Rapamycin derivatives

Abstract

The present disclosure provides 32-deoxo-rapamycin derivatives of formula (I) or pharmaceutically acceptable salts thereof, pharmaceutical compositions and pharmaceutical combinations comprising compounds of formula (I), and methods for making the same. Methods for using compounds of formula (I) or pharmaceutically acceptable salts thereof to treat the diseases and disorders described herein are also provided herein. [Formula 1] TIFF2022514254000093.tif32118

Description

[Technical field]

[0001] Claiming priority This application claims priority from U.S. Patent Application No. 62 / 781,242, filed December 18, 2018, which is incorporated by reference in its entirety.

[0002] The present disclosure provides 32-deoxo-rapamycin derivatives and relates to their preparation and to methods for their use. [Background technology]

[0003] In mammalian cells, the target of rapamycin (mTOR) kinase exists in two distinct multiprotein complexes, termed the mTORC1 and mTORC2 complexes, both of which sense nutrient and energy availability and integrate inputs from growth factors and stress signaling. mTORC1 integrates signals from growth factors and nutrients to control cell growth and metabolism (Laplante M. et al. Cell. (2012) 149(2):274-93) and is the master regulator of protein translation and autophagy. The mTORC1 complex is sensitive to allosteric mTOR inhibitors, such as rapamycin and rapamycin analogs (so-called "rapalogs"). The mode of action of rapamycin and previously produced rapalogs involves the formation of intracellular complexes with FK506-binding proteins, such as FKBP12, FKBP12.6, FKBP13, FKBP25, FKBP51 or FKBP52 (these FKBPs will be referred to herein as "FKBP" or "FKBPs"), followed by binding of the FKBP-rapalog complex to the FRB (FK506-rapamycin binding) domain of mTOR. Marz AM et al. Mol Cell Biol. (2013) 33(7):1357-1367. Such interaction of the FKBP-rapalog complex with TORC1 results in allosteric inhibition by the complex. Rapamycin and rapalogs such as RAD001 (everolimus; Afinitor®) have gained clinical importance by inhibiting the activity of mTORC1, which is associated with both benign and malignant proliferative disorders. Royce MEet al.Breast Cancer(Auckl).(2015)9:73-79;Pleniceanu O.et al.Kidney Int Rep.(2018)3(1):155-159.

[0004] Rapamycin is a known macrolide antibiotic produced by Streptomyces hygoscopius, see e.g., McAlpine, JB, et al., J. Antibiotics (1991) 44:688; Schreiber, SL; et al., J. Am. Chem. Soc. (1991) 113:7433; U.S. Patent No. 3,929,992. The following numbering conventions for rapamycin and its derivatives as used herein are set forth below: [ka]

[0005] Rapamycin is a potent immunosuppressant and has also been shown to have antitumor and antifungal activity.Rapamycin has been shown to be useful in preventing or treating systemic lupus erythematosus, pulmonary inflammation, insulin-dependent diabetes mellitus, skin disorders such as psoriasis, smooth muscle cell proliferation and intimal thickening after vascular injury, adult T-cell leukemia / lymphoma, malignant carcinoma, inflammatory diseases of the heart, anemia, and increased neurite outgrowth.However, its practical use as a medicine is limited by its very low and variable bioavailability.In addition, rapamycin is difficult to formulate, making it difficult to obtain a stable galenic composition.

[0006] In animal models, rapalogs extend life span and delay the onset of age-related diseases. Aging, like other biological processes, is regulated by signaling pathways such as the TOR pathway (herein referred to as "TOR" to include yeast and C. elegans systems) and the mTORC1 pathway in mammals. Modulation of TOR and mTORC1 signaling extends life span and delays the onset of age-related diseases in a wide range of organisms from flies to mammals. For example, inhibition of the TOR pathway by genetic mutation extends life span in yeast, C. elegans and Drosophila, and inhibition of the mTORC1 pathway extends life span in mice (Kaeberlein et al., Science (2005) 310:1193-1196; Kapahi et al., Curr Biol (2004) 14:885-890; Selman et al., Science (2009) 326:140-144; Vellai et al., Nature (2003) 426:620). In addition, the mTORC1 inhibitor rapamycin extends life span in mice, even when given late in life (Harrison et al., Nature (2009) 460 (7253):392-395). These data raise the possibility that drugs targeting the mammalian TOR (mTOR) pathway may have therapeutic effects in aging and age-related diseases in humans. A report of a clinical trial using rapamycin in elderly people was described by M.Leslie in Science, 2013, 342. J.Mannick et al. described in Sci Transl Med. (2014) 6(268):268ra179 that mTOR inhibition improves immune function in elderly people. However, investigators have been cautious about using currently available mTOR inhibitors in clinical trials for human aging due to their side effects (including immunosuppression, cytopenia, stomatitis, gastrointestinal disorders, and interstitial pneumonia).

[0007] Pharmacological inhibition of the mTOR pathway before or shortly after neuronal injury can prevent pathological changes in the animal brain and the development of spontaneous recurrent seizures in an acquired epilepsy model (Zeng et al., The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy; J. Neurosci., (2009) pp. 6964-6972). Therefore, rapamycin and rapalogs may also be of potential value in such indications.

[0008] Rapalogs have been shown to be effective in humans in the setting of liver fibrosis, see e.g., Liver Int. (2014) 34(10):1513-21.

[0009] Mitochondrial myopathy (MM), the most common manifestation of adult-onset mitochondrial disease, exhibits multifaceted tissue-specific stress responses: (1) transcriptional responses involving metabolic cytokines FGF21 and GDF15, (2) remodeling of one-carbon metabolism, and (3) mitochondrial stress response. In Cell Metabolism 26,419-428, August 1, 2017, Khan et al. described these processes as part of an integrated mitochondrial stress response (ISRmt), which is controlled by mTORC1 in skeletal muscle. mtDNA replication defects activate mTORC1, which promotes the integrated mitochondrial stress response through ATF4 activation, inducing de novo nucleotide and serine synthesis, the 1C cycle, and the production of FGF21 and GDF15. Inhibition of mTORC1 with rapamycin downregulated all components of the ISRmt (integrated mitochondrial stress response), ameliorated all MM hallmarks, and even reversed the progression of end-stage MM without induction of mitochondrial biogenesis, so rapamycin and rapalogs may also be of potential value in such indications. Summary of the Invention [Problem to be solved by the invention]

[0010] Thus, there remains a need to provide new mTOR inhibitors that exhibit a suitable balance of potency, stability and bioavailability, making them suitable drug candidates. [Means for solving the problem]

[0011] The compounds of formula (I) are mTORC1 inhibitors and are useful for the treatment of disorders, particularly age-related disorders or diseases and disorders currently approved for treatment with rapalogs. As described herein, the complete reduction of the ketone at C32 and replacement of the C16 methoxy group provides compounds that exhibit a favorable balance of potency, stability and bioavailability.

[0012] Without wishing to be bound by theory, the compound of formula (I) is effective in inhibiting mTORC1 by binding to FKBP12 in situations where FKBP12 levels are sufficient to inhibit mTORC1. The compound of formula (I) may also be effective in inhibiting mTORC1 by binding to FKBP25, FKBP51, and / or FKBP52 in situations where FKBP12 levels are insufficient to inhibit mTORC1, but FKBP25, FKBP51, and / or FKBP52 are sufficient to inhibit mTORC1. Thus, in certain cell types (e.g., and therefore in various possible indications, such as, for example, diseases and disorders described herein), FKBP levels may vary. As a result, RAD001 may be effective in such cell types where the level of FKBP12 is sufficient. However, the compound of formula (I) may be effective in certain cell types where the level of FKBP12 is sufficient or insufficient.

[0013] In one aspect, the present disclosure provides a compound of formula (I): [ka] (where R 1 -OR a and 5-6 membered heteroaryl; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; R 5 is H or C 1~6 is alkyl; R a H, -P(O)(R b )2, -C(O)R c , -C(O)OR c , C 1~6 Alkyl, and C 1~6 hydroxyalkyl; Each R b H and C 1~6 independently selected from the group consisting of alkyl; and Each R c , H, C 1~6 Alkyl, and C 1~6 hydroxyalkyl) or a pharma- ceutically acceptable salt thereof.

[0014] In one embodiment, the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I) or a pharma- ceutically acceptable salt thereof, and one or more pharma- ceutically acceptable carriers.

[0015] In one embodiment, the disclosure provides a pharmaceutical combination comprising a therapeutically effective amount of a compound of formula (I) or a pharma- ceutically acceptable salt thereof and one or more therapeutically active agents.

[0016] In another aspect, the disclosure provides a method of treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutical composition or pharmaceutical combination thereof.

[0017] In another aspect, the disclosure provides a method of treating a disease or disorder in a subject, wherein a target tissue, organ or cell associated with the pathology of the disease or disorder has FKBP12 levels insufficient to inhibit mTORC1, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical composition described herein, or a pharmaceutical combination described herein.

[0018] In one embodiment, the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP51, and / or FKBP52 sufficient to inhibit mTORC1, e.g., compared to rapamycin or RAD001.

[0019] In one embodiment, the compound of formula (I) or a pharma- ceutically acceptable salt thereof may form a complex with FKBP12, FKBP25, FKBP51, and / or FKBP52 to bind to and inhibit mTORC1 more potently than rapamycin or RAD001.

[0020] In one embodiment, higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 results in greater efficacy, for example compared to rapamycin or RAD001.

[0021] In one embodiment, the efficacy of a treatment is determined empirically, for example in comparison to rapamycin or RAD001.

[0022] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject having or determined to have insufficient FKBP12 levels to inhibit mTORC1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical acceptable salt thereof, or a pharmaceutical composition described herein, or a pharmaceutical combination described herein.

[0023] In one embodiment, the subject has, or is determined to have, levels of FKBP12 in a target tissue, organ, or cell associated with the pathology of a disease or disorder that are insufficient to inhibit mTORC1.

[0024] In one embodiment, the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 sufficient to inhibit mTORC1, e.g., compared to rapamycin or RAD001.

[0025] In one embodiment, the efficacy of a treatment is determined empirically, for example in comparison to rapamycin or RAD001.

[0026] In another aspect, the disclosure provides a method of treating a disease or disorder in a subject having or determined to have sufficient FKBP12 levels to inhibit mTORC1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical acceptable salt, or a pharmaceutical composition described herein, or a pharmaceutical combination described herein.

[0027] In another aspect, the disclosure provides a method for treating an age-related disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical composition as described herein or a pharmaceutical combination as described herein.

[0028] In one embodiment, the disease or disorder is sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, brain atrophy (also called dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., frailty), cognitive decline. , tendon stiffness, cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and type II diabetes (including complications resulting from diabetes such as renal failure, blindness and neuropathy).

[0029] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition or pharmaceutical combination thereof, wherein the disorder or disease is - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, e.g. cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress The present invention provides a method, wherein the method is selected from the group consisting of

[0030] In another aspect, the disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical composition described herein or a pharmaceutical combination described herein.

[0031] In one embodiment, the method further comprises a PD-1 / PDL-1 inhibitor.

[0032] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and neck cancer.

[0033] In one embodiment, the disorder is a liver disorder involving fibrotic and / or inflammatory processes, such as liver fibrosis occurring in end stage liver disease, cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis.

[0034] In one embodiment, the disorder is a renal disorder involving fibrotic or inflammatory processes in the kidney, such as renal fibrosis resulting from acute kidney injury leading to chronic kidney disease and diabetic nephropathy.

[0035] In one embodiment, the disorder is a cardiac dysfunction, such as myocardial infarction or cardiac hypertrophy. In one embodiment, the cardiac dysfunction is a systolic and / or diastolic dysfunction. In one embodiment, the cardiac dysfunction is hypertension. In one embodiment, the cardiac dysfunction results in a reduced ejection fraction.

[0036] In one embodiment, the disorder is immunosenescence, which leads to cancer through reduced immune surveillance.

[0037] In one embodiment, the disorder is a cancer, including tumors treated with immunotherapy and tumors previously treated with either rapamycin, RAD001, or another rapalog. In one embodiment, the cancer includes tumors with mutations in the Tsc1 gene or shown to have an activated mTOR pathway, including situations in which the tumor microenvironment is appropriately treated with a rapalog.

[0038] The details of one or more embodiments of the disclosure are set forth herein. Other features, objects, and advantages of the disclosure will become apparent from the drawings, detailed description, examples, and claims. [Brief description of the drawings]

[0039] [Figure 1] Figure 1 shows the X-ray co-crystal structure of FKBP12 and compound 2. The C16 substituent is in the (S)-configuration. [Diagram 2] Figure 2 shows the X-ray co-crystal structure of FKBP12 and compound 29. The C16 substituent is in the (R)-configuration. [Figure 3-1]FIG. 3: FIG. 3A is a line graph showing blood concentrations of RAD001 in rats after intravenous (iv) and oral (po) dosing. Y-axis - blood concentration of RAD001 (nM). X-axis - time of blood collection after administration of RAD001 (h). Data are mean ± standard deviation from 3 rats. FIG. 3B is a line graph showing blood concentrations of Compound 2 in rats after intravenous (iv) and oral (po) dosing. Y-axis - blood concentration of Compound 2 (nM). X-axis - time of blood collection after administration of Compound 2 (h). Data are mean ± standard deviation from 3 rats. [Figure 3-2] (As stated above.) [Figure 4-1] Figure 4: Figures 4A and 4B show that Compound 2 inhibits the mTORC1 pathway in rat liver. Rats were given a single oral dose of Compound 2 at 1, 3, or 10 mg / kg, and liver samples were collected 3 hours after dosing. Vehicle-treated rats were used as controls. Figure 4A shows immunoblot images of phosphorylated (p-) and total (t-) S6 protein in rat livers treated with vehicle or Compound 2 at 1, 3, or 10 mg / kg and analyzed 3 hours after treatment. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) was used as a control for protein loading. The histogram in Figure 4B shows densitometric quantification of p-S6 relative to t-S6. In the histograms depicted in Figure 4B, the average arbitrary values ​​representing the p-S6 / t-S6 ratio are shown above each bar. The X-axis represents the dose (1, 3, or 10 mg / kg) given orally. The Y-axis represents arbitrary units. Six rats were used in each experimental group. Data are the mean ± standard deviation. Data were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test, comparing the means from all groups with the vehicle-treated group. ****P<0.001. [Figure 4-2] (As stated above.) [Figure 5-1]Figure 5: Figures 5A-5D are line graphs showing inhibition of S6K1 (Thr389) in wild type (Figure 5A), FKBP12 knockout (Figure 5B), FKBP12 / 12.6 / 13 / 52 / 51 knockout (Figure 5C), and FKBP12 / 12.6 / 25 / 52 / 51 knockout (Figure 5D) 293T cells after treatment with compound 2 (solid line) or RAD001 (dotted line). Cells were treated in triplicate. The Y-axis represents the percent inhibition compared to S6K1 (Thr389) levels in media and DMSO-treated cells. The X-axis represents the concentration for compound 2 or RAD001. [Figure 5-2] (As stated above.) [Figure 5-3] (As stated above.) [Figure 5-4] (As stated above.) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The compounds disclosed herein are mTORC1 inhibitors useful in the treatment of disorders, particularly age-related disorders or disorders currently approved for treatment using rapalogs such as RAD001.

[0041] definition Unless otherwise indicated, the term "compounds of the disclosure," "compounds of formula (I)," refers to compounds of formula (I), subcompounds (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, (I)-F, exemplified compounds and salts thereof, and all stereoisomers (including diastereoisomers and enantiomers), rotamers, tautomers and isotopically labeled compounds (including deuterium substitutions) and inherently formed moieties.

[0042] The term "therapeutically effective amount" of a compound of the present disclosure refers to an amount of a compound of the present disclosure that will induce a biological or medical response in a subject, such as reducing or inhibiting the activity of an enzyme or protein, or ameliorate a symptom, alleviate a condition, slow or delay disease progression, or prevent a disease. In one embodiment, the term "therapeutically effective amount" refers to an amount of a compound of the present disclosure that, when administered to a subject, is effective to (1) at least partially reduce or ameliorate a condition or disorder or disease that is (i) mediated by the mTOR pathway, or (ii) associated with mTOR activity, or (iii) characterized by mTOR activity (normal or abnormal), or (2) reduce or inhibit the activity of mTOR, or (3) reduce or inhibit the expression of mTOR. In one embodiment, the term "therapeutically effective amount" refers to an amount of a compound of the present disclosure that, when administered to a cell or tissue or non-cellular biological material or medium, is effective to at least partially reduce or inhibit the activity of mTOR, or at least partially reduce or inhibit the expression of mTOR.

[0043] As used herein, the term "subject" refers to primates (e.g., humans, male or female), dogs, cats, rabbits, guinea pigs, pigs, rats, and mice. In some embodiments, the subject is a primate. In other embodiments, the subject is a human.

[0044] As used herein, the terms "administer," "administering," or "administration" refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a compound of the invention or a pharmaceutical composition thereof.

[0045] As used herein, the terms "inhibit," "inhibition," or "inhibiting" refer to the reduction or suppression of a given condition, symptom, or disorder or disease, or a significant decrease in baseline activity for a biological activity or process.

[0046] As used herein, the terms "treat", "treating" or "treatment" of any disease or disorder refer to alleviating the disease or disorder, delaying its onset, remission (i.e., delaying or suppressing the onset of the disease or at least one of its clinical symptoms), or reducing or ameliorating at least one physical parameter or biomarker associated with the disease or disorder, including those that may not be discernible to the patient. In one embodiment, "treatment", "treat" and "treating" require that a sign or symptom of the disease, disorder or condition has occurred or been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease or condition. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of the condition and / or in light of genetic or other susceptibility factors). Treatment may be further continued after symptoms have resolved, for example, to delay or prevent recurrence.

[0047] As used herein, the terms "prevent", "preventing" or "prevention" with respect to any disease or disorder refers to the prophylactic treatment of the disease or disorder or the delay in the onset or progression of the disease or disorder.

[0048] As used herein, an "age-related disease or disorder" refers to any disease or disorder whose incidence in a population or severity in an individual correlates with advancing age. More specifically, an age-related disease or disorder is a disease or disorder whose incidence is at least 1.5 times higher among human individuals over 65 years of age compared to human individuals between 25 and 35 years of age. Examples of age-related disorders include sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., frailty), cognitive decline, tendon stiffness, and cardiac hypertrophy. These include, but are not limited to, cardiac dysfunction such as hypertension, and / or systolic and / or diastolic dysfunction, and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications resulting from diabetes such as renal failure, blindness, and neuropathy).

[0049] As used herein, a subject is "in need of" a treatment if such subject would benefit biologically, medically, or in quality of life from such treatment.

[0050] As used herein, the terms "a," "an," "the," and similar terms used with respect to this disclosure (especially with respect to the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0051] The term "alkyl" refers to a linear or branched saturated hydrocarbon group having 1 to 6 carbon atoms ("C 1~6In some embodiments, an alkyl group has 1 to 5 carbon atoms ("C 1~5 In some embodiments, an alkyl group has 1 to 4 carbon atoms ("C 1~4 In some embodiments, an alkyl group has 1 to 3 carbon atoms ("C 1~3 In some embodiments, an alkyl group has 1 to 2 carbon atoms ("C 1~2 In some embodiments, an alkyl group has 1 carbon atom ("C alkyl"). In some embodiments, an alkyl group has 2 to 6 carbon atoms ("C 2~6 "Alkyl"). C 1~6 Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, isobutyl), pentyl (C5) (e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl, tertiary amyl), and hexyl (C6) (e.g., n-hexyl).

[0052] "Alkylene" refers to a divalent radical of an alkyl group, e.g., -CH2-, -CH2CH2-, and -CH2CH2CH2-.

