UBE3A Gene and Expression Cassettes and Uses Thereof

Abstract

The present invention relates to polynucleotides comprising UBE3A open reading frame (ORF) sequences, vectors containing the same, and methods of using the same for delivery of the ORF to cells or subjects and for treating disorders associated with aberrant expression of the UBE3A gene or aberrant activity of the UBE3A gene product in a subject, such as Angelman syndrome.

Description

[Technical field]

[0001] Claiming priority This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 851,411, filed May 22, 2019, the entire contents of which are incorporated herein by reference.

[0002] Statement Regarding Electronic Filing of Sequence Listings A Sequence Listing in ASCII text format submitted under 37 CFR 1.821 and filed via EFS-Web, entitled 5470-867WO_ST25.txt, created May 20, 2020, and 49,256 bytes in size, is provided in lieu of a paper copy, and is incorporated herein by reference for its disclosure.

[0003] The present invention relates to polynucleotides comprising the UBE3A open reading frame (ORF) sequence, vectors containing same, and methods of using same for delivery of said ORF to a cell or a subject and for treating disorders associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject, such as Angelman syndrome. [Background technology]

[0004] Angelman syndrome (AS) is a neurodevelopmental disorder that affects approximately 1:15,000 individuals. Individuals with AS have seizures, movement disorders, intellectual disability, and language deficits throughout their life. Individuals usually present with ataxia during the first year of life. Loss of functional UBE3A gene in neurons causes AS.

[0005] UBE3A is located on chromosome 15 and is the only gene in the 15q11-q13 region that exhibits biased expression from the maternally derived allele. The paternally derived allele is silenced in neurons due to paternal imprinting. Thus, both maternally derived 15q11-13 deletions and maternally derived loss-of-function mutations in UBE3A cause AS (see Figure 1). Point mutations impairing the E3 ubiquitin ligase function of the UBE3A protein (also known as E6AP ubiquitin protein ligase (E6AP)) are sufficient to result in the full spectrum of AS phenotypes, highlighting the importance of UBE3A for the pathogenesis of AS. The consensus is that neuronal loss of UBE3A induces AS. Glia, unlike neurons, are unlikely to play a role, as they express UBE3A biallelicly and at very low levels.

[0006] Currently, there is no specific treatment available for AS. Individuals affected by AS are managed with supportive symptomatic treatment. Summary of the Invention

[0007] The present invention is based in part on the development of optimized UBE3A genes, gene cassettes, and vectors that can provide therapeutic levels of UBE3A expression for treating disorders associated with UBE3A misexpression, such as Angelman syndrome. Embodiments of the present invention overcome shortcomings in the art by providing codon-optimized UBE3A genes, gene cassettes, and vectors that can provide therapeutic levels of UBE3A expression for treating disorders associated with UBE3A expression, such as AS.

[0008] Thus, one embodiment of the present invention relates to a polynucleotide comprising a human UBE3A open reading frame, which encodes a short and a long isoform of human UBE3A.

[0009] Further aspects of the invention relate to expression cassettes comprising a polynucleotide comprising a human UBE3A open reading frame, as well as vectors, transformed cells, and transgenic animals comprising the polynucleotides of the invention.

[0010] Another aspect of the invention relates to a pharmaceutical formulation comprising a polynucleotide, expression cassette, vector, and / or transformed cell of the invention in a pharma- ceutically acceptable carrier.

[0011] An additional aspect of the invention relates to a method of expressing a UBE3A open reading frame in a cell comprising the step of contacting the cell with a polynucleotide, expression cassette, and / or vector of the invention, thereby expressing the UBE3A open reading frame in the cell.

[0012] A further aspect of the invention relates to a method of expressing a UBE3A open reading frame in a subject comprising the step of delivering to a subject a polynucleotide, expression cassette, vector and / or transformed cell of the invention, thereby expressing the UBE3A open reading frame in the subject.

[0013] An additional aspect of the present invention relates to a method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a polynucleotide, expression cassette, vector, and / or transformed cell of the present invention, whereby the UBE3A open reading frame is expressed in the subject.

[0014] A further aspect of the invention relates to a method of treating Angelman Syndrome (AS) in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polynucleotide, expression cassette, vector, and / or transformed cell of the invention, whereby the UBE3A open reading frame is expressed in the subject.

[0015] Another aspect of the present invention relates to a polynucleotide, expression cassette, vector, and / or transformed cell of the present invention for use in a method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject in need thereof.

[0016] These and other aspects of the invention are set forth in greater detail in the following description of the invention. [Brief description of the drawings]

[0017] [Figure 1] Schematic representation of neuroregulation of UBE3A, where neurons have silencing of paternal UBE3A. [Diagram 2] A diagram showing the experimental design of flurothyl kindling and rechallenge (FIG. 2A) and a graph showing the generalized seizure threshold (GST, FIG. 2B) for wild-type mice (WT), mice lacking long UBE3A (ISO2-KO), and mice lacking short UBE3A (ISO3-KO). [Figure 3A] FIG. 1 shows the N-terminal amino acid sequences of WT human and mouse UBE3A isoforms (SEQ ID NOs: 15-19). Mouse isoform 1 (not shown) is truncated and does not express a stable protein. [Figure 3B] Figure 2 shows the 5' DNA sequence of the codon-optimized hUBE3A1>>3 open reading frame (SEQ ID NO:20) (top) along with the corresponding amino acid residues of the resulting hUBE3A protein (SEQ ID NO:21) (bottom). Both long and short hUBE3A are encoded in the same reading frame. Kozak sequences of various strengths were engineered to bias translation initiation from the second start codon (CAGGATGA) that initiates the short isoform of hUBE3A. [Figure 3C] FIG. 1 is a schematic depicting the overall AS gene therapy construct for expressing both the long (isoform 3) and short (isoform 1) isoforms of hUBE3A (SEQ ID NOs: 22-24). [Figure 4] Images of UBE3A stained sagittal sections taken from WT and AS model mice (Ube3am- / p+), where AS mice exhibit a near complete loss of neuronal UBE3A expression (Jiang et al, Neuron, 1998:21(4):799-811). [Diagram 5] Figure 1 shows the results of droplet digital PCR experiments detecting either endogenous mouse Ube3a transcripts (mUbe3a, left panel) or codon-optimized human UBE3A transcripts (hUBE3A-opt, right panel) reverse transcribed from mouse hippocampal mRNA. Hippocampi were harvested from adult WT and AS mice following ICV injection of vehicle or AS gene therapy virus (PHP.B / hUBE3A) at P1. Note the selective detection of hUBE3A-opt in the gene therapy treated AS+AAV group. [Figure 6] Images showing western blotting of P9 mouse whole brain lysates using a UBE3A antibody that binds equally to both mouse and human UBE3A, regardless of isoform. In WT samples (far left), the major band representing the short UBE3A isoform is juxtaposed with a minor band just upfield corresponding to the long UBE3A (short to long ratio, approximately 5:1). In samples from maternally derived ISO3-KO mice (far right), which lack neural expression of short UBE3A, the long:short UBE3A ratio drops dramatically, allowing very clear resolution of the two individual UBE3A isoform bands. Samples from homozygous ISO3-KO mice (second from left) give rise to only the long isoform band. Samples from PHP.B / hUBE3A-treated AS mice (second from right) express both short and long hUBE3A isoforms in an approximately 3:1 ratio, thus demonstrating the feasibility of the dual isoform approach. [Figure 7]Images showing immunohistochemistry of WT and AS model mice. Figure 7A shows a series of UBE3A stained sagittal sections from lateral to medial taken from mice of various postnatal ages (P10, P15, P25) after ICV injection of AS gene therapy virus (PHP.B / hUBE3A) at P1. Figure 7B shows the efficiency of hUBE3A gene transfer into hippocampal area CA3 in high magnification confocal micrographs. Sagittals show rare neurons (NeuN+) that do not re-express UBE3A. UBE3A protein shows prominent nuclear localization consistent with the predominant expression of the short hUBE3A isoform. [Figure 8] Images showing a cytoplasmic to nuclear shift in subcellular localization of hUBE3A following gene transfer. Panels A-C show UBE3A stained layer 2 / 3 neocortex from AS model mice at P10 (panel A), P15 (panel B), and P20 (panel C) following ICV injection of PHP.B / hUBE3A virus at P1. As shown in panels D-F from Judson et al., J Comparative Neurology, 2014:522(8):1874-1896, progressive accumulation of virally transduced hUBE3A in the nucleus is seen across development, faithfully recapitulating the spatiotemporal pattern of endogenous UBE3A expression. [Figure 9] Figure 1 shows the monthly total weight gain of male WT and AS model mice injected ICV with either vehicle or AS gene therapy virus (PHP.B / hUBE3A) on days 0-2 after birth. Body weight was statistically similar across experimental groups at 1 month of age for WT+vehicle, WT+AAV, AS+vehicle, and AS+AAV, demonstrating good tolerability and no overt toxicity of hUBE3A gene transfer. By 2 months and continuing into adulthood, AS+vehicle mice exhibited a statistically significant increase in weight gain. This phenotype was fully rescued in AS+AAV mice. [Figure 10]Graphs showing results of behavioral testing in adult WT and AS model mice injected ICV with either vehicle (WT+vehicle, AS+vehicle) or PHP.B / hUBE3A AS gene therapy virus (WT+AAV, AS+AAV) on postnatal days 0–2. Panel A outlines the experimental schedule. Panel B summarizes the open field experiment testing locomotor activity. Data are shown both in 5-min bins (left panel) and as the sum of activity in a 1-h recording session (right panel). Although trends were evident, as previously reported, there was no statistically significant reduction between AS+vehicle and WT+vehicle mice, which did not appear to be rescued in AS+AAV mice. Of note, WT+AAV mice exhibit mild hyperactivity, a potential side effect of UBE3A overexpression. Panel C depicts results from rotarod locomotor performance assays performed on two separate days: day 1 consisting of three acquisition trials; day 2 consisting of two retest trials at 48 h later. All trials were of 5 min duration. Unlike AS+vehicle mice, AS+AAV mice significantly overcame their motor deficits during acquisition, approaching the level of performance of the WT+vehicle control group, which persisted during retesting. Panel D shows the results of marble burying, an assay that measures spontaneous digging and burrowing behavior. AS+vehicle mice typically buried very few marbles during the 30 min session, indicating that these mice had severe deficits in this ethologically relevant behavior. This phenotype was partially, if not fully, rescued in most AS+AAV mice. Panel E demonstrates that PHP.B / hUBE3A treatment significantly improved nest building, another innate behavior severely deficient in AS mice, in the AS+AAV group. PHP.B / hUBE3A-treated AS mice incorporated more available nesting material into their nests (left panel) and built higher quality nests than their vehicle-treated counterparts. [Figure 11]Graphs showing the results of flurothyl kindling and rechallenge studies in adult WT and AS model mice ICV-injected with either vehicle (WT+vehicle, AS+vehicle) or PHP.B / hUBE3A AS gene therapy viruses (WT+AAV, AS+AAV) on postnatal days 0–2. Panel A outlines the experimental schedule. Panel B summarizes the mean group latencies to myoclonic seizures (left panel) and generalized seizures (right panel) over the 8-day flurothyl kindling period and subsequent flurothyl rechallenge on day 36. AS+vehicle mice showed a strong trend to have a decrease in myoclonic seizure threshold (MST) and generalized seizure induction threshold (GST) upon rechallenge. Seizure induction thresholds were normalized in the AS+AAV group, demonstrating the potential of AS gene therapy to protect against excessive epileptogenesis. [Figure 12] Images and graphs showing anatomical correlates of enhanced seizure susceptibility following flurothyl seizure kindling. Panel A shows WFA staining (magenta) of perineuronal nets in sagittal sections of the dorsal hippocampus. Quantitation of mean WFA fluorescence in the dentate gyrus confirmed that enhanced perineuronal net deposition in this structure was specific to AS+vehicle mice. Panel B shows GFAP staining of astrocytes in sagittal sections spanning the hippocampus and cortex. Intensely stained astrocytes in the hippocampus, indicative of reactive astrogliosis, a hallmark of temporal lobe epilepsy, were only observed in the AS+vehicle group, as demonstrated by quantitation of mean hippocampal GFAP fluorescence. [Figure 13] FIG. 2 shows the WT (native) coding sequence (SEQ ID NO:26) of the UBE3A ORF encoding both human UBE3A isoform 3 and isoform 1, with the WT Kozak sequence. The Kozak sequences regulating each expressed isoform are shown in bold and the translation start sites are underlined. [Figure 14]WT (native) coding sequence of the UBE3A ORF (SEQ ID NO:27) encoding both human UBE3A isoform 3 and isoform 1 with modified Kozak sequences. The Kozak sequences regulating each expressed isoform are shown in bold and the translation start sites are underlined. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The present invention will be described in further detail below. This description is not intended to be a detailed list of all the different ways in which the present invention can be implemented or all the features that can be added to the present invention. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. In addition, numerous modifications and additions to the various embodiments suggested herein that do not depart from the present invention will be apparent to those skilled in the art in light of this disclosure. Therefore, the following specification is intended to illustrate some specific embodiments of the present invention, and is not intended to exhaustively specify all permutations, combinations, and variations thereof.

[0019] Unless otherwise indicated by the context, it is specifically intended that the various features of the invention described herein may be used in any combination.Furthermore, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features described herein may be excluded or deleted.To illustrate, if the present specification describes a complex as comprising components A, B, and C, it is specifically intended that any of A, B, or C, or combinations thereof, may be deleted and abandoned, either alone or in any combination.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the description of the present invention herein are for the purpose of describing specific embodiments only and are not intended to be limiting of the present invention.

[0021] Nucleotide sequences are presented herein only as a single strand in a 5' to 3' direction from left to right unless specifically indicated otherwise. Nucleotides and amino acids are represented herein either in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter or three-letter symbols, both in accordance with 37 U.S.C. 1.822 and established usage.

[0022] Unless otherwise stated, standard methods known to those skilled in the art can be used to produce recombinant and synthetic polypeptides, antibodies or antigen-binding fragments thereof, manipulate nucleic acid sequences, produce transformed cells, construct rAAV constructs, modified capsid proteins, packaging vectors expressing AAV rep and / or cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, for example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, NY, 1989); FMAUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0023] All publications, patent applications, patents, nucleotide sequences, amino acid sequences, and other references mentioned herein are incorporated by reference.

[0024] definition As used in the description of the invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0025] As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as no combinations when interpreted as an alternative ("or").

[0026] Further, the present invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted.

[0027] Furthermore, the term "about" as used herein when referring to measurable values ​​such as amounts, doses, times, temperatures, and the like of the compounds or agents of the invention is intended to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.

[0028] As used herein, the transitional phrase "consisting essentially of" should be construed to include the recited materials or steps, as well as those that do not materially affect the basic and novel characteristics of the claimed invention. Thus, the term "consisting essentially of" as used herein should not be construed as the equivalent of "comprising."

[0029] The term "consisting essentially of" (and grammatical variations) as applied to a polynucleotide or polypeptide sequence of the invention means a polynucleotide or polypeptide consisting of both a listed sequence (e.g., SEQ ID NO:) and a total of 10 or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides or amino acids at the 5' and / or 3' or N-terminus and / or C-terminus of the listed sequence, or between the two termini (e.g., between domains) such that the function of the polynucleotide or polypeptide is not significantly altered. A total of 10 or less additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids added together. The term "significantly altered" as applied to a polynucleotide of the invention refers to an increase or decrease in the ability to express the encoded polypeptide by at least about 50% or more compared to the expression level of a polynucleotide consisting of the listed sequence. The term "significantly altered" as applied to a polypeptide of the invention refers to an increase or decrease in biological activity by at least about 50% or more compared to the activity of a polypeptide consisting of the listed sequence.

[0030] The term "parvovirus" as used herein encompasses the Parvoviridae family, including autonomously replicating parvoviruses and dependoviruses. Autonomous parvoviruses include members of the Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus genera. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mice, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, Muscovy duck parvovirus, snake parvovirus, and B19 virus. Other autonomous parvoviruses are known to those skilled in the art. See, for example, FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).

[0031] The Dependovirus genus includes adeno-associated viruses (AAVs), including, but not limited to, AAV1, AAV2, AAV3 (including 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, avian AAV, bovine AAV, canine AAV, caprine AAV, snake AAV, equine AAV, and ovine AAV.See, for example, FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers); and Table 1.

[0032] The term "adeno-associated virus" (AAV) in the context of the present invention includes, but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV, as well as any other AAV now known or later discovered. See, for example, BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Many additional AAV serotypes and clades have been identified (see, for example, Gao et al., (2004) J. Virol. 78:6381-6388 and Table 1), which are also encompassed by the term "AAV".

[0033] Parvovirus particles and genomes of the present invention can be derived from, but are not limited to, AAV.The genome sequences of various serotypes of AAV and autonomous parvoviruses, as well as the sequences of natural ITRs, Rep proteins, and capsid subunits, are known in the art.Such sequences can be found in the literature or in public databases such as GenBank.For example, GenBank accession numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J0227 See, e.g., US Pat. No. 5, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852, and AY530579; the disclosures of which are incorporated by reference herein for their teaching parvovirus and AAV nucleic acid and amino acid sequences.For example, Bantel-Schaal et al.,(1999)J.Virol.73:939;Chiorini et al.,(1997)J.Virol.71:6823;Chiorini et al.,(1999)J.Virol.73:1309;Gao et al.,(2002)Proc.Nat.Acad.Sci.USA 99:11854;Moris et al.,(2004)Virol.33-:375-383;Mori et al.,(2004)Virol.330:375;Muramatsu et al.,(1996)Virol.221:208;Ruffing et al. al.,(1994)J.Gen.Virol.75:3385;Rutledge et See also, e.g., et al., (1998) J. Virol. 72:309; Schmidt et al., (2008) J. Virol. 82:8911; Shade et al., (1986) J. Virol. 58:921; Srivastava et al., (1983) J. Virol. 45:555; Xiao et al., (1999) J. Virol. 73:3994; International Patent Publications WO00 / 28061, WO99 / 61601, WO98 / 11244, and U.S. Patent No. 6,156,303, the disclosures of which are incorporated herein by reference for their teaching of parvovirus and AAV nucleic acid and amino acid sequences. See also, Table 1. An early description of the AAV1, AAV2, and AAV3 ITR sequences is provided by Xiao, X., (1996), “Characterization of Adeno-associated virus (AAV) DNA replication and integration,” Ph. D. Dissertation, University of Pittsburgh, Pittsburgh, PA, which is incorporated herein in its entirety.

[0034] A "chimeric" AAV nucleic acid capsid coding sequence or AAV capsid protein is one that combines portions of two or more capsid sequences. A "chimeric" AAV virion or particle contains a chimeric AAV capsid protein.

