubated with 10 μL of ANTI-FLAG M2 Affinity Gel (Sigma-Aldrich). The beads were washed twice with lysis buffer, four times with high salt buffer (800 mM NaCl and 50 mM Tris (pH 8.0)), and four times with buffer D (200 mM KCl, 20 mM Tris (pH 8.0), 0.2 mM EDTA).

[0112] Immunopurified Dicer underwent in vitro reaction in a total volume of 30 μL (containing 2 mM MgCl2, 1 mM DTT, 60 units of SUPERase In RNase Inhibitor (Thermo Scientific), and 5'-radiolabeled pre-mir-324). RNA was purified with phenol extraction or Oligo Clean & Concentrator and analyzed on 15% urea-polyacrylamide gel. Synthetic miR-324-5p and Decade Markers System were used as size markers. Synthetic pre-mir-324 fragment was obtained from IDT. Synthetic miR-324-5p was obtained from Bioneer. The sequences of synthetic pre-mir-324 fragment and miR-324-5p are shown in Table 5 below.

[0113] [Table 5]

[0114] 9. Dual-luciferase Reporter Analysis pmirGLO, containing three 8-mer target sites of miR-1-3p, miR-324-5p or miR-324-3p.1, was co-transfected with control miRNA or mir-324 dual complex into HEK293T cells using Lipofectamine 3000. Two days after transfection, cells were harvested and reporter assays were performed. Reporter activity was measured using the Dual-Luciferase Reporter Assay System on a Spark® microplate reader (TECAN) according to the manufacturer's instructions (Promega). Given that miR-1-3p was barely expressed in HEK293T (~8 RPM in AQ-seq), pmirGLO with three 8-mer target sites of miR-1-3p was used as a plasmid control. Control miRNA was used for additional normalization.

[0115] 10. Gene expression analysis of glioblastoma patient data Preprocessed gene expression data were retrieved using microarrays from Oncopression (http: / / oncopression.com) (Lee and Choi, 2017). The REMBRANDT gene expression dataset (E-MTAB-3073) was obtained from ArrayExpress (Madhavan et al., 2009).

[0116] To analyze simultaneous mRNA and miRNA profiling ( Gulluoglu et al., 2018 ), raw microarray data were normalized by robust multi-array average (RMA) using the limma package in R and then used for gene expression analysis.

[0117] 11.Survival analysis Level 3 miRNA gene quantification data and clinical data for TCGA glioblastoma patients were obtained from the GDC legacy archive and GDC data portal, respectively. Patients were stratified by miR-324-5p / 3p ratio, and the top and bottom 40% were included in the analysis. Patient survival was estimated by the Kaplan-Meier method and tested with the two-sided log-rank test using the survival package in R.

[0118] 12. Western blot Cells were washed with PBS and lysed in RIPA buffer (Thermo Scientific) supplemented with protease inhibitor cocktail set III (Merck Millipore) and phosphatase inhibitor cocktail II (AG Scientific). Protein concentrations were measured with a BCA protein assay kit (Pierce Biotechnology), and identical amounts of protein were separated from 4–12% Tris-glycine gels (Thermo Scientific) and transferred to Immobilon-P PVDF membranes (Merck Millipore). The membranes were incubated with 5% nonfat milk in PBS-T (PBS (Amresco) + 0.1% Tween 20 (Anatrace)) and then treated with primary antibodies. After washing three times with PBS-T, the membranes were incubated with HRP-conjugated secondary antibodies. Protein bands were detected by SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Scientific) and scanned by a ChemiDoc XRS+ system (Bio-Rad).

[0119] Rabbit polyclonal antibodies against TUT4 (18980-1-AP, RRID:AB_10598327, 1:500) and TUT7 (25196-1-AP, 1:500) were obtained from Proteintech. Mouse monoclonal antibodies against Cyclin E (sc-247, RRID:AB_627357, 1:1,000) and rabbit polyclonal antibodies against Cyclin A (sc-751, RRID:AB_631329, 1:1,000), Cyclin B1 (sc-752, RRID:AB_2072134, 1:1,000), and Cyclin D1 (sc-753, RRID:AB_2070433, 1:1,000) were obtained from Santa Cruz Biotechnology. Rabbit polyclonal antibody against HSP90 (4874, RRID:AB_2121214, 1:1,000) was obtained from Cell Signaling. HRP-conjugated goat polyclonal antibodies against rabbit IgG (111-035-144, RRID:AB_2307391, 1:10,000) and mouse IgG (115-035-146, RRID:AB_2307392, 1:10,000) were obtained from Jackson ImmunoResearch.