[0053] "Heteroalkyl" refers to an alkyl group that further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur, located within the parent chain (i.e., inserted between adjacent carbon atoms of the parent chain) and / or at one or more terminal positions of the parent chain. In some embodiments, a heteroalkyl group is a saturated group having 1 to 6 carbon atoms and one or more heteroatoms in the parent chain ("heteroalkyl" refers to an alkyl group that further includes at least one heteroatom ...). 1~6 In some embodiments, a heteroalkyl group is a saturated group having 1 to 5 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 1~5In some embodiments, a heteroalkyl group is a saturated group having 1 to 4 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 1~4 In some embodiments, a heteroalkyl group is a saturated group having 1 to 3 carbon atoms and 1 heteroatom in the parent chain ("heteroC 1~3 In some embodiments, a heteroalkyl group is a saturated group having 1 to 2 carbon atoms and 1 heteroatom in the parent chain ("heteroC 1~2 In some embodiments, a heteroalkyl group is a saturated group having 1 carbon atom and 1 heteroatom ("heteroC1 alkyl"). In some embodiments, a heteroalkyl group is a saturated group having 2-6 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 2~6 "alkyl").

[0054] "Haloalkyl" refers to a substituted alkyl group in which one or more hydrogen atoms are independently replaced by a halogen, such as fluoro, bromo, chloro, or iodo, and includes alkyl moieties in which all hydrogens are replaced by halo (e.g., perfluoroalkyl). In some embodiments, the haloalkyl moiety has 1 to 6 carbon atoms ("C 1~6 In some embodiments, the haloalkyl moiety has 1 to 4 carbon atoms ("C 1~4 In some embodiments, the haloalkyl moiety has 1 to 3 carbon atoms ("C 1~3 In some embodiments, the haloalkyl moiety has 1 to 2 carbon atoms ("C 1~2 Examples of haloalkyl groups include -CF3, -CF2CF3, -CF2CF2CF3, -CCl3, -CH2CH2Cl, -CH2CH2CH2Cl, -CFCl2, -CF2Cl, and the like.

[0055] "Hydroxy C 1~6"Alkyl" refers to an alkyl group substituted with one or more -OH groups. 1~6 Examples of alkyl groups include HO-CH2-, HO-CH2CH2-, and -CH2-CH(OH)CH3.

[0056] "Cycloalkyl" refers to a cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon group having 3 to 12 carbons. In one embodiment, a cycloalkyl is a monocyclic group having 3 to 6 carbons. Cycloalkyl groups can include fused or spiro rings. Fused rings are rings that share a common carbon atom. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, and norbornyl.

[0057] "Cycloalkylalkyl" refers to a (cycloalkyl)-alkyl radical, where cycloalkyl and alkyl are as disclosed herein. The "cycloalkylalkyl" is attached to the parent molecular structure through an alkyl group. In one embodiment, the cycloalkylalkyl moiety is a CcycloalkylC 1~6 In one embodiment, the cycloalkyl alkyl moiety is a C cycloalkyl C 1~6 In one embodiment, cycloalkylalkyl is a C5 cycloalkylC 1~6 In one embodiment, cycloalkylalkyl is a C6 cycloalkylC 1~6 In one embodiment, the cycloalkyl alkyl moiety is a C cycloalkyl C 1~3 In one embodiment, the cycloalkyl alkyl moiety is a C cycloalkyl C 1~3 In one embodiment, cycloalkylalkyl is a C5 cycloalkylC 1~3 In one embodiment, cycloalkylalkyl is a C6 cycloalkylC 1~3 It is an alkyl group.

[0058] "Heteroaryl" refers to a stable aromatic monocyclic or bicyclic ring radical having the specified number of ring atoms and containing one or more heteroatoms individually selected from nitrogen, oxygen, and sulfur. The heteroaryl radical may be bonded via a carbon atom or a heteroatom. In one embodiment, the heteroaryl is a 5- or 6-membered heteroaryl. In one embodiment, the heteroaryl is a 5-membered heteroaryl. In one embodiment, the heteroaryl is a 6-membered heteroaryl. Examples of heteroaryl groups include, but are not limited to, furyl, pyrrolyl, thienyl, pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, triazolyl, tetrazolyl, pyrazinyl, pyridazinyl, pyrimidyl, pyridyl, quinolinyl, isoquinolinyl, indolyl, indazolyl, oxadiazolyl, benzothiazolyl, quinoxalinyl, and the like.

[0059] As used herein, "hydroxy" or "hydroxyl" refers to --OH.

[0060] As used herein, the definition of each term, e.g., alkyl, m, n, etc., when it occurs more than one time in any structure, is intended to be independent of its definition elsewhere in the same structure.

[0061] Definitions of specific functional groups and chemical terms are described in more detail below. Chemical elements are defined in the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75 th Ed., inside cover, and specific functional groups are broadly defined as described therein. Additionally, general principles of organic chemistry and specific functional moieties and reactivities are described in detail in: Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5 thEdition, John Wiley&Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3 rd Edition, Cambridge University Press, Cambridge, 1987.

[0062] Certain compounds of the present disclosure may exist in specific geometric or stereoisomeric forms. For example, if a specific enantiomer of a compound of the present disclosure is desired, the enantiomer may be prepared by asymmetric synthesis or by derivatization with a chiral auxiliary, and the resulting diastereomeric mixture is separated and the auxiliary is cleaved to provide the pure desired enantiomer. Alternatively, if the molecule contains a basic functional group such as amino or an acidic functional group such as carboxyl, diastereomeric salts are formed with a suitable optically active acid or base, followed by separation of the thus formed diastereomers by fractional crystallization or chromatographic methods well known in the art, and the pure enantiomers are subsequently recovered.

[0063] Unless otherwise specified, structures depicted herein are also intended to include the geometric (or configurational) forms of the structure; for example, R and S configurations, Z and E double bond isomers, and Z and E conformational isomers for each asymmetric center. Thus, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the disclosed compounds are within the scope of the disclosure. Unless otherwise specified, all tautomeric forms of the disclosed compounds are within the scope of the disclosure. Moreover, unless otherwise specified, structures depicted herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, replacement of hydrogen by deuterium or tritium or 13C or 14 Compounds having the disclosed structures that include the replacement of a carbon with a C-rich carbon are within the scope of the present disclosure. Such compounds are useful, for example, as analytical tools, probes in bioassays, or as therapeutic agents in accordance with the present disclosure.

[0064] The "enantiomeric excess" or "enantiomeric excess %" of a composition can be calculated using the formula shown below: In the example shown below, the composition contains 90% of one enantiomer, e.g., the S enantiomer, and 10% of the other enantiomer, i.e., the R enantiomer. ee=(90-10) / 100*100%=80%.

[0065] Thus, a composition containing 90% of one enantiomer and 10% of the other enantiomer is said to have an enantiomeric excess of 80%. The compounds or compositions described herein may contain an enantiomeric excess of at least 50%, 75%, 90%, 95%, or 99% for one form of the compound, such as the S enantiomer. In other words, such compounds or compositions contain an enantiomeric excess of the S enantiomer relative to the R enantiomer.

[0066] When a particular enantiomer is preferred, in some embodiments, the enantiomer may be provided substantially free of the corresponding enantiomer and may be referred to as "optically enriched." "Optically enriched," as used herein, means that the compound is made up of a significantly greater proportion of one enantiomer. In some embodiments, the compound is made up of at least about 90% by weight of the preferred enantiomer. In other embodiments, the compound is made up of at least about 95%, 98%, or 99% by weight of the preferred enantiomer. The preferred enantiomer may be isolated from a racemic mixture by any method known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or may be prepared by asymmetric synthesis. See, e.g., Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen, et al., Tetrahedron 33:2725 (1977); Eliel, ELStereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); Wilen, SHTables of Resolving Agents and Optical Resolutions p. 268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972).

[0067] All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "etc.") provided herein is intended merely to further clarify the disclosure and does not create limitations on the scope of the disclosure unless otherwise stated.

[0068] Any resulting stereoisomers can be separated on the basis of the physical chemical differences of the constituents into pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization.

[0069] Any resulting racemates of the final products or of the intermediates can be resolved into their optical antipodes by known methods, for example by separation of their diastereomeric salts obtained with optically active acids or bases and liberating the optically active acidic or basic compounds. In particular, basic moieties can thus be used to resolve the compounds of the present disclosure into their optical antipodes, for example by fractional crystallization of salts formed with optically active acids, for example tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluoyltartaric acid, mandelic acid, malic acid or camphor-10-sulfonic acid. Racemic products can also be resolved by chiral chromatography using a chiral adsorbent, for example high performance liquid chromatography (HPLC).

[0070] The compounds disclosed herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may contain, for example, deuterium ( 2 H), tritium ( 3 H), Carbon 13 ( 13 C), or carbon 14 ( 14 C) and the like. All isotopic variations of the compounds disclosed herein, whether radioactive or not, are intended to be encompassed within the scope of the present disclosure. In addition, all tautomeric forms of the compounds described herein are intended to be within the scope of the present disclosure.

[0071] The term "tautomer" refers to a compound that is an interchangeable form of a particular compound structure and changes with the shift of hydrogen atoms and electrons. Thus, two structures may be in equilibrium through the shift of pi electrons and atoms (generally H). For example, enols and ketones are tautomers because they are rapidly interconverted by treatment with either acid or base. Another example of tautomerism is the aci- and nitro-forms of phenylnitromethane, which are also formed by treatment with acid or base. Tautomeric forms may be relevant to achieving optimal chemical reactivity and biological activity of a compound of interest.

[0072] compound In one aspect, the present disclosure provides a compound of formula (I): [ka] (where R 1 -OR a and 5-6 membered heteroaryl; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; R 5 is H or C 1~6 is alkyl; R a H, -P(O)(R b )2, -C(O)R c , -C(O)OR c , C 1~6 Alkyl, and C 1~6hydroxyalkyl; Each R b H and C 1~6 independently selected from the group consisting of alkyl; and Each R c , H, C 1~6 Alkyl, and C 1~6 hydroxyalkyl) or a pharma- ceutically acceptable salt thereof.

[0073] In one embodiment, R 1 -OR a In one embodiment, R 1 is a 5-6 membered heteroaryl, for example a 5 membered heteroaryl. 1 is hydroxy, [ka] is selected from the group consisting of:

[0074] In one embodiment, R 2 and R 3 each independently represents H or -OR b In one embodiment, R 2 and R 3 are independently H, C 1~6 Alkyl, and -C 0~6 Alkylene-SO2R 4 In one embodiment, R 2 and R 3 are each independently H, hydroxyl, -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 is selected from the group consisting of:

[0075] In one embodiment, the compound is a compound of formula (I) or a pharma- ceutically acceptable salt thereof: R1 is hydroxy, [ka] selected from the group consisting of; R 2 and R 3 are each independently H, hydroxyl, -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; and R 5 is H or C 1~6 In one embodiment, R 2 is H, hydroxyl, or C 1~6 alkyl; and R 3 -C 0~6 Alkylene-SO2R 4 Or -C(O)OR 5 It is.

[0076] In one embodiment, the compound is a compound of formula (I) or a pharma- ceutically acceptable salt thereof: R 1 is hydroxyl; R 2 and R 3 are each independently H and -C 0~6 Alkylene-SO2R 4 is selected from the group consisting of: R 4 is C 1~6 -alkyl. In one embodiment, R 2 and R 3 One of the groups is H and the other is -C 0~6 Alkylene-SO2R 4 It is.

[0077] In one embodiment, the compound has structural formula (I)-A or (I)-B: [ka] It is a compound having the formula:

[0078] In one embodiment, the compound has structural formula (I)-C or (I)-D: [ka] It is a compound having the formula:

[0079] In one embodiment, the compound has structural formula (I)-E or (I)-F: [ka] It is a compound having the formula:

[0080] In one embodiment, the compound or a pharma- ceutically acceptable salt thereof is selected from Table 1:

[0081] [Table 1]

[0082] [Table 2]

[0083] [Table 3]

[0084] [Table 4]

[0085] [Table 5]

[0086]

Table 6

[0087]

Table 7

[0088]

Table 8

[0089]

Table 9

[0090]

Table 10

[0091]

Table 11

[0092]

Table 12

[0093]

Table 13

[0094]

Table 14

[0095]

Table 15

[0096] Pharmaceutically acceptable salts Pharmaceutically acceptable salts of these compounds are also contemplated for use as described herein. As used herein, the term "salt" refers to an acid or base addition salt of a compound of the present disclosure. "Salt" specifically includes "pharmaceutical acceptable salts". The term "pharmaceutical acceptable salts" refers to salts that retain the biological effectiveness and properties of the compounds disclosed herein and are not usually biologically or otherwise undesirable. In many cases, the compounds disclosed herein are capable of forming acid and / or base salts due to the presence of amino and / or carboxyl groups or groups similar thereto.

[0097] Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids.

[0098] Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.

[0099] Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, and the like.

[0100] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.

[0101] Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I-XII of the periodic table, in certain embodiments salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper, with particularly suitable salts including the ammonium, potassium, sodium, calcium, and magnesium salts.

[0102] Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like. Particular organic amines include isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine, and tromethamine.

[0103] In another aspect, the present disclosure provides an ester of acetate, ascorbylates, adipates, aspartates, benzoates, besylates, bromides / hydrobromides, bicarbonates / carbonates, bisulfates / sulfates, camphorsulfonates, caprates, chlorides / hydrochlorides, chlortheophyllonates, citrates, ethanedisulfonates, fumarates, gluceptates, gluconates, glucuronates, glutamates, glutarates, glycolates, hippurates, hydroiodides / iodides, isethionates, lactates, lactobionates, lauryl sulfates, malates, maleates, The present invention provides compounds of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F in the form of an iodate, malonate, mandelate, mesylate, methylsulfate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, polygalacturonate, propionate, sebacate, stearate, succinate, sulfosalicylate, sulfate, tartrate, tosylate, triphenylacetate, trifluoroacetate, or xinafoate salt.

[0104] Pharmaceutical Compositions In another aspect, the present disclosure provides pharmaceutical compositions comprising one or more compounds of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or pharma- ceutically acceptable salts thereof and one or more pharma- ceutically acceptable carriers. The term "pharma- ceutically acceptable carrier" refers to a pharma- ceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulant, involved in carrying or transporting any subject composition or its components. Each carrier must be "acceptable" in the sense of being compatible with the subject composition and its components and not harmful to the patient. Some examples of materials which may serve as pharma- ceutically acceptable carriers include: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) cornstarch; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil. (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solution, and (21) other nontoxic and compatible substances utilized in pharmaceutical preparations.

[0105] The compositions of the present disclosure may be administered orally, parenterally, by inhalation aerosol, topically, rectally, nasally, bucally, vaginally, or via an implanted reservoir. The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. In some embodiments, the compositions of the present disclosure are administered orally, intraperitoneally, or intravenously. Sterile injectable forms of the compositions of the present disclosure may be aqueous or oily suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents, such as, for example, solutions in 1,3-butanediol. Among the acceptable vehicles and solvents that may be used are water, Ringer's solution, and physiological saline solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.

[0106] For this purpose, any bland, fixed oil may be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharma- ceutical acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oils or suspensions may contain long-chain alcohol diluents or dispersants, such as carboxymethylcellulose, or similar dispersing aids commonly used in the preparation of pharma- ceutical acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants, such as Tween®, Spans, and other emulsifiers, or bioavailability enhancers commonly used in the manufacture of pharma- ceutical acceptable solid, liquid, or other dosage forms may also be used for the purpose of formulation.

[0107] The pharma- ceutically acceptable composition of the present disclosure may be orally administered in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions, or liquids.For tablets for oral use, commonly used carriers include lactose and cornstarch.Luminous agents, such as magnesium stearate, are also usually added.For oral administration in capsule form, useful diluents include lactose and dried cornstarch.When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents.Sweeteners, flavorings, or colorings may also be added as needed.

[0108] Alternatively, the pharma- ceutically acceptable compositions of the present disclosure may be administered in the form of suppositories for rectal administration. These can be prepared by mixing the active agent with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and therefore melts in the rectum and releases the agent. Such materials include cocoa butter, beeswax, and polyethylene glycols.

[0109] The pharmaceutically acceptable composition of the present disclosure may also be administered locally, especially when the target of treatment includes areas or organs that are easily accessible by topical application, including diseases of the eye, skin, or lower gastrointestinal tract.Suitable topical formulations are easily prepared for each of these areas or organs.Topical application for the lower gastrointestinal tract can be achieved in a rectal suppository formulation (see above) or in a suitable enema formulation.Topically transdermal patches may also be used.

[0110] For topical application, the pharma- ceutically acceptable composition may be formulated in a suitable ointment containing the active ingredient suspended or dissolved in one or more carriers.Carriers for topical administration of the compounds of the present disclosure include, but are not limited to, mineral oil, liquid paraffin, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax, and water.Alternatively, the pharma-ceutically acceptable composition may be formulated in a suitable lotion or cream containing the active ingredient suspended or dissolved in one or more pharma-ceutically acceptable carriers.Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0111] The pharma- ceutically acceptable compositions of the present disclosure may also be administered by nasal aerosol or inhalation. Such compositions may be prepared according to techniques well known in the art of pharmaceutical formulation, and may be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other conventional solubilizing or dispersing agents. The amount of the compounds of the present disclosure that may be combined with the carrier materials to produce a composition in a single dosage form will vary depending on the host treated, the particular mode of administration. Preferably, the compositions should be formulated so that a dosage of 0.01 to 100 mg / kg body weight / day of the inhibitor can be administered to a patient receiving these compositions.

[0112] isotope labeled compounds The compounds of formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F, or pharma- ceutically acceptable salts thereof, are also intended to represent unlabeled and isotopically labeled forms of the compounds. Isotopically labeled compounds have structures represented by the formulas set forth herein, except that one or more atoms are replaced with an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into the compounds of the present disclosure are, respectively: 2 H, 3 H, 11 C. 13 C. 14 C. 15 N, 18 F 31 P, 32 P, 35 S, 36 Cl, 123 I, 124 I, 125 The present disclosure includes isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as I. The present disclosure includes various isotopically labeled compounds as defined herein, e.g., 3 H and 14 Compounds containing radioactive isotopes such as C or 2 H and 13 This includes compounds in which non-radioactive isotopes such as C exist. Such isotope-labeled compounds are useful for metabolic studies ( 14 C), reaction rate studies (e.g. 2 H or 3 H), detection or imaging techniques such as positron emission tomography (PET) or single photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays, or in radiation treatment of patients. 18 F or labeled compounds may be particularly desirable for PET or SPECT studies. Isotopically labeled compounds of formula (I), (Ia), or (Ib) or pharma- ceutically acceptable salts thereof can generally be prepared by conventional techniques known to those skilled in the art or by processes similar to those described in the examples and preparations presented herein, substituting an appropriate isotopically labeled reagent for the previously used unlabeled reagent.

[0113] In addition, the heavier isotopes, especially deuterium (i.e. 2 Substitution with H or D) may provide certain therapeutic advantages due to better metabolic stability, for example increased half-life in vivo or reduced dosage requirements or improved therapeutic index. It is understood that deuterium in this context is considered a substituent of the compounds of formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F or pharma- ceutically acceptable salts thereof. The concentration of such heavier isotopes, particularly deuterium, may be determined by the isotopic enrichment factor. As used herein, the term "isotopic enrichment factor" refers to the ratio between the isotopic abundance and the natural abundance for a particular isotope. When a substituent in a compound of the disclosure is designated as deuterium, such compound has an isotopic enrichment factor for each designated deuterium of at least 3500 (52.5% deuterium incorporation at each designated deuterium), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation).

[0114] Dosage Toxicity and therapeutic efficacy of the compounds of the present disclosure, including pharma- ceutically acceptable salts and deuterated variants, can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. 50 is the dose lethal to 50% of the population. ED50 is the dose therapeutically effective in 50% of the population. The dose ratio between toxic and therapeutic effects (LD 50 / ED 50) is the therapeutic index. Compounds that exhibit large therapeutic indices are preferred. Compounds that exhibit toxic side effects may also be used, but care must be taken to design delivery systems that target such compounds to the site of affected tissues to minimize potential damage to uninfected cells, thereby reducing side effects.