[0035] The term "tropism" as used herein refers to the preferential, but not necessarily exclusive, entry of a vector (e.g., a viral vector) into a certain cell or tissue type, optionally and preferably followed by expression (e.g., transcription and optionally translation) of sequences carried by vector contents (e.g., viral genome) in a cell, e.g., in the case of recombinant viruses, expression of a heterologous nucleotide sequence, and / or preferential, but not necessarily exclusive, interaction with a cell surface that promotes entry into a certain cell or tissue type. Those skilled in the art will understand that transcription of a heterologous nucleic acid sequence from a viral genome cannot be initiated in the absence of a trans-acting factor, for example, an inducible promoter or an otherwise regulated nucleic acid sequence. In the case of a rAAV genome, gene expression from the viral genome can be from a stably integrated provirus and / or from a non-integrated episome, as well as any other form that viral nucleic acid can take in a cell.

[0036] The term "tropism profile" refers to the pattern of transduction of one or more target cells, tissues, and / or organs. Representative examples of chimeric AAV capsids have a tropism profile characterized by efficient transduction of cells of the central nervous system (CNS) with low transduction of peripheral organs (see, e.g., U.S. Pat. No. 9,636,370, McCown et al., and U.S. Patent Publication 2017 / 0360960, Gray et al.). Vectors (e.g., viral vectors, e.g., AAV capsids) that express specific tropism profiles can be referred to as "tropisms" for their tropism profile, e.g., neurotropism, hepatotropism, etc.

[0037] JPEG0007616668000001.jpg231163

[0038] As used herein, the term "disorder associated with abnormal expression of the UBE3A gene" refers to a disease, disorder, syndrome, or condition caused by or which is a symptom of reduced or altered expression of the UBE3A gene in a subject compared to expression levels in normal subjects or in a population.

[0039] As used herein, the term "disorder associated with abnormal activity of the UBE3A gene product" refers to a disease, disorder, syndrome, or condition caused by or symptom of decreased or altered activity of the UBE3A gene product in a subject compared to activity in a normal subject or population. In some embodiments, the disorder associated with abnormal activity of the UBE3A gene product may be Angelman syndrome.

[0040] Angelman syndrome (AS) is a monogenic disorder caused by deletions or mutations in the maternally derived UBE3A allele. The intact paternally derived allele is silenced in healthy and AS patient neurons by the antisense DNA transcript UBE3A-ATS, as diagrammed in Figure 1. There are three human UBE3A protein isoforms (Figure 3A). The shortest one (i.e., human isoform 1) has an inherent ability to localize to the nucleus and is out-expressed over the two long isoforms, human isoforms 2 and 3, which are distinguished by an amino acid extension that aligns with the N-terminus of the long mouse isoform 2 (Miao et al, J Neuroscience, 2013;33(1):327-333). Mice lacking the short isoform (isoform 3 in mice; ISO3-KO) have been shown to broadly phenocopy electrophysiological and behavioral deficits in AS model mice (Avagliano et al., Nat Neurosci, 2019:22(8):1235-1247). More recently, we demonstrated that ISO3-KO mice, similar to AS mice (Gu et al., J Clin Invest, 2019;129(1):163-168), exhibit enhanced susceptibility to seizure reload after flurothyl kindling. In contrast, a complementary mouse model with selective deletion of the long UBE3A isoform (isoform 2 in mice; ISO2-KO) has so far failed to develop any AS mouse phenotype (Figure 2B; Avagliano et al., Nat Neurosci, 2019:22(8):1235-1247). Recent clinical data similarly support the critical importance of short UBE3A but suggest that long UBE3A also contributes to healthy brain development and function, albeit at lower levels (Sadhwani et al, Am J Med Genet A, 2018;176(7):1641-1647).Without wishing to be bound by theory, the endogenous expression ratio of the short and long UBE3A isoforms from an exogenously added expression cassette can be approached by modulating the relative strength or weakness of the Kozak sequences that govern their translation.

[0041] As used herein, a Kozak sequence refers to a nucleotide sequence that includes nucleotides upstream, downstream, and encompassing a start / initiation codon (i.e., a translation initiation site). The Kozak sequence is recognized by the ribosome as a translation initiation site. Known Kozak consensus sequences (e.g., gccRcc AUG Sequence variation (e.g., due to natural and / or artificial modifications) from G (SEQ ID NO:24) may alter the strength of initiation (see FIG. 3C Kozak consensus sequence), where the underlined nucleotide indicates the start / initiation codon, the capital letters indicate highly conserved bases, R indicates a conserved purine (most commonly adenine), and the lower case letters indicate common, but variable, bases. The known consensus Kozak sequences are consensuses representing the most common nucleotides at each location based on numerous human mRNAs; the native / wild-type Kozak sequences of individual genes and / or open reading frames may vary. As known in the art, a thymidine (T) nucleotide in a DNA sequence corresponds to (e.g., is transcribed as) a uridine (U) nucleotide in the corresponding mRNA (e.g., a DNA ATG initiation codon corresponds to an mRNA AUG, etc.). Any sequence disclosed herein is considered to be disclosed as both T and U for DNA and RNA, respectively.

[0042] As used herein, "transduction" of a cell with a viral vector (e.g., an AAV vector) refers to entry of the vector into the cell and transfer of genetic material into the cell by incorporation of a nucleic acid into the viral vector and subsequent transfer into the cell via the viral vector.

[0043] Unless otherwise indicated, "efficient transduction" or "efficient tropism" or similar terms may be determined by reference to an appropriate positive or negative control (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95% or more of the transduction or tropism, respectively, of the positive control, or at least about 110%, 120%, 150%, 200%, 300%, 500%, 1000% or more of the transduction or tropism, respectively, of the negative control).

[0044] Similarly, by referring to appropriate controls, it can be determined whether a virus "does not transduce efficiently" or "does not have efficient tropism" or similar terms for a target tissue. In certain embodiments, a viral vector does not efficiently transduce (i.e., does not have efficient tropism for) tissues outside the CNS, such as the liver, kidney, gonads, and / or germ cells. In certain embodiments, undesired transduction of tissues (e.g., liver) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less of the level of transduction of desired target tissues (e.g., CNS cells).

[0045] The terms "5' portion" and "3' portion" are relative terms that define the spatial relationship between two or more elements. Thus, for example, the "3' portion" of a polynucleotide refers to a segment of the polynucleotide that is downstream of another segment. The term "3' portion" is not intended to indicate that the segment is necessarily at the 3' end of the polynucleotide, or even that it is necessarily in the 3' half of the polynucleotide, although that may be the case. Similarly, the "5' portion" of a polynucleotide refers to a segment of the polynucleotide that is upstream of another segment. The term "5' portion" is not intended to indicate that the segment is necessarily at the 5' end of the polynucleotide, or even that it is necessarily in the 5' half of the polynucleotide, although that may be the case.

[0046] As used herein, the term "polypeptide", unless otherwise indicated, encompasses both peptides and proteins.

[0047] A "polynucleotide," "nucleic acid," or "nucleotide sequence" can be an RNA, DNA, or DNA-RNA hybrid sequence (containing both naturally occurring and non-naturally occurring nucleotides), but is preferably either a single- or double-stranded DNA sequence.

[0048] The term "regulatory element" refers to a genetic element that controls some aspect of the expression of a nucleic acid sequence. For example, a promoter is a regulatory element that facilitates the initiation of transcription of an operably linked coding region. Other regulatory elements are splicing signals, polyadenylation signals, termination signals, etc. A region in a nucleic acid sequence or polynucleotide in which one or more regulatory elements are found may be referred to as a "regulatory region."

[0049] As used herein with respect to nucleic acid, the term "operably linked" refers to a functional link between two or more nucleic acids. For example, a promoter sequence can be described as "operably linked" to a heterologous nucleic acid sequence because the promoter sequence initiates and / or mediates the transcription of the heterologous nucleic acid sequence. In some embodiments, the operably linked nucleic acid sequences are contiguous and / or in the same reading frame.

[0050] As used herein, the term "open reading frame (ORF)" refers to a portion of a polynucleotide (e.g., a gene) that encodes a polypeptide and includes an initiation start site (i.e., a Kozak sequence) for initiating transcription of the polypeptide. The term "coding region" may be used interchangeably with open reading frame.

[0051] The term "codon-optimized" as used herein refers to a gene coding sequence that has been optimized to increase expression by replacing one or more codons that are normally present in the coding sequence (e.g., in the wild-type sequence, including, for example, the coding sequence for UBE3A) with codons for the same amino acid. This is referred to as synonymous codons. In this way, the proteins encoded by the genes are identical, but the underlying nucleobase sequences of the genes or corresponding mRNAs are different. In some embodiments, optimization replaces one or more rare codons (i.e., codons for tRNAs that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation. For example, in human codon optimization, one or more codons in a coding sequence are replaced by codons for the same amino acid that occur more frequently in human cells. Codon optimization can also increase gene expression through other mechanisms that can improve the efficiency of transcription and / or translation. Strategies include, but are not limited to, increasing the total GC content (i.e., the percentage of guanine and cytosine in the entire coding sequence), decreasing the CpG content (i.e., the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and / or adding or removing ribosome entry and / or start sites, such as Kozak sequences. Desirably, the codon-optimized gene exhibits improved protein expression, e.g., the encoded protein is thereby expressed at a detectably higher level in a cell compared to the level of protein expression provided by the wild-type gene in an otherwise similar cell. Codon optimization also provides the ability to distinguish between codon-optimized genes and / or corresponding mRNAs and endogenous genes and / or corresponding mRNAs in vitro or in vivo.

[0052] The term "sequence identity" as used herein has its standard meaning in the art. As is known in the art, several different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), preferably using default settings, the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group, 575 Science Drive, Madison, WI), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:387 (1984), or by inspection.

[0053] An example of a useful algorithm is PILEUP. PILEUP uses progressive pairwise alignment to create multiple sequence alignments from a group of related sequences. It also plots a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5:151 (1989).

[0054] Another example of a useful algorithm is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program, obtained from Altschul et al., Meth. Enzymol., 266:460 (1996); blast.wustl / edu / blast / README.html. WU-BLAST-2 uses several search parameters, which are preferably set to default values. The parameters are dynamic values, established by the program itself depending on the composition of the particular sequence and the composition of the particular database in which the sequence of interest is being searched; however, the values ​​can be adjusted to increase sensitivity.

[0055] An additional useful algorithm is Gapped BLAST, as described by Altschul et al., Nucleic Acids Res. 25:3389 (1997).

[0056] Percentage amino acid sequence identity values ​​are determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region, the "longer" sequence being the one with the most real residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).

[0057] In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in a candidate sequence that are identical with the nucleotides in a polynucleotide specifically disclosed herein.

[0058] Alignment may include the introduction of gaps in the sequence to be aligned.In addition, for sequences that contain more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides.Thus, for example, the sequence identity of a sequence that is shorter than the sequences specifically disclosed herein will be determined in one embodiment using the number of nucleotides in the shorter sequence.In identity percentage calculation, relative weight is not assigned to various manifestations of sequence variation such as insertion, deletion, substitution, etc.

[0059] In one embodiment, only identities are scored positively (+1) and all forms of sequence variation, including gaps, are assigned a value of "0", which removes the need for the weighting measures or parameters described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the "shorter" sequence in the aligned region and multiplying by 100. The "longer" sequence is the one with the most realistic residues in the aligned region.

[0060] As used herein, an "isolated" nucleic acid or nucleotide sequence (e.g., "isolated DNA" or "isolated RNA") means a nucleic acid or nucleotide sequence that is separated from or substantially free of other components of a naturally occurring organism or virus, such as at least some of the structural components of a cell or virus, or from other polypeptides or nucleic acids that are typically found in association with the nucleic acid or nucleotide sequence.

[0061] Similarly, an "isolated" polypeptide means a polypeptide that is separated from or substantially free of other components of a naturally occurring organism or virus, such as at least some of the structural components of a cell or virus, or from other polypeptides or nucleic acids that are typically found in association with the polypeptide.

[0062] As used herein, the term "modified" as applied to a polynucleotide or polypeptide sequence refers to a sequence that differs from the wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.

[0063] As used herein, by "isolating" a viral vector (or grammatical equivalents) it is meant that the viral vector is at least partially separated from at least some of the other components in the starting material.

[0064] By the terms "treat", "treating" or "treatment of" (or grammatical equivalents) is meant to lessen the severity or at least partially ameliorate or improve the condition in a subject, and / or to alleviate, relieve or reduce at least one clinical symptom, and / or to slow the progression of the condition.

[0065] As used herein, the terms "prevent", "prevents", or "prevention" (and grammatical equivalents) mean to delay or inhibit the onset of a disease. The term is not intended to require the complete abolition of a disease, but encompasses any type of prophylactic treatment that reduces the appearance of or delays the onset of a disease condition.

[0066] As used herein, a "therapeutically effective" amount is an amount that is sufficient to provide some improvement or benefit to the subject.In other words, a "therapeutically effective" amount is an amount that will provide some relief, relief, reduction, or stabilization of at least one clinical symptom in the subject.Those skilled in the art will understand that the therapeutic effect does not need to be complete or curative, as long as some benefit is provided to the subject.

[0067] As used herein, a "prophylactically effective" amount is an amount that is sufficient to prevent and / or delay the onset of a disease, disorder, and / or clinical condition in a subject, and / or reduce the severity and / or delay the onset of a disease, disorder, and / or clinical condition in a subject, compared to that which would occur in the absence of the method of the present invention. One of ordinary skill in the art will appreciate that the level of prevention need not be complete, as long as some benefit is provided to the subject.

[0068] The term "heterologous" used to describe a nucleic acid sequence or protein means that the nucleic acid sequence or protein originates from a different organism than the host cell or subject in which it is expressed, or from a different species of the same organism. The term "heterologous" when used in reference to a protein, or a nucleic acid in a plasmid, expression cassette, or vector, indicates that the protein or nucleic acid in question is present with another sequence or subsequence with which it is not found in its natural context. Typically, a heterologous nucleic acid is a nucleic acid of interest that contains an open reading frame encoding a polypeptide and / or contains a non-translated RNA, each of which may be referred to herein as a "transgene". The nucleic acid of interest may code for a therapeutic polypeptide or RNA, or a diagnostic polypeptide or RNA. The nucleic acid of interest / heterologous nucleic acid is often in the context of an expression cassette.

[0069] As the term is used herein, an "expression cassette" comprises a nucleic acid of interest operably linked / associated with a suitable regulatory element sequence (regulatory element), such as a transcription / translation control signal, an origin of replication, a polyadenylation signal, an internal ribosome entry site (IRES), a promoter, and / or an enhancer. In some embodiments of the present invention, an expression cassette comprises a promoter (e.g., eukaryotic) operably linked to a nucleic acid of interest, and optionally a (eukaryotic) transcription termination sequence. Typically, the expression cassette is in the context of a vector (e.g., adjacent to vector sequences). In the context of a viral vector, it is typically adjacent to a viral packaging signal for a viral vector. For example, for an AAV viral vector, the packaging signal is at least one inverted terminal repeat located adjacent to the expression cassette, and optionally the 5' inverted terminal repeat (ITR) and 3' ITR flank the expression cassette.

[0070] A "vector" refers to a compound used as a vehicle to carry foreign genetic material into another cell where it can be replicated and / or expressed. A cloning vector containing a foreign nucleic acid is called a recombinant vector. Examples of nucleic acid vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. A recombinant vector typically contains an origin of replication, a multiple cloning site, and a selectable marker. A nucleic acid sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the "backbone" of the vector. The purpose of a vector to transfer genetic information to another cell is typically to isolate, propagate, or express the insert in the target cell. Expression vectors (expression constructs) are for the expression of exogenous genes in target cells and generally have a promoter sequence that drives the expression of the exogenous gene / ORF. The insertion of a vector into a target cell is called transformation or transfection for bacterial and eukaryotic cells, although the insertion of a viral vector is often called transduction. The term "vector" may also be used generally to describe an article that serves to carry foreign genetic material into another cell, such as, but not limited to, a transformed cell or a nanoparticle.

[0071] As used herein, the terms "vector", "viral vector", "delivery vector" (and similar terms) in specific embodiments generally refer to a viral particle that functions as a nucleic acid delivery vehicle and contains viral nucleic acid (i.e., vector genome) packaged within the virion. A viral vector according to the present invention comprises a chimeric AAV capsid according to the present invention and can package an AAV or rAAV genome, or any other nucleic acid, including viral nucleic acid. Alternatively, in some contexts, the terms "vector", "viral vector", "delivery vector" (and similar terms) can be used to refer to a vector genome (e.g., vDNA) in the absence of a virion, and / or a viral capsid that acts as a transporter to deliver molecules tethered to or packaged within the capsid.

[0072] The viral vector of the present invention may further be a double-stranded parvovirus particle as described in International Publication No. WO 01 / 92551, the disclosure of which is incorporated herein by reference. Thus, in some embodiments, a double-stranded (double-stranded) genome may be packaged.

[0073] A "recombinant AAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) that contains at least one inverted terminal repeat (e.g., one, two, or three inverted terminal repeats) and one or more heterologous nucleotide sequences. rAAV vectors generally retain a 145-base terminal repeat (TR) in cis to generate virus; however, modified AAV TRs and non-AAV TRs that contain partially or completely synthetic sequences can also serve this purpose. All other viral sequences are non-essential and can be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). rAAV vectors optionally contain two TRs (e.g., AAV TRs), which will generally be at the 5' and 3' ends of the heterologous nucleotide sequence, but do not have to be contiguous with it. The TRs can be the same or different from each other. The vector genome can also contain a single ITR at its 3' or 5' end.

[0074] The term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (ITR) (i.e., mediates a desired function such as replication, viral packaging, integration, and / or proviral rescue). A TR can be an AAV TR (referred to herein as an AAV ITR) or a non-AAV TR. For example, a non-AAV TR (referred to herein as a non-AAV ITR) sequence, such as that of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19), or an SV40 hairpin that serves as an origin of SV40 replication, can be used as a TR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. Furthermore, a TR (ITR) can be partially or completely synthetic, such as the "double-D sequence" described in U.S. Patent No. 5,478,745 to Samulski et al.

[0075] Parvovirus genomes have palindromic sequences at both their 5' and 3' ends. The palindromic nature of the sequences leads to the formation of a hairpin structure stabilized by the formation of hydrogen bonds between complementary base pairs. This hairpin structure appears to take the shape of a "Y" or a "T". See, e.g., FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0076] "AAV inverted terminal repeats" or "AAV ITRs" can be from any AAV serotype or isolate, including, but not limited to, serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or any other AAV now known or later discovered (see, e.g., Table 1). AAV ITRs need not have the native ITRs (e.g., the native AAV ITR sequences can be altered by insertions, deletions, truncations, and / or missense mutations), so long as the ITRs mediate the desired function, such as replication, viral packaging, integration, and / or proviral rescue.

[0077] The terms "rAAV particle" and "rAAV virion" are used interchangeably herein. An "rAAV particle" or "rAAV virion" comprises a rAAV vector genome packaged within an AAV capsid.

[0078] The viral vectors of the present invention may further be "targeted" viral vectors (e.g., having a tropic tropism) and / or "hybrid" parvoviruses (i.e., in which the viral ITRs and the viral capsid are from different parvoviruses), as described in International Patent Publication WO 00 / 28004 and Chao et al., (2000) Mol. Therapy 2:619.