[0120] 13.Flow cytometry Cells were incubated with 10 μM BrdU for 3–8 h and then fixed with ice-cold 70% ethanol. Fixed cells were incubated with FITC-conjugated anti-BrdU antibody (11-5071-42, RRID:AB_11042627, Invitrogen) and additionally stained with 20 μg / mL propidium iodide (Sigma-Aldrich) in the presence of 10 μg / mL RNase A (Thermo Scientific). Then, they were detected using a BD Accuri C6 Plus flow cytometer. The cell cycle was analyzed by the BD Accuri C6 system software. [Example] 1. Alternative strand selection (or arm switching) of mir-324 First, we searched for miRNAs that showed large changes in strand ratio. For accurate quantification of strand ratio, we used the AQ-seq library protocol. Variation in strand selection was estimated across 15 different mouse tissues / developmental stages (x-axis in Figure 1A). To compare human strand usage, we also used sRNA-seq datasets from nine human cell lines.

[0121] As can be seen in Figure 1A, the majority of miRNAs in both human and mouse datasets did not change strand fraction (~79%, mean variance <3%), but we identified a few cases where changes were evident, such as mir-324, mir-362, mir-193a, and mir-140.

[0122] In particular, we focused on strand changes in mir-324, as arm switching of mir-324 is thought to have a substantial effect on cell fate decisions.

[0123] As can be seen from Figure 1B-D, three groups of 5'-isomiRs (5p, 3p.1 and 3p.2) generated at a single MIR324 locus were detected (Figure 1B). The 5p strand was predominant in mouse embryos and neural tissues, whereas the major 3p variant, 3p.1, appeared predominantly in liver and stomach (Figure 1C). The 5'-isomiR group was also found in mammals, implying that the alternative strand selection mechanism is evolutionarily conserved (Figure 1D).

[0124] 2. mir-324 arm switching is regulated by TUT4 and TUT7.

[0125] We found that the uridylation frequency of 3p was negatively correlated with the 5p / 3p.1 ratio (Fig. 2A), leading us to hypothesize that uridylation may be involved in arm switching.

[0126] On the other hand, the terminal uridylyl transferases TUT4 (also known as ZCCHC11 and TENT3A) and TUT7 (also known as ZCCHC6 and TENT3B) are known to catalyze the uridylation of various RNA species, including a specific set of pre-miRNAs (e.g., the let-7 precursor). TUT4 and TUT7 (TUT4 / 7) operate redundantly on most substrates.

[0127] Based on the above findings, we quantified TUT4 / 7 levels (RT-qPCR) in mouse tissues and found that the 5p / 3p.1 ratio was higher in cell types with relatively low TUT4 and TUT7 levels (Figure 2B).

[0128] To confirm the involvement of TUT4 / 7 in mir-324 maturation, we depleted TUT4 / 7 in HEK293T cells and performed sRNA-seq (AQ-seq).

[0129] As can be seen in Figure 2C, TUT4 / 7 knockdown decreased the urinylation of miRNAs, including miR-324-3p (top left panel), and also led to changes in the isoform composition of miR-324, such as a decrease in 3p.1 and an increase in 5p and the minor isoform 3p.2, resulting in an increase in the ratio between the major isoforms (5p / 3p.1) (top right and bottom right panels).

[0130] These sequencing data were consistent with the Northern blot results (Figure 2D), implying that the abundance of miR-324 variants was altered upon TUT4 / 7 knockdown.

[0131] Additionally, reanalysis of published sRNA-seq data from TUT4 / 7 double knockout mice showed that 3p.1 levels were decreased but 5p levels were increased upon TUT4 / 7 knockout (left panel), as shown in Figure 2E. Consequently, changes in strand ratios due to TUT4 / 7 double knockout were observed in all tissue / cell types examined (bone marrow, embryonic fibroblasts, embryonic stem cells, and liver) (right panel).

[0132] 3. Uridineylation induces alternative Dicer cleavage of pre-mir-324.

[0133] Because TUT4 / 7 are known to modify pre-miRNAs rather than mature miRNAs, we therefore performed in vitro Dicer cleavage assays with synthetic pre-mir-324 to determine the effect of uridineylation on pre-miRNA cleavage.