[0115] The data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The dosages of such compounds are sufficient to achieve ED therapy with little or no toxicity. 50 The dosage may be within a circulating concentration range including the IC50, IC60, IC70, IC80, IC90, IC100, IC110, IC120, IC130, IC240, IC150, IC250, IC260, IC160, IC270, IC310, IC420, IC50, IC60, IC110, IC240, IC120, IC250, IC130, IC260, IC140, IC270, IC150, IC280, IC160, IC290, IC290, IC310, IC290, IC150, IC290, IC310, IC420, IC50, IC60, IC150, IC250, IC160, IC260, IC170, IC270, IC180, IC280, IC310, IC290, IC190, IC290, IC290, IC310, IC420, IC50, IC60, IC100, IC290, IC290, IC100, IC290, IC150, IC290, IC290, IC310, IC410, IC50, IC610, IC290, IC10 ... 50 Therapeutic agents may be formulated in animal models to obtain a circulating plasma concentration range that includes the concentration of the test compound that achieves a half-maximal inhibition of symptoms (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms). Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0116] It should also be understood that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the activity of the particular compound employed, age, body weight, general health, sex, diet, time of administration, excretion rate, drug combination, as well as the judgment of the treating physician and the severity of the particular disease being treated. The amount of a compound of the present disclosure in the composition will also depend on the particular compound in the composition.

[0117] All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "etc.") provided herein is intended merely to further clarify the disclosure and does not create limitations on the scope of the disclosure unless otherwise stated.

[0118] Any asymmetric atom (e.g., carbon or the like) of the compounds of the present disclosure can be present in racemic or enantiomerically enriched, for example, in the (R)-, (S)-, or (R,S)-configuration. In some embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R)- or (S)-configuration. Substituents of atoms with unsaturated double bonds may be present in cis-(Z)- or trans-(E)-forms, where possible.

[0119] Thus, as used herein, the compounds of the present disclosure may be in the form of one of the possible stereoisomers, rotamers, atropisomers, tautomers, or mixtures thereof, for example, may exist as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers (enantiomers), racemates, or mixtures thereof.

[0120] Any resulting mixtures of stereoisomers can be separated on the basis of the physical chemical differences of the components into pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization.

[0121] Any resulting racemates of the compounds of the present disclosure or of the intermediates can be resolved into their optical antipodes by known methods, for example by separation of their diastereomeric salts obtained with optically active acids or bases and liberation of the optically active acidic or basic compounds. In particular, basic moieties may thus be used to resolve the compounds of the present disclosure into their optical antipodes, for example by fractional crystallization of salts formed with optically active acids, for example tartaric acid, dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluoyltartaric acid, mandelic acid, malic acid, or camphor-10-sulfonic acid. The racemates or racemic intermediates of the present disclosure can also be resolved by chiral chromatography, for example high performance liquid chromatography (HPLC), using a chiral adsorbent.

[0122] Diseases and Disorders The compounds of formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, and formula (I)-F of the present disclosure are - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis, - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, e.g. cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress The present invention is useful for treating an age-related disease or disorder selected from the group consisting of:

[0123] In another aspect, compounds of the present disclosure can be used to treat treatable conditions that have been shown to increase the likelihood of age-related diseases, such as situations where there is an increase in pro-senescence cytokines (e.g., IL6).

[0124] In another aspect, the compounds of the present disclosure can be used to treat disorders involving fibrosis and / or inflammatory processes, such as liver and kidney disorders.Examples include liver fibrosis occurring in end-stage liver disease, liver cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH and alcohol-related steatosis.Another example is renal fibrosis, which occurs as a result of acute kidney injury and leads to chronic kidney disease.Diabetic nephropathy can induce renal fibrosis and inflammation.In many cases, renal disease leads to heart failure as a result of increased blood pressure, which can also be accompanied by cardiac fibrosis.

[0125] In another embodiment, the compounds of the disclosure can be used to treat heart failure (Buss, SJ et al. Beneficial effects of Mammalian target of rapamycin inhibition on left ventricular remodeling after myocardial infarction. J Am Coll Cardiol. (2009) 54(25):2435-46; Buss, SJ et al. Augmentation of autophagy by mTOR-inhibition in myocardial infarction: When size matters. Autophagy. (2010) 6(2):304-6).

[0126] In another embodiment, the compounds of the disclosure can be used to treat liver fibrosis in patients who have undergone liver transplants (Villamil, F Get al. Fibrosis progression in maintenance liver transplant patients with hepatitis C recurrence: a randomized study of RAD001 vs. calcineurin inhibitors. Liver Int. (2014) 34(10):1513-21).

[0127] Treatment of acute or chronic organ or tissue transplant rejection includes, for example, treatment of recipients of heart, lung, combined heart-lung, liver, kidney, pancreas, skin or cornea transplants. Compounds of the present disclosure are also indicated for the prevention of graft-versus-host disease, such as after bone marrow transplantation.

[0128] Transplant vasculopathy includes atherosclerosis.

[0129] Autoimmune diseases and inflammatory conditions include, in particular, inflammatory conditions with an etiology that includes an autoimmune component, such as arthritis (e.g., rheumatoid arthritis, progressive chronic arthritis, and osteoarthritis) and rheumatic diseases. Specific autoimmune diseases for which the compounds of formula (I), formula (I)-A, formula (I)-B, formula (I)-C, formula (I)-D, formula (I)-E, formula (I)-F may be used include autoimmune blood diseases (including, for example, hemolytic anemia, aplastic anemia, pure red cell aplasia, and idiopathic thrombocytopenic purpura), systemic lupus erythematosus, polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Stevens-Johnson syndrome, sprue of unknown etiology, Autoimmune inflammatory bowel disease (including, for example, ulcerative colitis and Crohn's disease), endocrine ophthalmopathy, Graves' disease, sarcoidosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes mellitus (type I diabetes mellitus), uveitis (anterior and posterior), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, glomerulonephritis (with and without nephrotic syndrome, including, for example, idiopathic nephrotic syndrome or minimal change nephrosis) and juvenile dermatomyositis.

[0130] The compounds of the present disclosure can also be used to treat multidrug resistance (MDR), including enhancing the efficacy of other chemotherapeutic agents in the treatment and control of multidrug resistant conditions, such as multidrug resistant cancer or multidrug resistant AIDS. MDR is particularly problematic in cancer and AIDS patients who would not respond to conventional chemotherapy because the drugs are effluxed from the cell by Pgp.

[0131] The compounds of the present disclosure may also be used to treat infectious diseases, including infections caused by pathogens that possess Mip or Mip-like factors.

[0132] Age-related diseases also include sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy (also called dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment (e.g., frailty), cognitive decline, These include tendon stiffness, cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and type II diabetes (including complications resulting from diabetes such as renal failure, blindness and neuropathy).

[0133] Neurodegenerative diseases include Huntington's disease, Parkinson's disease, spinocerebellar ataxia type 3, Alzheimer's disease, motor neuron disease and peripheral neuropathies.

[0134] Proliferative disorders include cancer. Such conditions include those listed in U.S. Patent No. 9,669,032, such as kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or neck cancer.

[0135] Seizures and seizure disorders include West syndrome, focal cortical dysplasia (FCD), tuberous sclerosis complex (TSC), childhood absence epilepsy, benign focal epilepsy of childhood, juvenile myoclonic epilepsy (JME), temporal lobe epilepsy, frontal lobe epilepsy, refractory epilepsy, Lennox-Gastaut syndrome, occipital lobe epilepsy, Proteus syndrome, hemimegalencephaly (HMEG), megalencephaly (MEG), capillary malformation syndrome (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH).

[0136] Mitochondrial myopathy and mitochondrial stress are mitochondrial diseases described in Chinnery, PF (2015); EMBO Mol. Med. 7, 1503-1512; Koopman, WJ et al., (2016); EMBO Mol. Med. 8, 311-327 and Young, MJ, and Yound and Copeland, WC (2016); Curr. Opin. Genet. Dev. 38, 52-62.

[0137] Treatable conditions that have been shown to make age-related diseases more likely include senescence, e.g., immunosenescence, which is diagnosed by (i) an increase in circulating cytokines such as IL-6, but also by (ii) senescent cells found in muscle, kidney, liver, brain, neurons, liver, pancreas, or heart, or by (iii) a decreased efficiency of DNA repair, which can be indicated by increased transcription of repetitive elements, including transposon-encoding genes.

[0138] Treatment methods The present disclosure provides compounds of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or pharma- ceutically acceptable salts thereof for the treatment of diseases and disorders described herein, e.g., age-related disorders or diseases and disorders currently approved for treatment using rapalogs, such as RAD001.

[0139] In one aspect, the disclosure provides a method for treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof.

[0140] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject, wherein a target tissue, organ, or cell associated with the pathology of the disease or disorder has insufficient FKBP12 levels to inhibit mTORC1, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F, or a pharma- ceutically acceptable salt thereof.

[0141] In one embodiment, the compounds of formula (I) or pharma- ceutically acceptable salts thereof have a higher binding affinity to FKBP12, FKBP25, FKBP51, and / or FKBP52, for example compared to rapamycin or RAD001.

[0142] In one embodiment, the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a high binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 sufficient to inhibit mTORC1.

[0143] In one embodiment, the efficacy of a treatment is determined empirically, for example in comparison to rapamycin or RAD001.

[0144] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject having, or determined to have, insufficient FKBP12 levels to inhibit mTORC1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F, or a pharma- ceutically acceptable salt thereof.

[0145] In one embodiment, the compounds of formula (I) or pharma- ceutically acceptable salts thereof have a higher binding affinity to FKBP12, FKBP25, FKBP51, and / or FKBP52, for example compared to rapamycin or RAD001.

[0146] In one embodiment, the subject has, or is determined to have, levels of FKBP12 in a target tissue, organ, or cell that are insufficient to inhibit mTORC1.

[0147] In one embodiment, the efficacy of a treatment is determined empirically, for example in comparison to rapamycin or RAD001.

[0148] In another aspect, the disclosure provides a method for treating a disease or disorder in a subject having, or predetermined to have, sufficient FKBP12 levels to inhibit mTORC1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of formula (I) or a pharma- ceutical acceptable salt thereof, or a pharmaceutical composition described herein, or a pharmaceutical combination described herein.

[0149] In one embodiment, the disease or disorder is selected from the group consisting of sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, brain atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes including complications resulting from diabetes such as renal failure, blindness and neuropathy.

[0150] In one embodiment, the disorder is liver fibrosis.

[0151] In another aspect, the disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress The present invention provides a method, wherein the method is selected from the group consisting of

[0152] In one embodiment, the disorder is one involving fibrotic and / or inflammatory processes.

[0153] In one embodiment, the disorder is selected from a hepatic disorder and a renal disorder.

[0154] In one embodiment, the liver disorder is selected from liver fibrosis occurring in end stage liver disease, liver cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis.

[0155] In one embodiment, the renal disorder is renal fibrosis.

[0156] In one embodiment, renal fibrosis occurs as a result of acute kidney injury.

[0157] In one embodiment, the renal disorder is chronic renal disorder.

[0158] In one embodiment, the renal disorder is diabetic nephropathy.

[0159] In another aspect, the disclosure provides a method of treating an age-related disorder or disease in a subject in need thereof, comprising administering a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, The method includes administering to a subject a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutical combination ... , arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction such as systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes including complications resulting from diabetes such as renal failure, blindness and neuropathy.

[0160] In another aspect, the disclosure provides a method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof.

[0161] In one embodiment, the method further comprises a PD-1 / PDL-1 inhibitor.

[0162] In one embodiment, the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and neck cancer.

[0163] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof for use as a medicament.

[0164] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof for use in the prophylaxis or treatment of a disorder or disease mediated by the mTOR pathway.

[0165] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, and Formula (I)-F or a pharma- ceutically acceptable salt thereof, for the prevention or treatment of a disorder or disease selected from the following: - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis, - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders; - Mitochondrial myopathy and mitochondrial stress.

[0166] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, for use in the prophylaxis or treatment of a disorder or disease involving fibrotic and / or inflammatory processes.

[0167] In one embodiment, the disorder is selected from a hepatic disorder and a renal disorder.

[0168] In one embodiment, the liver disorder is selected from liver fibrosis occurring in end stage liver disease, liver cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis.

[0169] In one embodiment, the renal injury is renal fibrosis resulting from acute kidney injury.

[0170] In one embodiment, the renal disorder is chronic renal disorder.

[0171] In one embodiment, the renal disorder is diabetic nephropathy.

[0172] In another aspect, the present disclosure relates to a method for treating a variety of conditions, including but not limited to sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction such as systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic kidney disease, diabetes mellitus ... The present invention provides a compound of formula (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of formula (I), (I)-A, (I)-B, (I)-C, (I)-D, (I)-E, (I)-F or a pharma- ceutically acceptable salt thereof, for the treatment of age-related disorders or age-associated diseases selected from chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications resulting from diabetes such as renal failure, blindness, and neuropathy).

[0173] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof, for the treatment of cancer.

[0174] In another aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, Formula (I)-G, Formula (I)-H, Formula (I)-I, Formula (I)-I, Formula (I)-J, Formula (I)-K, Formula (I)-K, Formula (I)-L, Formula (I)-N, Formula (I)-N, Formula (I)-O, Formula (I)-O, Formula (I)-P, Formula (I)-P, Formula (I)-Q, Formula (I)-R, Formula (I)-S, Formula (I)-T, Formula (I)-T, Formula (I)-U, Formula (I)-V ... and a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof; or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof.

[0175] In another aspect, the disclosure provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament.

[0176] In another aspect, the disclosure provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a disorder or disease mediated by the mTOR pathway.

[0177] In another aspect, the present disclosure provides a method for producing a method for manufacturing a pharmaceutical composition comprising: - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, e.g. cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress The present invention provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a disorder or disease selected from the group consisting of:

[0178] In another aspect, the disclosure provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of a disorder or disease involving a fibrotic or inflammatory process.

[0179] In one embodiment, the disorder is selected from a hepatic disorder and a renal disorder.

[0180] In one embodiment, the liver disorder is selected from liver fibrosis occurring in end stage liver disease, liver cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis.

[0181] In one embodiment, the renal injury is renal fibrosis resulting from acute kidney injury.

[0182] In one embodiment, the renal disorder is chronic renal disorder.

[0183] In one embodiment, the renal disorder is diabetic nephropathy.

[0184] In another aspect, the present disclosure provides a method for treating conditions including sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, brain atrophy (also known as dementia), atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, impaired mobility, cognitive decline, tendon stiffness, cardiac hypertrophy, and / or cardiac dysfunction such as systolic and / or diastolic dysfunction, and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction. The present invention provides use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the prophylaxis or treatment of an age-related disorder or age-associated disease selected from impaired immune function, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to weakened immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications resulting from diabetes such as renal failure, blindness, and neuropathy).

[0185] In another aspect, the disclosure provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F, or a pharma- ceutically acceptable salt thereof, for the manufacture of a medicament for the prevention or treatment of cancer.

[0186] In another aspect, the disclosure provides the use of a compound of Formula (I), Formula (I)-A, Formula (I)-B, Formula (I)-C, Formula (I)-D, Formula (I)-E, Formula (I)-F or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment of kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or neck cancer.

[0187] Processes for making compounds of formula (I) In another aspect, the present disclosure provides methods for making the compounds of the present disclosure according to Schemes 1, 2, and 3.

[0188] [ka] R 2 and R 3 The compound of formula (I), wherein is as defined in formula (I), can be prepared by reacting C32-deoxyrapamycin (intermediate 1) with R 2 and R 3 is as defined in formula (I) (R 2 )(R 3 )NH in the presence of a suitable reagent for the substitution reaction, such as zinc(II) chloride, in the presence of a suitable solvent, such as dichloromethane. Suitable conditions are as follows: 1)(R 2 )(R 3 )NH, p-toluenesulfonic acid-H2O, dichloromethane, room temperature 2)(R 2 )(R 3 ) NH, trifluoroacetic acid, -40°C, dichloromethane (see EP 1212331 B1) 3)(R 2 )(R 3 )NH, 5M LiClO4, Et2O (0.1M), room temperature (see TL, 1995, 43, 7823) 4)(R 2 )(R 3 )NH, Cp2HfCl2-AgClO4 (Suzuki's catalyst), 4A MS, dichloromethane, room temperature (see TL, 1995, 43, 7823) 5)(R 2 )(R 3 ) NH, BF3-OEt2 or Zn(OTf)2, THF, 0°C (see TL, 1994, 37, 6835) 6)(R 2 )(R 3) NH, ZnCl2, dichloromethane, 0°C (see JOC, 1994, 59, 6512) 7)(R 2 )(R 3 )NH, methanesulfonic acid, dichloromethane, room temperature 8)(R 2 )(R 3 )NH, phosphoric acid, dichloromethane, room temperature 9)(R 2 )(R 3 )NH, polyphosphoric acid, dichloromethane, room temperature

[0189] The C32-deoxyrapamycin used as the starting material may be prepared by methods known in the art, for example, as described in WO 2007 / 085400.

[0190] [ka] R 1 -OR a R a is H, P(O)(R b )2, C 1~6 Alkyl, and C 1~6 hydroxyalkyl; and R 2 and R 3 is as defined in formula (I), the compound of formula (I)-A can be prepared by reacting intermediate 1 with R 1 -H or R 1 -X, and then (R 2 )(R 3 In one embodiment, intermediate 1 may be obtained by reacting with R1-H or R 1 In one embodiment, intermediate 1-A is reacted with -X under alkylation, phosphination, or esterification conditions to obtain a compound of formula (I)-A. In one embodiment, intermediate 1-A is reacted with -X under substitution reaction conditions (R 2 )(R 3Compounds of Formula (I)-C and Formula (I)-D can also be prepared in a manner similar to the synthetic route shown in Scheme 2.

[0191] [ka] R 1 teeth, [ka] and R 2 and R 3 is as defined in formula (I), the compound of formula (I)-B can be prepared by reacting intermediate 1-B with R 1 -H, and then (R 2 )(R 3 )NH. In one embodiment, intermediate 1-B is activated and reacted under nucleophilic conditions to provide intermediate 1-B. In one embodiment, intermediate 1-B is activated and reacted under substitution reaction conditions, e.g., as provided herein, to provide a compound of formula (I)-B. 2 )(R 3 Compounds of Formula (I)-E and Formula (I)-F can also be prepared in a manner similar to the synthetic route shown in Scheme 3. EXAMPLES

[0192] This disclosure provides the following examples: The synthetic and biological examples described in this application are presented to illustrate the compounds, pharmaceutical compositions and methods provided herein and should not be construed in any way as limiting the scope thereof.

[0193] The compounds provided herein can be prepared from readily available starting materials using modifications of the specific synthetic protocols described below that will be familiar to those skilled in the art. It will be understood that where typical or preferred process conditions (i.e., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.) are given, other process conditions can also be used unless otherwise specified. Optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art by routine optimization procedures.

[0194] Moreover, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. The selection of a suitable protecting group for a particular functional group and suitable conditions for protection and deprotection are well known in the art. For example, numerous protecting groups and their introduction and removal are described in Greene et al., Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991 and references cited therein.

[0195] Rapamycin and its derivatives, such as the compound of formula (I), exist in a solvent- and pH-dependent equilibrium of 6- and 7-membered hemiketal forms, shown below as E and F (Schemes 4 and 5). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142. Rapamycin and its derivatives also exist in a mixture of cis- and trans-amides, shown below as E, H, J and K (Schemes 4 and 5). [See Mierke, D.F., Schmieder, P., Karuso, P. and Kessler, H. (1991), Conformational Analysis of the cis- and trans-Isomers of FK506 by NMR and Molecular Dynamics. Helvetica Chimica Acta, 74:1027-1047]. The NMR characterization data presented in the examples corresponds only to the major equilibrium forms observed under the reported deuterium solvent conditions.

[0196] [ka] Where: R 1 -OR a and; R a is H, P(O)(R b )2, C 1~6 Alkyl, and C 1~6 hydroxyalkyl; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; Each R b H and C 1~6independently selected from the group consisting of alkyl; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; and R 5 is H or C 1~6 It is an alkyl.

[0197] [ka] Where: R 1 is a heteroaryl, such as a 5-membered heteroaryl, e.g. [ka] and; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; Each R b H and C 1~6 independently selected from the group consisting of alkyl; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; and R 5 is H or C 1~6 It is an alkyl.