[0079] Moreover, the viral capsid or genomic elements may contain other modifications, including insertions, deletions, and / or substitutions.

[0080] As used herein, the term "amino acid" includes any naturally occurring amino acid, modified forms thereof, and synthetic amino acids, including non-naturally occurring amino acids.

[0081] Naturally occurring levorotatory (L-) amino acids are shown in Table 2.

[0082] JPEG0007616668000002.jpg146163

[0083] Alternatively, the amino acid can be a modified amino acid residue (non-limiting examples are shown in Table 3), or an amino acid that has been modified by post-translational modification (e.g., acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation, or sulfatation).

[0084] JPEG0007616668000003.jpg235163

[0085] Furthermore, the non-naturally occurring amino acid may be a "non-natural" amino acid as described by Wang et al., (2006) Annu. Rev. Biophys. Biomol. Struct. 35:225-49. These non-natural amino acids may be advantageously used to chemically link a molecule of interest to an AAV capsid protein.

[0086] The term "template" or "substrate" is used herein to refer to a polynucleotide sequence that can be replicated to produce parvovirus viral DNA. For purposes of vector production, the template will typically be embedded within a larger nucleotide sequence or construct, including but not limited to a plasmid, naked DNA vector, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), or viral vector (e.g., adenovirus, herpes virus, Epstein-Barr virus, AAV, baculovirus, retroviral vectors, etc.). Alternatively, the template can be stably integrated into the chromosome of the packaging cell.

[0087] As used herein, parvovirus or AAV "Rep coding sequence" refers to a nucleic acid sequence that encodes a parvovirus or AAV nonstructural protein that mediates viral replication and the production of new viral particles. Parvovirus and AAV replication genes and proteins are described, for example, in FIELDS et al., VIROLOGY, volume 2, chapters 69&70 (4th ed., Lippincott-Raven Publishers).

[0088] A "Rep coding sequence" does not have to code for all of the parvovirus or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequence does not have to code for all four AAV Rep proteins (Rep78, Rep68, Rep52, and Rep40), and in fact AAV5 appears to express only the spliced ​​Rep68 and Rep40 proteins. In representative embodiments, the Rep coding sequence codes for at least those replication proteins that are necessary for viral genome replication and packaging into new virions. The Rep coding sequence will generally code for at least one large Rep protein (i.e., Rep78 / 68) and one small Rep protein (i.e., Rep52 / 40). In certain embodiments, the Rep coding sequence codes for the AAV Rep78 protein, and the AAV Rep52 and / or Rep40 protein. In other embodiments, the Rep coding sequence codes for the Rep68, and the Rep52 and / or Rep40 protein. In still further embodiments, the Rep coding sequence encodes Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins.

[0089] As used herein, the term "large Rep protein" refers to Rep68 and / or Rep78. The large Rep proteins of the claimed invention can be either wild-type or synthetic. Wild-type large Rep proteins can be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered (see, e.g., Table 1). Synthetic large Rep proteins can be altered by insertions, deletions, truncations, and / or missense mutations.

[0090] Those skilled in the art will further understand that replication proteins do not have to be encoded by the same polynucleotide. For example, for MVM, NS-1 and NS-2 proteins (which are splice variants) can be expressed independently of each other. Similarly, for AAV, p19 promoter can be inactivated, large Rep protein is expressed from one polynucleotide, and small Rep protein is expressed from a different polynucleotide. However, typically, it will be more convenient to express replication proteins from a single construct. In some systems, viral promoters (e.g., AAV p19 promoter) cannot be recognized by cells, and therefore it is necessary to express large and small Rep proteins from separate expression cassettes. In other cases, it may be desirable to express large Rep and small Rep proteins separately, i.e., under the control of separate transcriptional and / or translational control elements. For example, it may be desirable to control the expression of large Rep protein so as to reduce the ratio of large Rep protein to small Rep protein. In the case of insect cells, it may be advantageous to downregulate expression of large Rep proteins (e.g., Rep78 / 68) to avoid toxicity to the cells (see, e.g., Urabe et al., (2002) Human Gene Therapy 13:1935).

[0091] As used herein, a parvovirus or AAV "cap coding sequence" encodes the structural proteins that form a functional parvovirus or AAV capsid (i.e., capable of packaging DNA and infecting a target cell). Typically, the cap coding sequence will encode all of the parvovirus or AAV capsid subunits, although less than all of the capsid subunits may be encoded, so long as a functional capsid is produced. Typically, but not necessarily, the cap coding sequence will be present on a single nucleic acid molecule.

[0092] The capsid structure of autonomous parvoviruses and AAV is described in detail by BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0093] By "substantially retain" a property, it is meant that at least about 75%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% of the property (e.g., activity or other measurable characteristic) is retained.

[0094] UBE3A expression cassettes and vectors The present invention relates to the design of UBE3A expression cassettes that provide therapeutic levels of intracellular (e.g., non-secreted) expression of UBE3A protein (also known as E6AP ubiquitin protein ligase (E6AP)), the enzyme encoded by the UBE3A gene, and the use of the expression cassettes to achieve therapeutic levels of UBE3A / E6AP in a subject.