[0134] As can be seen in Figure 3A, when pre-mir-324 possessed one or two extra uridine residues at its 3' end, the Dicer cleavage site shifted by 3-nt (from position A to position B in Figure 3A). Unmodified pre-mir-324 released a longer double complex (black arrow) containing mainly 5p and 3p.2, whereas uridineylated pre-mir-324 cleaved at an alternative position (position B) and generated a shorter double complex composed of the shorter 5p and 3p.1 (white arrow). Thus, TUT4 / 7-mediated uridineylation of pre-mir-324 was found to lead to alternative Dicer cleavage.

[0135] Furthermore, as can be seen in Figures 3B and 3C, sequencing data from TUT4 / 7-depleted human and mouse cells show that the relative abundance of 3p isomiRs (3p.1 vs. 3p.2) is altered upon TUT4 / 7 knockdown (Figure 3B) and knockout (Figure 3C), supporting the conclusion that uridineylation alters Dicer cleavage site selection.

[0136] 4. Alternative Dicer cleavage is promoted by a double stranded RNA-binding domain.

[0137] First, to identify the determinant responsible for the 3-nt translocation, we deleted the U bulge from pre-mir-324.

[0138] As can be seen in Figure 4A, in the case of the "no-U bulge" mutant, the Dicer cleavage site did not shift suddenly to position B upon uridine addition, but shifted sequentially according to the number of uridines (lanes 10-12). Therefore, we confirmed that the U bulge is an anti-determinant for cleavage at the site between positions A and B, thereby acting as a cis-acting element responsible for alternative cleavage by Dicer.

[0139] Next, to determine how the 5'- and 3'-counting rules relate to pre-mir-324 cleavage, we utilized Dicer mutants in the 5' or 3' pocket.

[0140] As can be seen in Fig. 4B, the 5' pocket Dicer mutant was unable to cleave pre-mir-324 at position A, whereas the 3' pocket mutant had no effect on cleavage site selection and only slightly affected the cleavage efficiency, suggesting the importance of the 5' pocket for cleavage at position A.

[0141] We further investigated the contribution of other domains in Dicer. To confirm the role of the Dicer dsRBD in vitro, we generated a dsRBD-deletion mutant.

[0142] As can be seen in Figure 4C, dsRBD deletion resulted in a substantial change in the cleavage pattern: in the absence of the dsRBD, Dicer primarily cleaved at position A, suggesting that the dsRBD is responsible for cleavage at position B.

[0143] In summary, as can be seen in Figure 4D, unmodified pre-mir-324 relies on the 5' pocket present in the Dicer platform region for cleavage at position A (left panel), but upon uridineylation, it is no longer tightly anchored to the platform / PAZ domain, and the final structure (3-4 nt 3' overhang) allows pre-mir-324 to be repositioned in Dicer with the aid of the dsRBD to allow alternative cleavage at position B (right panel).

[0144] 5. Alternative Dicer cleavage induces arm switching.

[0145] The results of the above examples show that pre-mir-324 can generate two alternative forms of double complexes, namely, a long double complex (position A; 5p / 3p.2) and a short double complex (position B; 5p / 3p.1), as can be seen in Figure 5A.

[0146] To confirm strand selection in cells, we constructed reporters containing 3' UTRs complementary to miR-324-5p or miR-324-3p.1 (Fig. 5B, left panel), and co-transfected synthetic double complexes ((5p / 3p.2) or (5p / 3p.1)) with the reporters. The long double complexes selectively repressed the reporters with 5p complementary sites but not with 3p.1 sites. In contrast, the short double complexes downregulated the 3p.1 reporter but not the 5p reporter (Fig. 5B, right panel).

[0147] These results suggest that 5p and 3p.1 are indeed generated separately from long and short duplexes: in the long duplex, the 5' end of 5p is thermodynamically less stable than that of 3p.2, leading to the selection of the 5p strand (Fig. 5A, blue dotted rectangle), whereas in the short duplex, 3p.1 begins with the 5' adenosine preferred by AGO (Fig. 5A, red dotted rectangle).

[0148] In summary, we show that alternative Dicer cleavage leads to arm switching of mir-324.

[0149] 6.mir-324 arm switching regulates cell cycle progression.