[0198] In one embodiment, the compounds of formula (I), formula (I)-A and formula (I)-B exist in a solvent- and pH-dependent equilibrium of 6- and 7-membered hemiketal forms shown below as E-1 and F-1 (Scheme 6). In one embodiment, the compounds of formula (I), formula (I)-A and formula (I)-B exist in a mixture of cis- and trans-amides E-1 and H-1.

[0199] [ka] R 1 -OR a and; R a is H, P(O)(R b )2, C 1~6 Alkyl, and C 1~6 hydroxyalkyl; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; Each R b H and C 1~6 independently selected from the group consisting of alkyl; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; and R 5 is H or C 1~6 It is an alkyl.

[0200] Preparation of compounds The compounds of the present disclosure can be prepared as described in the Examples below.

[0201] List of abbreviations The following abbreviations used herein below have the corresponding meanings: A Angstrom d double line dd double double line DCM Dichloromethane DMSO Dimethyl sulfoxide ESIMS Electrospray Ionization Mass Spectrometry EtOAc Ethyl acetate eq equivalent FA Formic Acid HSQC NMR Heteronuclear Single Quantum Coherence Nuclear Magnetic Resonance HPLC High Performance Liquid Chromatography Hz Hertz MeCN Acetonitrile MeOH Methanol M mole m multiplet mg milligram MHz Megahertz mL Milliliters mmol NMR nuclear magnetic resonance PEI Polyethyleneimine PPU Propyl-pyridyl-urea q quartet μL microliter μM micromolar s single line SFC Supercritical Fluid Chromatography t triple line

[0202] Methods used in the purification of the examples Purification of intermediates and final products was carried out via either normal or reverse phase chromatography.

[0203] Flash Chromatography Normal phase chromatography was performed using pre-packed SiO2 cartridges (e.g., RediSep® Rf columns from Teledyne Isco, Inc.) eluted with a gradient of an appropriate solvent system (e.g., hexanes and ethyl acetate; DCM and MeOH; i.e., unless otherwise indicated).

[0204] Reverse phase chromatography was performed using pre-packed C18 cartridges (eg, RediSep® Rf columns from Teledyne Isco, Inc.) eluted with a gradient of an appropriate solvent system (eg, acetonitrile and water; ie, unless otherwise indicated).

[0205] SFC was performed using the method described below: Method 1: Reprospher PEI 5μm (100A) column (30×250mm); CO2 / MeOH Method 2: Princeton PPU 5 μm (100A) column (30 × 250 mm); CO2 / MeOH Method 3: Kinetex BiPhenyl 5 μm (100A) column (30 × 250 mm); CO2 / MeOH The gradient was selected based on the analytical separation.

[0206] Reverse phase preparative HPLC was performed using the method described below: Method 1: Phenomenex Luna C18; 5 μm column (30×250 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. The gradient was selected based on the analytical separation. Method 2: YMC Actus Triart C18; 5 μm column (20 × 150 mm); acetonitrile / water. Method 3: YMC Actus Triart C18ExRS; 5 μm column (20×150 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. The gradient was selected based on the analytical separation. Method 4: YMC Actus Triart C8; 5 μm column (20×150 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. The gradient was selected based on the analytical separation.

[0207] Preparation of intermediates Preparation of intermediates 1-9 Intermediate 1: C32-deoxo-rapamycin [ka] Intermediate 1 was prepared according to procedures known in the literature, including those disclosed in WO 2007 / 085400 A1, each of which is incorporated by reference herein in its entirety.

[0208] Intermediate 2: [ka] Intermediate 1 (4.37 g, 4.86 mmol) was dissolved in anhydrous dichloromethane (20 mL). Anhydrous toluene was added (20 mL). The reaction mixture was evaporated to dryness on a rotary evaporator. This azeotropic drying process was repeated two more times.

[0209] The dried starting material was combined with 2,6-lutidine (1.39 ml, 11.9 mmol) in anhydrous dichloromethane (58 mL). The flask was capped and the mixture was vacuum purged with nitrogen twice. The mixture was cooled to -30°C in an acetonitrile / dry ice bath.

[0210] Trifluoromethanesulfonic anhydride (1.20 ml, 7.16 mmol) was added dropwise via syringe over 4 minutes. The reaction mixture was stirred for 30 minutes at −30° C. The reaction mixture was transferred to a 0° C. ice-water bath and stirred at 0° C. for 20 minutes.

[0211] The reaction mixture was placed on a rotary evaporator and concentrated without heating. Isopropyl acetate (22 mL) was added. Tetrazole (1.17 g, 16.7 mmol) was added in one portion. The flask was quickly capped and vacuum purged with nitrogen twice. N,N-Diisopropylethylamine (4.18 ml, 23.9 mmol) was added via syringe over 1 minute. The reaction mixture was stirred at room temperature overnight.

[0212] The reaction mixture was concentrated on a rotary evaporator and the concentrate was purified by normal phase silica gel flash column chromatography (0-40% acetone-heptane gradient elution, 80 g silica column, TLC in 40% acetone-heptane, visualized under UV).

[0213] The second eluting peak fractions (determined by UV absorbance at 279 nm) were pooled and concentrated to give Intermediate 2 (2.19 g, 2.30 mmol, 47.4% yield) as a white solid.

[0214] Intermediate 2:ESIMS[M+NH4] + 969.8, ESIMS [MH] - 950.8. 1H NMR(400MHz,DMSO-d6)δ 9.33(d,J=6.4Hz,1H),6.58-6.41(m,2H),6.35-6.14(m,2H),6.09-5.98(m,1H),5.55-5.43(m,1H),5.19(m,1H),5.05(m,1H), 5.00-4.93(m,1H),4.87-4.79(m,1H),4.67-4.56(m,1H),3.98-3.87(m,1H),3.87(d,J=6.9Hz,1H),3.61(m,2H),3.55(dd,J=1 1.8,1.9Hz,1H),3.49-3.38(m,1H),3.31-3.17(m,4H),3.10(m,4H),3.04(s,3H),2.88-2.75(m,1H),2.29-2.09(m,3H),2.07- 1.86(m,3H),1.88-1.60(m,9H),1.59-1.44(m,7H),1.43-1.01(m,11H),0.96(t,J=7.1Hz,5H),0.95-0.77(m,7H),0.72(m,4H).

[0215] Intermediate 3: [ka] Intermediate 1 (0.233 g, 0.259 mmol) was combined with 2,6-di-tert-butyl-4-methylpyridine (0.424 g, 2.07 mmol) in anhydrous dichloromethane (2.6 mL). The reaction mixture was vacuum purged with nitrogen once. The reaction mixture was cooled to 0° C. in an ice-water bath. Solid dimethylphosphinic chloride (0.145 g, 1.29 mmol) was added in one portion. The reaction mixture was stirred at 0° C. for 80 minutes.

[0216] The reaction was diluted with saturated aqueous NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to give a colorless tar crude product (0.77 g).

[0217] The crude product was purified by silica gel flash column chromatography (0-80% acetone-heptane gradient elution, 24 g silica column, TLC in 80% EtOAc-heptane, visualized under UV). Product-containing fractions were pooled and concentrated to give intermediate 3 (0.09 g, 0.09 mmol, 34.4% yield) as a white solid.

[0218] Intermediate 3:ESIMS[M+NH4] + 993.7, ESIMS [MH] - 974.7. HRMS: Calculated: 999.5812(Na + Addition).Measured value: 999.5807. 1 H NMR (600MHz, chloroform-d) δ 6.47-6.26(m,2H), 6.22-6.08(m,1H), 6.02-5.83(m,1H), 5.54(m,1H), 5.35-5.26(m,1H), 5.21(m,1H), 4.85-4.76(m,1H), 4.12(m,2H), 3.93-3.81(m,1H), 3.67 (t,J=7.7Hz,1H),3.62(d,J=6.7Hz,1H),3.60-3.53(m,1H),3.53-3.44(m,1H),3 .42-3.36(m,3H),3.32(m,3H),3.28-3.18(m,1H),3.13(m,3H),3.05(m,1H),2.8 2(m,1H),2.42-2.21(m,3H),2.16-2.08(m,3H),1.99(m,1H),1.95-1.83(m,1H), 1.83-1.72(m,4H),1.71-1.57(m,9H),1.57-1.43(m,12H),1.39(m,1H),1.34-1. 20(m,4H),1.20-1.10(m,1H),1.05(m,4H),1.00(d,J=6.5Hz,3H),0.95(dd,J=6. 6,2.1Hz,3H),0.92(d,J=6.6Hz,3H),0.91-0.84(m,4H),0.77(q,J=12.1Hz,1H).

[0219] Intermediate 4: [ka] 2-((tert-Butyldimethylsilyl)oxy)ethanol (0.471 g, 2.67 mmol) was dissolved in anhydrous toluene (0.95 mL) in a reaction vial. The vial was capped and then vacuum purged with nitrogen. N,N-Diisopropylethylamine (DIPEA) (0.490 ml, 2.81 mmol) was added via syringe. The mixture was cooled to 0° C. in an ice-water bath. Trifluoromethanesulfonic anhydride (TfO) (0.438 ml, 2.59 mmol) was added dropwise over approximately 2 minutes at 0° C. The reaction mixture was stirred for 30 minutes at 0° C.

[0220] The vial was removed from the cold bath. DIPEA (0.490 ml, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added quickly in one portion. The vial was quickly recapped and the mixture was vacuum purged with nitrogen. Toluene (0.5 mL) was added.

[0221] The reaction was stirred overnight under nitrogen at 40° C. The reaction was diluted with saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through Celite, and concentrated to give a waxy white solid crude product.

[0222] The crude product was purified by silica gel flash column chromatography (0–35% acetone-heptane, gradient elution, 40 g silica column, TLC in 35% acetone-heptane, visualized under UV) to give the desired intermediate 4 (0.245 g, 0.231 mmol, 34.7% yield) as a glass, which was used immediately “as is” in the following step.

[0223] Intermediate 4:ESIMS[M+NH4] + 1076.1, ESIMS [MH] - 1056.0.

[0224] Intermediate 5: C16-(1,1-dioxido-1,2-thiazetidin-2-yl)-C32-deoxo-rapamycin (diastereomer 1) Intermediate 6: C16-(1,1-dioxido-1,2-thiazetidin-2-yl)-C32-deoxo-rapamycin (diastereomer 2) [ka] To a solution of intermediate 1 (150 mg, 0.167 mmol) and 1,2-thiazetidine 1,1-dioxide (891 mg, 0.833 mmol) in DCM (3 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.5 mL, 0.5 mmol) at 0 °C. The reaction mixture was stirred for 2 h at room temperature. The mixture was diluted with H2O and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure. The crude product of the diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0225] Final purification of the first eluting diastereomer by preparative HPLC (Method 2) afforded Intermediate 5 (18 mg, 10% yield) as a white solid.

[0226] Intermediate 5:ESIMS[M+NH4] + 992.6, [M+FA-H] - 1019.6. 1H NMR(400MHz,chloroform-d)δ 6.39(dd,J=14.8,9.8Hz,1H),6.34(dd,J=14.8,10.3Hz,1H),6.18-6.10(m,1H),6.02(d,J=10.3,1.5Hz,1H),5.66( dd,J=15.1,8.6Hz,1H),5.38(s,1H),5.32(dd,J=6.4,1.8Hz,1H),5.23(d,J=9.6Hz,1H),4.87-4.76(m,1H),4.12-4 .06(m,1H),3.99(ddd,J=12.0,8.2,6.2Hz,1H),3.92-3.86(m,1H),3.84(dd,J=10.7,4.4Hz,1H),3.81-3.74(m,1H) ,3.63-3.59(m,2H),3.59(d,J=3.6Hz,1H),3.46(d,J=7.6Hz,1H),3.43(s,3H),3.40-3.37(m,1H),3.32(s,3H),3.0 4(ddd,J=8.2,5.8,3.8Hz,1H),3.00-2.94(m,1H),2.94-2.89(m,1H),2.88-2.84(m,1H),2.64(d,J=6.7Hz,1H),2.4 7-2.38(m,1H),2.36-2.27(m,2H),2.21-2.12(m,1H),2.03-1.97(m,1H),1.95-1.77(m,7H),1.76-1.67(m,5H),1.6 5(s,3H),1.60-1.50(m,6H),1.47-1.39(m,2H),1.38-1.27(m,4H),1.25-1.10(m,3H),1.08-1.04(m,1H),1.03-1.0 1(m,3H),1.00(d,J=1.4Hz,3H),0.99-0.97(m,3H),0.97(d,J=6.6Hz,3H),0.93(d,J=6.8Hz,3H),0.75-0.66(m,1H).

[0227] Final purification of the second eluting diastereomer using SFC chromatography (Method 2) afforded Intermediate 6 (16 mg, 9.2% yield) as a white solid.

[0228] Intermediate 6:ESIMS[M+NH4] + 992.7, [M+FA-H] -1019.6 1 H NMR(400MHz,クロロホルム-d)δ 6.46(dd,J=14.2,10.9Hz,1H),6.22(dd,J=14.2,10.6Hz,1H),6.14(dd,J=14.5,10.6Hz,1H),6.00(d, J=10.9Hz,1H),5.38(dd,J=14.5,9.6Hz,1H),5.27-5.19(m,1H),5.12-5.05(m,1H),4.66-4.59(m,1H) ,4.59-4.53(m,1H),4.25(d,J=1.8Hz,1H),4.17-4.06(m,3H),4.02(ddd,J=11.8,8.0,3.5Hz,1H),3.6 6(d,J=7.0Hz,1H),3.60-3.52(m,2H),3.43-3.34(m,4H),3.28(s,3H),3.17-3.07(m,1H),3.03-2.95( m,1H),2.95-2.89(m,1H),2.84-2.73(m,1H),2.65-2.62(m,1H),2.35-2.26(m,1H),2.27-2.21(m,1H) ,2.21-2.12(m,3H),2.12-2.05(m,1H),2.02-1.98(m,1H),1.97-1.95(m,3H),1.91-1.83(m,1H),1.82 -1.70(m,3H),1.70-1.51(m,10H),1.50-1.17(m,10H),1.11-1.06(m,1H),1.06-1.02(m,6H),1.01-0. 96(m,1H),0.93(d,J=6.8Hz,4H),0.89(d,J=6.6Hz,3H),0.86(d,J=6.8Hz,3H),0.64(q,J=11.9Hz,1H).

[0229] Intermediates 7 and 8:

change

[0230] Intermediate 7:ESIMS[M+Na] + 1008.0,ESIMS[MH] - 984.0.

[0231] Isolation of the second eluting diastereomer afforded INTERMEDIATE 8 (220 mg, 36.2% yield) as a yellow solid.

[0232] Intermediate 8:ESIMS[M+Na] + 1008.1, ESIMS [MH] - 984.7. HRMS: Calculated for C55H89N2O13 – 985.6365. Found – 985.6379.

[0233] Intermediate 9 and Intermediate 10: [ka] To a solution of intermediate 4 (120 mg, 0.113 mmol) and 1,2-thiazetidine 1,1-dioxide (121 mg, 1.13 mmol) in DCM (4 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.57 mL, 0.57 mmol). The reaction mixture was stirred for 3 h at room temperature. The reaction was diluted with saturated aqueous NaHCO3 and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 40:60).

[0234] The first eluting diastereomer was purified using SFC chromatography (Method 2) to give Intermediate 9 (18.3 mg, 13.5% yield) as a white solid.

[0235] Intermediate 9:ESIMS[M+NH4] + 1151.1, [M+FA-H] - 1178.2 1 H NMR(400MHz,DMSO-d6)δ:6.57-6.37(m,2H),6.32-6.12(m,2H),6.04(dd,J=22.7,10. 9Hz,1H),5.60-5.48(m,1H),5.06(d,J=9.1Hz,1H),4.98-4.91(m,1H),4.90-4.83(m, 1H),4.68-4.59(m,1H),4.17-3.99(m,3H),3.92-3.86(m,1H),3.69-3.61(m,3H),3.5 9-3.49(m,3H),3.49-3.41(m,1H),3.34(s,3H),3.28(d,J=8.9Hz,1H),3.17-3.09(m,4 H),3.09-3.03(m,1H),3.01-2.93(m,2H),2.91-2.80(m,1H),2.29-2.12(m,2H),2.12 -2.00(m,2H),1.99-1.88(m,3H),1.82(s,3H),1.78-1.62(m,6H),1.58-1.54(m,1H),1 .53-1.32(m,10H),1.34-1.20(m,3H),1.18-1.09(m,3H),1.06-0.94(m,7H),0.92-0. 83(m,13H),0.80(d,J=6.7Hz,3H),0.77-0.68(m,4H),0.68-0.59(m,1H),0.03(s,6H).

[0236] The second eluting diastereomer was purified using SFC chromatography (Method 2) to give Intermediate 10 (7.3 mg, 5.5% yield) as a white solid.

[0237] Intermediate 10:ESIMS[M+NH4] +1151.3,[M+FA-H] - 1178.4 1 H NMR(400MHz,DMSO-d6)δ:6.44(dd,J=13.9,11.0Hz,1H),6.26-6.12(m,2H),6.10-6.05(m,1H) ,5.98(s,1H),5.52(dd,J=14.1,9.4Hz,1H),5.15-5.04(m,1H),5.04-5.00(m,1H),4.96(d,J= 9.7Hz,1H),4.67-4.57(m,1H),4.20-4.00(m,4H),3.98-3.89(m,1H),3.65(t,J=5.2Hz,2H),3 .58-3.49(m,4H),3.42-3.35(m,1H),3.33(s,3H),3.22-3.16(m,1H),3.16-3.09(m,4H),3.09- 3.03(m,1H),3.00-2.92(m,1H),2.75-2.65(m,1H),2.27-2.12(m,2H),2.12-2.01(m,2H),2.0 0-1.88(m,3H),1.83(s,3H),1.78-1.66(m,2H),1.64-1.57(m,3H),1.56-1.48(m,7H),1.48-1 .34(m,3H),1.32-1.23(m,3H),1.22-1.03(m,5H),1.01-0.95(m,4H),0.93-0.88(m,4H),0.87 -0.84(m,12H),0.83-0.77(m,4H),0.75(d,J=6.7Hz,3H),0.62(q,J=11.9Hz,1H),0.03(s,6H).

[0238] Example 1. Synthesis of Compound 1 and Compound 2

change

[0239] The first eluting diastereomer was isolated to give compound 1 (6.5 mg, 4.6% yield) as a white solid.

[0240] Compound 1:ESIMS[MH] - 961.6 1 H NMR(400MHz,DMSO-d6)δ:7.30(d,J=7.9Hz,1H),6.47(s,1H),6.39(dd,J=13.7 ,11.2Hz,1H),6.22-6.08(m,2H),6.05(d,J=11.0Hz,1H),5.54(dd,J=14.2,8. 8Hz,1H),5.07-4.98(m,3H),4.69-4.62(m,1H),4.59(d,J=4.6Hz,1H),4.00-3 .96(m,1H),3.96-3.87(m,1H),3.80-3.69(m,2H),3.62(d,J=14.5Hz,1H),3.31 (d,J=1.7Hz,3H),3.23-3.10(m,5H),2.89(s,3H),2.86-2.76(m,1H),2.58-2. 52(m,1H),2.28-2.19(m,1H),2.19-1.98(m,3H),1.94-1.86(m,1H),1.82-1.7 0(m,5H),1.70-1.34(m,17H),1.34-1.11(m,6H),1.10-0.88(m,6H),0.87-0.8 1(m,6H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0241] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 2 (7.5 mg, 5.3% yield) as a white solid.

[0242] Compound 2:ESIMS[MH] - 961.7 1 H NMR(400MHz,DMSO-d6)δ:7.49(d,J=9.3Hz,1H),6.60(s,1H),6.44(dd,J=14.3,11.0Hz,1H),6.31-6.11(m,2H),5.98(d,J=11.0Hz,1H),5.51(dd,J =14.5,9.5Hz,1H),5.05(s,1H),4.99-4.92(m,1H),4.87-4.77(m,1H),4. 66-4.53(m,2H),3.95-3.85(m,2H),3.77-3.68(m,1H),3.68-3.57(m,1H), 3.49-3.39(m,1H),3.39-3.28(m,3H),3.26-3.14(m,2H),3.12(s,3H),2. 91-2.78(m,2H),2.71(s,3H),2.22(s,1H),2.17-1.83(m,6H),1.81(s,3H) ,1.79-1.57(m,5H),1.56-1.08(m,17H),1.06-0.89(m,8H),0.86(d,J=6. 6Hz,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.65-0.54(m,2H).