[0095] Thus, one aspect of the present invention relates to a polynucleotide comprising a mammalian UBE3A open reading frame. The open reading frame is a portion of the UBE3A gene encoding UBE3A / E6AP. In some embodiments, the mammalian UBE3A open reading frame can be a human UBE3A open reading frame. The human UBE3A open reading frame can encode one or more isoforms of human UBE3A in the same reading frame. For example, in some embodiments, the mammalian UBE3A open reading frame can be a short isoform of human UBE3A (i.e., human UBE3A isoform 1) and / or a long isoform of human UBE3A (e.g., human UBE3A isoform 2 and / or 3) open reading frame. In some embodiments, the mammalian UBE3A open reading frame can be a human UBE3A isoform 1 and isoform 3 open reading frame. In other embodiments, the mammalian UBE3A open reading frame can be a human UBE3A isoform 1 and isoform 2 open reading frame. As used herein, mammalian UBE3A open reading frame refers to the nucleotide sequence encoding mammalian UBE3A / E6AP, for example, human UBE3A open reading frame refers to the nucleotide sequence encoding human UBE3A / E6AP. Where appropriate for function, the term UBE3A open reading frame is used herein to refer to the open reading frame encoding both the short isoform of human UBE3A and the long isoform of human UBE3A, so that the open reading frame includes the 5' upstream nucleic acid sequence that includes the Kozak sequence that affects the expression of the long isoform. Such open reading frames are shown in Figure 13 and Figure 14. SEQ ID NO: 1. Wild-type human UBE3A short isoform (isoform 1; GenBank accession # NM_130838.3) GCTGCCTGCCGGGATACTCGGCCCGCCCAGCCAGTCCTCCCGTCTTGCGCCGCGGCCGCGAGATCCGTGT GTCTCCCAAGATGGTGGCGCTGGGCTCGGGGTGACTACAGGAGACGACGGGGCCTTTTCCCTTCGCCAGG ACCCGACACACCAGGCTTCGCTCGCTCGCGCACCCCTCCGCCGCGTAGCCATCCGCCAGCGCGGGCGCCC GCCATCCGCCGCCTACTTACGCTTCACCTCTGCCGACCCGGCGCGCTCGGCTGCGGGCGGCGGCGCCTCC TTCGGCTCCTCCTCGGAATAGCTCGCGGCCTGTAGCCCCTGGCAGGAGGGCCCCTCAGCCCCCCGGTGTG GACAGGCAGCGGCGGCTGGCGACGAACGCCGGGATTTCGGCGGCCCCGGCGCTCCCTTTCCCGGCCTCGT TTTCCGGATAAGGAAGCGCGGGTCCCGCATGAGCCCCGGCGGTGGCGGCAGCGAAAGAGAACGAGGCGGT GGCGGGCGGAGGCGGCGGGCGAGGGCGACTACGACCAGTGAGGCGGCCGCCGCAGCCCAGGCGCGGGGGC GACGACAGATCAGGAGAACCTCAGTCTGACGACATTGAAGCTAGCCGAATGAAGCGAGCAGCTGCAAAGC ATCTAATAGAACGCTACTACCACCAGTTAACTGAGGGCTGTGGAAATGAAGCCTGCACGAATGAGTTTTG TGCTTCCTGTCCAACTTTTCTTCGTATGGATAATAATGCAGCAGCTATTAAAGCCCTCGAGCTTTATAAG ATTAATGCAAAACTCTGTGATCCTCATCCCTCCAAGAAAGGAGCAAGCTCAGCTTACCTTGAGAACTCGA AAGTGCCCCCAACAACTCCTGCTCTGAGATAAATAATGAACAAGAAAGGCGCTAGAATTGATTTTAAAGA TGTGACTTACTTAACAGAAGAGAAGGTATATGAAATTCTTGAATTATGTAGAGAAAGAGAGGATTATTCC CCTTTAATCCGTGTTATTGGAAGAGTTTTTTCTAGTGCTGAGGCATTGGTACAGAGCTTCCGGAAAGTTA AACAACACACCAAGGAAGAACTGAAATCTCTTCAAGCAAAAGATGAAGACAAAGATGAAGATGAAAAGGA AAAAGCTGCATGTTCTGCTGCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGC TCACAGGGAGACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAA GGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTC ACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTC ATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCA AAGCGATGAGCAAGCTACCCCTTGCAGCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGA CCAGATTCGGAGAATGATGGAGACATTTCAGCAACTTATTACTTATAAAGTCATAAGCAATGAATTTAAC AGTCGAAATCTAGTGAATGATGATGATGCCATTGTTGCTGCTTCGAAGTGCTTGAAAATGGTTTACTATG CAAATGTAGTGGGAGGGGAAGTGGACACAAATCACAATGAAGAAGATGATGAAGAGCCCATCCCTGAGTC CAGCGAGCTGACACTTCAGGAACTTTTGGGAGAAGAAAGAAGAAACAAGAAAGGTCCTCGAGTGGACCCC CTGGAAACTGAACTTGGTGTTAAAACCCTGGATTGTCGAAAACCACTTATCCCTTTTGAAGAGTTTATTA ATGAACCACTGAATGAGGTTCTAGAAATGGATAAAGATTATACTTTTTTCAAAGTAGAAACAGAGAACAA ATTCTCTTTTATGACATGTCCCTTATATTGAATGCTGTCACAAAGAATTTGGGATTATATTATGACAAT AGAATTCGCATGTACAGTGAACGAAGAATCACTGTTCTCTACAGCTTAGTTCAAGGACAGCAGTTGAATC CATATTTGAGACTCAAAGTTAGACGTGACCATATCATAGATGATGCACTTGTCCGGCTAGAGATGATCGC TATGGAAATTCCTGCAGACTTGAAGAAGCAGTTGTATGTGGAATTTGAAGGAGAACAAGGAGTTGATGAG GGAGGTGTTTTCCAAAGAATTTTTTCAGCTGGTTGTGGAGGAAATCTTCAATCCAGATATTGGTATGTTCA CATACGATGAATCTACAAAATTGTTTTGGTTTAATCCATCTTCTTTTGAAACTGAGGGTCAGTTTACTCT GATTGGCATAGTACTGGGTCTGGCTATTTACAATAACTGTATACTGGATGTACATTTTCCCATGGTTGTC TACAGGAAGCTAATGGGGAAAAAAGGAACTTTTCGTGACTTGGGAGACTCTCACCCAGTTCTATATCAGA GTTTAAAAGATTTATTGGAGTATGAAGGGAATGTGGAAGATGACATGATGATCACTTTCCAGATATCACA GACAGATCTTTTGGTAACCCAATGATGTATGATCTAAAGGAAAATGGTGATAAAATTCCAATTACAAAT GAAAACAGGAAGGAATTTGTCAATCTTATTCTGACTACATTCTCAATAAATCAGTAGAAAAACAGTTCA AGGCTTTTCGGAGGGTTTCATATGGTGACCAATGAATCTCCCTTAAAGTACTTTATTCAGACCAGAAGA AATTGAATTGCTTATATGTGGAAGCCGGAATCTAGATTTCCAAGCACTAGAAGAAACTACAGAATATGAC GGTGGCTATACCAGGGACTCTGTTCTGATTAGGGAGTTCTGGGAAATCGTTCATTCATTTACAGATGAAC AGAAAAGACTCTTCTTGCAGTTTACAACGGGCACAGACAGAGCACCTGTGGGAGGACTAGGAAAATTAAA GATGATTATAGCCAAAAATGGCCCAGACACAGAAAGGTTACCTACATCTCATACTTGCTTTAATGTGCTT TTACTTCCGGAATACTCAAGCAAAGAAAAACTTAAAGAGAGATTGTTGAAGGCCATCACGTATGCCAAAG GATTTGGCATGCTGTAAACAAAACAAAACAAAATAAAAACAAAAAAAGGAAGGAAAAAAAAAAGAAAAAA TTTAAAAAATTTTAAAAATAACGAGGGAATAAATTTTTGGTGGTGATAGTGCCCAGTACAAAAAGGCT GTAAGATAGTCAACCACAGTAGTCACCTATGTCTGTGCCTCCCTTCTTTATTGGGGACATGTGGGCTGGA ACAGCAGATTTCAGCTACATATATGAACAAATCCTTTATTATTATTATAATTATTTTTTTTGCGTGAAAGT GTTACATATTCTTTCACTTGTATGTACAGAGAGGTTTTTCTGAATATTTATTTTAAGGGTTAAATCACTT TTGCTTGTGTTTATTACTGCTTGAGGTTGAGCCTTTTGAGTATTTAAAAAATATATACCAACAGAACTAC TCTCCCAAGGAAAATATTGCCACCATTTGTAGACCACGTAACCTTCAAGTATGTGCTACTTTTTTGTCCC TGTATCTAACTCAAATCAGGAACTGTATTTTTTTTAATGATTTGCTTTTGAAACTTGAAGTCTTGAAAAC AGTGTGATGCAATTACTGCTGTTCTAGCCCCAAAGAGTTTTCTGTGCAAAATCTTGAGAATCAATCAAT AAAGAAAGATGGAAGGAAGGGAGAAATTGGAATGTTTTAACTGCAGCCCTCAGAACTTTAGTAACAGCAC AACAAATTAAAAACAAAAACAACTCATGCCACAGTATGTCGTCTTCATGTGTCTTGCAATGAACTGTTTC AGTAGCCAATCCTCTTTCTTAGTATATGAAAGGACAGGGATTTTTGTTCTTGTTGTTCTCGTTGTTGTTT TAGTTACTGGGGAAAGTGCATTTGGCCAAATGAAATGGTAGTCAAGCCTATTGCAACAAAGTTAGGAA GTTGTTGTTGTTTTTATTATAAACAAAAAGCATGTGAAAGTGCACTTAAGATAGAGTTTTTATTAATTAC TTACTTATTACCTAGATTTTAAATAGACAATCCAAAGTCTCCCCTTCGTGTTGCCATCATCTTGTTGAAT CAGCCATTTTATCGAGGCACGTGATCAGTGTTGCAACATAATGAAAAAGATGGCTACTGTGCCTTGTGTT ACTTAATCATACAGTAAGCTGACCTGGAAATGAATGAAACTATTACTCCTAAGAATTACATTGTATAGCC CCACAGATTAAATTTAATTAATTAATTCAAAACATGTTAAACGTTACTTTCATGTACTATGGAAAAGTAC AAGTAGGTTTACATTACTGATTTCCAGAAGTAAGTAGTTTCCCCTTTCCTAGTCTTCTGTGTATGTGATG TTGTTAATTTCTTTTATTGCATTATAAAATAAAAGGATTATGTATTTTTAACTAAGGTGAGACATTGATA TATCCTTTTGCTACAAGCTATAGCTAATGTGCTGAGCTTGTGCCTTGGTGATTGATTGATTGATTGACTG ATTGTTTTAACTGATTACTGTAGATCAACCTGATGATTTGTTGTTTGAAATTGGCAGGAAATTGCAGC TTTCAAATCATTGGGGGGAGAAAAAGGATGTCTTTCAGGATTATTTTAATTAATTTTTTTCATAATTGAG ACAGAACTGTTTGTTATGTACCATAATGCTAAATAAAACTGTGGCACTTTTCACCATAATTTAATTTAGT GGAAAAAGAGACAATGCTTTCCATATTGTGATAAGGTAACATGGGGTTTTTCTGGGCCAGCCTTTAGAA CACTGTTAGGGTACATACGCTACCTTGATGAAAGGGACCTTCGTGCAACTGTAGTCATCTTAAAGGCTTC TCATCCACTGTGCTTCTTAATGTGTAATTAAAGTGAGGAGAATAATTAATACTCTGAGGGCGTTTTATATA ATAAATTCGTGAAGAAATGTGTGCTCTTCA Accession No.: 2. Long isoform of wild-type human UBE3A (isoform 2; GenBank accession #NM_000462.5) GCTGCCTGCCGGGATACTCGGCCCGCCCAGCCAGTCCTCCCGTCTTGCGCCGCGGCCGCGAGATCCGTGT GTCTCCCAAGATGGTGGCGCTGGGCTCGGGGTGACTACAGGAGACGACGGGGCCTTTTCCCTTCGCCAGG ACCCGACACACCAGGCTTCGCTCGCTCGCGCACCCCTCCGCCGCGTAGCCATCCGCCAGCGCGGGCGCCC GCCATCCGCCGCCTACTTACGCTTCACCTCTGCCGACCCGGCGCGCTCGGCTGCGGGCGGCGGCGCCTCC TTCGGCTCCTCCTCGGAATAGCTCGCGGCCTGTAGCCCCTGGCAGGAGGGCCCCTCAGCCCCCCGGTGTG GACAGGCAGCGGCGGCTGGCGACGAACGCCGGGATTTCGGCGGCCCCGGCGCTCCCTTTCCCGGCCTCGT TTTCCGGATAAGGAAGCGCGGGTCCCGCATGAGCCCCGGCGGTGGCGGCAGCGAAAGAGAACGAGGCGGT GGCGGGCGGAGGCGGCGGGCGAGGGCGACTACGACCAGTGAGGCGGCCGCCGCAGCCCAGGCGCGGGGGC GACGACAGGTTAAAAATCTGTAAGAGCCTGATTTTAGAATTCACCAGCTCCTCAGAAGTTTGGCGAAATA TGAGTTATTAAGCCTACGCTCAGATCAAGGTAGCAGCTAGACTGGTGTGACAACCTGTTTTTAATCAGTG ACTCAAAGCTGTGATCACCCTGATGTCACCGAATGGCCACAGCTTGTAAAAGAGAGTTACAGTGGAGGTA AAAGGAGTGGCTTGCAGGATGGAGAAGCTGCACCAGTGTTATTGGAAATCAGGAGAACCTCAGTCTGACG ACATTGAAGCTAGCCGAATGAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAGTTAAC TGAGGGCTGTGGAAATGAAGCCTGCACGAATGAGTTTTGTGCTTCCTGTCCAACTTTTCTTCGTATGGAT AATAATGCAGCAGCTATTAAAGCCCTCGAGCTTTATAAGATTAATGCAAAACTCTGTGATCCTCATCCCT CCAAGAAAGGAGCAAGCTCAGCTTACCTTGAGAACTCGAAAGGTGCCCCCAACAACTCCTGCTCTGAGAT AAAAATGAACAAGAAAGGCGCTAGAATTGATTTTAAAGATGTGACTTACTTAACAGAAGAGAAGGTATAT GAAATTCTTGAATTATGTAGAGAAAGAGAGGATTATTCCCCTTTAATCCGTGTTATTGGAAGAGTTTTTT CTAGTGCTGAGGCATTGGTACAGAGCTTCCGGAAAGTTAAACAACACACCAAGGAAGAACTGAAATCTCT TCAAGCAAAAGATGAAGACAAAGATGAAGATGAAAAGGAAAAAGCTGCATGTTCTGCTGCTGCTATGGAA GAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAG GCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAATGAAAA AATTGAAACTGCCTTTCTCAATGCACTTGTATATTGTCACCTAACGTGGAATGTGACTTGACGTATCAC AATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACA GTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCCCA AGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAGAATGATGGAGACATTTCAG CAACTTATTACTTATAAAGTCATAAGCAATGAATTTAACAGTCGAAATCTAGTGAATGATGATGATGCCA TTGTTGCTGCTTCGAAGTGCTTGAAAATGGTTACTATGCAAATGTAGTGGGAGGGGAAGTGGACACAAA TCACAATGAAGAGATGATGAAGAGCCCATCCCTGAGTCCAGCGAGCTGACACTTCAGGAACTTTTGGGA GAAGAAGAAGAAAACAAGAAAGGTCCTCGAGTGGACCCCCTGGAAACTGAACTTGGTGTTAAAACCCTGG ATTGTCGAAAACCACTTATCCCTTTTGAAGAGTTATTAATGAACCACTGAATGAGGTTCTAGAAATGGA TAAAGATTATACTTTTTTTCAAAGTAGAAAGAGAACAAATTCTCTTTTATGACATGTCCCTTTATATTG AATGCTGTCACAAAGAATTTGGGATTATATTATGACAATAGAATTCGCATGTACAGTGAACGAAGAATCA CTGTTCTCTACAGCTTAGTTCAAGGACAGCAGTTGAATCCATATTTGAGACTCAAAGTTAGACGTGACCA TATCATAGATGATGCACTTGTCCGGCTAGAGATGATCGCTATGGAAAATCCTGCAGACTTGAAGAAGCAG TTGTATGTGGAATTTGAAGGAGAACAAGGAGTTGATGAGGGAGGTGTTCCAAAGAATTTTTTCAGCTGG TTGTGGAGGAAATCTTCAATCCAGATATTGGTATGTTCACATACGATGAATCTACAAAATTGTTTTGGTT TAATCCATCTTCTTTTGAAACTGAGGGTCAGTTACTCTGATTGGCATAGTACTGGGTCTGGCTATTTAC AATAACTGTATACTGGATGTACATTTTCCCATGGTTGCTACAGGAAGCTAATGGGGAAAAAAGGAACTT TTCGTGACTTGGGAGACTCTCACCCAGTTCTATATCAGAGTTTAAAAGATTTATTGGAGTATGAAGGGAA TGTGGAAGATGACATGATGATCACTTTCCAGATATCACAGACAGATCTTTTTTGGTAACCCAATGATGTAT GATCTAAAGGAATTGGTGATAAAATTCCAATTACAAATGAAAACAGGAAGGAATTTGTCAATCTTTATT CTGACTACATTCTCAATAAATCAGTAGAAAAAACAGTTCAAGGCTTTTCGGAGAGGTTTTCATATGGTGAC CAATGAATCTCCCTTAAAGTACTTATTCAGACCAGAAGAAATTGAATTGCTTATATGTGGAAGCCGGAAT CTAGATTTCCAAGCACTAGAAGAAACTACAGAATATGACGGTGGCTATACCAGGGACTCTGTTCTGATTA GGGAGTTTCTGGGAAATCGTTCATTCATTTACAGATGAACAGAAAAGACTCTTCTTGCAGTTTACAACGGG CACAGACAGAGCACCTGTGGGAGGACTAGGAAAATTAAAGATGATTATAGCCAAATTGGCCCAGACACA GAAAGGTTACCTACATCTCATACTTGCTTTAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGAAAAAC TTAAAGAGAGATTGTTGAAGGCCATCACGTATGCCAAAGGATTTGGCATGCTGTAAAACAAAACAAAACA AAATAAAACAAAAAAGGAAGGAAAAAAAGGAAAAAATTTAAAATTTTTTAAAAATATAACGAGGGAT AATTTTTGGTGGTGATAGTGTCCCAGTACAAAGGGCTGTAAGATAGTCAACCACAGTAGTCACCTATG TCTGTGCCTCCCTTCTTTATTGGGGACATGTGGGCTGGAACAGCAGATTTCAGCTACATATATGAACAAA TCCTTTATTATTATTATAATTATTTTTTTGCGTGAAAGTGTTACATATTCTTCACTTGTATGTACAGAG AGGTTTTTCTGAATATTTATTTTAAGGGTTAAATCACTTTTGCTTGTGTTTATTACTGCTTGAGGTTGAG CCTTTTGAGTATTTAAAAAATATATACCAACAGAACTACTCTCCCAAGGAAAATATTGCCACCATTTGTA GACCACGTAACCTTCAAGTAGTGCTACTTTTTTGTCCCTGTATCTAACTCAAATCAGGAACTGTATTTT TTTTAATTTGCTTTTGAAACTTGAAGTCTTGAAACAGTGTGATGCAATTACTGCTGTTCTAGCCCC CAAAGAGTTTTCTGTGCAAAATCTTGAGAATCAATCAATAAAGAAAGATGGAAGGAAGGGAGAAATTGGA ATGTTTTAACTGCAGCCCTCAGAACTTTAGTAACAGCACAACAAATTAAACAACAACAACTCATGCCA CAGTATGTCGTCTTCATGTGTCTTGCAATGAACTGTTTCAGTAGCCAATCCTCTTTCTTAGTATATGAAA GGACAGGGATTTTTGTTCTTGTTGTTCTCGTTGTTGTTTTAAGTTTACTGGGGAAAGTGCATTTGGCCAA ATGAAATGGTAGTCAAGCCTATTGCAACAAAGTTAGGAAGTTTGTTGTTTGTTTATTATAAACAAAGC ATGTGAAAGTGCACTTAAGATAGAGTTTTTATTAATTACTTACTTATTACCTAGATTTTAAATAGACAAT CCAAAGTCTCCCCTTCGTGTTGCCATCATCTTGTTGAATCAGCCATTTTATCGAGGCACGTGATCAGTGT TGCAACATAATGAAAAAGATGGCTACTGTGCCTTGTGTTACTTAATCATACAGTAAGCTGACCTGGAAAT GAATGAAACTATTACTCCTAAGAATTACATTGTATAGCCCCACAGATTAAATTTAATTAATTAATTCAAA ACATGTTAAACGTTACTTTCATGTACTATGGAAAAGTACAAGTAGGTTTACATTACTGATTTCCAGAAGT AAGTGTTCCCCTTCCTAGTCTTCTGTGTATGTGATGTTGTTAATTTCTTTTATTGCATTATAAAATA AAAGGATTATGTATTTTTAACTAAGGTGAGACATTGATATATCCTTTTGCTACAAGCTATAGCTAATGTG CTGAGCTTGTGCCTTGGTGATTGATTGATTGATTGACTGATTGTTTTAACTGATTACTGTAGATCAACCT GATGATTTGTTTGTTTGAAATTGGCAGGAAAAATGCAGCTTTCAAATCATTGGGGGGAGAAAAAGGATGT CTTTCAGGATTATTTTAATTAATTTTTTTCATAATTGAGACAGAACTGTTTGTTATGTACCATAATGCTA AATAAAACTGTGGCACTTTTCACCATAATTTAATTTAGTGGAAAAAGAAGACAATGCTTTCCATATTGTG ATAAGGTAACATGGGGTTTTTCTGGGCCAGCCTTTAGAACACTGTTAGGGTACATACGCTACCTTGATGA AAGGGACCTTCGTGCAACTGTAGTCATCTTAAAGGCTTCTCATCCACTGTGCTTCTTAATGTGTAATTAA AGTGAGGAGAAATTAAATACTCTGAGGGCGTTTTATATAATAAATTCGTGAAGAAATGTGTGCTCTTCA Accession No.: 3. Long isoform of wild-type human UBE3A (isoform 3; GenBank accession #NM_130839.4) GCTGCCTGCCGGGATACTCGGCCCGCCCAGCCAGTCCTCCCGTCTTGCGCCGCGGCCGCGAGATCCGTGT GTCTCCCAAGATGGTGGCGCTGGGCTCGGGGTGACTACAGGAGACGACGGGGCCTTTTCCCTTCGCCAGG ACCCGACACACCAGGCTTCGCTCGCTCGCGCACCCCTCCGCCGCGTAGCCATCCGCCAGCGCGGGCGCCC GCCATCCGCCGCCTACTTACGCTTCACCTCTGCCGACCCGGCGCGCTCGGCTGCGGGCGGCGGCGCCTCC TTCGGCTCCTCCTCGGAATAGCTCGCGGCCTGTAGCCCCTGGCAGGAGGGCCCCTCAGCCCCCCGGTGTG GACAGGCAGCGGCGGCTGGCGACGAACGCCGGGATTTCGGCGGCCCCGGCGCTCCCTTTCCCGGCCTCGT TTTCCGGATAAGGAAGCGCGGGTCCCGCATGAGCCCCGGCGGTGGCGGCAGCGAAAGAGAACGAGGCGGT GGCGGGCGGAGGCGGCGGGCGAGGGCGACTACGACCAGTGAGGCGGCCGCCGCAGCCCAGGCGCGGGGGC GACGACAGGTTAAAAATCTGTAAGAGCCTGATTTTAGAATTCACCAGCTCCTCAGAAGTTTGGCGAAATA TGAGTTATTAAGCCTACGCTCAGATCAAGGTAGCAGCTAGACTGGTGTGACAACCTGTTTTTAATCAGTG ACTCAAAGCTGTGATCACCCTGATGTCACCGAATGGCCACAGCTTGTAAAAGATCAGGAGAACCTCAGTC TGACGACATTGAAGCTAGCCGAATGAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAG TTAACTGAGGGCTGTGGAAATGAAGCCTGCACGAATGAGTTTTGTGCTTCCTGTCCAACTTTTCTTCGTA TGGATAATAATGCAGCAGCTATTAAAGCCCTCGAGCTTTATAAGATTAATGCAAAACTCTGTGATCCTCA TCCCTCCAAGAAAGGAGCAAGCTCAGCTTACCTTGAGAACTCGAAAGGTGCCCCCAACAACTCCTGCTCT GAGATAAAAATGAACAAGAAAGGCGCTAGAATTGATTTTAAAGATGTGACTTACTTAACAGAAGAGAAGG TATATGAAATTCTTGAATTATGTAGAGAAAGAGAGGATTATTCCCCTTTAATCCGTGTTATTGGAAGAGT TTTTTCTAGTGCTGAGGCATTGGTACAGAGCTTCCGGAAAGTTAAACAACACACCAAGGAAGAACTGAAA TCTCTTCAAGCAAAAGATGAAGACAAAGATGAAGATGAAAAGGAAAAAGCTGCATGTTCTGCTGCTGCTA TGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAA ATTAGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAAT GAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTCACCTAACGTGGAATGTGACTTGACGT ATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCT CCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCA GCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAGAATGATGGAGACAT TTCAGCAACTTATTACTTATAAAGTCATAAGCAATGAATTTAACAGTCGAAATCTAGTGAATGATGATGA TGCCATTGTTGCTGCTTCGAAGTGCTTGAAAATGGTTTACTATGCAAATGTAGTGGGAGGGGAAGTGGAC ACAAATCACAATGAAGAAGATGATGAAGAGCCCATCCCTGAGTCCAGCGAGCTGACACTTCAGGAACTTT TGGGAAAGAAAGAAGAAACAAGAAAGGTCCTCGAGTGGACCCCCTGGAAACTGAACTTGGTGTTAAAAC CCTGGATTGTCGAAAACCACTTATCCCTTTTGAAGAGTTTATTAATGAACCACTGAATGAGGTTCTAGAA ATGGATAAAGATTATACTTTTTTCAAAGTAGAAACAGAGAACAAATTTCTCTTTTATGACATGTCCCTTTA TATTGAATGCTGTCACAAAGAATTTGGGATTATATTATGACAATAGAATTCGCATGTACAGTGAACGAAG AATCACTGTTCTCTACAGCTTAGTTCAAGGACAGCAGTTGAATCCATATTTGAGACTCAAAGTTAGACGT GACCATATCATAGATGATGCACTTGTCCGGCTAGAGATGATCGCTATGGAAAATCCTGCAGACTTGAAGA AGCAGTTGTATGTGGAATTTGAAGGAGAACAAGGAGTTGATGAGGGAGGTGTTTCCAAAGAATTTTTTCA GCTGGTTGTGGAGGAAATCTTCAATCCAGATATTGGTATGTTCACATACGATGAATCTACAAAATTGTTT TGGTTAATCCATCTTCTTTTGAAACTGAGGGTCAGTTTACTCTGATTGGCATAGTACTGGGTCTGGCTA TTTACAATAACTGTATACTGGATGTACATTTTCCCATGGTTGCTACAGGAAGCTAATGGGGAAAAAAGG AACTTTTCGTGACTTGGGAGACTCTCACCCAGTTCTATATCAGAGTTTAAAAGATTTATTGGAGTATGAA GGGAATGTGGAAGATGACATGATGATCACTTTCCAGATATCACAGACAGATCTTTTTTGGTAACCCAATGA TGTATGATCTAAAGGAATTGGTGATAAAATTCCAATTACAAATGAAAACAGGAAGGAATTTGTCAATCT TTATTCTGACTACATTCTCAATAAATCAGTAGAAAAAACAGTTCAAGGCTTTTCGGAGAGGTTTTCATATG GTGACCAATGAATCTCCCTTAAAGTACTTATTCAGACCAGAAGAAATTGAATTGCTTATATGTGGAAGCC GGAATCTAGATTTCCAAGCACTAGAAGAAACTACAGAATATGACGGTGGCTATACCAGGGACTCTGTTCT GATTAGGGAGTTCTGGGAAATCGTTCATTCATTTACAGATGAACAGAAAAGACTCTTCTTGCAGTTTACA ACGGGCACAGACAGAGCACCTGTGGGAGGACTAGGAAAATTAAAGATGATTATAGCCAAAATTGGCCCAG ACACAGAAAGGTTACCTACATCTCATACTTGCTTTAATGTGCTTTTACTTCCGGAATACTCAAGCAAAGA AAAACTTAAAGAGAGATTGTTGAAGGCCATCACGTATGCCAAAGGATTTGGCATGCTGTAACAACAACA AAACAAAATAAAACAAAAAAAAGGAAGGAAAAAAAGGAAAAAATTTAAAAAATTTTAAAAATATAACGA GGGATAAATTTTTGGTGGTGATAGTGTCCCAGTACAAAGGGCTGTAAGATAGTCAACCACAGTAGTCAC CTATGTTCTGTGCCTCCCTTCTTTATTGGGGACATGTGGGCTGGAACAGCAGATTTCAGCTACATATATGA ACAAATCCTTTATTATTATTATAATTATTTTTTTGCGTGAAAGTGTTACATATTCTTTCACTTGTATGTA CAGAGAGGTTTTTCTGAATATTTATTTTAAGGGTTAAATCACTTTTGCTTGTGTTTATTACTGCTTGAGG TTGAGCCTTTTGAGTATTTAAAAAATATATACCAACAGAACTACTCTCCCAAGGAAAATATTGCCACCAT TTGTAGACCACGTAACCTTCAAGTATGTGCTACTTTTTTGTCCCTGTATCTAACTCAAATCAGGAACTGT ATTTTTTTAATGATTTGCTTTTGAAACTTGAAGTCTTGAAACAGTGTGATGCAATTACTGCTGTTCTA GCCCCCAAGAGTTTTCTGTGCAAAATCTTGAGAATCAATCAATAAAGAAAGATGGAAGGAAGGGAGAAA TTGGAATGTTTTAACTGCAGCCCTCAGAACTTTAGTAACAGCACAACAAATTAAACAACAACAACTCA TGCCACAGTATGTCGTCTTCATGGTCTTGCAATGAACTGTTTCAGTAGCCAATCCTCTTTCTTAGTATA TGAAAGGACAGGGATTTTTGTTCTTGTTGTTCTCGTTGTTGTTTTAAGTTTACTGGGGAAAGTGCATTTG GCCAAATGAAATGGTAGTCAAGCCTATTGCAACAAAGTTAGGAAGTTTGTTGTTTGTTTATTATAAACAA AAAGCATGTGAAAGTGCACTTAAGATAGAGTTTTTATTAATTACTTACTTATTACCTAGATTTTAAAATAG ACAATCCAAAGTCTCCCCTTCGTGTTGCCATCATCTTGTTGAATCAGCCATTTTATCGAGGCACGTGATC AGTGTTGCAACATAATGAAAAAGATGGCTACTGTGCCTTGTGTTACTTAATCATACAGTAAGCTGACCTG GAAAGGAATGAAACTATTACTCCTAAGAATTACATTGTATAGCCCCACAGATTAAATTTAATTTAATTAAT TCAAAACATGTTAAACGTTACTTTCATGTACTATGGAAAAGTACAAGTAGGTTTACATTACTGATTTCCA GAYG ... AAATAAAAGGATTATGTATTTTTAACTAAGGTGAGACATTGATATATCCTTTTGCTACAAGCTATAGCTA ATGTGCTGAGCTTGTGCCTTGGTGATTGATTGATTGATTGACTGATTGTTTTAACTGATTACTGTAGATC AACCTGATGATTTGTTTGTTTGAAATTGGCAGGAAAAATGCAGCTTTCAAATCATTGGGGGGAGAAAGAAG GATGTCTTTCAGGATTATTTTAATTAATTTTTTTCATAATTGAGACAGAACTGTTTGTTATGTACCATAA TGCTAAATAAAACTGTGGCACTTTTCACCATAATTTAATTTAGTGGAAAAAGAAGACAATGCTTTCCATA TTGTGATAAGGTAACATGGGGTTTTTCTGGGCCAGCCTTTAGAACACTGTTAGGGTACATACGCTACCTT GATGAAAGGGACCTTCGTGCAACTGTAGTCATCTTAAAGGCTTCTCATCCACTGTGCTTCTTAATGTGTA ATTAAAGTGAGGAGAATAAATTAAATACTCTGAGGGCGTTTTATATAATAAATTCGTGAAGAATGTGTGCTC TTCA

[0096] Without wishing to be bound by theory, analysis of UBE3A isoform expression in human brain tissues showed that the short UBE3A isoform 1 is expressed at a ratio of at least 4:1 and up to 8:1 compared to the long UBE3A isoform, depending on the specific brain region assayed (Mele et al, Science, 2015;348(6235):660-665). Thus, in some embodiments, a mammalian UBE3A open reading frame may include one or more Kozak sequences that are modified from WT or a control, e.g., comprises, consists essentially of, or consists of a polynucleotide sequence in which 1, 2, 3, 4, 5, or more nucleotides have been replaced, added, and / or deleted compared to WT or a control, e.g., a consensus Kozak sequence and / or a wild-type UBE3A Kozak sequence. In some embodiments, a mammalian UBE3A open reading frame may include one or more Kozak sequences that include nucleotide modifications (e.g., substitutions) that reduce and / or enhance the initiation activity of one or more start codons (i.e., one or more start codons also known as translation initiation sites) in the open reading frame. In some embodiments, a mammalian UBE3A open reading frame may include one or more Kozak sequences that include nucleotide modifications (e.g., substitutions) that reduce the initiation activity of one or more start codons by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more (e.g., reduce expression of an isoform) compared to a control, e.g., a consensus Kozak sequence, or, e.g., a wild-type (e.g., unmodified) UBE3A Kozak sequence.In some embodiments, a mammalian UBE3A open reading frame may include one or more Kozak sequences that contain nucleotide modifications (e.g., substitutions) that enhance the initiation activity of one or more start codons by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, 150%, 200% or more (e.g., enhance expression of an isoform) compared to a control, e.g., a consensus Kozak sequence, or, e.g., a wild-type (e.g., unmodified) UBE3A Kozak sequence. In some embodiments, a mammalian UBE3A open reading frame may contain one or more nucleotide modifications that provide for expression of the short isoform at a ratio of about 1:1 to about 15:1, e.g., about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1, or any value or range therein, relative to expression of the long isoform. For example, in some embodiments, a mammalian (e.g., human) UBE3A open reading frame may contain one or more nucleotide modifications that provide for expression of the short isoform at a ratio of about 2:1 to about 4.5:1, about 1:1 to about 10:1, about 3:1 to about 8.5:1, or about 3:1 to about 4:1, relative to expression of the long isoform. For example, in some embodiments, a mammalian (e.g., human) UBE3A open reading frame may contain one or more nucleotide modifications that provide for expression of the short isoform in a ratio of about 2.5:1, about 3:1, about 4:1, about 6.5:1, about 8:1, or about 10:1 compared to expression of the long isoform.