[0150] Alterations at the 5' end of miR-324-3p have been reported in human glioblastoma (GBM), and as can be seen in Figure 6A, the ratio of 3p.1 appeared substantially higher in tumors (GBM) than in normal brain tissue (normal brain).

[0151] Therefore, to investigate whether TUT4 / 7-mediated mir-324 maturation may be differentially regulated in GBM, we analyzed the transcript dataset using Oncopression.

[0152] As can be seen in FIG. 6B, both TUT4 and TUT7 were significantly upregulated in GBM.

[0153] Furthermore, we identified upregulated TUT4 / 7 abundance and decreased miR-324-5p / 3p ratios in GBM when compared to normal samples using an independent dataset profiling both mRNA and miRNA.

[0154] As can be seen in Figure 6C, TUT4 / 7 levels were found to be negatively correlated with the 5p / 3p ratio, suggesting that TUT4 / 7-mediated mir-324 regulation may be physiologically relevant in GBM.

[0155] Based on the above results, to understand the function of mir-324 arm switching, we investigated the molecular and cellular phenotypes induced by mir-324 alternative strand selection in GBM cell lines.

[0156] As can be seen in Figures 6D and 6E, transfection of synthetic long duplexes ("5p duplex") or antisense oligos against 3p ("3p inhibitor") led to accumulation of cyclins D and E and reduction of cyclins A and B (left panel), and cell cycle profiling showed that cells were arrested in the G1 phase (right panel).

[0157] As can be seen in Figure 6F, TUT4 / 7 knockdown similarly resulted in cyclin dysregulation and G1 arrest.

[0158] In conclusion, miR-324 isomiRs have opposing functions on GBM cell proliferation. [summary] As can be seen from Figure 7, terminal uridine esterase TUT4 / 7 plays a key role in mir-324 alternative strand selection by uridineylating pre-mir-324. That is, TUT4 / 7 uridineylates pre-mir-324, and the uridineylation phenomenon changes the ratio between three microRNAs (5p and 23p variants) with different functions by regulating the Dicer cleavage site of pre-mir-324. Therefore, inhibition of miR-324 regulation by uridineylation can suppress the expression of cell division-related genes and inhibit the growth of glioblastoma.

[0159] According to the present invention, alternative strand selection of microRNA (miR-324) by TUT4 / 7 can be regulated, which can be effectively used for the prevention and treatment of cancer (brain tumor). [Industrial Applicability] The present invention relates to a pharmaceutical composition for preventing or treating cancer, comprising a TUT4 / 7 expression regulator, and more specifically, to a pharmaceutical composition for preventing or treating cancer, comprising a nucleic acid sequence that regulates TUT4 / 7 expression. [Brief description of the drawings]