[0243] The absolute configuration of the C16 substituent in compound 2 was determined by X-ray crystallography of co-crystallization with FKBP12. [See Stuart L. Schrieber and Jon Clardy, et al., Atomic Structure of the Rapamycin Humano Immunophilin FKBP-12 Complex, J. Am. Chem. Soc., 1991, 113, 7433-7434]. The crystal structure is depicted in FIG. 1.

[0244] Pure FKBP12(1-108) protein was concentrated to 9 mg / mL in 50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM TCEP. Complexes for co-crystallization were prepared by mixing 3 mM of compound (from a 50 mM stock prepared in 90% dDMSO, 10% D2O) with the protein. The complexes were incubated at 4°C for 2 h and then centrifuged at 10000 rpm for 2 min to remove any possible precipitates before crystallization. Co-crystals were obtained at 20°C by the sitting drop vapor diffusion method using microseed matrix screening [Allan D'Arcy et al., An automated microseed matrix-screening method for protein crystallization, Acta Cryst., (2007) D63, 550-554]. Droplets consisted of 200 nL of protein solution, 160 nL of well solution, and 40 nL of seed stock. Crystals appeared within days in the A1 condition of the "Ammonium Sulfate" screen commercially available from Qiagen. The reservoir solution consisted of 2.2 M ammonium sulfate. Crystals were cryoprotected in reservoir solution supplemented with 20% ethylene glycol, flash frozen, and placed in liquid nitrogen. Data were collected at the Swiss Light Source Facility (SLS, Villigen, Switzerland) on a beamline X10SA.

[0245] Data were processed in XDS (Kabsch, W. (2010), XDS. Acta Cryst. D, 66:125-132). The structure was determined by molecular replacement (Collaborative Computational Project, Number 4 (1994). Acta Cryst. D50, 760-763) using the previous FKBP12 X-ray structure as a search model. The programs REFMAC (Murshudov GN, Skubak P, Lebedev AA, et al., REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallographica Section D: Biological Crystallography. 2011;67(Pt 4):355-367) and COOT (Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot, Acta Crystallographica Section D: Biological Crystallography. 2010;66(Pt 4):486-501) were used for structure refinement and model (re)building.

[0246] Based on the X-ray co-crystal structure, the C16 substituent of compound 2 has the (S)-configuration. The crystal structure is depicted in FIG.

[0247] Example 2. Compound 3 and Compound 4 [ka] To a solution of intermediate 1 (120 mg, 0.133 mmol) and ethanesulfonamide (218 mg, 2.00 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.67 mL, 0.67 mmol). The reaction mixture was stirred for 14 min at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0248] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 3 (13.4 mg, 10.1% yield) as a white solid.

[0249] Compound 3:ESIMS[M+NH4] + 994.7, [M+FA-H] - 1021.7 1H NMR(400MHz,DMSO-d6)δ:7.52(d,J=9.3Hz,1H),6.59(s,1H),6.43(dd,J=14.2,11.0Hz,1H),6.24(dd,J=14.2, 10.6Hz,1H),6.17(dd,J=14.2,10.7Hz,1H),5.96(d,J=10.9,1.6Hz,1H),5.50(dd,J=14.4,9.6Hz,1H),5.04(d ,J=4.7Hz,1H),4.96-4.89(m,1H),4.87-4.78(m,1H),4.69-4.54(m,2H),4.00-3.91(m,1H),3.88(dd,J=9.3,4 .7Hz,1H),3.76-3.67(m,1H),3.67-3.58(m,1H),3.50-3.40(m,1H),3.31(s,3H),3.25-3.15(m,2H),3.12(s,3H ),2.92-2.79(m,3H),2.77-2.65(m,1H),2.29-2.17(m,1H),2.17-2.10(m,1H),2.10-1.98(m,2H),1.97-1.86( m,3H),1.82(s,3H),1.80-1.76(m,1H),1.74-1.68(m,2H),1.67-1.60(m,2H),1.55-1.49(m,3H),1.48(s,3H), 1.46-1.33(m,4H),1.32-1.24(m,1H),1.22-1.11(m,6H),1.09(t,J=7.3Hz,3H),1.07-1.01(m,1H),1.01-0.94 (m,7H),0.89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.63(m,1H),0.63-0.54(m,1H).

[0250] The 2nd method of using the soluble solvent and SFC material (Method 1) After purification, a white solid compound 4 (28.6 mg, 21.5% yield) was obtained.

[0251] Compound 4: ESIMS [M+NH4] + 994.8,[MH] - 976.0 1H NMR(400MHz,DMSO-d6)δ:7.30(d,J=7.9Hz,1H),6.42(s,1H),6.41-6.34(m,1H),6.19-6.10(m,2H),6.10 -6.04(m,1H),5.54(dd,J=14.2,8.9Hz,1H),5.06-5.00(m,3H),4.66(ddd,J=9.4,6.0,2.5Hz,1H),4.59(d ,J=4.5Hz,1H),4.03-3.96(m,1H),3.96-3.85(m,1H),3.75(d,J=5.3Hz,1H),3.74-3.68(m,1H),3.62(dd ,J=9.9,6.3Hz,1H),3.31(s,3H),3.23-3.10(m,5H),3.03-2.90(m,2H),2.82(ddd,J=11.0,8.7,4.3Hz,1H ),2.52-2.48(m,1H),2.29-2.19(m,1H),2.19-2.12(m,1H),2.12-2.07(m,1H),2.06-1.98(m,1H),1.97- 1.86(m,1H),1.80-1.70(m,5H),1.69-1.64(m,1H),1.64-1.56(m,4H),1.56-1.50(m,6H),1.50-1.43(m,2 H),1.43-1.33(m,3H),1.30-1.23(m,2H),1.21-1.12(m,7H),1.11-1.01(m,1H),0.98(d,J=6.4Hz,3H),0. 96-0.87(m,2H),0.87-0.81(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0252] Example 3. Synthesis of Compound 5 and Compound 6

change

[0253] The first eluting diastereomer was purified using flash chromatography (silica; MeCN / DCM 0:100 to 40:60) followed by reverse-phase preparative HPLC (Method 2) to give compound 5 (2.5 mg, 1.8% yield) as a white solid.

[0254] Compound 5:ESIMS[M+NH4] + 1008.8, [M+FA-H] - 1035.8 1H NMR(400MHz,DMSO-d6)δ:7.53(d,J=9.4Hz,1H),6.59(s,1H),6.43(dd,J=14.2,11.0Hz,1H),6.25(dd,J=14.2,10 .5Hz,1H),6.18(dd,J=14.4,10.6Hz,1H),6.01-5.92(m,1H),5.50(dd,J=14.5,9.6Hz,1H),5.05(d,J=4.7Hz,1H) ,4.97-4.91(m,1H),4.86-4.78(m,1H),4.66-4.53(m,2H),3.99-3.90(m,1H),3.87(dd,J=9.3,4.6Hz,1H),3.75- 3.67(m,1H),3.67-3.59(m,1H),3.49-3.40(m,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H),3.20-3.14(m,1H),3.12( s,3H),2.89-2.78(m,3H),2.73-2.63(m,1H),2.28-2.17(m,1H),2.17-2.09(m,1H),2.09-2.01(m,2H),1.96-1.8 6(m,3H),1.81(s,3H),1.78-1.69(m,3H),1.69-1.60(m,2H),1.60-1.53(m,2H),1.53-1.49(m,3H),1.48(s,3H), 1.45-1.35(m,3H),1.35-1.25(m,2H),1.23-1.09(m,6H),1.07-1.01(m,2H),0.98(d,J=3.3Hz,3H),0.97(d,J=3. 4Hz,3H),0.89-0.84(m,7H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.65(m,1H),0.64-0.54(m,1H).

[0255] The second eluting diastereomer was purified using reverse-phase flash chromatography (C18; MeCN / water 10:90 to 100:0) to give compound 6 (3 mg, 2.2% yield) as a white solid.

[0256] Compound 6:ESIMS[M+NH4] + 1008.8, [M+FA-H] - 1035.8 1 H NMR(400MHz, DMSO-d6)δ:7.53-7.06(m,1H),6.51-6.30(m,2H),6.19-6.09(m,2H),6.06(d, J=11.4Hz,1H),5.53(dd,J=14.3,8.7Hz,1H),5.15-4.95(m,3H),4.66(td,J=7.5,6.0,2.4Hz ,1H),4.62-4.52(m,1H),4.05-3.95(m,1H),3.95-3.84(m,1H),3.77(d,J=5.1Hz,1H),3.75- 3.68(m,1H),3.68-3.58(m,1H),3.31(s,3H),3.24-3.09(m,5H),3.03-2.95(m,1H),2.95-2. 87(m,1H),2.84-2.78(m,1H),2.57-2.43(m,1H),2.35-2.21(m,1H),2.20-2.11(m,1H),2.1 1-1.96(m,2H),1.96-1.85(m,1H),1.82-1.70(m,5H),1.70-1.56(m,8H),1.56-1.48(m,6H), 1.48-1.32(m,4H),1.32-1.09(m,6H),1.08-1.00(m,1H),1.00-0.92(m,6H),0.92-0.86(m,3 H),0.86-0.80(m,6H),0.78(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.53(q,J=11.8Hz,1H).

[0257] Example 4. Synthesis of Compound 7 and Compound 8

change

[0258] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 7 (9.1 mg, 6.7% yield) as a white solid.

[0259] Compound 7:ESIMS[M+NH4] + 1008.8, [M+FA-H] + 1035.9 1H NMR(400MHz,DMSO-d6)δ:7.47(d,J=9.3Hz,1H),6.59(s,1H),6.42(dd,J=14.0,11.0Hz,1H),6.29-6. 19(m,1H),6.16(dd,J=13.7,10.1Hz,1H),5.97-5.89(m,1H),5.49(dd,J=14.2,9.6Hz,1H),5.04(d,J= 4.7Hz,1H),4.98-4.88(m,1H),4.87-4.77(m,1H),4.66-4.55(m,2H),4.03-3.90(m,1H),3.87(dd,J= 9.2,4.6Hz,1H),3.75-3.68(m,1H),3.68-3.58(m,1H),3.50-3.39(m,1H),3.32(s,3H),3.25-3.15(m, 2H),3.12(s,3H),2.94-2.76(m,3H),2.29-2.17(m,1H),2.17-2.00(m,3H),2.00-1.87(m,3H),1.82( s,3H),1.81-1.70(m,2H),1.70-1.59(m,3H),1.59-1.45(m,6H),1.45-1.34(m,3H),1.34-1.22(m,2H) ,1.22-1.14(m,7H),1.15-1.12(m,2H),1.10(d,J=6.7Hz,3H),1.07-0.99(m,2H),1.00-0.93(m,6H),0 .89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.72-0.64(m,1H),0.64-0.52(m,1H).

[0260] The 2nd method of using the soluble solvent and SFC material (Method 1) After purification, a white solid compound 8 (19.8 mg, 14.5% yield) was obtained.

[0261] Compound 8: ESIMS [M+NH4] + 1008.7,[MH] - 989.7 1H NMR(400MHz,DMSO-d6)δ:7.26(d,J=8.1Hz,1H),6.43-6.37(m,1H),6.36(s,1H),6.18-6.0 4(m,3H),5.54(dd,J=14.0,8.9Hz,1H),5.08-4.98(m,3H),4.71-4.62(m,1H),4.59(d,J=4 .4Hz,1H),4.08-3.97(m,1H),3.96-3.89(m,1H),3.77(d,J=5.0Hz,1H),3.74-3.67(m,1H) ,3.66-3.58(m,1H),3.31(s,3H),3.21-3.09(m,6H),2.86-2.77(m,1H),2.54-2.45(m,1H), 2.28-2.20(m,1H),2.19-2.13(m,1H),2.12-2.06(m,1H),2.06-1.99(m,1H),1.95-1.86(m ,1H),1.81-1.68(m,5H),1.68-1.56(m,4H),1.56-1.49(m,6H),1.49-1.32(m,6H),1.32-1. 25(m,1H),1.25-1.10(m,11H),1.09-1.01(m,1H),0.98(d,J=6.6Hz,3H),0.94-0.88(m,2H ),0.88-0.81(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.7Hz,3H),0.53(q,J=11.8Hz,1H).

[0262] Example 5. Synthesis of Compound 9 and Compound 10 [ka] To a solution of intermediate 1 (120 mg, 0.133 mmol) and 2-methylpropane-1-sulfonamide (274 mg, 2.00 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.67 mL, 0.67 mmol). The reaction mixture was stirred for 1 h at room temperature. The mixture was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0263] The first eluted diastereomer was purified using SFC chromatography (Method 1) to give Compound 9 (13.9 mg, 10.2% yield) as a white solid.

[0264] Compound 9: ESIMS [M+NH4] + 1022.8, [M-H] - 1003.8 1 H NMR (400 MHz, DMSO-d6) δ: 7.54 (d, J = 9.3 Hz, 1H), 6.58 (s, 1H), 6.43 (dd, J = 14.2, 11.0 Hz, 1H), 6.25 (dd, J = 14.3, 10.6 Hz, 1H), 6.18 (dd, J = 14.4, 10.5 Hz, 1H), 6.01 - 5.91 (m, 1H), 5.50 (dd, J = 14.4, 9.6 Hz, 1H), 5.05 (d, J = 4.5 Hz, 1H), 4.97 - 4.90 (m, 1H), 4.86 - 4.78 (m, 1H), 4.67 - 4.54 (m, 2H), 3.98 - 3.89 (m, 1H), 3.89 - 3.79 (m, 1H), 3.76 - 3.68 (m, 1H), 3.67 - 3.58 (m, 1H), 3.50 - 3.41 (m, 1H), 3.31 (s, 3H), 3.25 - 3.15 (m, 2H), 3.12 (s, 3H), 2.89 - 2.77 (m, 2H), 2.74 - 2.61 (m, 2H), 2.28 - 2.17 (m, 1H), 2.17 - 2.09 (m, 1H), 2.09 - 2.00 (m, 2H), 2.00 - 1.95 (m, 1H), 1.95 - 1.86 (m, 3H), 1.81 (s, 3H), 1.78 - 1.59 (m, 5H), 1.58 - 1.50 (m, 3H), 1.48 (s, 3H), 1.45 - 1.35 (m, 3H), 1.35 - 1.24 (m, 2H), 1.23 - 1.08 (m, 6H), 1.05 - 1.00 (m, 2H), 1.00 - 0.96 (m, 9H), 0.91 - 0.87 (m, 4H), 0.85 (d, J = 6.4 Hz, 3H), 0.79 (d, J = 6.7 Hz, 3H), 0.76 (d, J = 6.7 Hz, 3H), 0.70 - 0.63 (m, 1H), 0.63 - 0.54 (m, 1H).

[0265] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 10 (24.6 mg, 18.0% yield) as a white solid.

[0266] Compound 10:ESIMS[M+NH4] + 1022.9,[MH] - 1004.0 1 H NMR(400MHz,DMSO-d6)δ:7.32(d,J=8.2Hz,1H),6.47-6.33(m,2H),6.20-6.10(m,2H),6 .09-6.03(m,1H),5.53(dd,J=14.2,8.8Hz,1H),5.10-4.97(m,3H),4.73-4.62(m,1H),4. 59(d,J=4.5Hz,1H),4.04-3.96(m,1H),3.95-3.87(m,1H),3.78(d,J=4.8Hz,1H),3.76- 3.69(m,1H),3.68-3.58(m,1H),3.31(s,3H),3.22-3.09(m,5H),2.94-2.84(m,2H),2.83 -2.76(m,1H),2.56-2.42(m,1H),2.29-2.20(m,1H),2.20-2.13(m,1H),2.11-2.00(m,3 H),1.95-1.87(m,1H),1.81-1.70(m,5H),1.68-1.56(m,5H),1.56-1.50(m,5H),1.50-1. 43(m,3H),1.43-1.33(m,3H),1.31-1.11(m,6H),1.09-0.95(m,10H),0.95-0.87(m,2H), 0.87-0.81(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.53(q,J=11.8Hz,1H).

[0267] Example 6. Synthesis of Compound 11 and Compound 12 [ka] To a solution of intermediate 1 (120 mg, 0.133 mmol) and cyclopropanesulfonamide (323 mg, 2.67 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.67 mL, 0.67 mmol). The reaction mixture was stirred for 10 min at room temperature. The reaction mixture was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0268] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 11 (4.4 mg, 3.2% yield) as a white solid.

[0269] Compound 11:ESIMS[M+NH4] + 1006.7, [M+FA-H] - 1033.7 1H NMR(400MHz,DMSO-d6)δ:7.51(d,J=8.5Hz,1H),6.59(s,1H),6.43(dd,J=14.1,11.0Hz,1H),6.22(dd,J=1 4.2,10.5Hz,1H),6.17(dd,J=14.4,10.8Hz,1H),6.00-5.91(m,1H),5.50(dd,J=14.3,9.6Hz,1H),5.05(d, J=4.5Hz,1H),4.99-4.90(m,1H),4.87-4.79(m,1H),4.69-4.54(m,2H),4.00-3.90(m,1H),3.90-3.80(m,1 H),3.78-3.68(m,1H),3.68-3.56(m,1H),3.50-3.40(m,1H),3.31(s,3H),3.23(d,J=9.2Hz,1H),3.19-3.1 5(m,1H),3.12(s,3H),2.91-2.78(m,2H),2.29-2.17(m,2H),2.17-2.09(m,1H),2.06-1.98(m,2H),1.98- 1.86(m,3H),1.83(s,3H),1.79-1.74(m,1H),1.73-1.67(m,2H),1.67-1.58(m,2H),1.58-1.49(m,3H),1.4 8(s,3H),1.46-1.27(m,5H),1.24-1.09(m,6H),1.09-1.00(m,2H),1.00-0.94(m,6H),0.89-0.85(m,4H),0 .85-0.81(m,4H),0.79(d,J=6.8Hz,3H),0.74(d,J=6.7Hz,3H),0.73-0.66(m,1H),0.60(q,J=11.8Hz,1H).

[0270] The 2nd method of dissolving the solvent and SFC melting material (Method 1) is to use it. Compound 12 (16.7 mg, 12.4% yield) was obtained as a purified, white solid.

[0271] Compound 12: ESIMS [M+NH4] + 1006.4,[MH] - 987.5 1H NMR(400MHz,DMSO-d6)δ:7.28(d,J=7.6Hz,1H),6.47-6.37(m,1H),6.36(s,1H),6.20-6.09( m,2H),6.05(d,J=11.1Hz,1H),5.54(dd,J=14.3,8.7Hz,1H),5.10-4.96(m,3H),4.70-4.63(m ,1H),4.59(d,J=4.4Hz,1H),4.05-3.94(m,2H),3.84-3.76(m,1H),3.71(d,J=5.4Hz,1H),3. 66-3.57(m,1H),3.31(s,3H),3.23-3.17(m,1H),3.17-3.10(m,4H),2.82(ddd,J=11.0,8.7,4 .3Hz,1H),2.63-2.53(m,2H),2.31-2.19(m,1H),2.19-2.09(m,2H),2.06-1.99(m,1H),1.96 -1.87(m,1H),1.80-1.72(m,5H),1.69-1.57(m,5H),1.57-1.50(m,7H),1.50-1.44(m,2H),1. 44-1.33(m,2H),1.32-1.12(m,6H),1.12-1.01(m,1H),0.98(d,J=6.4Hz,3H),0.94-0.88(m, 6H),0.88-0.82(m,7H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.7Hz,3H),0.54(q,J=11.8Hz,1H).

[0272] Example 7. Synthesis of Compound 13 and Compound 14

change

[0273] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 13 (12.3 mg, 9.19% yield) as a white solid.