[0097] In some embodiments, the mammalian UBE3A open reading frame comprises a first Kozak sequence comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:6, or a sequence at least about 50% identical thereto, e.g., at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, the first Kozak sequence (e.g., SEQ ID NO:6) is operably linked to isoform 3 or isoform 2, such as by replacing or modifying the WT isoform 3 or WT isoform 2 Kozak sequence (SEQ ID NO:5 or 4, respectively). SEQ ID NO: 4. Wild-type human UBE3A long isoform 2 Kozak sequence (start codon underlined) UGCAGG AUG G SEQ ID NO: 5. Wild-type human UBE3A long isoform 3 Kozak sequence (start codon underlined) CACCGA AUG G SEQ ID NO: 6. First Kozak sequence of modified human UBE3A with reduced initiation activity (start codon underlined) UUUUUU AUG G

[0098] In some embodiments, the mammalian UBE3A open reading frame comprises a second Kozak sequence comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO: 8, or a sequence at least about 50% identical thereto, such as at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, the second Kozak sequence (e.g., SEQ ID NO: 8) is operably linked to the short isoform 1, such as by replacing or modifying the WT human UBE3A isoform 1 Kozak sequence (SEQ ID NO: 7). SEQ ID NO: 7. Kozak sequence of the short isoform (isoform 1) of wild-type human UBE3A (start codon is underlined) AGCCGA AUG A SEQ ID NO: 8. Second Kozak sequence of modified human UBE3A with enhanced initiation activity (start codon underlined) AGCAGG AUG A

[0099] In some embodiments, the only codon-optimized nucleotide sequence of a mammalian UBE3A open reading frame is for one or both Kozak sequences, such as that shown in FIG. 14 for human UBE3A. In some embodiments, additional codon-optimized nucleotide sequences (in addition to the Kozak sequence) are in the mammalian UBE3A open reading frame to affect expression in mammalian cells. The term "mammalian" as used herein includes, but is not limited to, humans, primates, non-human primates (e.g., monkeys and baboons), cows, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g., rats, mice, hamsters, etc.), etc. Codon optimization is a well-known technique in the art, and optimal codons for expression in various species are known. The use of codon-optimized UBE3A sequences allows the expression of the transduced sequence to be distinguished from the expression of the endogenous UBE3A sequence in a subject. In some embodiments, a polynucleotide comprising the human UBE3A open reading frame of the present invention can be codon-optimized for expression in human cells.

[0100] In some embodiments, the codon-optimized UBE3A open reading frame comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:26, or SEQ ID NO:27, or a sequence that is at least about 70% identical thereto, such as at least about 70, 75, 76, 77, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In some embodiments, one or both of the Kozak sequences in SEQ ID NO:27 (Figure 14) are not further modified, while the other nucleotide sequence is further codon optimized to create a UBE3A open reading frame that is at least about 70% identical, for example at least about 70, 75, 76, 77, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical, to the respective sequence in SEQ ID NO:27 (Figure 14) when the Kozak sequence is removed from the comparison, thereby keeping the Kozak sequence (SEQ ID NO:8) operably linked to the short isoform 1 and / or the Kozak sequence (SEQ ID NO:6) operably linked to isoform 3 or isoform 2. SEQ ID NO: 9. Human codon-optimized UBE3A isoform 1 and isoform 3 open reading frame (hUBE3A1>>3)

[0101] Another aspect of the present invention relates to an expression cassette comprising a polynucleotide comprising the mammalian (e.g., human) UBE3A open reading frame of the present invention. In certain embodiments, the polynucleotide is a polynucleotide comprising a human codon-optimized sequence, such as the nucleotide sequence of SEQ ID NO: 9, or a sequence at least about 70% identical thereto, such as at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. In various embodiments of the present invention described herein, the UBE3A nucleotide sequence of SEQ ID NO: 9 further comprises an additional 5' base pair sequence (e.g., six thymines resulting in a modified Kozak sequence of SEQ ID NO: 6) to include the first Kozak sequence.

[0102] The UBE3A open reading frame in the expression cassette may be operably linked to one or more expression elements that can modify (i.e., enhance or reduce or limit) the expression of UBE3A and / or E6AP, such as promoters, enhancers, polyadenylation signals, localization signals, and / or other expression elements known in the art.

[0103] In some embodiments, the polynucleotide is operably linked to a promoter, e.g., a neuron-specific promoter, e.g., human synapsin (hSYN), neuron-specific enolase (NSE), tubulin alpha 1 (Ta1), MeCP2 (MeP).

[0104] In some embodiments, the polynucleotide is operably linked to a human synapsin promoter, e.g., a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO: 10, or a sequence that is at least about 70% identical thereto, e.g., at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO: 10. Human synapsin (hSYN) promoter GGTACCAGGGCCCTGCGATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGC CACCGCCGCCTCAGCACTGAAGGCGCCGCTGACGTCACTCGCCGGTCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAGTC

[0105] In some embodiments, the UBE3A open reading frame is operably linked to a polyadenylation signal, such as a bovine growth hormone (bGH) polyadenylation signal (bGHpA), such as a polyadenylation signal comprising, consisting essentially of, or consisting of a nucleotide sequence of SEQ ID NO:11, or a sequence at least about 70% identical thereto, such as at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO: 11. Bovine growth hormone polyadenylation signal (bGHpA) CTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTG AGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAACAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCT

[0106] In some embodiments, the UBE3A open reading frame is operably linked to a polyadenylation signal, such as a polyadenylation signal comprising, consisting essentially of, or consisting of a synthetic polyA (SpA), such as a nucleotide sequence of SEQ ID NO: 12, or a sequence at least about 70% identical thereto, such as at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO: 12. Synthetic polyadenylation signal (SpA) AATAAAGAGCTCAGATGCATCGATCAGAGTGTGTTGGTTTTTTGTGTG

[0107] In some embodiments, the UBE3A open reading frame is operably linked to a polyadenylation signal, such as a Simian Virus 40 (SV40) polyadenylation signal (SV40pA), such as a polyadenylation signal comprising, consisting essentially of, or consisting of a nucleotide sequence of SEQ ID NO: 13, or a sequence at least about 70% identical thereto, such as at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO: 13. SV40 polyadenylation signal (SV40pA) AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATT

[0108] Those skilled in the art will further understand that a variety of promoter / enhancer elements can be used depending on the desired level and tissue-specific expression. The promoter / enhancer can be constitutive or inducible depending on the desired pattern of expression. The promoter / enhancer can be native or foreign, and can be a natural or synthetic sequence. By foreign, it is intended that the transcription initiation region is not found in the wild-type host into which it is introduced.

[0109] The promoter / enhancer element can be native to the target cell or subject to be treated and / or native to the heterologous nucleic acid sequence.The promoter / enhancer element is generally selected so that it functions in the intended target cell.In a representative embodiment, the promoter / enhancer element is a mammalian promoter / enhancer element.The promoter / enhancer element can be constitutive or inducible.

[0110] Inducible expression control elements are generally used in those applications where it is desirable to provide regulation over the expression of heterologous nucleic acid sequences.The inducible promoter / enhancer element for gene delivery can be tissue-specific or tissue-preferential promoter / enhancer element, including muscle-specific or preferential (including cardiac muscle, skeletal muscle, and / or smooth muscle), nerve tissue-specific or preferential (including brain-specific), eye (including retina-specific and cornea-specific), liver-specific or preferential, bone marrow-specific or preferential, pancreas-specific or preferential, spleen-specific or preferential, and lung-specific or preferential promoter / enhancer element.Other inducible promoter / enhancer elements include hormone-inducible and metal-inducible elements.Exemplary inducible promoter / enhancer elements include, but are not limited to, Tet on / off element, RU486-inducible promoter, ecdysone-inducible promoter, rapamycin-inducible promoter, and metallothionein promoter.

[0111] In embodiments in which the UBE3A open reading frame is transcribed and then translated in the target cell, specific initiation signals are generally employed for efficient translation of the inserted protein coding sequence. These exogenous translation control sequences, which may include the ATG initiation codon (i.e., translation initiation site) and adjacent sequences, may be of various origins, natural or synthetic. Non-limiting examples of these additional exogenous translation control sequences include Kozak sequences (e.g., additional Kozak consensus sequences).

[0112] In certain embodiments, the expression cassette further comprises at least one adeno-associated virus (AAV) inverted terminal repeat (ITR), for example, two AAV ITRs. The two ITRs can have the same nucleotide sequence or different nucleotide sequences. The AAV ITRs can be from any AAV serotype or isolate (e.g., AAV1, AAV2, AAV3 (including 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or any of those shown in Table 1). In some embodiments, the ITRs are from AAV2. Each ITR can be independently a wild-type sequence or a modified sequence. In some embodiments, the modified ITR can have a D-element deletion (WO01 / 92551). A D-element deletion is defined as the removal of that portion of an ITR known as a D-element. D-element can alternatively be referred to or known as D region or D sequence, and / or the nucleotide of ITR that does not form palindromic hairpin structure.In some embodiments, expression cassette is AAV single-stranded vector.In some embodiments, expression cassette is AAV genome, for example self-complementary AAV genome.

[0113] In certain embodiments, the expression cassette comprises, in any order listed, a promoter, a mammalian UBE3A open reading frame, and a polyadenylation site. In certain embodiments, the expression cassette comprises, in any order listed, a promoter, a human UBE3A open reading frame, and a polyadenylation site. In certain embodiments, the expression cassette comprises, in any order listed, an AAV ITR, a promoter, a human UBE3A open reading frame, a polyadenylation site, and an AAV ITR. In certain embodiments, the expression cassette comprises, in any order listed, a human synapsin promoter, a human UBE3A open reading frame, and a bGH polyadenylation site. In certain embodiments, the expression cassette comprises, in any order listed, an AAV ITR, a human synapsin promoter, a human UBE3A open reading frame, a bGH polyadenylation site, and an AAV ITR. In certain embodiments, the expression cassette comprises, in any order listed, AAV2 ITR, promoter, human UBE3A open reading frame, bGH polyadenylation site, and AA2V ITR.In certain embodiments, the expression cassette comprises, in any order listed, AAV2 ITR, human synapsin promoter, human UBE3A open reading frame comprising short and long isoforms of human UBE3A, bGH polyadenylation site, and AA2V ITR.In certain embodiments, the expression cassette comprises, in any order listed, AAV2 ITR, human synapsin promoter, human UBE3A open reading frame comprising short isoforms (i.e., isoform 1) and long isoform 3 of human UBE3A, bGH polyadenylation site, and AA2V ITR. In certain embodiments, the expression cassette comprises, optionally in the order listed, an AAV2 ITR, a human synapsin promoter, a human UBE3A open reading frame comprising the short isoform and long isoform 2 of human UBE3A, a bGH polyadenylation site, and an AAV2 ITR.The aforementioned components are in operable linkage. In certain embodiments, the expression cassette comprises, in any of the listed order, AAV2 ITR, human synapsin promoter, human UBE3A short isoform and human long isoform (i.e., either isoform 2 or 3), and further comprises one or more Kozak sequences comprising, consisting essentially of, or consisting of SEQ ID NO:6 and / or SEQ ID NO:8, or at least about 50% identical thereto, for example at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto, bGH polyadenylation site, and AA2V ITR. The aforementioned components are in operable linkage.

[0114] In some embodiments, the expression cassette comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14, or a sequence that is at least about 70% identical thereto, such as at least about 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical thereto. SEQ ID NO: 14. Human UBE3A expression cassette excluding ITRs

[0115] A further aspect of the present invention relates to a vector comprising the polynucleotide or expression cassette described herein. Suitable vectors include, but are not limited to, a plasmid, a phage, a viral vector (e.g., an AAV vector, a lentiviral vector, an adenoviral vector, a herpesvirus vector, an alphavirus vector, or a baculovirus vector), a bacterial artificial chromosome (BAC), or a yeast artificial chromosome (YAC). For example, the nucleic acid may comprise, consist of, or essentially consist of an AAV vector comprising 5' and / or 3' terminal repeats (e.g., 5' and / or 3' AAV terminal repeats). In some embodiments, the vector is a delivery vehicle, such as a particle (e.g., a microparticle or nanoparticle) or a liposome, to which the expression cassette is attached or in which the expression cassette is embedded. The vector may be any delivery vehicle suitable for carrying the expression cassette into a cell. In some embodiments, the vector may be a neurotropic vector.

[0116] In some embodiments, the vector is a viral vector, such as a lentiviral vector and / or an AAV vector. In some embodiments, the vector is an AAV vector. The AAV vector can be any AAV serotype or isolate (e.g., AAV1, AAV2, AAV3 (including 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or any of those shown in Table 1). In some embodiments, the AAV vector is an AAV9 vector. In some embodiments, the AAV vector can be AAV9 and / or AAV9-derived variants, such as, but not limited to, PHP.B, PHP.eB, or AAV9.HR. In some embodiments, the AAV vector can be a synthetic AAV vector, such as Anc80. In some embodiments, the AAV vector can include wild-type capsid protein. In other embodiments, the AAV vector can include a modified capsid protein that has altered tropism compared to the wild-type capsid protein, for example the modified capsid protein is liver detargeted or has enhanced tropism for a particular cell.

[0117] In some embodiments, the vector is a single-stranded AAV (ssAAV) vector. In some embodiments, the vector is a self-complementary or double-stranded AAV (scAAV) vector. scAAV vectors are described in International Publication WO01 / 92551, the disclosure of which is incorporated herein by reference. The use of scAAV to express UBE3A ORF can provide an increase in the number of transduced cells, the copy number per transduced cell, or both.

[0118] An additional aspect of the invention relates to a transformed cell comprising the polynucleotide, expression cassette, and / or vector of the invention. In some embodiments, the polynucleotide, expression cassette, and / or vector is stably integrated into the cell genome. The cell can be an in vitro, ex vivo, or in vivo cell.

[0119] Another aspect of the invention relates to a transgenic animal comprising a polynucleotide, expression cassette, vector, and / or transformed cell of the invention. In some embodiments, the animal is a laboratory animal, such as a mouse, rat, rabbit, dog, monkey, or non-human primate.

[0120] A further aspect of the invention relates to a pharmaceutical formulation comprising a polynucleotide, expression cassette, vector, and / or transformed cell of the invention in a pharma- ceutically acceptable carrier.

[0121] In a specific embodiment, the polynucleotides, expression cassettes, vectors, and / or transformed cells of the invention are isolated.

[0122] In another specific embodiment, the polynucleotides, expression cassettes, vectors, and / or transformed cells of the invention are purified.

[0123] Methods for Producing Viral Vectors The present invention further provides a method for producing a viral vector. In one particular embodiment, the present invention provides a method for producing a recombinant AAV particle, comprising the steps of: (a) providing a recombinant AAV template comprising (i) a polynucleotide or expression cassette of the present invention, and (ii) an ITR; (b) a polynucleotide comprising a Rep coding sequence and a Cap coding sequence to a cell permissive for AAV replication, under conditions sufficient for the replication and packaging of the recombinant AAV template, thereby producing a recombinant AAV particle in the cell. Conditions sufficient for the replication and packaging of the recombinant AAV template can be, for example, the presence of AAV sequences (e.g., AAV rep and AAV cap sequences) sufficient for the replication and encapsidation of the AAV template into an AAV capsid, and helper sequences from adenovirus and / or herpesvirus. In a particular embodiment, the AAV template comprises two AAV ITR sequences, which are located 5' and 3' to the polynucleotide of the present invention, but need not be directly contiguous with it.

[0124] In some embodiments, the recombinant AAV template contains ITRs that are not separated by Rep to create a double-stranded AAV vector, as described in International Publication WO 01 / 92551.

[0125] The AAV template and AAV rep and cap sequences are provided under conditions such that a viral vector comprising the AAV template packaged within an AAV capsid is produced in the cell. The method may further comprise recovering the viral vector from the cell. The viral vector may be recovered from the medium and / or by lysing the cell.

[0126] The cell can be a cell that is permissive for AAV virus replication.Any suitable cell known in the art can be adopted.In certain embodiments, the cell is a mammalian cell (e.g., a primate or human cell).As another option, the cell can be a trans-complementing packaging cell line that provides the function that is deleted from the replication-defective helper virus, such as 293 cell or other E1a trans-complementing cell.

[0127] AAV replication and capsid sequences can be provided by any method known in the art. Current protocols typically express AAV rep / cap genes on a single plasmid. AAV replication and packaging sequences do not need to be provided together, but it may be convenient to do so. AAV rep and / or cap sequences can be provided by any viral or non-viral vector. For example, rep / cap sequences can be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the E1a or E3 region of a deleted adenovirus vector). EBV vectors can also be employed to express AAV cap and rep genes. One advantage of this method is that EBV vectors are episomal, but will nevertheless maintain high copy number through continued cell division (i.e., stably integrated into cells as extrachromosomal elements designated "EBV-based nuclear episomes"; see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).

[0128] As a further alternative, the rep / cap sequences can be stably integrated into the cell.