[0160] [Figure 1A] mir-324 arm switching results showing the scatter of mean absolute deviation of 5p ratio to miRNA. [Figure 1B] mir-324 arm switching results, showing the IsomiR profile of miR-324 in HEK293T cells measured by AQ-seq. [Figure 1C] mir-324 arm switching results showing mir-324 strand ratios for the indicated panel of mouse tissues measured by AQ-seq. [Figure 1D] mir-324 arm switching results showing conservation of the 5'-isomiR of miR-324 in mammals. [Figure 2A] Figure 1. TUT4 / 7-regulated mir-324 arm switching results, showing a negative association between the uridineylation frequency of miR-324-3p and the 5p / 3p.1 ratio of mir-324 in nine human cell lines and 15 mouse tissues. [Figure 2B] TUT4 / 7-regulated mir-324 arm switching results showing relative TUT4 / 7 levels and mir-324 5p / 3p.1 ratios in the indicated panel of mouse tissues. [Figure 2C] mir-324 arm switching regulated by TUT4 / 7. AQ-seq results after TUT4 / 7 knockdown in HEK293T. [Figure 2D] Figure 1 shows the results of mir-324 arm switching regulated by TUT4 / 7, and Northern blots of miR-324-5p and miR-324-3p in HEK293T. [Figure 2E]mir-324 arm switching regulated by TUT4 / 7. sRNA-seq results after double Tut4 / 7 knockout in mice. [Figure 3A] Alternative Dicer cleavage of pre-mir-324 induced by uridine silencing. Shows in vitro cleavage of unmodified, mono- or di-uridine silencing forms of pre-mir-324 by immunopurified Dicer. [Figure 3B] Alternative Dicer cleavage of pre-mir-324 induced by uridineylation, showing the 5'-isomiR composition of miR-324-3p in HEK293T. [Figure 3C] 13. Uridineylation-induced alternative Dicer cleavage of pre-mir-324, showing the 5'-isomiR composition of miR-324-3p in mice. [Figure 4A] Alternative Dicer cleavage promoted by the double-stranded RNA-binding domain shows in vitro cleavage of unaltered, mono- or di-uridylated forms of wild-type or bulgeless mutant pre-mir-324 by immunopurified Dicer. [Figure 4B] Alternative Dicer cleavage promoted by the double-stranded RNA-binding domain shows in vitro cleavage of unmodified, mono- or di-uridylated forms of pre-mir-324 by immunopurified pocket Dicer mutants. [Figure 4C] This is the result of alternative Dicer cleavage facilitated by the double-stranded RNA-binding domain, demonstrating in vitro cleavage of unaltered, mono- or di-uridylated forms of pre-mir-324 by dsRBD-deleted mutants. [Figure 4D] This results in alternative Dicer cleavage promoted by the duplex RNA-binding domain and shows a proposed model for uridineylation-mediated alternative Dicer cleavage of pre-mir-324. [Figure 5A]Schematic representation of alternative Dicer cleavage-induced arm-switching outcomes and strand selection of mir-324 binary complexes generated from unmodified and uridylated pre-mir-324. [Figure 5B] Alternative Dicer cleavage-induced arm switching results. Luciferase reporter analysis using two mir-324 double complexes. [Figure 6A] Cell cycle progression regulated by mir-324 arm switching. The ratio of 5'-isomiR composition of miR-324-3p in glioblastoma and normal brain tissues. [Figure 6B] Cell cycle progression regulated by mir-324 arm switching. Expression levels of TUT4 / 7 in normal, low-grade glioma and glioblastoma tissues from the Oncopression database. [Figure 6C] Cell cycle progression regulated by mir-324 arm switching results in a negative correlation between TUT4 / 7 expression levels and miR-324-5p / 3p ratio in glioblastoma (black) and matched normal brain tissue (white). [Figure 6D] Cell cycle progression regulated by mir-324 arm switching. Western blot and cell cycle profiles of the indicated cyclin proteins after overexpressing synthetic 5p bicomplexes or 3p.1 bicomplexes of mir-324 in A172 cells. [Figure 6E] Cell cycle progression regulated by mir-324 arm switching. Results show western blot and cell cycle profiles of the indicated cyclin proteins after suppression of miR-324 by locked nucleic acid antisense oligonucleotides in A172 cells. [Figure 6F] Cell cycle progression regulated by mir-324 arm switching. Western blot and cell cycle profiles of the indicated proteins after TUT4 / 7 knockdown in A172 cells. [Figure 7]Schematic diagram of the mir-324 arm switching mechanism model.

Claims

1. A microRNA comprising a base sequence of SEQ ID NO:1; and a base sequence of SEQ ID NO:2, The microRNA is in the form of a long duplex.

2. The microRNA of claim 1 , wherein a phosphate is bound to the 5′ end of each of the base sequences.

3. A pharmaceutical composition for preventing or treating cancer, comprising the microRNA according to claim 1 or 2.

4. The pharmaceutical composition for preventing or treating cancer according to claim 3, further comprising: a nucleic acid consisting of the base sequence of SEQ ID NO: 4; a short interfering RNA (siRNA) comprising a base sequence selected from SEQ ID NOs: 5 to 20; and a composition.

5. The pharmaceutical composition for preventing or treating cancer according to claim 4, wherein the short interfering RNA is in the form of a complex in which a short interfering RNA having a base sequence of any one of SEQ ID NOs: 5 to 8 and a short interfering RNA having a base sequence of any one of SEQ ID NOs: 9 to 12 are bound to each other; or in the form of a complex in which a short interfering RNA having a base sequence of any one of SEQ ID NOs: 13 to 16 and a short interfering RNA having a base sequence of any one of SEQ ID NOs: 17 to 20 are bound to each other.

6. 4. The pharmaceutical composition for preventing or treating cancer according to claim 3, wherein the cancer is selected from the group consisting of brain cancer, colon cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, breast cancer, thyroid cancer, brain cancer, head and neck cancer and malignant melanoma.

7. The pharmaceutical composition for preventing or treating cancer according to claim 6 , wherein the cancer is a brain tumor.

Images