[0274] Compound 13:ESIMS[M+NH4] + 1020.8, [M+FA-H] - 1047.9 1H NMR(400MHz,DMSO-d6)δ:7.46(d,J=9.3Hz,1H),6.59(s,1H),6.43(dd,J=13.9,11.0Hz,1H),6.29-6.21( m,1H),6.21-6.13(m,1H),5.92(dd,J=11.0,1.5Hz,1H),5.50(dd,J=14.2,9.6Hz,1H),5.05(d,J=4.7Hz,1 H),4.97-4.90(m,1H),4.86-4.78(m,1H),4.65-4.56(m,2H),3.97-3.90(m,1H),3.89-3.84(m,1H),3.71 -3.65(m,1H),3.65-3.58(m,1H),3.55-3.49(m,1H),3.47-3.40(m,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H ),3.20-3.14(m,1H),3.12(s,3H),2.91-2.79(m,2H),2.26-2.17(m,3H),2.17-2.09(m,2H),2.09-1.99( m,3H),1.96-1.87(m,3H),1.86-1.80(m,2H),1.80-1.71(m,5H),1.69-1.59(m,3H),1.57-1.50(m,3H),1. 48(s,3H),1.45-1.35(m,3H),1.35-1.25(m,2H),1.22-1.08(m,6H),1.07-1.00(m,1H),1.00-0.93(m,7H ),0.89-0.82(m,4H),0.78(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.71-0.63(m,1H),0.63-0.54(m,1H).

[0275] The 2nd method of dissolving the solvent and SFC melting material (Method 1) is to use it. Compound 14 (26.6 mg, 19.5% yield) was obtained as a purified, white solid.

[0276] Compound 14: ESIMS [M+NH4] + 1020.9,[MH] - 1002.0 1H NMR(400MHz,DMSO-d6)δ:7.27(d,J=8.2Hz,1H),6.47(s,1H),6.44-6.34(m,1H),6.17-6. 09(m,2H),6.04(dd,J=11.1,1.6Hz,1H),5.58-5.47(m,1H),5.07-4.98(m,3H),4.70-4.62 (m,1H),4.59(s,1H),4.03-3.96(m,1H),3.93-3.86(m,1H),3.85-3.81(m,1H),3.77(d,J =4.9Hz,1H),3.68-3.63(m,2H),3.31(s,3H),3.20-3.09(m,5H),2.81(ddd,J=11.2,8.6,4 .3Hz,1H),2.54-2.45(m,1H),2.27-2.14(m,6H),2.10-2.00(m,2H),1.95-1.82(m,3H),1 .77-1.70(m,5H),1.64-1.58(m,5H),1.58-1.53(m,3H),1.53(s,3H),1.49-1.43(m,2H),1 .43-1.33(m,3H),1.33-1.23(m,1H),1.23-1.11(m,5H),1.09-1.01(m,1H),0.98(d,J=6.5 Hz,3H),0.94-0.88(m,2H),0.87-0.81(m,7H),0.80-0.74(m,6H),0.53(q,J=11.8Hz,1H).

[0277] Example 8. Synthesis of Compound 15 and Compound 16 [ka] To a solution of intermediate 1 (120 mg, 0.133 mmol) and cyclopentanesulfonamide (298 mg, 2.00 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.67 mL, 0.67 mmol). The reaction mixture was stirred for 11 min at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 50:50).

[0278] The first eluting diastereomer was purified using SFC chromatography (Method 1) followed by preparative HPLC (Method 2) to give compound 15 (4.8 mg, 3.4% yield) as a white solid.

[0279] Compound 15:ESIMS[M+NH4] + 1034.9,[MH] - 1015.9 1 H NMR(400MHz,DMSO-d6)δ:7.48(d,J=9.2Hz,1H),6.54(s,1H),6.43(dd,J=14.1,11.0Hz,1H),6.23( dd,J=14.3,10.7Hz,1H),6.20-6.11(m,1H),5.95(dd,J=10.9,1.6Hz,1H),5.49(dd,J=14.2,9.6Hz ,1H),5.05(s,1H),4.97-4.89(m,1H),4.86-4.77(m,1H),4.71-4.51(m,2H),4.00-3.90(m,1H),3. 90-3.83(m,1H),3.78-3.68(m,1H),3.68-3.59(m,1H),3.50-3.40(m,1H),3.32(s,3H),3.24-3.20 (m,1H),3.20-3.14(m,2H),3.12(s,3H),2.92-2.80(m,2H),2.28-2.17(m,1H),2.16-2.08(m,1H), 2.08-1.99(m,2H),1.96-1.87(m,3H),1.85-1.78(m,7H),1.76-1.72(m,1H),1.69-1.59(m,6H),1. 53-1.46(m,8H),1.44-1.36(m,3H),1.34-1.26(m,2H),1.22-1.09(m,6H),1.02-0.93(m,8H),0.88 -0.83(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.63(m,1H),0.63-0.53(m,1H).

[0280] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 16 (22.8 mg, 16.3% yield) as a white solid.

[0281] Compound 16:ESIMS[M+NH4] + 1034.5,[MH] - 1015.5 1 H NMR(400MHz,DMSO-d6)δ:7.53-7.11(m,1H),6.47-6.30(m,2H),6.19-6.09(m,2H),6.09-6.02(m ,1H),5.53(dd,J=14.1,8.9Hz,1H),5.18-4.90(m,3H),4.66(ddd,J=9.5,6.2,2.5Hz,1H),4.63- 4.52(m,1H),4.04-3.96(m,1H),3.96-3.87(m,1H),3.79(d,J=4.8Hz,1H),3.72-3.65(m,1H),3. 65-3.60(m,1H),3.60-3.51(m,1H),3.31(s,3H),3.20-3.10(m,5H),2.87-2.76(m,1H),2.57-2. 45(m,1H),2.28-2.20(m,1H),2.20-2.14(m,1H),2.11-2.00(m,2H),1.92-1.80(m,5H),1.79-1. 69(m,5H),1.69-1.61(m,5H),1.60-1.53(m,7H),1.51(s,3H),1.50-1.43(m,2H),1.43-1.33(m, 3H),1.31-1.27(m,1H),1.24-1.13(m,5H),1.09-1.01(m,1H),0.98(d,J=6.5Hz,3H),0.94-0.87 (m,3H),0.86-0.80(m,6H),0.78(d,J=6.7Hz,3H),0.75(d,J=6.6Hz,3H),0.53(q,J=11.9Hz,1H).

[0282] Example 9. Synthesis of Compound 17 and Compound 18 [ka] To a solution of intermediate 1 (100 mg, 0.111 mmol) and 3-chloropropane-1-sulfonamide (263 mg, 1.67 mmol) in DCM (3 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.56 mL, 0.56 mmol). The reaction mixture was stirred for 10 min at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 40:60).

[0283] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 17 (8.0 mg, 6.8% yield) as a white solid.

[0284] Compound 17:ESIMS[M+NH4] + 1042.4,[MH] - 1023.3 1H NMR(400MHz,DMSO-d6)δ:7.69(d,J=9.0Hz,1H),6.60(s,1H),6.41(dd,J=14.1,11.0Hz,1H),6. 23(dd,J=14.1,10.5Hz,1H),6.17(dd,J=14.4,10.5Hz,1H),6.03-5.91(m,1H),5.49(dd,J=14.4 ,9.6Hz,1H),5.05(d,J=4.6Hz,1H),4.98-4.90(m,1H),4.86-4.77(m,1H),4.68-4.55(m,2H),3. 99-3.90(m,1H),3.88(dd,J=9.2,3.8Hz,1H),3.77-3.56(m,4H),3.51-3.40(m,1H),3.31(s,3H) ,3.25-3.16(m,2H),3.12(s,3H),3.05-2.94(m,1H),2.92-2.80(m,3H),2.29-2.17(m,1H),2.17 -2.08(m,1H),2.08-1.98(m,4H),1.96-1.87(m,3H),1.82(s,3H),1.78-1.60(m,5H),1.55-1.45 (m,6H),1.44-1.34(m,4H),1.32-1.25(m,1H),1.23-1.08(m,6H),1.04-0.94(m,8H),0.88-0.82 (m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.65(d,J=9.5Hz,1H),0.63-0.51(m,1H).

[0285] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 18 (15.0 mg, 12.9% yield) as a white solid.

[0286] Compound 18:ESIMS[M+NH4] + 1042.4,[MH] - 1023.4 1H NMR(400MHz,DMSO-d6)δ:7.48(d,J=7.9Hz,1H),6.45(s,1H),6.43-6.35(m,1H),6 .20-6.10(m,2H),6.09-6.03(m,1H),5.53(dd,J=14.2,8.9Hz,1H),5.09-4.97(m, 3H),4.71-4.62(m,1H),4.59(d,J=4.4Hz,1H),4.03-3.96(m,1H),3.93-3.83(m,1 H),3.80-3.69(m,4H),3.68-3.58(m,1H),3.31(s,3H),3.20-3.11(m,6H),3.08-3. 02(m,1H),2.81(ddd,J=11.1,8.6,4.3Hz,1H),2.55-2.50(m,1H),2.29-2.19(m,1 H),2.16-2.02(m,5H),1.96-1.85(m,1H),1.80-1.70(m,5H),1.69-1.34(m,16H),1 .33-1.10(m,6H),1.09-1.02(m,1H),1.00-0.97(m,3H),0.94-0.89(m,2H),0.88- 0.81(m,7H),0.79(d,J=6.6Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.9Hz,1H).

[0287] Example 10. Synthesis of Compound 19 and Compound 20 [ka] To a solution of intermediate 1 (100 mg, 0.111 mmol) and 2-hydroxyethanesulfonamide (139 mg, 1.11 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.55 mL, 0.55 mmol). The reaction mixture was stirred for 30 min at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give a product mixture of both diastereomers. The diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 70:30).

[0288] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 19 (2.2 mg, 1.8% yield) as a white solid.

[0289] Compound 19:ESIMS[MH] - 991.9 1 H NMR(400MHz,DMSO-d6)δ:6.44(dd,J=14.0,10.9Hz,1H),6.29-6.13(m,2H),5.96(d,J=10.6Hz,1H),5.50(dd,J=14.2,9.6Hz,1H),4.96-4. 90(m,1H),4.82(d,J=9.9Hz,1H),4.68-4.56(m,1H),3.97-3.84(m,2H),3.78-3.68(m,1H),3.68-3.58(m,3H),3.48-3.40(m,1H),3.39-3. 26(m,3H),3.24-3.13(m,2H),3.12(s,3H),3.05-2.79(m,4H),2.28-2.18(m,1H),2.18-1.99(m,3H),1.99-1.83(m,3H),1.81(s,3H),1.79 -1.58(m,5H),1.57-1.08(m,17H),1.06-0.89(m,8H),0.89-0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.53(m,2H).

[0290] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 20 (9.0 mg, 7.8% yield) as a white solid.

[0291] Compound 20:ESIMS[MH] - 991.9 1H NMR(400MHz,DMSO-d6)δ:7.32(d,J=7.8Hz,1H),6.50-6.32(m,2H),6.21-6.08(m,2H),6.08-6.03(m,1H),5.56(dd,J=14.1,8.7Hz,1H),5.06 -4.99(m,3H),4.85(s,1H),4.71-4.62(m,1H),4.61-4.54(m,1H),4.02 -3.88(m,2H),3.81-3.67(m,4H),3.65-3.58(m,1H),3.37-3.25(m,3H) ,3.20-3.09(m,7H),2.85-2.77(m,1H),2.60-2.53(m,1H),2.28-2.19( m,1H),2.19-1.96(m,3H),1.95-1.87(m,1H),1.82-1.70(m,5H),1.69- 1.35(m,16H),1.33-1.11(m,6H),1.11-0.96(m,4H),0.95-0.81(m,9H),0.79(d,J=6.6Hz,3H),0.75(d,J=6.6Hz,3H),0.54(q,J=11.8Hz,1H).

[0292] Example 11. Synthesis of Compound 21 and Compound 22 [ka] To a solution of intermediate 2 (100 mg, 0.105 mmol) and methanesulfonamide (100 mg, 1.05 mmol) in DCM (25 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.53 mL, 0.53 mmol). The reaction mixture was stirred for 1 h at room temperature. The reaction was diluted with H2O and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give the product mixture of both diastereomers. The diastereomeric mixture was separated by reverse phase preparative HPLC chromatography (Method 1).

[0293] The first eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 21 (4.5 mg, 4.0% yield) as a white solid.

[0294] Compound 21:ESIMS[MH] - 1014.0 1 H NMR(400MHz,DMSO-d6)δ:9.28(s,1H),7.27(s,1H),6.58-6.34(m,2H),6.26-6.08(m,2H),6.09-6.00(m,1H),5.53(dd,J=14. 1,8.8Hz,1H),5.24-5.12(m,1H),5.09-4.97(m,3H),4.76-4.64(m,1H),3.99-3.96(m,1H),3.95-3.85(m,1H),3.84-3.75(m,1 H),3.67(d,J=5.7Hz,1H),3.64-3.56(m,2H),3.45-3.17(m,4H),3.14(s,3H),2.88(s,3H),2.62-2.54(m,1H),2.30-2.08(m, 4H),2.08-1.99(m,1H),1.98-1.87(m,1H),1.83-1.34(m,22H),1.33-1.14(m,5H),1.12-0.79(m,16H),0.69(d,J=6.7Hz,3H).

[0295] The second eluting diastereomer was purified using SFC chromatography (Method 1) to give compound 22 (5.5 mg, 4.8% yield) as a white solid.

[0296] Compound 22:ESIMS[MH] - 1014.1 1H NMR(400MHz,DMSO-d6)δ:9.32(s,1H),7.48(s,1H),6.72-6.38(m,2H),6.33-6.12(m,2H),5.98(d,J=10.9Hz,1H),5.50(dd,J=14.2,9.6Hz ,1H),5.26-5.15(m,1H),5.05(s,1H),4.99-4.92(m,1H),4.83(d,J=9.8Hz,1H),4.64-4.54(m,1H),3.97-3.80(m,2H),3.79-3.70(m,1H), 3.68-3.57(m,2H),3.48-3.41(m,1H),3.26(s,3H),3.21(d,J=9.2Hz,1H),3.09(s,3H),2.91-2.78(m,1H),2.71(s,3H),2.30-1.85(m,7H) ,1.80(s,3H),1.77-1.61(m,5H),1.61-1.35(m,13H),1.33-0.89(m,14H),0.86(d,J=6.5Hz,3H),0.81(d,J=6.7Hz,3H),0.77-0.55(m,4H).

[0297] Example 12. Synthesis of Compound 23 and Compound 24 [ka] To a solution of intermediate 3 (100 mg, 0.102 mmol) and methanesulfonamide (97 mg, 1.0 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.51 mL, 0.51 mmol). The reaction mixture was stirred for 30 min at room temperature. The reaction was diluted with H2O and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure to give the product mixture of both diastereomers. The diastereomeric mixture was separated by reverse phase preparative HPLC chromatography (Method 1).

[0298] The first eluting diastereomer was isolated to give compound 23 (5.6 mg, 4.6% yield) as a white solid.

[0299] Compound 23:ESIMS[MH] - 1037.4 1 H NMR(400MHz,DMSO-d6)δ:7.30(d,J=7.7Hz,1H),6.48(s,1H),6.46-6.33(m,1H),6.23-6.08(m,2H),6.05(d,J=11.0Hz,1H),5.54( dd,J=14.2,8.8Hz,1H),5.11-4.97(m,3H),4.73-4.62(m,1H),4.06-3.84(m,3H),3.81-3.70(m,2H),3.68-3.59(m,1H),3.37-3.26 (m,3H),3.21-3.11(m,4H),3.11-2.99(m,1H),2.89(s,3H),2.59-2.51(m,1H),2.30-1.86(m,6H),1.80-1.68(m,4H),1.66-1.46(m ,14H),1.46-1.11(m,14H),1.10-0.87(m,7H),0.88-0.82(m,6H),0.79(d,J=6.6Hz,3H),0.75(d,J=6.6Hz,3H),0.69-0.52(m,1H).

[0300] The second eluting diastereomer was purified using SFC chromatography (Method 1) followed by reverse-phase preparative HPLC chromatography (Method 3) to give compound 24 (5.3 mg, 4.7% yield) as a white solid.

[0301] Compound 24:ESIMS[MH] - 1037.9 1H NMR(400MHz,DMSO-d6)δ:7.49(d,J=9.3Hz,1H),6.60(s,1H),6.45(dd,J=14.1,11.1Hz,1H),6.31-6.11(m,2H),5.98(d,J=10.9Hz,1H),5.50(dd,J=14 .3,9.6Hz,1H),5.06(d,J=4.6Hz,1H),5.01-4.91(m,1H),4.82(d,J=9.8Hz, 1H),4.62-4.52(m,1H),4.06-3.80(m,3H),3.78-3.68(m,1H),3.68-3.56(m ,1H),3.50-3.40(m,1H),3.29(s,3H),3.23(d,J=9.1Hz,1H),3.12(s,3H),3 .08-2.98(m,1H),2.91-2.77(m,1H),2.71(s,3H),2.30-1.84(m,8H),1.81( s,3H),1.78-1.59(m,4H),1.58-1.27(m,19H),1.26-1.09(m,4H),1.08-0.9 0(m,10H),0.86(d,J=6.4Hz,3H),0.80(d,J=6.7Hz,3H),0.76-0.60(m,4H).

[0302] Example 13. Synthesis of intermediate 4-A, intermediate 4-B, and compound 25 [ka] To a solution of intermediate 4 (100 mg, 0.094 mmol) and methanesulfonamide (180 mg, 1.88 mmol) in DCM (10 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.47 mL, 0.47 mmol). The reaction mixture was stirred for 30 min at room temperature. The reaction was diluted with H2O and extracted with dichloromethane. The organic extracts were evaporated under reduced pressure. The crude product was separated by flash chromatography (silica; cyclohexane / EtOAc 100:0 to 0:100).

[0303] The first eluting peak, containing a mixture of diastereomers, was separated using SFC chromatography (Method 1) to give Intermediate 4-A (6.0 mg, 5.4% yield) as a white solid.

[0304] Intermediate 4-A:ESIMS[MH] - 1119.9 1 H NMR(400MHz,DMSO-d6)δ:7.49(d,J=9.4Hz,1H),6.59(s,1H),6.43(dd,J=14.4,11.1H z,1H),6.30-6.11(m,2H),5.98(d,J=11.2,1.5Hz,1H),5.51(dd,J=14.6,9.5Hz,1H), 5.05(d,J=4.7Hz,1H),4.97-4.90(m,1H),4.86-4.77(m,1H),4.65-4.56(m,1H),3.99 -3.80(m,2H),3.78-3.69(m,1H),3.68-3.58(m,3H),3.57-3.50(m,2H),3.48-3.40(m ,1H),3.31(s,3H),3.22(d,J=9.2Hz,1H),3.16-3.05(m,4H),3.04-2.93(m,1H),2.90 -2.76(m,1H),2.70(s,3H),2.27-2.18(m,1H),2.17-1.84(m,7H),1.81(s,3H),1.77- 1.59(m,3H),1.59-1.45(m,6H),1.44-1.08(m,12H),1.07-0.91(m,8H),0.90-0.81(m ,14H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.70-0.57(m,1H),0.03(s,6H).

[0305] The fraction from the SFC purification, containing the second diastereomer, was purified by reverse-phase preparative HPLC chromatography (Method 4) to afford intermediate 4-B (5.0 mg, 4.2% yield) as a white solid.