[0129] Typically, the AAV rep / cap sequences will not be flanked by TRs to prevent rescue and / or packaging of these sequences.

[0130] AAV template can be provided to cells using any method known in the art. For example, template can be provided by non-viral (e.g., plasmid) or viral vector. In certain embodiments, AAV template is provided by herpesvirus or adenovirus vector (e.g., inserted into deleted adenovirus E1a or E3 region). As another example, Palombo et al., (1998) J. Virology 72:5025, describes a baculovirus vector carrying a reporter gene flanked by AAV TR. As described above with respect to rep / cap genes, EBV vectors can also be employed to deliver template.

[0131] In another representative embodiment, the AAV template is provided by a replicating rAAV virus. In yet other embodiments, the AAV provirus containing the AAV template is stably integrated into a chromosome of the cell.

[0132] To enhance virus titer, helper virus function (e.g., adenovirus or herpesvirus) can be provided to cells to promote productive AAV infection.Helper virus sequences required for AAV replication are known in the art.Typically, these sequences will be provided by helper adenovirus or herpesvirus vector.Alternatively, adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, for example, as non-infectious adenovirus mini-plasmid that carries all of the helper genes that promote efficient AAV production, as described by Ferrari et al., (1997) Nature Med.3:1295, and U.S. Patent Nos. 6,040,183 and 6,093,570.

[0133] Additionally, helper virus functions can be provided by packaging cells that have helper sequences embedded in a chromosome or maintained as stable extrachromosomal elements. Generally, the helper virus sequences cannot be packaged into AAV virions and are not flanked by, for example, ITRs.

[0134] Those skilled in the art will appreciate that it may be advantageous to provide AAV replication and capsid sequences and helper virus sequences (e.g., adenovirus sequences) on a single helper construct. This helper construct may be a non-viral or viral construct. As one non-limiting example, the helper construct may be a hybrid adenovirus or hybrid herpesvirus that contains the AAV rep / cap genes.

[0135] In one particular embodiment, the AAV rep / cap sequence and the adenovirus helper sequence are provided by a single adenovirus helper vector. This vector may further comprise an AAV template. The AAV rep / cap sequence and / or the AAV template may be inserted into the deleted region of the adenovirus (e.g., E1a or E3 region).

[0136] In a further embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. According to this embodiment, the AAV template may be provided as a plasmid template.

[0137] In another exemplary embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are provided by a single adenovirus helper vector, and the AAV template is integrated into the cell as a provirus. Alternatively, the AAV template is provided by an EBV vector that is maintained in the cell as an extrachromosomal element (e.g., as an EBV-based nuclear episome).

[0138] In a further exemplary embodiment, the AAV rep / cap sequence and the adenovirus helper sequence are provided by a single adenovirus helper. The AAV template can be provided as a separate replicating viral vector. For example, the AAV template can be provided by an AAV particle or a second recombinant adenovirus particle.

[0139] According to the above-mentioned method, hybrid adenovirus vector typically comprises sufficient adenovirus 5' and 3' cis sequences (i.e., adenovirus terminal repeat and PAC sequences) for adenovirus replication and packaging.AAV rep / cap sequences, and if present, AAV template, are embedded in adenovirus backbone and flanked by 5' and 3' cis sequences, so that these sequences can be packaged in adenovirus capsid.As described above, adenovirus helper sequences and AAV rep / cap sequences are generally not flanked by ITRs, so that these sequences are not packaged in AAV virions.

[0140] Zhang et al., ((2001) Gene Ther. 18:704-12) describe an adenovirus and chimeric helper that contains both the AAV rep and cap genes.

[0141] Herpesviruses can also be used as helper viruses in AAV packaging methods.Hybrid herpesviruses encoding AAV Rep proteins can advantageously facilitate scalable AAV vector production schemes.Hybrid herpes simplex virus type I (HSV-1) vectors expressing AAV-2 rep and cap genes have been described (Conway et al., (1999) Gene Ther. 6:986 and WO00 / 17377).

[0142] As a further alternative, the viral vectors of the invention can be produced in insect cells using a baculovirus vector delivering the rep / cap genes and an AAV template, for example as described by Urabe et al., (2002) Human Gene Ther. 13:1935-43.

[0143] AAV vector stocks free of contaminating helper virus can be obtained by any method known in the art. For example, AAV and helper virus can be easily distinguished based on size. AAV can also be separated from helper virus based on affinity to heparin substrate (Zolotukhin et al. (1999) Gene Therapy 6:973). Replication-defective helper virus can be used that is deleted so that any contaminating helper virus is replication-incompetent. As a further alternative, adenovirus helper that lacks late gene expression can be employed, since only adenovirus early gene expression is required to mediate packaging of AAV. Adenovirus mutants that are defective in late gene expression are known in the art (e.g., ts100K and ts149 adenovirus mutants).

[0144] How to use the UBE3A vector The present invention also relates to a method for delivering UBE3A open reading frame to a cell or a subject, for example for in vitro, ex vivo, and / or in vivo therapeutic or research purposes, to increase the production of UBE3A and / or E6AP.Thus, one aspect of the present invention relates to a method for expressing UBE3A open reading frame in a cell, comprising contacting the cell with a polynucleotide, expression cassette, and / or vector of the present invention, thereby expressing UBE3A open reading frame in the cell.In some embodiments, the cell is an in vitro cell, an ex vivo cell, and / or an in vivo cell.Expression of the present invention in vitro can be useful for research purposes, for example to express recombinant protein, to investigate the effect of the protein on cells, to evaluate efficacy and / or safety prior to in vivo expression, and / or for developing research and medical diagnostic and / or screening methods.

[0145] Another aspect of the present invention relates to a method for expressing a UBE3A open reading frame in a subject, comprising delivering a polynucleotide, an expression cassette, a vector, and / or a transformed cell of the present invention to a subject, thereby expressing the UBE3A open reading frame in the subject. In some embodiments, the subject is an animal model of a disorder associated with abnormal UBE3A gene expression.

[0146] A further aspect of the present invention relates to a method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of a UBE3A gene product (e.g., E6AP) in a subject in need thereof, comprising the step of delivering a therapeutically effective amount of a polynucleotide, expression cassette, vector, and / or transformed cell of the present invention to the subject, thereby treating the disorder associated with abnormal expression of the UBE3A gene or abnormal activity of a UBE3A gene product in the subject. The present invention provides a method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of a UBE3A gene product (e.g., E6AP) in a subject in need thereof, comprising the step of administering a therapeutically effective amount of a polynucleotide, expression cassette, vector, and / or transformed cell of the present invention to the subject, thereby expressing the UBE3A open reading frame in the subject. In some embodiments, the disorder associated with abnormal expression of the UBE3A gene or gene product may be Angelman syndrome.

[0147] The present invention further provides a method of treating Angelman syndrome in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a polynucleotide, expression cassette, vector, and / or transformed cell of the present invention, whereby the UBE3A open reading frame is expressed in the subject.

[0148] In certain embodiments, the polynucleotide, expression cassette, vector, and / or transformed cell is delivered to the subject, for example, to the subject's central nervous system systemically (e.g., intravenously) or directly (e.g., into the cerebrospinal fluid by intrathecal or intraventricular or intracisternal injection). In some embodiments, the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intravenously. In some embodiments, the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intraventricularly.

[0149] The recombinant viral vector according to the present invention finds use in both veterinary and medical applications. Suitable subjects include birds, reptiles, amphibians, fish, and mammals. The term "mammal" as used herein includes, but is not limited to, humans, primates, non-human primates (e.g., monkeys and baboons), cows, sheep, goats, pigs, horses, cats, dogs, rabbits, rodents (e.g., rats, mice, hamsters, etc.), and the like. Human subjects include embryos, fetuses, neonates, infants, young children, and adults. Optionally, the subject is "in need of" the method of the present invention, for example, because the subject has or is suspected to be at risk for a disorder, including those described herein, or a disorder that would benefit from delivery of a polynucleotide, including those described herein. As a further option, the subject can be a laboratory animal and / or an animal model of a disease. Preferably, the subject is a human.

[0150] In certain embodiments, the polynucleotide of the present invention is administered to a subject in need thereof as early as possible in the subject's life, for example, as soon as the subject is diagnosed with abnormal UBE3A and / or E6AP expression or activity, or any of the aforementioned diseases or disorders. In some embodiments, the polynucleotide is administered to a newborn subject, for example, after newborn screening identifies abnormal UBE3A and / or E6AP expression or activity. In some embodiments, the polynucleotide is administered to a subject before age 10, for example, before age 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the polynucleotide is administered to an adolescent or adult subject after age 10. In some embodiments, the polynucleotide is administered to a fetus in utero, for example, after prenatal screening identifies abnormal UBE3A and / or E6AP expression or activity, or the presence of one of the aforementioned diseases or disorders. In some embodiments, the polynucleotide is administered to the subject as soon as the subject develops symptoms associated with aberrant UBE3A and / or E6AP expression or activity, or as soon as the subject is suspected or diagnosed with aberrant UBE3A and / or E6AP expression or activity or one of the aforementioned diseases or disorders. In some embodiments, the polynucleotide is administered to the subject before the subject develops symptoms or a disease / disorder associated with aberrant UBE3A and / or E6AP expression or activity, such as a subject suspected or diagnosed with aberrant UBE3A and / or E6AP expression or activity or one of the aforementioned diseases or disorders, but has not yet begun to show symptoms.

[0151] In certain embodiments, the present invention provides pharmaceutical compositions comprising the polynucleotides, expression cassettes, vectors, and / or transformed cells of the present invention, and optionally other medicinal agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents, etc., in a pharma-ceutically acceptable carrier. For injection, the carrier will typically be liquid. For other methods of administration, the carrier can be either solid or liquid. For inhalation administration, the carrier will be respirable and will preferably be in solid or liquid particulate form. In some embodiments, the pharmaceutical carrier may include D-sorbitol (e.g., PBS 5% w / v D-sorbitol).

[0152] By "pharmacologically acceptable" it is intended a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesired biological effects.

[0153] One aspect of the present invention is a method for transferring UBE3A open reading frame into cells in vitro. The polynucleotides, expression cassettes, and / or vectors of the present invention can be introduced into cells in appropriate amounts. Viral vectors can be introduced into cells at appropriate multiplicities of infection according to standard transduction methods appropriate for the particular target cells. The titer of the viral vector or capsid administered can vary depending on the target cell type and number, and the particular viral vector or capsid, and can be determined by one of skill in the art without undue experimentation. In certain embodiments, the titer is at least about 10 3 infectious units, more preferably at least about 10 5 The infectious units are introduced into the cells.

[0154] The cells into which the polynucleotides, expression cassettes, and / or vectors, e.g., viral vectors, of the invention may be introduced may be of any type, including, but not limited to, neural cells (including cells of the peripheral and central nervous system, particularly brain cells such as neurons, oligodendrocytes, glial cells, astrocytes, etc.), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g., intestinal and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes, and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including pancreatic islet cells), hepatic cells, cells of the digestive tract (including smooth muscle cells, epithelial cells), cardiac cells (including cardiac muscle cells), bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, articular cells (including, e.g., cartilage, meniscus, synovium, and bone marrow), germ cells, etc. Alternatively, the cells may be any progenitor cells. As a further alternative, the cell can be a stem cell (e.g., neural stem cell, hepatic stem cell). As yet a further alternative, the cell can be a cancer or tumor cell. Furthermore, the cell can be from any species of origin, as indicated above.

[0155] The polynucleotide, expression cassette, and / or vector of the present invention, such as a viral vector, can be introduced into cells in vitro for the purpose of administering the modified cells to a subject. In certain embodiments, cells are removed from a subject, the polynucleotide, expression cassette, and / or vector of the present invention, such as a viral vector, is introduced therein, and then the cells are replaced back into the subject. Methods for removing cells from a subject for ex vivo treatment followed by introduction back into the subject are known in the art (see, for example, U.S. Patent No. 5,399,346). Alternatively, the polynucleotide, expression cassette, and / or vector of the present invention, such as a viral vector, is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.

[0156] Appropriate cells for ex vivo gene therapy are described above. The dosage of cells administered to a subject will vary depending on the age, condition, and species of the subject, the type of cells, the nucleic acid expressed by the cells, the mode of administration, and the like. Typically, at least about 10 2 ~about 10 8 or about 10 3 ~about 10 6 Individual cells will be administered per dose in a pharma- ceutically acceptable carrier. In certain embodiments, cells transduced with an ex vivo viral vector are administered to a subject in an effective amount in combination with a pharmaceutical carrier.

[0157] A further aspect of the present invention is a method of administering the polynucleotide, expression cassette, and / or vector, such as a viral vector, of the present invention to a subject.In a particular embodiment, the method comprises a method of delivering UBE3A open reading frame to an animal subject, the method comprises administering to the animal subject an effective amount of a viral vector according to the present invention.The administration of the viral vector of the present invention to a human subject or an animal in need thereof can be by any means known in the art.Optionally, the viral vector is delivered in an effective dose in a pharmaceutically acceptable carrier.

[0158] The dosage of the viral vector to be administered to a subject will depend on the mode of administration, the disease or condition to be treated, the condition of the individual subject, the particular viral vector, and the nucleic acid to be delivered, and can be determined in a routine manner. Exemplary doses to achieve a therapeutic effect are at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16Transducing units (TU) or more, e.g., about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 A viral titer of about 10 TU is even more preferred. 8 ~10 14 TU, or about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 TU is used for dosing. Dose and viral titer transducing units can be calculated as vector or viral genome (vg), and / or vg / kg subject. In some embodiments, the dose is at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 vg / kg subject, e.g., about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 vg / kg subject, or approximately 10 8 ~10 14 vg / kg subject, in some embodiments, about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 vg / kg subject.

[0159] In some embodiments, the methods of the invention may include expressing and / or administering at such a dose (e.g., viral titer) a UBE3A open reading frame such that the short isoform of UBE3A is expressed at a ratio of about 1:1 to about 15:1, such as about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1, or any value or range therein, relative to the expression of the long isoform. For example, in some embodiments, a mammalian (e.g., human) UBE3A open reading frame may be administered such that the short isoform is expressed at a ratio of about 2:1 to about 4.5:1, about 1:1 to about 10:1, about 3:1 to about 8.5:1, or about 3:1 to about 4:1, relative to the expression of the long isoform. In some embodiments, a mammalian (e.g., human) UBE3A open reading frame can be administered such that the short isoform is expressed in a ratio of about 2.5:1, about 3:1, about 4:1, about 6.5:1, about 8:1, or about 10:1 compared to expression of the long isoform.

[0160] In certain embodiments, more than one administration (e.g., 2, 3, 4 or more administrations) may be employed to achieve a desired level of gene expression over a range of intervals, e.g., daily, weekly, monthly, yearly, etc.

[0161] Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), intravaginal, intrathecal, intraocular, transdermal, intrauterine (or intraovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal muscle, diaphragm muscle, and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), local (e.g., to both cutaneous and mucosal surfaces, including respiratory tract surfaces, and transdermal administration), intro-lymphatic, etc., as well as direct tissue or organ injection (e.g., to the liver, skeletal muscle, cardiac muscle, diaphragm muscle, or brain). Administration may also be to a tumor (e.g., at or near a tumor or lymph node). The most appropriate route in any given case will depend on the nature and severity of the condition being treated, as well as the nature of the particular vector being used. In some embodiments, more than one mode and / or route of administration may be utilized, for example, intraparenchymal and intraventricular administration.

[0162] In some embodiments, the vector containing the expression cassette (e.g., viral vector, AAV vector) is administered to the CNS, the peripheral nervous system, or both. In some embodiments, the viral vector is administered directly to the CNS, e.g., the brain or spinal cord. Direct administration can result in high specificity of transduction of CNS cells, e.g., at least 80%, 85%, 90%, 95%, or more of the transduced cells are CNS cells. Any method known in the art for directly administering a vector to the CNS can be used. The vector can be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary, substantia nigra, pineal), cerebellum, telencephalon (cerebrum, including striatum, occipital, temporal, parietal and frontal lobes, cerebral cortex, basal ganglia, hippocampus, and amygdala), limbic system, neocortex, striatum, cerebrum, and inferior colliculus. The vector can also be administered to various regions of the eye, such as the retina, cornea, or optic nerve. The vector can be delivered to the cerebrospinal fluid (eg, by lumbar puncture) for more disperse administration of the vector.

[0163] The vector (e.g., viral vector, AAV vector) containing the expression cassette may be administered to the desired region of the CNS by any route known in the art, including, but not limited to, intrathecal, intracerebral, intraventricular, intracisternal, intraparenchymal, intranasal, intraaural, intraocular (e.g., intravitreal, subretinal, anterior chamber), and periocular (e.g., sub-Tenon's area) delivery, or any combination thereof.

[0164] Vectors can be administered in a manner that results in broader, diffuse transduction of tissues, including the CNS, peripheral nervous system, and / or other tissues.

[0165] Typically, the vector (e.g., viral vector, AAV vector) containing the expression cassette will be administered in a liquid formulation by direct injection (e.g., stereotactic injection) into the desired area or compartment in the CNS and / or other tissue. In some embodiments, the vector can be delivered via a reservoir and / or pump. In other embodiments, the vector can be provided by topical application to the desired area or by intranasal administration of an aerosol formulation. Administration to the eye or into the ear can be by topical application of liquid drops. As a further alternative, the vector can be administered as a solid sustained release formulation. Controlled release of parvovirus and AAV vectors is described by International Publication WO01 / 91803.

[0166] Injectables can be prepared in conventional form, as liquid solution or suspension, solid form suitable for dissolving or suspension before injection, or as emulsion.Alternatively, viral vectors can be administered in a local rather than systemic manner, for example, in depot or sustained release formulations.Furthermore, viral vectors can be delivered dry in surgically implantable matrices such as bone graft substitutes, sutures, stents, etc. (e.g., as described in U.S. Patent No. 7,201,898).

[0167] Pharmaceutical compositions suitable for oral administration may be presented in discrete units such as capsules, cachets, drops, or tablets, each containing a predetermined amount of the composition of the present invention; as powders or granules; as solutions or suspensions in aqueous or non-aqueous liquids; or as oil-in-water or water-in-oil emulsions. Oral delivery may be performed by complexing the viral vector of the present invention with a carrier that can withstand degradation by digestive enzymes in the animal's intestines. Examples of such carriers include plastic capsules or tablets, as known in the art. Such formulations are prepared by any suitable method of pharmacy, including the step of bringing the composition into association with a suitable carrier, which may contain one or more accessory ingredients as noted above. In general, pharmaceutical compositions according to embodiments of the present invention are prepared by uniformly and intimately mixing the composition with a liquid or finely divided solid carrier, or both, and then shaping the resulting mixture, if necessary. For example, a tablet may be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients. Compressed tablets are prepared by compressing in a suitable machine the composition in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, and / or surfactant / dispersant. Molded tablets are made by molding in a suitable machine the powdered compound moistened with an inert liquid binder.

[0168] Pharmaceutical compositions suitable for buccal (sublingual) administration include lozenges comprising the composition of the invention in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia.

[0169] Pharmaceutical compositions suitable for parenteral administration may include sterile aqueous and non-aqueous injection solutions of the compositions of the present invention, the preparations being optionally isotonic with the blood of the intended recipient. These preparations may contain antioxidants, buffers, bacteriostats, and solutes that render the compositions isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions, and emulsions may include suspending agents and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose, and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.

[0170] The compositions may be presented in unit / dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example saline or water for injections, immediately prior to use.

[0171] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type previously described. For example, an injectable, stable, sterile composition of the present invention in a unit dosage form in a sealed container can be provided. The composition can be provided in the form of a lyophilizate, which can be reconstituted with a suitable pharma-ceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be about 1 μg to about 10 grams of the composition of the present invention. If the composition is substantially water-insoluble, a sufficient amount of emulsifying agent that is physiologically acceptable can be included in a sufficient quantity to emulsify the composition in an aqueous carrier. One such useful emulsifying agent is phosphatidylcholine.

[0172] Pharmaceutical compositions suitable for rectal administration may be presented as unit-dose suppositories. These may be prepared by admixing the composition with one or more conventional solid carriers, such as cocoa butter, and then shaping the resulting mixture.

[0173] The pharmaceutical composition of the present invention suitable for topical application to skin can take the form of ointment, cream, lotion, paste, gel, spray, aerosol, or oil.The carrier that can be used includes, but is not limited to, Vaseline, lanolin, polyethylene glycol, alcohol, transdermal enhancer, and combinations of two or more thereof.In some embodiments, for example, topical delivery can be carried out by mixing the pharmaceutical composition of the present invention with a lipophilic agent (e.g., DMSO) that can enter the skin.

[0174] Pharmaceutical compositions suitable for transdermal administration may be in the form of individual patches adapted to remain in intimate contact with the epidermis of a subject for extended periods of time.Compositions suitable for transdermal administration may also be delivered by iontophoresis (see, for example, Pharm.Res.3:318 (1986)), typically taking the form of an optionally buffered aqueous solution of the composition of the present invention.Suitable formulations may include citric acid or bis / tris buffer (pH 6) or ethanol / water, and may contain 0.1-0.2M of active ingredient.

[0175] The viral vectors disclosed herein can be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles composed of the viral vector, which the subject inhales. The respirable particles can be liquid or solid. The aerosol of liquid particles containing the viral vector can be generated by any suitable means, such as using a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as known to those skilled in the art. See, for example, U.S. Patent No. 4,501,729. The aerosol of solid particles containing the viral vector can be generated in the same manner using any solid particulate medicinal aerosol generator, by techniques known in the pharmaceutical arts.

[0176] The invention may be as defined in any one of the following numbered clauses. 1. A polynucleotide comprising a human UBE3A open reading frame, said human UBE3A open reading frame encoding a short and a long isoform of human UBE3A. 2. The polynucleotide of paragraph 1, wherein said human UBE3A open reading frame encodes a short isoform (ie, isoform 1) and a long isoform 2 of human UBE3A. 3. The polynucleotide of paragraph 1, wherein said human UBE3A open reading frame encodes the short isoform (ie, isoform 1) and the long isoform 3 of human UBE3A. 4. The polynucleotide of any one of paragraphs 1 to 3, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that reduce expression of the long isoform compared to expression of a native ORF lacking said expression-reducing nucleotide modification(s). 5. The polynucleotide of clause 4, wherein said expression of said long isoform is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a native ORF that does not contain an expression-reducing nucleotide modification. 6. The polynucleotide of any one of paragraphs 1 to 5, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that enhance expression of the short isoform (e.g., enhance expression by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more) compared to a native ORF that does not comprise the expression-enhancing nucleotide modifications. 7. The polynucleotide of paragraph 6, wherein said expression of said short isoform is enhanced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a native ORF that does not contain an expression-enhancing nucleotide modification. 8. The polynucleotide of any one of paragraphs 1 to 7, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that encode expression of the short isoform at a ratio of about 1:1 to about 15:1 compared to expression of the long isoform. 9. The polynucleotide of any one of clauses 1 to 8, comprising a first Kozak sequence comprising SEQ ID NO:6, operably linked to a coding sequence for said long isoform. 10. The polynucleotide of any one of clauses 1 to 9, comprising a second Kozak sequence comprising SEQ ID NO:8, operably linked to the coding sequence for said short isoform. 11. The polynucleotide of any one of paragraphs 1 to 10, wherein the human UBE3A open reading frame is codon-optimized for expression in a human cell. 12. The polynucleotide of paragraph 12, wherein the human UBE3A open reading frame is codon-optimized for intracellular or non-secretory expression in human cells. 13. The polynucleotide of any one of paragraphs 1 to 12, wherein the human UBE3A open reading frame comprises the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:25, or SEQ ID NO:26, or a nucleotide sequence having at least about 70%, 75%, 76%, 77%, 80%, 85%, or 90% identity thereto. 14. An expression cassette comprising the polynucleotide of any one of paragraphs 1 to 13. 15. The expression cassette of claim 14, wherein the human UBE3A open reading frame is operably linked to a promoter. 16. The expression cassette of claim 15, wherein the promoter is a neuron-specific promoter. 17. The expression cassette of claim 15 or 16, wherein the promoter is a human synapsin promoter. 18. The expression cassette of any one of paragraphs 14 to 17, wherein said human UBE3A open reading frame is operably linked to a polyadenylation signal. 19. The expression cassette of claim 18, wherein said polyadenylation signal is the bovine growth hormone (bGH) polyadenylation signal (bGHpA). 20. The expression cassette of any one of clauses 14 to 19, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR). 21. The expression cassette of claim 20, wherein said expression cassette comprises two AAV ITRs. 22. The expression cassette of claim 21, wherein the AAV ITRs are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13 ITRs. 23. The expression cassette of claim 22, wherein said AAV ITRs are AAV2 ITRs. 24. The expression cassette of any one of clauses 14 to 23, which is a single-stranded AAV genome. 25. An expression cassette according to any one of paragraphs 14 to 24, comprising a promoter, the human UBE3A open reading frame, and a polyadenylation site. 26. An expression cassette according to any one of clauses 14 to 25, comprising an AAV ITR, a promoter, the human UBE3A open reading frame, a polyadenylation site and an AAV ITR. 27. The expression cassette of any one of clauses 14 to 26, comprising an AAV2 ITR, a human synapsin promoter, the human UBE3A open reading frame comprising the short isoform and long isoform 2 of human UBE3A, bGHpA, and an AAV2 ITR. 28. The expression cassette of any one of clauses 14 to 26, comprising an AAV2 ITR, a human synapsin promoter, the human UBE3A open reading frame comprising the short and long isoforms 3 of human UBE3A, bGHpA, and an AAV2 ITR. 29. The expression cassette of any one of clauses 14 to 28, comprising: AAV2 ITR; a human synapsin promoter; a human UBE3A open reading frame comprising the short and long isoforms 2 of human UBE3A, further comprising one or more Kozak sequences comprising, consisting essentially of, or consisting of SEQ ID NO:6 and / or SEQ ID NO:8; bGHpA; and an AAV2 ITR. 30. The expression cassette of any one of clauses 14 to 28, comprising: AAV2 ITR; a human synapsin promoter; a human UBE3A open reading frame comprising the short and long isoforms 3 of human UBE3A, further comprising one or more Kozak sequences comprising, consisting essentially of, or consisting of SEQ ID NO:6 and / or SEQ ID NO:8; bGHpA; and an AAV2 ITR. 31. The expression cassette of clause 30, comprising the nucleotide sequence of SEQ ID NO: 14 or a sequence at least about 90% identical thereto. 32. A vector comprising the polynucleotide of any one of clauses 1 to 13, or the expression cassette of any one of clauses 14 to 31. 33. The vector of paragraph 32, which is a neurotropic vector. 34. The vector of paragraph 32 or paragraph 33, which is a viral vector. 35. The vector of paragraph 34, which is an AAV vector. 36. The vector of paragraph 34, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and combinations thereof. 37. The vector of paragraph 35, wherein said AAV vector is AAV9 or an AAV9-derived vector. 38. The vector of paragraph 37, wherein the AAV9-derived vector is PHP.B, PHP.eB, or AAV9.HR. 39. A transformed cell comprising a polynucleotide of any one of paragraphs 1 to 13, an expression cassette of any one of paragraphs 14 to 31, and / or a vector of any one of paragraphs 32 to 38. 40. The transformed cell of paragraph 39, wherein the polynucleotide, expression cassette, and / or vector is stably integrated into the genome of the cell. 41. A transgenic animal comprising a polynucleotide of any one of paragraphs 1 to 13, an expression cassette of any one of paragraphs 14 to 31, a vector of any one of paragraphs 32 to 38, and / or a transformed cell of paragraph 39 or 40. 42. A pharmaceutical composition comprising a polynucleotide of any one of clauses 1 to 13, an expression cassette of any one of clauses 14 to 31, a vector of any one of clauses 32 to 38, and / or a transformed cell of clause 39 or 40 in a pharma- ceutically acceptable carrier. 43. A method for expressing a UBE3A open reading frame in a cell, comprising the step of contacting a cell with a polynucleotide of any one of clauses 1 to 13, an expression cassette of any one of clauses 14 to 31, and / or a vector of any one of clauses 32 to 38, thereby expressing the UBE3A open reading frame in the cell. 44. A method for expressing a UBE3A open reading frame in a subject, comprising the step of delivering to a subject a polynucleotide of any one of paragraphs 1 to 13, an expression cassette of any one of paragraphs 14 to 31, a vector of any one of paragraphs 32 to 38, and / or a transformed cell of paragraph 39 or 40, thereby expressing the UBE3A open reading frame in the subject. 45. A method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a polynucleotide of any one of paragraphs 1 to 13, an expression cassette of any one of paragraphs 14 to 31, a vector of any one of paragraphs 32 to 38, and / or a transformed cell of paragraph 39 or 40, whereby the UBE3A open reading frame is expressed in the subject. 46. ​​The method of claim 45, wherein the disorder associated with expression of the UBE3A gene is Angelman syndrome. 47. A method of treating Angelman syndrome in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a polynucleotide of any one of paragraphs 1 to 13, an expression cassette of any one of paragraphs 14 to 31, a vector of any one of paragraphs 32 to 38, and / or a transformed cell of paragraph 39 or 40, whereby the UBE3A open reading frame is expressed in said subject. 48. The method of any one of paragraphs 43 to 47, wherein the short isoform of human UBE3A is expressed at a ratio of about 1:1 to about 15:1 compared to the expression of the long isoform. 49. The method of any one of clauses 44 to 48, wherein the subject exhibits symptoms of the disease prior to delivery of the polynucleotide, expression cassette, vector, and / or transformed cell. 50. The method of any one of paragraphs 44 to 49, wherein the polynucleotide, expression cassette, vector and / or transformed cell is delivered intrauterinely. 51. The method of any one of clauses 44 to 50, wherein the subject is a human. 52. The method of any one of paragraphs 44 to 51, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered to the nervous system of the subject. 53. The AAV vector has at least about 10 2 , 10 3 , 10 4 , 10 5, 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , or 10 16 Viral genomes / kilogram, optional 10 8 ~10 14 53. The method of any one of clauses 44 to 52, wherein the dose of viral genomes / kilogram is administered to said subject. 54. The method of paragraph 52, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intravenously. 55. The method of paragraph 52, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered by intrathecal, intracerebral, intracisternal, intraparenchymal, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof. 56. The method of paragraph 55, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intrathecally. 57. The method of claim 55, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intraventricularly.

[0177] Having described the invention, it will be further described in the following examples, which are included herein for illustrative purposes only and are not intended to limit the invention. EXAMPLES

[0178] [Example 1] Generation of human UBE3A codon-optimized constructs for intracellular expression A novel Angelman syndrome therapy was designed that allows for co-delivery of both short and long UBE3A isoforms (e.g., human isoforms 1 (also known as "short") and 3 (also known as "long")) at an appropriate expression ratio, referred to herein as PHP.B / SYN-UBE3A incorporating the open reading frame (ORF) hUBE3A_isoform1>>3. This is a significant technical advantage, since viral vector packaging limitations normally allow expression of only one isoform. This construct overcomes two main challenges: (1) widespread brain-wide delivery of UBE3A; and (2) avoidance of UBE3A overexpression, which may be associated with a syndromic form of autism (Dup15q syndrome). AAV9-derived capsids can broadly transduce neurons throughout the brain when delivered during early childhood. Although there are other AAV capsids that may allow for even broader gene transfer in non-human primate and human brains, care was taken to choose the AAV9-derived capsid to limit UBE3A overexpression.

[0179] In addition, this construct differs from work performed in other laboratories in that it was created to express intracellular (e.g., cytoplasmic and / or nuclear) UBE3A and does not contain an exogenously added secretion signal, thereby preventing extracellular expression of UBE3A and the production of its secreted form. While not wishing to be bound by theory, such manipulation of UBE3A resulting in secreted UBE3A is believed to remove the ability to regulate the expression of appropriate levels of UBE3A, which may lead to dangerous overexpression. Overexpression of UBE3A may be associated with Dup15q syndrome, a syndromic form of autism. Secreted UBE3A may also lose cell type specificity of UBE3A expression or regulation of biodistribution, as well as have altered post-translational modifications and / or altered and / or expanded substrate interactions for its ligase activity. In this regard, it is believed that UBE3A products produced from the constructs described herein will produce better results than previously reported.

[0180] FIG. 3B shows a schematic of the 5' vector DNA sequence (SEQ ID NO:20) (top) and protein (SEQ ID NO:21) (bottom) of the Kozak optimization of the codon-optimized hUBE3A1>>3 open reading frame for vector design to achieve biased expression of the short human UBE3A (hUBE3A) isoform. Both long and short hUBE3A are encoded in the same reading frame. The second start codon (AGCAGG ATG Kozak sequences of various strengths were engineered to bias translation initiation from the ribosome-specific ribosome (SEQ ID NO:25; Fig. 3B and Fig. 3C).

[0181] The AS mouse model in which mice show complete loss of all UBE3A isoforms in neurons (Ube3a m- / p+ ) to examine the expression characteristics of the construct (Figure 4; Jiang et al., Neuron, 1998:21(4):799-811). 11The AAV9-derived variant viral vector PHP.B / SYN-hUBE3A of viral genome (vg) was injected intracerebroventricularly (ICV) and collected at various time points for complementary analysis of mRNA and protein expression. Figure 5 shows that the hUBE3A transcript expressed from the construct can be selectively detected among endogenous mRNA in treated subjects due to the presence of unique nucleotide sequences introduced by codon optimization. This aspect of the construct design can be exploited to faithfully follow the biodistribution of PHP.B / SYN-hUBE3A, thereby facilitating the optimization of biodelivery strategies in mice, non-human primates, and ultimately humans. It was found that the hUBE3A transcript encoded by the design can express both short and long hUBE3A protein isoforms, as shown by the Western blotting experiment in Figure 6. Importantly, the ratio of short to long hUBE3A was 3:1, approaching the 4:1 ratio previously observed for endogenous mouse UBE3A isoforms (Avagliano et al., Nat Neurosci, 2019:22(8):1235-1247), demonstrating the feasibility of construct design to achieve desired hUBE3A isoform ratios by engineering Kozak sequence strength.

[0182] Figure 7A demonstrates successful delivery of hUBE3A_isoform1>>3 product into neonatal AS model mice, as evidenced by UBE3A immunohistochemistry (IHC) performed on postnatal days P10, P15, and P25. Closer examination of brain structures and co-staining for UBE3A with the neuronal marker NeuN showed near-perfect co-localization, indicating highly efficient transduction of neurons with PHP.B / SYN-UBE3A (Figure 7B). UBE3A protein showed prominent nuclear localization consistent with the predominant expression of the short hUBE3A isoform. Arrows indicate rare hippocampal neurons in which UBE3A was not re-expressed, indicating that most neurons in the cortex and hippocampus express hUBE3A_isoform1>>3 product.

[0183] Qualitative assessment demonstrated effective reintroduction of UBE3A isoforms into the developing brain at appropriate levels and following endogenous patterns of subcellular localization, with hUBE3A exhibiting a cytoplasmic to nuclear shift in subcellular localization following gene transfer (Figure 8 Panels A-F). Figure 8 Panels A-C show UBE3A stained layer 2 / 3 neocortex from AS model mice at P10 (Panel A), P15 (Panel B), and P25 (Panel C) following ICV injection of PHP.B / hUBE3A virus at P1. As shown in Panels D-F from Judson et al., J Comparative Neurology, 2014:522(8):1874-1896, a graded accumulation of virally transduced hUBE3A in the nucleus was seen across development, faithfully recapitulating the spatiotemporal pattern of endogenous UBE3A expression.

[0184] [Example 2] Engineering a human UBE3A codon-optimized construct to restore anatomical and behavioral phenotypes in AS model mice Figure 9 shows that PHP.B / hUBE3A was generally well tolerated in both WT and AS model mice, as demonstrated by equivalent body weights in gene therapy treatment groups (WT+AAV and AS+AAV) and vehicle-treated WT controls (WT+vehicle) at 1 month of age. Vehicle-treated AS mice gained weight excessively into adulthood, consistent with both previous reports (Judson et al., J Neurosci, 2017:37(31):7347-7361) and clinical observations of adult-onset obesity in AS individuals (Bindels-de Heus et al., Am J Med Genet A, 2020:182(1):53-63). This phenotype was fully rescued by PHP.B / hUBE3A treatment in the AS+AAV group.

[0185] Further testing of the ability of neonatal ICV PHP.B / hUBE3A treatment to rescue AS mouse model defects with high penetrance and reproducibility was pursued (Figure 10, Panel A; Rotaru et al., Neuroscience, 2020: Epub ahead of print). Figure 10, Panel B shows a trend of hypolocomotion in AS+vehicle mice that was unaffected by gene therapy treatment. AS+vehicle and AS+AAV exhibited similarly poor performance in the first trial of the rotarod task, suggesting that a certain level of motor dysfunction in AS may be insensitive to neonatal ICV PHP.B / hUBE3A treatment. However, repeated rotarod testing revealed a restoration of motor learning and plasticity capabilities in AS+AAV mice, which enhanced motor performance over successive acquisition trials and sustained it near control levels over time (Figure 10, Panel C).

[0186] Innate behaviors, including burrowing and nest building, are also known to be severely deficient in AS mice (Rotaru et al., Neuroscience, 2020: Epub ahead of print). Figure 10, panels D and E, show that these phenotypes are recapitulated in AS+vehicle mice, as evidenced by the poor performance of AS+vehicle mice compared to WT+vehicle controls in the well-established marble burying and nest building assays. The penetrance of these phenotypes was greatly reduced in the AS+AAV group, with many individual subjects performing the task at control levels. Nevertheless, there was a small subset of poor AS+AAV responders, which was particularly noticeable in the spread of marble burying data. These results warrant careful post-hoc analysis of hUBE3A biodistribution to ensure that the true efficacy of the treatment is not underestimated due to poor injection targeting or spread, technical errors that derail measurements of behavioral rescue.