[0306] Intermediate 4-B:ESIMS[MH] - 1119.6 1H NMR(400MHz,DMSO-d6)δ:7.29(d,J=7.6Hz,1H),6.46(s,1H),6.44-6.33(m, 1H),6.23-6.08(m,2H),6.05(d,J=11.1Hz,1H),5.54(dd,J=14.2,9.0Hz,1H ),5.07-4.96(m,3H),4.74-4.62(m,1H),4.01-3.96(m,1H),3.95-3.87(m,1 H),3.81-3.69(m,2H),3.68-3.58(m,3H),3.56-3.50(m,2H),3.38-3.25(m, 3H),3.23-3.11(m,4H),3.10-3.00(m,1H),3.00-2.91(m,1H),2.89(s,3H), 2.60-2.52(m,1H),2.28-2.18(m,1H),2.18-2.01(m,3H),2.00-1.84(m,2H) ,1.80-1.70(m,4H),1.70-1.46(m,17H),1.46-1.00(m,6H),1.00-0.91(m,4 H),0.91-0.81(m,16H),0.80-0.69(m,7H),0.65-0.51(m,1H),0.03(s,6H).

[0307] The second eluting peak was purified using SFC chromatography (Method 1) to give compound 25 (5.5 mg, 5.5% yield) as a white solid.

[0308] Compound 25:ESIMS[MH] - 1005.4 1H NMR(400MHz,DMSO-d6)δ:7.30(d,J=7.8Hz,1H),6.47(s,1H),6.40(dd,J=13.7,11.2Hz,1H),6.20-6.08(m,2H),6.05(d,J=11.0Hz,1H),5.54(dd,J=14. 3,8.8Hz,1H),5.08-4.97(m,3H),4.70-4.62(m,1H),4.49-4.38(m,1H),4.0 2-3.96(m,1H),3.95-3.87(m,1H),3.80-3.70(m,2H),3.67-3.58(m,1H),3.5 5-3.41(m,4H),3.37-3.24(m,3H),3.22-3.10(m,4H),3.04-2.92(m,2H),2. 89(s,3H),2.60-2.49(m,1H),2.27-2.19(m,1H),2.18-1.99(m,3H),1.98-1 .87(m,2H),1.83-1.71(m,4H),1.70-1.34(m,15H),1.32-1.00(m,7H),1.00 -0.88(m,5H),0.88-0.81(m,8H),0.81-0.69(m,6H),0.59(q,J=11.7Hz,1H).

[0309] Example 14. Synthesis of Compound 26 [ka] To a mixture of intermediate 4-B (30 mg, 0.027 mmol) in hexane (1 mL), EtOAc (1 mL), and HO (1 mL) was added acetic acid (0.1 mL). The reaction mixture was stirred for 4 h at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure. The crude product was purified by SFC chromatography (Method 1) to give compound 26 (4.5 mg, 16% yield) as a white solid.

[0310] Compound 26:ESIMS[MH] - 1005.9 1H NMR(400MHz,DMSO-d6)δ:7.49(d,J=9.3Hz,1H),6.59(s,1H),6.44(dd,J=14. 3,11.0Hz,1H),6.30-6.11(m,2H),6.02-5.94(m,1H),5.50(dd,J=14.5,9.5H z,1H),5.05(d,J=4.6Hz,1H),4.98-4.89(m,1H),4.82(d,J=9.8Hz,1H),4.64 -4.54(m,1H),4.46(s,1H),3.99-3.78(m,2H),3.77-3.68(m,1H),3.68-3.58( m,1H),3.57-3.41(m,5H),3.40-3.26(m,3H),3.22(d,J=9.2Hz,1H),3.12(s, 3H),3.10-2.93(m,2H),2.91-2.77(m,1H),2.70(s,3H),2.28-1.83(m,8H),1. 81(s,3H),1.77-1.46(m,10H),1.45-1.07(m,12H),1.07-0.89(m,8H),0.89- 0.82(m,4H),0.79(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.71-0.55(m,1H).

[0311] Example 15. Synthesis of Compound 27 [ka] To a solution of intermediate 3 (100 mg, 0.102 mmol) and N-methylmethanesulfonamide (112 mg, 1.02 mmol) in DCM (7 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.51 mL, 0.51 mmol). The reaction mixture was stirred for 30 min at room temperature. The reaction was diluted with HO and extracted with ethyl acetate. The organic extracts were evaporated under reduced pressure. The crude product was purified using SFC chromatography (Method 1) to give compound 27 (25 mg, 22% yield) as a white solid.

[0312] Compound 27:ESIMS[MH] - 1051.4 1H NMR(400MHz,DMSO-d6)δ:6.49(dd,J=14.1,10.9Hz,1H),6.35(s,1H),6.30-6.12(m,2H),5.99(d,J=10.9Hz,1H),5.46(dd ,J=14.4,9.7Hz,1H),5.07(d,J=4.9Hz,1H),4.98-4.87(m,2H),4.75-4.63(m,1H),4.60-4.48(m,1H),4.02-3.90(m,2H), 3.80-3.69(m,1H),3.68-3.55(m,1H),3.53-3.26(m,5H),3.22-2.97(m,7H),2.84-2.72(m,1H),2.51(s,3H),2.29-2.13( m,2H),2.13-1.89(m,4H),1.80(s,3H),1.76-1.06(m,30H),1.04-0.90(m,8H),0.88(d,J=6.3Hz,3H),0.83-0.59(m,8H).

[0313] Example 16. Synthesis of Compound 28 and Compound 29 [ka] Diastereomer 1: A solution of intermediate 7 (68 mg, 0.069 mmol) in HCl (4 M solution in dioxane, 1.35 mL, 5.52 mmol) was stirred for 1 h at room temperature. The reaction was directly lyophilized to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 1) to give compound 28 (4.4 mg, 6.7% yield) as a white solid.

[0314] Compound 28:ESIMS[M+H] + 885.6, [M+FA-H] - 929.6 1H NMR(400MHz,DMSO-d6)δ:6.47-6.40(m,1H),6.21-6.12(m,2H),5.96-5.87(m,1H),5. 46(dd,J=14.0,9.2Hz,1H),4.98-4.93(m,1H),4.89-4.81(m,1H),4.66-4.59(m,1H), 4.02-3.94(m,1H),3.91-3.86(m,1H),3.64-3.55(m,1H),3.48-3.40(m,1H),3.31(s, 3H),3.29-3.24(m,2H),3.21-3.16(m,1H),3.12(s,3H),2.88-2.80(m,2H),2.24-2.17 (m,1H),2.17-2.10(m,1H),2.09-2.01(m,1H),1.97-1.90(m,2H),1.88-1.82(m,1H), 1.81-1.74(m,5H),1.74-1.70(m,2H),1.68-1.61(m,2H),1.54-1.47(m,6H),1.44-1.3 7(m,3H),1.34-1.27(m,2H),1.25-1.09(m,6H),1.07-1.00(m,2H),0.98-0.95(m,6H) ,0.88-0.83(m,4H),0.79(d,J=6.7Hz,3H),0.75-0.69(m,4H),0.59(q,J=11.9Hz,1H).

[0315] Diastereomer 2: A solution of intermediate 8 (75 mg, 0.076 mmol) in HCl (4 M solution in dioxane, 0.95 mL, 3.8 mmol) was stirred at room temperature for 1 h. The reaction was directly lyophilized to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 1) to give compound 29 (10.9 mg, 15.8% yield) as a white solid.

[0316] Compound 29:ESIMS[M+H] + 885.9, [M+FA-H] - 930.2 1H NMR(400MHz,DMSO-d6)δ:6.50-6.40(m,1H),6.24-6.11(m,3H),5.60(dd,J=14.1,8 .7Hz,1H),5.06-5.01(m,1H),4.95(d,J=9.7Hz,1H),4.70-4.63(m,1H),4.04-3.98( m,1H),3.98-3.92(m,1H),3.69-3.61(m,2H),3.57(d,J=6.8Hz,1H),3.31(s,3H),3. 27-3.21(m,1H),3.20-3.16(m,1H),3.15(s,3H),2.82(ddd,J=11.2,8.7,4.4Hz,1H) ,2.76-2.67(m,1H),2.29-2.20(m,1H),2.19-2.13(m,1H),2.12-2.01(m,2H),1.95- 1.89(m,1H),1.85-1.80(m,3H),1.78-1.71(m,3H),1.68-1.55(m,5H),1.55-1.49(m ,6H),1.49-1.46(m,2H),1.45-1.38(m,2H),1.33-1.10(m,7H),1.02-0.97(m,4H),0 .92-0.85(m,5H),0.84-0.79(m,6H),0.74(d,J=6.7Hz,3H),0.57(q,J=11.8Hz,1H).

[0317] The absolute configuration of the C16 substituent in compound 29 was determined by X-ray crystallography of co-crystallization with FKBP12. Based on the X-ray co-crystal structure, the C16 substituent in compound 29 has the (R)-configuration. The crystal structure is depicted in Figure 2.

[0318] Example 17. Synthesis of Compound 30 and Compound 31 [ka] To a mixture of intermediate 1 (350 mg, 0.389 mmol) and tert-butyl methylcarbamate (765 mg, 5.83 mmol) in DCM (3 mL) was added 4-methylbenzenesulfonic acid hydrate (74 mg, 0.389 mmol). The reaction mixture was stirred for 23 h at room temperature. The entire reaction mixture, containing the product mixture of both diastereomers, was separated by reverse phase flash chromatography (C18; MeCN / H2O 40:60 to 90:10).

[0319] The first eluting diastereomer was purified using SFC chromatography (Method 3) followed by preparative HPLC (Method 2) to give compound 30 (22 mg, 5.4% yield) as a white solid.

[0320] Compound 30:ESIMS[M+NH4] + 1017.2, [M+FA-H] - 1044.2 1H NMR(400MHz,DMSO-d6)δ:6.61-6.51(m,1H),6.50-6.45(m,1H),6.24-6.15(m,2H),5.99(d ,J=11.0Hz,1H),5.66(dd,J=14.2,8.4Hz,1H),5.07(d,J=4.7Hz,1H),5.04-5.00(m,1H),4. 89(d,J=9.6Hz,1H),4.72-4.65(m,1H),4.59(d,J=4.4Hz,1H),4.48-4.29(m,1H),3.91(dd, J=8.6,4.6Hz,1H),3.73-3.61(m,1H),3.54-3.42(m,2H),3.34(d,J=8.1Hz,1H),3.30(s,3H ),3.20-3.16(m,1H),3.14(s,3H),2.96-2.88(m,1H),2.86-2.79(m,1H),2.59(s,3H),2.28 -2.19(m,2H),2.17-2.10(m,1H),2.08-2.00(m,2H),1.96-1.90(m,1H),1.86-1.80(m,1H), 1.77-1.62(m,8H),1.56-1.46(m,6H),1.43-1.26(m,17H),1.23-1.09(m,4H),1.07-1.02(m ,1H),1.01-0.94(m,6H),0.89-0.81(m,8H),0.73(d,J=6.7Hz,3H),0.58(q,J=11.9Hz,1H).

[0321] The second eluting diastereomer was purified using SFC chromatography (Method 3) followed by preparative HPLC (Method 2) to give compound 31 (45 mg, 11.2% yield) as a white solid.

[0322] Compound 31:ESIMS[M+NH4] + 1017.2, [M+FA-H] - 1044.3 1H NMR(400MHz,DMSO-d6)δ:6.49-6.40(m,1H),6.27-6.11(m,2H),5.98-5.84(m,1H ),5.53-5.36(m,1H),5.10-5.05(m,1H),5.02-4.91(m,2H),4.64-4.54(m,2H),4. 44-4.19(m,1H),4.06-3.92(m,1H),3.77-3.64(m,1H),3.65-3.50(m,2H),3.51- 3.39(m,1H),3.33(s,3H),3.21-3.16(m,1H),3.13(s,3H),2.90-2.79(m,1H),2.6 9-2.61(m,1H),2.51(s,3H),2.26-2.13(m,2H),2.09-2.00(m,2H),1.94-1.88(m ,1H),1.78-1.67(m,5H),1.67-1.65(m,1H),1.63-1.48(m,10H),1.47-1.44(m,1H ),1.42-1.30(m,12H),1.29-1.22(m,3H),1.22-1.12(m,4H),1.12-1.01(m,1H), 1.01-0.95(m,4H),0.92-0.81(m,8H),0.80-0.73(m,6H),0.60(q,J=11.9Hz,1H).

[0323] Example 18. Synthesis of Compound 32 and Compound 33 [ka] Diastereomer 1: A solution of compound 31 (44 mg, 0.044 mmol) in HCl (4 M solution in dioxane, 550 μL, 2.20 mmol) was stirred at room temperature for 6 min. The reaction was directly lyophilized to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 2) to give compound 32 (11.5 mg, 27.4% yield) as a white solid.

[0324] Compound 32:ESIMS[M+H] + 899.9, [M+FA-H] - 945.2 1H NMR(400MHz,DMSO-d6)δ:9.08-8.59(m,2H),6.86(s,1H),6.51-6.41(m,1H),6.34-6.1 7(m,3H),5.71-5.60(m,1H),5.12-5.07(m,2H),4.96(d,J=9.5Hz,1H),4.70-4.63(m,1H ),4.60(d,J=4.4Hz,1H),4.14-4.03(m,1H),4.02-3.90(m,2H),3.76-3.65(m,1H),3.5 4(d,J=7.3Hz,1H),3.31(s,3H),3.25-3.17(m,1H),3.17-3.15(m,1H),3.14(s,3H),2.8 5-2.75(m,2H),2.43-2.37(m,3H),2.34-2.24(m,1H),2.21-2.12(m,2H),2.11-1.97(m ,2H),1.93-1.87(m,1H),1.81(s,3H),1.78-1.68(m,4H),1.65-1.44(m,11H),1.41-1.3 6(m,1H),1.35-1.24(m,5H),1.18-1.09(m,3H),1.01-0.97(m,4H),0.96-0.92(m,1H),0 .90(d,J=6.4Hz,3H),0.87-0.79(m,7H),0.73(d,J=6.7Hz,3H),0.56(q,J=11.8Hz,1H).

[0325] Diastereomer 2: A solution of compound 30 (60 mg, 0.060 mmol) in HCl (1.25 M solution in methanol, 2.9 mL, 3.60 mmol) was stirred for 8 h at room temperature. The reaction was evaporated under reduced pressure to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 2) to give compound 33 (3.6 mg, 6.3% yield) as a white solid.

[0326] Compound 33:ESIMS[M+H] + 900.0, [M+FA-H] - 944.0 1H NMR(400MHz,DMSO-d6)δ:9.19(d,J=150.7Hz,2H),6.72(s,1H),6.48(dd,J=14.3,11.1Hz,1H) ,6.31-6.16(m,3H),5.56(dd,J=14.6,9.5Hz,1H),5.04(d,J=5.0Hz,1H),4.94(dd,J=6.4,1.9 Hz,1H),4.81(d,J=9.8Hz,1H),4.67-4.59(m,2H),4.17-4.05(m,1H),3.87(dd,J=9.2,4.9Hz, 1H),3.65-3.52(m,2H),3.50-3.43(m,1H),3.32(s,3H),3.23(d,J=9.2Hz,1H),3.20-3.16(m, 1H),3.12(s,3H),2.91-2.82(m,2H),2.29(s,3H),2.23-2.10(m,3H),2.09-2.03(m,1H),2.00 -1.90(m,3H),1.86(s,3H),1.80-1.63(m,5H),1.56-1.50(m,3H),1.47(s,3H),1.44-1.35(m, 4H),1.33-1.25(m,1H),1.24-1.09(m,6H),1.04-0.94(m,8H),0.90-0.87(m,1H),0.84(d,J=6 .5Hz,3H),0.80(d,J=6.7Hz,3H),0.74(d,J=6.7Hz,3H),0.72-0.66(m,1H),0.65-0.54(m,1H).

[0327] Example 19. Synthesis of Compound 34 and Compound 35 [ka] To a mixture of intermediate 1 (150 mg, 0.167 mmol) and tert-butyl hydroxycarbamate (333 mg, 2.50 mmol) in DCM (5 mL) was added 4-methylbenzenesulfonic acid hydrate (9.51 mg, 0.0501 mmol). The reaction mixture was stirred for 3 h at room temperature. The entire reaction mixture was directly purified by flash chromatography (silica; MeCN / DCM 0:100 to 100:0). The second eluting peak gave the product mixture of both diastereomers.

[0328] The diastereomeric mixture was separated by SFC chromatography (Method 1).

[0329] The first eluting diastereomer gave compound 34 (32.4 mg, 19.0% yield) as a white solid.

[0330] Compound 34:ESIMS[M+NH4] + 1019.1, [M+FA-H] - 1046.1 1 H NMR(400MHz,DMSO-d6)δ:8.78(s,1H),6.47-6.37(m,1H),6.22-6.10(m,2H),5.97 (s,1H),5.97-5.90(m,1H),5.50-5.39(m,1H),5.06(d,J=4.7Hz,1H),5.02-4.94( m,2H),4.65-4.53(m,3H),4.05-3.94(m,1H),3.87-3.76(m,1H),3.60(d,J=6.5Hz ,1H),3.58-3.51(m,1H),3.39-3.34(m,1H),3.32(s,3H),3.23-3.16(m,1H),3.14 (s,3H),2.84(ddd,J=11.2,8.6,4.3Hz,1H),2.71-2.59(m,1H),2.24-2.11(m,2H) ,2.08-2.01(m,2H),1.95-1.88(m,1H),1.78-1.71(m,5H),1.64-1.46(m,10H),1. 44-1.35(m,13H),1.30-1.13(m,8H),1.11-1.03(m,1H),1.00-0.95(m,4H),0.92- 0.82(m,8H),0.79(d,J=6.8Hz,3H),0.76(d,J=6.7Hz,3H),0.58(q,J=11.9Hz,1H).

[0331] The second eluting diastereomer gave compound 35 (17 mg, 10.3% yield) as a white solid.

[0332] Compound 35:ESIMS[M+NH4] +1019.1, [M+FA-H] - 1046.1 1 H NMR(400MHz,DMSO-d6)δ:9.02(s,1H),6.55(s,1H),6.51-6.41(m,1H),6.24-6.13(m,2H), 5.96-5.90(m,1H),5.59-5.46(m,1H),5.02(d,J=4.7Hz,1H),4.99-4.93(m,1H),4.87-4.8 0(m,1H),4.69-4.61(m,1H),4.60(d,J=4.5Hz,1H),4.45-4.36(m,1H),3.87(dd,J=9.1,4. 4Hz,1H),3.85-3.76(m,1H),3.71-3.60(m,1H),3.54-3.44(m,1H),3.31(s,3H),3.23(d,J =9.2Hz,1H),3.21-3.15(m,1H),3.12(s,3H),2.91-2.79(m,2H),2.46-2.35(m,1H),2.29- 2.18(m,1H),2.17-2.10(m,1H),2.09-2.01(m,1H),1.98-1.89(m,2H),1.86(s,3H),1.79- 1.62(m,6H),1.55-1.46(m,6H),1.44-1.27(m,14H),1.25-1.09(m,6H),1.06-0.95(m,8H) ,0.89-0.83(m,4H),0.80(d,J=6.8Hz,3H),0.72(d,J=6.7Hz,4H),0.59(q,J=11.8Hz,1H).

[0333] Example 20. Synthesis of Compound 36 and Compound 37 [ka] Diastereomer 1: A solution of compound 34 (29.7 mg, 0.030 mmol) in HCl (4 M solution in dioxane, 445 μL, 1.78 mmol) was stirred at room temperature for 13 min. The reaction was directly lyophilized to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 2) to give compound 36 (10.5 mg, 38.1% yield) as a white solid.

[0334] Compound 36:ESIMS[M+H] + 902.0, [M+FA-H] - 946.0 1 H NMR(400MHz,DMSO-d6)δ:6.81-6.74(m,1H),6.54(s,1H),6.48-6.39(m,1H),6.17-6.08(m,2H),5.96( d,J=10.7Hz,1H),5.49(dd,J=14.1,8.9Hz,1H),5.05(d,J=4.6Hz,1H),5.03-4.98(m,2H),4.71-4.63(m ,1H),4.60(d,J=4.4Hz,1H),4.02-3.93(m,2H),3.66(d,J=6.0Hz,1H),3.63-3.53(m,1H),3.40-3.35(m ,1H),3.31(s,3H),3.25-3.19(m,1H),3.16-3.12(m,4H),2.86-2.80(m,1H),2.66-2.56(m,1H),2.27-2 .15(m,2H),2.12-2.07(m,1H),2.06-1.98(m,1H),1.95-1.88(m,1H),1.84-1.78(m,4H),1.74-1.69(m ,2H),1.64-1.60(m,2H),1.59-1.56(m,2H),1.55-1.51(m,5H),1.48-1.45(m,2H),1.41-1.37(m,1H),1 .37-1.27(m,4H),1.25-1.22(m,1H),1.21-1.14(m,4H),1.07-1.02(m,1H),1.00-0.96(m,4H),0.89-0. 85(m,5H),0.83(d,J=6.4Hz,3H),0.79(d,J=6.7Hz,3H),0.75(d,J=6.8Hz,3H),0.56(q,J=11.8Hz,1H).