[0187] Figure 11 shows evidence of severe epileptogenesis in AS+vehicle mice as revealed by flurothyl seizure kindling and rechallenge. This result is consistent with findings from a previous study (Gu et al., J Clin Invest, 2018:129(1):163-168), in which AS mice exhibited a similarly enhanced sensitivity to flurothyl re-exposure one month after kindling. Furthermore, the excessive epileptogenesis in AS mice was amenable to rescue by tamoxifen-induced reinstatement of UBE3A during postnatal development, and thus neonatal ICV PHP.B / hUBE3A treatment rendered AS+AAV mice resilient to flurothyl rechallenge (Figure 11, Panel B).

[0188] Anatomical and physiological changes to brain circuits define epileptogenesis. AS mice kindled with flurothyl show enhanced deposition of perineuronal nets (PNNs) in the hippocampus, specifically in the molecular layer of the dentate gyrus (Gu et al., J Clin Invest, 2018:129(1):163-168). Figure 12, panel A shows that this abnormal PNN phenotype was also penetrant in AS+vehicle mice, but fully rescued in AS+AAV mice. Reactive astrogliosis is another hallmark of epileptogenic foci. Figure 12, panel B shows that there was a dramatic increase in strongly GFAP-stained astrocytes in the hippocampus of AS+vehicle mice, which was found to be completely normalized in the AS+AAV group. Collectively, these studies provide supportive evidence that neonatal ICV PHP.B / hUBE3A treatment can be highly effective in improving seizure outcomes in AS.

[0189] WT+AAV mice served as a de facto test for the tolerability of UBE3A overexpression in these studies. In most cases, WT+AAV and WT+vehicle group performance was comparable, suggesting that UBE3A overexpression produced by PHP.B / hUBE3A treatment was relatively well tolerated. However, WT+AAV mice were found to be moderately hyperlocomotive (Figure 10, panel B), and they underperformed slightly in the marble burying task (Figure 10, panel D). Thus, certain behaviors and underlying neural circuits may potentially be more vulnerable to UBE3A overexpression than others.

[0190] [Example 3] Construct processing in human-derived cells in vitro and in vivo The constructs described in Example 1 will be delivered in vitro to patient-derived iPSCs that have differentiated into neurons and exhibit an AS cell phenotype. The recipient cells will then be observed for restoration of the characteristic AS cell phenotype compared to appropriate control cells that have not received the construct.

[0191] AS iPSC lines can be generated from patient peripheral skin or blood cells rendered pluripotent by retroviral or lentiviral vectors expressing key transcription factors OCT4, SOX2, KLF4, MYC, and LIN28 (Takahashi et al., Cell, 2007:131:861-872; Sommer et al., Stem Cells, 2008:27:543-549). In some preparations, CRISPR / Cas9 editing can be used to introduce AS-causing UBE3A deletions into iPSCs derived from neurotypical patients, thus generating novel AS iPSC lines with associated isogenic controls. AS iPSCs can be differentiated into neurons using neural induction medium containing supplements and nerve growth factors according to established protocols (Chamberlain et al., Proc. Natl. Acad. Sci., 2010:107:17668-17673).

[0192] Patient-derived AS neurons have been shown to exhibit characteristically delayed maturation of electrophysiological properties, including hyperpolarization of resting membrane potential and action potential firing, which are amenable to rescue by paternally derived UBE3A unsilencing with pharmacological agents (Fink et al., Nat. Comm., 2017:Apr 24;8:15038). Similarly, constructs will be delivered to patient-derived AS neurons (in vitro and in vivo) to restore the correct delay in hUBE3A expression and electrophysiological maturation. For proof-of-concept treatments in non-human primates and humans, constructs will be delivered in an early intervention phase (e.g., <2 years of age) in 1-3 patients, with dose escalation as needed based on safety and efficacy studies. Clinical benefit and safety will be evaluated (e.g., compared to appropriate controls).

[0193] The foregoing examples are illustrative of the present invention and should not be construed as limiting thereof. Although the present invention has been described in detail with reference to preferred embodiments, variations and modifications are within the scope and spirit of the invention as described and defined in the following claims. The claims at the time of filing are as follows: [Claim 1] A polynucleotide comprising a human UBE3A open reading frame, said human UBE3A open reading frame encoding a short and a long isoform of human UBE3A. [Claim 2] The polynucleotide of claim 1, wherein the human UBE3A open reading frame encodes a short isoform (i.e., isoform 1) and a long isoform 2 of human UBE3A. [Claim 3] The polynucleotide of claim 1, wherein the human UBE3A open reading frame encodes a short isoform (i.e., isoform 1) and a long isoform 3 of human UBE3A. [Claim 4] 4. The polynucleotide of any one of claims 1 to 3, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that reduce expression of the long isoform compared to expression of a native ORF lacking said one or more nucleotide modifications that reduce expression. [Claim 5] 5. The polynucleotide of claim 4, wherein the expression of the long isoform is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a native ORF that does not contain an expression-reducing nucleotide modification. [Claim 6] The polynucleotide of any one of claims 1 to 5, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that enhance expression of the short isoform (e.g., enhance expression by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more) compared to a native ORF that does not comprise the expression-enhancing nucleotide modifications. [Claim 7] The polynucleotide of claim 6, wherein the expression of the short isoform is enhanced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a native ORF that does not contain an expression-enhancing nucleotide modification. [Claim 8] 8. The polynucleotide of claim 1, wherein the human UBE3A open reading frame comprises one or more nucleotide modifications that encode expression of the short isoform at a ratio of about 1:1 to about 15:1 compared to expression of the long isoform. [Claim 9] 9. The polynucleotide of any one of claims 1 to 8, comprising a first Kozak sequence comprising SEQ ID NO:6, operably linked to a coding sequence for the long isoform. [Claim 10] 10. The polynucleotide of any one of claims 1 to 9, comprising a second Kozak sequence comprising SEQ ID NO:8, operably linked to the coding sequence for the short isoform. [Claim 11] 11. The polynucleotide of claim 1, wherein the human UBE3A open reading frame is codon-optimized for expression in a human cell. [Claim 12] The polynucleotide of claim 12, wherein the human UBE3A open reading frame is codon-optimized for intracellular or non-secretory expression in human cells. [Claim 13] 13. The polynucleotide of any one of claims 1 to 12, wherein the human UBE3A open reading frame comprises the nucleotide sequence of SEQ ID NO:9, SEQ ID NO:26, or SEQ ID NO:27, or a nucleotide sequence having at least about 70%, 75%, 76%, 77%, 80%, 85%, or 90% identity thereto. [Claim 14] 14. An expression cassette comprising a polynucleotide according to any one of claims 1 to 13. [Claim 15] The expression cassette of claim 14, wherein the human UBE3A open reading frame is operably linked to a promoter. [Claim 16] 16. The expression cassette of claim 15, wherein the promoter is a neuron-specific promoter. [Claim 17] 17. The expression cassette of claim 15 or 16, wherein the promoter is a human synapsin promoter. [Claim 18] 18. The expression cassette of claim 14, wherein the human UBE3A open reading frame is operably linked to a polyadenylation signal. [Claim 19] 19. The expression cassette of claim 18, wherein the polyadenylation signal is the bovine growth hormone (bGH) polyadenylation signal (bGHpA). [Claim 20] 20. The expression cassette of any one of claims 14 to 19, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR). [Claim 21] 21. The expression cassette of claim 20, wherein the expression cassette comprises two AAV ITRs. [Claim 22] 22. The expression cassette of claim 21, wherein the AAV ITRs are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13 ITRs. [Claim 23] 23. The expression cassette of claim 22, wherein the AAV ITRs are AAV2 ITRs. [Claim 24] 24. An expression cassette according to any one of claims 14 to 23, which is a single-stranded AAV genome. [Claim 25] 25. An expression cassette according to any one of claims 14 to 24, comprising a promoter, the human UBE3A open reading frame, and a polyadenylation site. [Claim 26] 26. The expression cassette of any one of claims 14 to 25, comprising an AAV ITR, a promoter, the human UBE3A open reading frame, a polyadenylation site, and an AAV ITR. [Claim 27] 27. The expression cassette of any one of claims 14 to 26, comprising an AAV2 ITR, a human synapsin promoter, a human UBE3A open reading frame comprising the short isoform and long isoform 2 of human UBE3A, bGHpA, and an AAV2 ITR. [Claim 28] 27. The expression cassette of any one of claims 14 to 26, comprising an AAV2 ITR, a human synapsin promoter, a human UBE3A open reading frame comprising the short and long isoforms 3 of human UBE3A, bGHpA, and an AAV2 ITR. [Claim 29] 29. The expression cassette of any one of claims 14 to 28, comprising: AAV2 ITR; a human synapsin promoter; a human UBE3A open reading frame comprising the short and long isoforms 2 of human UBE3A, further comprising one or more Kozak sequences comprising, consisting essentially of, or consisting of SEQ ID NO:6 and / or SEQ ID NO:8; bGHpA; and an AAV2 ITR. [Claim 30] 29. The expression cassette of any one of claims 14 to 28, comprising: AAV2 ITR; a human synapsin promoter; a human UBE3A open reading frame comprising the short and long isoforms 3 of human UBE3A, further comprising one or more Kozak sequences comprising, consisting essentially of, or consisting of SEQ ID NO:6 and / or SEQ ID NO:8; bGHpA; and an AAV2 ITR. [Claim 31] 31. The expression cassette of claim 30, comprising the nucleotide sequence of SEQ ID NO: 14 or a sequence that is at least about 90% identical thereto. [Claim 32] 32. A vector comprising a polynucleotide according to any one of claims 1 to 13 or an expression cassette according to any one of claims 14 to 31. [Claim 33] 33. The vector of claim 32, which is a neurotropic vector. [Claim 34] 34. The vector of claim 32 or 33, which is a viral vector. [Claim 35] The vector of claim 34, which is an AAV vector. [Claim 36] The vector of claim 35, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and combinations thereof. [Claim 37] The vector of claim 35, wherein the AAV vector is AAV9 or an AAV9-derived vector. [Claim 38] The vector of claim 37, wherein the AAV9-derived vector is PHP.B, PHP.eB, or AAV9.HR. [Claim 39] 39. A transformed cell comprising a polynucleotide according to any one of claims 1 to 13, an expression cassette according to any one of claims 14 to 31, and / or a vector according to any one of claims 32 to 38. [Claim 40] 40. The transformed cell of claim 39, wherein the polynucleotide, expression cassette, and / or vector is stably integrated into the cell genome. [Claim 41] A transgenic animal comprising a polynucleotide according to any one of claims 1 to 13, an expression cassette according to any one of claims 14 to 31, a vector according to any one of claims 32 to 38, and / or a transformed cell according to claim 39 or 40. [Claim 42] 41. A pharmaceutical composition comprising a polynucleotide according to any one of claims 1 to 13, an expression cassette according to any one of claims 14 to 31, a vector according to any one of claims 32 to 38, and / or a transformed cell according to claim 39 or 40 in a pharma- ceutically acceptable carrier. [Claim 43] A method for expressing a UBE3A open reading frame in a cell, comprising the step of contacting a cell with a polynucleotide described in any one of claims 1 to 13, an expression cassette described in any one of claims 14 to 31, and / or a vector described in any one of claims 32 to 38, thereby expressing the UBE3A open reading frame in the cell. [Claim 44] A method for expressing a UBE3A open reading frame in a subject, comprising the step of delivering to a subject a polynucleotide described in any one of claims 1 to 13, an expression cassette described in any one of claims 14 to 31, a vector described in any one of claims 32 to 38, and / or a transformed cell described in claim 39 or 40, thereby expressing the UBE3A open reading frame in the subject. [Claim 45] A method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of a polynucleotide described in any one of claims 1 to 13, an expression cassette described in any one of claims 14 to 31, a vector described in any one of claims 32 to 38, and / or a transformed cell described in claim 39 or 40, whereby the UBE3A open reading frame is expressed in the subject. [Claim 46] 46. ​​The method of claim 45, wherein the disorder associated with expression of the UBE3A gene is Angelman Syndrome. [Claim 47] 11. A method of treating Angelman syndrome in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a polynucleotide described in any one of claims 1 to 13, an expression cassette described in any one of claims 14 to 31, a vector described in any one of claims 32 to 38, and / or a transformed cell described in claim 39 or 40, whereby the UBE3A open reading frame is expressed in the subject. [Claim 48] 48. The method of any one of claims 43 to 47, wherein the short isoform of human UBE3A is expressed at a ratio of about 1:1 to about 15:1 compared to the expression of the long isoform. [Claim 49] 49. The method of any one of claims 44 to 48, wherein the subject exhibits symptoms of the disease prior to delivery of the polynucleotide, expression cassette, vector, and / or transformed cell. [Claim 50] 50. The method of any one of claims 44 to 49, wherein the polynucleotide, expression cassette, vector and / or transformed cell is delivered intrauterinely. [Claim 51] 51. The method of any one of claims 44 to 50, wherein the subject is a human. [Claim 52] 52. The method of any one of claims 44 to 51, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered to the nervous system of the subject. [Claim 53] The AAV vector comprises at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , or 10 16 Viral genomes / kilogram, optional 10 8 ~10 14 53. The method of any one of claims 44 to 52, wherein the method is administered to the subject in a dose of viral genomes / kilogram. [Claim 54] 53. The method of claim 52, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intravenously. [Claim 55] 53. The method of claim 52, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered by intrathecal, intracerebral, intracisternal, intraparenchymal, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof. [Claim 56] 56. The method of claim 55, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intrathecally. [Claim 57] 56. The method of claim 55, wherein the polynucleotide, expression cassette, vector, and / or transformed cell is delivered intraventricularly.

Claims

1. A polynucleotide comprising a human UBE3A open reading frame, said human UBE3A open reading frame encoding isoform 1 and isoform 3 of human UBE3A; the polynucleotide comprises a first Kozak sequence comprising SEQ ID NO:6 operably linked to a coding sequence for isoform 3, and a second Kozak sequence comprising SEQ ID NO:8 operably linked to a coding sequence for isoform 1; A polynucleotide which lacks a sequence encoding an exogenously added secretion signal.

2. The polynucleotide of claim 1, wherein the human UBE3A open reading frame is codon-optimized for intracellular or non-secretory expression in human cells.

3. 3. The polynucleotide of claim 1 or 2, wherein the human UBE3A open reading frame comprises the nucleotide sequence of SEQ ID NO: 27, or a nucleotide sequence having at least 90% identity thereto.

4. An expression cassette comprising a polynucleotide according to any one of claims 1 to 3.

5. The expression cassette of claim 4 , wherein the human UBE3A open reading frame is operably linked to a promoter and / or a polyadenylation signal.

6. The expression cassette of claim 5 , wherein the promoter is a neuron-specific promoter.

7. 7. The expression cassette of claim 5 or 6, wherein the promoter is a human synapsin promoter.

8. 8. The expression cassette of claim 4, wherein the polyadenylation signal is the bovine growth hormone (bGH) polyadenylation signal (bGHpA).

9. 9. The expression cassette of claim 4, further comprising at least one adeno-associated virus (AAV) inverted terminal repeat (ITR).

10. 10. The expression cassette of claim 9, wherein the expression cassette comprises two AAV ITRs.

11. 11. The expression cassette of claim 10, wherein the AAV ITRs are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13 ITRs.

12. 12. The expression cassette of any one of claims 4 to 11, comprising: AAV2 ITR; a human synapsin promoter; a human UBE3A open reading frame comprising isoform 1 and isoform 3 of human UBE3A, further comprising a first Kozak sequence comprising SEQ ID NO:6, and a second Kozak sequence comprising SEQ ID NO:8; bGHpA; and an AAV2 ITR.

13. 13. The expression cassette of claim 12, comprising the nucleotide sequence of SEQ ID NO: 14 or a sequence at least 90% identical thereto.

14. A vector comprising a polynucleotide according to any one of claims 1 to 3 or an expression cassette according to any one of claims 4 to 13.

15. The vector of claim 14 which is a neurotropic vector.

16. The vector of claim 14 or 15, which is a viral vector.

17. The vector of claim 16 which is an AAV vector.

18. 18. The vector of claim 17, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and any combination or derivative thereof.

19. A transformed cell comprising a polynucleotide according to any one of claims 1 to 3, an expression cassette according to any one of claims 4 to 13, and / or a vector according to any one of claims 14 to 18.

20. 20. The transformed cell of claim 19, wherein the polynucleotide, expression cassette, and / or vector is stably integrated into the cell genome.

21. A pharmaceutical composition comprising a polynucleotide according to any one of claims 1 to 3, an expression cassette according to any one of claims 4 to 13, and / or a vector according to any one of claims 14 to 18, and / or a transformed cell according to claim 19 or 20 in a pharma- ceutically acceptable carrier.

22. A polynucleotide described in any one of claims 1 to 3, an expression cassette described in any one of claims 4 to 13, a vector described in any one of claims 14 to 18, a transformed cell described in claim 19 or 20, and / or a pharmaceutical composition described in claim 21, for use in a method for treating a disorder associated with abnormal expression of the UBE3A gene or abnormal activity of the UBE3A gene product in a subject in need thereof, comprising the step of administering a therapeutically effective amount of the polynucleotide, expression cassette, vector, transformed cell, and / or pharmaceutical composition to the subject, whereby the UBE3A open reading frame is expressed in the subject.

23. 23. The polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition of claim 22, wherein the disorder associated with expression of the UBE3A gene is Angelman syndrome.

24. The polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition of claim 22 or 23, wherein isoform 1 of human UBE3A is expressed at a ratio of 1:1 to 15:1 compared to the expression of isoform 3.

25. 25. The polynucleotide, expression cassette, vector, transformed cell, and / or pharmaceutical composition of any one of claims 22 to 24, wherein the subject exhibits symptoms of a disease prior to delivery of the polynucleotide, expression cassette, vector, transformed cell, and / or pharmaceutical composition.

26. 26. The polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition of any one of claims 22 to 25, wherein the polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition is delivered intrauterinely.

27. 27. The polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition of any one of claims 22 to 26, wherein the subject is a human.

28. 28. The polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition of any one of claims 22 to 27, wherein the polynucleotide, expression cassette, vector, transformed cell and / or pharmaceutical composition is delivered to the nervous system of the subject.

29. The vector comprises at least 10 ２ , 10 ３ , 10 ４ , 10 ５ , 10 ６ , 10 ７ , 10 ８ , 10 ９ , 10 １０ , 10 １１ , 10 １２ , 10 １３ , 10 １４ , 10 １５ , or 10 １６ Viral genomes / kilogram, optionally 10 ８ ~10 １４ 29. The vector of any one of claims 22 to 28, administered to the subject in a dose of viral genomes / kilogram.

30. A vector according to claim 29, a transformed cell comprising the vector according to claim 29, or a pharmaceutical composition comprising the vector according to claim 29, wherein the vector, the transformed cell, and / or the pharmaceutical composition is delivered by intravenous, intrathecal, intracerebral, intracisternal, intraparenchymal, intraventricular, intranasal, intraaural, intraocular, or periocular delivery, or any combination thereof.

Images