[0335] Diastereomer 2: A solution of compound 35 (15.7 mg, 0.0157 mmol) in HCl (4 M solution in dioxane, 392 μL, 1.57 mmol) was stirred at room temperature for 13 min. The reaction was directly lyophilized to give the crude product. The crude diastereomer was purified by preparative HPLC (Method 2) to give compound 37 (4.0 mg, 27.5% yield) as a white solid.

[0336] Compound 37:ESIMS[M+H] + 901.6, [M+FA-H] - 945.6 1 H NMR(400MHz,DMSO-d6)δ:7.05-6.89(m,1H),6.48(s,1H),6.46-6.39(m,1H),6.18-6 .10(m,2H),5.89(dd,J=11.1,1.6Hz,1H),5.45(dd,J=14.0,9.4Hz,1H),5.04(d,J=4 .7Hz,1H),4.97-4.90(m,1H),4.90-4.83(m,1H),4.66-4.58(m,2H),4.00-3.93(m,1 H),3.91(dd,J=8.9,3.8Hz,1H),3.63-3.54(m,1H),3.48-3.39(m,1H),3.36-3.26(m, 5H),3.20-3.16(m,1H),3.12(s,3H),2.88-2.80(m,2H),2.26-2.19(m,1H),2.17-2. 10(m,1H),2.07-2.00(m,1H),1.97-1.85(m,3H),1.80-1.72(m,5H),1.70-1.61(m,4 H),1.54-1.47(m,6H),1.43-1.27(m,5H),1.23-1.11(m,6H),1.03-0.94(m,8H),0.8 8-0.83(m,4H),0.79(d,J=6.7Hz,4H),0.72(d,J=6.8Hz,3H),0.60(q,J=11.9Hz,1H).

[0337] Example 21. Synthesis of Compound 38 and Compound 39 [ka] Diastereomer 1: To a solution of intermediate 5 (15.4 mg, 0.0160 mmol) in DCM (1 mL) was added 4-methylbenzenesulfonic acid hydrate (3.0 mg, 0.016 mmol). The reaction mixture was stirred for 1 h at room temperature. The entire reaction mixture was directly purified by preparative HPLC (Method 2) to give compound 38 (11.3 mg, 70.6% yield) as a white solid.

[0338] Compound 38:ESIMS[M+H] + 994.0,[MH] - 992.1 1 H NMR(400MHz,DMSO-d6)δ:8.88-8.30(m,2H),6.71(s,1H),6.49(dd,J=14.6,11.0Hz,1H),6. 35-6.24(m,2H),6.20(dd,J=14.8,10.7Hz,1H),5.57(dd,J=14.8,9.6Hz,1H),5.04(d,J=4. 8Hz,1H),4.96-4.91(m,1H),4.81(d,J=9.8Hz,1H),4.66-4.61(m,1H),4.60(d,J=4.7Hz,1H) ),4.08-3.98(m,1H),3.91-3.85(m,1H),3.85-3.75(m,1H),3.68-3.57(m,1H),3.50-3.42( m,1H),3.32(s,3H),3.23(d,J=9.2Hz,1H),3.21-3.15(m,1H),3.12(s,3H),3.06-2.91(m,2 H),2.89-2.74(m,4H),2.25-2.08(m,3H),2.08-1.98(m,2H),1.98-1.89(m,2H),1.84(s,3H) ),1.78-1.62(m,5H),1.55-1.45(m,6H),1.44-1.28(m,5H),1.24-1.08(m,6H),1.04-0.93( m,8H),0.89-0.82(m,4H),0.80(d,J=6.8Hz,3H),0.75(d,J=6.7Hz,3H),0.69-0.54(m,2H).

[0339] Diastereomer 2: To a solution of intermediate 6 (13.7 mg, 0.0141 mmol) in DCM (1 mL) was added 4-methylbenzenesulfonic acid hydrate (2.67 mg, 0.0141 mmol). The reaction mixture was stirred for 1 h at room temperature. The entire reaction mixture was directly purified by preparative HPLC (Method 2) to give compound 39 (9.1 mg, 63.9% yield) as a white solid.

[0340] Compound 39:ESIMS[M+H]+ 993.9,[MH] - 991.9 1 H NMR(400MHz,DMSO-d6)δ:8.85-8.07(m,2H),6.53-6.45(m,1H),6.36(d,J=10.9Hz,1H),6.30-6 .20(m,2H),6.17(s,1H),5.74(dd,J=14.3,8.1Hz,1H),5.12-5.08(m,1H),5.08-5.05(m,1H),4 .93(d,J=9.5Hz,1H),4.76-4.67(m,1H),4.59(d,J=4.4Hz,1H),4.10-3.98(m,2H),3.94(dd,J= 7.7,5.0Hz,1H),3.71-3.61(m,1H),3.50(d,J=7.7Hz,1H),3.31(s,3H),3.25-3.18(m,1H),3.17 -3.09(m,5H),3.08-3.02(m,1H),2.89-2.78(m,4H),2.35-2.26(m,1H),2.24-2.18(m,1H),2.1 8-2.10(m,2H),2.10-1.99(m,1H),1.95-1.88(m,1H),1.81(s,3H),1.77-1.68(m,4H),1.65-1.5 9(m,2H),1.59-1.46(m,8H),1.46-1.38(m,1H),1.37-1.22(m,6H),1.21-1.12(m,3H),1.04-0. 97(m,4H),0.94-0.88(m,4H),0.87-0.78(m,7H),0.74(d,J=6.7Hz,3H),0.56(q,J=11.9Hz,1H).

[0341] Example 22. Synthesis of Compound 40 and Compound 41

change

[0342] Compound 40:ESIMS[M+H] + 1038.1,[MH] - 1036.1 1 H NMR(400MHz,DMSO-d6)δ:8.85-8.39(m,2H),6.71(s,1H),6.53-6.43(m,1H),6.37-6.24(m,2 H),6.23-6.14(m,1H),5.57(dd,J=15.0,9.6Hz,1H),5.03(d,J=4.9Hz,1H),4.97-4.90(m,1H ),4.81(d,J=9.8Hz,1H),4.67-4.54(m,1H),4.45(t,J=5.4Hz,1H),4.10-3.97(m,1H),3.92- 3.78(m,2H),3.68-3.57(m,1H),3.54-3.42(m,5H),3.32(s,3H),3.23(d,J=9.1Hz,1H),3.12( s,3H),3.10-3.01(m,2H),3.01-2.93(m,2H),2.90-2.83(m,1H),2.83-2.71(m,2H),2.25-2. 07(m,3H),2.06-2.01(m,1H),1.99-1.90(m,3H),1.83(s,3H),1.74-1.62(m,4H),1.58-1.50 (m,3H),1.47(s,3H),1.45-1.26(m,6H),1.26-1.06(m,6H),1.07-0.95(m,8H),0.94-0.90(m ,1H),0.84(d,J=6.5Hz,3H),0.80(d,J=6.7Hz,3H),0.75(d,J=6.7Hz,3H),0.70-0.56(m,2H).

[0343] Diastereomer 2: To a solution of intermediate 10 (9 mg, 0.008 mmol) in DCM (0.5 mL) was added 4-methylbenzenesulfonic acid hydrate (2.3 mg, 0.012 mmol). The reaction mixture was stirred for 1 h at room temperature. The entire reaction mixture was directly purified by preparative HPLC (Method 2) to give compound 41 (3.0 mg, 35.3% yield) as a white solid.

[0344] Compound 41:ESIMS[M+H] + 1037.9,[MH] - 1036.1 1 H NMR(400MHz,DMSO-d6)δ:8.90-8.13(m,2H),6.52-6.44(m,1H),6.34(d,J=11.0Hz,1H),6 .28-6.20(m,2H),6.19(s,1H),5.74(dd,J=14.2,7.9Hz,1H),5.11-5.06(m,2H),4.96-4. 90(m,1H),4.76-4.68(m,1H),4.44(t,J=5.4Hz,1H),4.11-3.97(m,2H),3.94(dd,J=7.6, 4.9Hz,1H),3.70-3.62(m,1H),3.52-3.45(m,5H),3.32(s,3H),3.28-3.19(m,1H),3.14( s,3H),3.08-2.92(m,4H),2.89-2.78(m,3H),2.35-2.26(m,1H),2.24-2.17(m,1H),2.16 -2.08(m,2H),1.96-1.89(m,2H),1.80(s,3H),1.75-1.59(m,6H),1.56-1.50(m,7H),1.4 6-1.40(m,1H),1.38-1.23(m,7H),1.21-1.14(m,2H),1.09-1.05(m,1H),1.03-0.98(m,4 H),0.93-0.89(m,4H),0.86-0.81(m,7H),0.74(d,J=6.7Hz,3H),0.62(q,J=11.7Hz,1H).

[0345] Example 23: Synthesis of Compound 42 [ka] Intermediate 1 (0.185 g, 0.206 mmol) was combined with N-methylmethanesulfonamide (0.188 ml, 2.06 mmol) in anhydrous dichloromethane (1.0 mL) in a reaction vial. The vial was capped and the mixture was vacuum purged with nitrogen twice. Trifluoroacetic acid (0.047 ml, 0.62 mmol) was added dropwise over 20 seconds. The reaction was stirred at room temperature for 30 minutes.

[0346] The reaction was quenched with saturated aqueous NaHCO3. The quenched mixture was extracted three times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted and concentrated.

[0347] The crude product was purified by silica gel flash column chromatography (0-50% acetone-heptane) to give compound 42 (0.063 g, 0.061 mmol, 29.8% yield) as a pale yellow solid.

[0348] Compound 42:ESIMS[M+NH4] + 995.8,[MH] - 976.0 HRMS: Calculated for C52H84N2O13SNa (sodium adduct) 999.5592. Found 999.5591 1H NMR(600MHz,chloroform-d)δ 6.43(dd,J=14.7,10.9Hz,1H),6.23(dd,J=14.7,10.6Hz,1H),6.12(dd,J=14.9,10.7Hz ,1H),5.97(d,J=10.9Hz,1H),5.35(dd,J=14.9,9.8Hz,1H),5.19(d,J=5.9Hz,1H),5.14( d,J=9.9Hz,1H),4.83(d,J=12.2Hz,1H),4.70-4.65(m,1H),4.18(d,J=5.7Hz,1H),3.91 (t,J=11.2Hz,1H),3.85(t,J=8.1Hz,1H),3.63(d,J=13.9Hz,1H),3.47-3.32(m,8H),3.3 0(s,3H),3.00(s,3H),2.95-2.89(m,2H),2.69-2.62(m,1H),2.55(s,3H),2.25(m,4H), 2.18-2.04(m,4H),1.99(dd,J=12.9,4.3Hz,2H),1.88-1.83(m,4H),1.80-1.68(m,3H),1 .68-1.60(m,4H),1.60-1.48(m,2H),1.44-1.40(m,2H),1.40-1.17(m,4H),1.09-1.03( m,4H),1.02-0.96(m,4H),0.96-0.88(m,4H),0.87-0.84(m,6H),0.65(q,J=12.0Hz,1H).

[0349] Determining absolute configuration The absolute configuration of the compounds at C16 was assigned from their respective HSQC NMR spectra using the chemical shifts of hydrogen atoms H25 and H27 and the relative shift Δf2 of hydrogen atom H6. The spectra were recorded on a Bruker Spectrospin (400 MHz). DMSO-d6 was usually used as the solvent. The relative chemical shifts of H25 and H27 were characteristic for the stereoisomers (R)-C16 and (S)-C16.

[0350] [Table 16]

[0351] The relative chemical shifts (Δf2) of the two C6 hydrogens indicate the absolute configuration of the C16 epimer.

[0352] [Table 17]

[0353] The X-ray structures of compound 2 (absolute configuration (S)-C16) and compound 29 (absolute configuration (R)-C16) served as references for stereochemical assignment. [ka]

[0354] [Table 18]

[0355] [Table 19]

[0356] Example 24: Bioassays and Data The activity of compounds according to the present disclosure was evaluated by the following in vitro and in vivo methods.

[0357] Pharmacological characteristics Materials and Methods Cell-based assay for determining rapalog potency. Rapalog potency was determined using a MEF TSC1- / - cell-based assay. MEF TSC1- / - cells are mouse embryonic fibroblasts that are deficient in the tuberous sclerosis protein-TSC1, which negatively regulates mTORC1 signaling, and therefore exhibit constitutive mTORC1 activation, resulting in phosphorylation (activation) of downstream molecules. This cell-based assay is used to measure inhibition (dephosphorylation) of S6 and 4EBP1 by rapalogs or other mTOR inhibitors.

[0358] MEF TSC1- / - cells were plated on poly-D-lysine coated 384-well Griener clear bottom plates and incubated overnight at 37°C, 5% CO2. The next day, cells were washed 8 times with "Hard starve" solution (1L DPBS + 1g D-(+) glucose + 10ml 7.5% sodium bicarbonate + 20ml 1M HEPES) and incubated for another 2 hours in the same solution. Cells were then treated with decreasing concentrations of compounds (8 steps of 3.16-fold dilutions) and incubated for 2 hours at 37°C, 5% CO2. Cells were fixed with 4% paraformaldehyde for 30 minutes, washed 5 times with TBS-EDTA, and then immunostained with fluorescently tagged antibodies for pS6 (Ser240 / 244) (Cell Signaling #9468) and p4EBP1 (Thr37 / 46) (Cell Signaling #5123). Nuclei were visualized by Hoechst (ThermoFisher Scientific #H3570) staining. Cells were imaged (InCell 600) using the respective fluorescent channel and the potency of mTOR inhibitors was evaluated as pS6 IC 50 (nM).

[0359] Animal husbandry, compound treatment, and tissue collection. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Novartis Institutes for Biomedical Research, Cambridge, MA, USA. Adult Sprague Dawley (SD) male rats were purchased from Envigo (Indianapolis, USA). Upon import, rats were housed in a specific pathogen-free facility with controlled temperature and lighting (22°C, 12-h light / 12-h dark cycle: lights on 0600 h / off 1800 h) and free access to food and water. Rats were allowed to acclimate for at least 3 days before starting the experiments.

[0360] Compound 2 and RAD001 were formulated for oral dosing. Blank formulations (no Compound 2 or RAD001) served as vehicle controls. Rats received one dose of Compound 2, RAD001 or the respective vehicle po. At the designated times after treatment, rats were anesthetized with 3.5% isoflurane and euthanized. Various organs were harvested and frozen in liquid nitrogen. Blood was collected via tail vein or cardiac puncture (fatal) and frozen for further pharmacokinetic analysis. All tissues were stored at -80°C until analysis.

[0361] Determination of Compound 2 and RAD001 concentrations in blood. Concentrations were determined using HPLC / mass spectrometry.

[0362] Protein extraction and immunoblotting. For protein extraction, snap-frozen tissues were lysed in MSD lysis buffer (MSD, Rockville, Maryland) supplemented with complete EDTA-free protease inhibitors and PhosSTOP phosphatase inhibitor tablets (Roche, Manheim, Germany) and centrifuged at 13,000 g for 20 min at 4°C. The resulting supernatant was used for immunoblotting. Protein was quantified by BCA protein assay (Thermo Scientific, MA). Samples were separated on 4-20% Criterion™ TGX™ Precast Midi Protein gels (Bio-Rad, CA) and transferred onto nitrocellulose membranes (Bio-Rad, CA) using the Trans Turbo Blot system (Bio-Rad, CA). Immunoblotting was performed with antibodies against p-S6 and t-S6 from Cell Signaling Technologies (all 1:1000 in TBS-T with 5% BSA). The "p" and "t" identifiers indicate the "phosphorylated" and "total" forms, respectively. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) detected by anti-GAPDH antibody (#5174, Cell Signaling Technologies, MA) was used as a protein loading control. HRP-conjugated secondary antibody against rabbit (#7074) was from Cell Signaling Technologies, MA. Chemiluminescent signals were generated using SuperSignal™ West Femto Enhanced Chemiluminescent Substrate (#34095, Thermo Scientific, MA) or Western Lightning® Plus-ECL Enhanced Chemiluminescence Substrate (NEL103001EA, Perkin Elmer, MA) and captured using a ChemiDoc MP Imaging System (Bio-Rad). The resulting digital images were converted to TIFF format and quantified using ImageJ software.

[0363] Generation of FKBP knockout cells. The CRISPR / Cas9 system was used to deliver ribonucleoprotein complexes containing guide RNA (gRNA) sequences targeting FKBP12 (GCCACTACTCACCGTCTCCT, pos. 1392950), FKBP12.6 (TGCCCCAAGCTCATCTAGCA, pos. 24063057), FKBP13 (GCAGATCGGGGTCAAGAAGC, pos. 64242479), FKBP25 (GGTTATAGGCTGTAACCAAG, pos. 45130715), FKBP52 (AAGACTCGGTCCCCAATCAT, pos. 2797173), and FKBP51 (TCATCAAGGCATGGGACATT, pos. 35620248) into 293T cells using the Amaxa® 4D-Nucleofector™ X Kit (Lonza, V4XC-2032). Cell clones were screened by immunoblotting with the following anti-FKBP specific antibodies: FKBP12 (Novus, NB300-508), FKBP12.6 (Abnova, H00002281-M01), FKBP13 (R&D Systems, MAB4356), FKBP25 (R&D Systems, MAB3955), FKBP52 (Cell signaling Technology, #11826), and FKBP51 (Cell signaling Technology, #12210). Single cell clones deficient in each FKBP were selected. Five-fold FKBP12 / 12.6 / 13 / 52 / 51 knockout cells and five-fold FKBP12 / 12.6 / 25 / 52 / 51 knockout cells were generated by sequentially knocking out five FKBP genes.

[0364] Treatment of wild type (WT) and FKBP12 knockout 293T cells with RAD001 and compound 2. WT, FKBP12 knockout, FKBP12 / 12.6 / 13 / 52 / 51 knockout, or FKBP12 / 12.6 / 25 / 52 / 51 knockout 293T cells were plated at a density of 30,000 cells per well in poly-D-lysine coated 96-well plates (Corning, #354461) in Dulbecco's modified Eagle's medium (ThermoFisher, #11995-065) supplemented with 10% fetal bovine serum (ThermoFisher, #16140-071). Cells were incubated at 37°C, 5% CO2 for 48 hours until they reached approximately 80% confluence. Cells were treated with RAD001 or compound 2 in triplicate, using 12 or 10 dose ranges from 1000 nM to 0.0033 nM, for 2 h at 37°C. Blank dimethyl sulfoxide (DMSO)-supplemented medium was used as a control for both compounds. Phosphorylation of S6K1 (Thr389) was detected by a sandwich ELISA kit (Cell signaling, #7063C) according to the manufacturer's protocol.

[0365] SPR assay to determine binding affinity to FK506 binding protein (FKBP). N-terminal avi-his6 tagged FKBP fusion proteins were expressed in E. coli and purified by nickel chromatography using standard procedures. Biotinylated his-avi-FKBP was immobilized on a streptavidin chip using a Biacore 8K (GE Healthcare). To determine the kinetics-affinity of rapalogs to FKBP, rapalogs were diluted in DMSO to 50x working concentration. Then, 3.1 uL of each rapalog solution was added to 150 uL of buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT) in a 384 deep-well plate (greiner bio-one / 78127) and mixed using a Biomek FX. A rapalog solution gradient (6 concentrations / 2-fold dilutions, 3.1-100 nM or 31-1000 nM or 310-10000 nM) was then injected at 45 uL / min for 120 s: contact and dissociation times were 1800 s in running buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO). Single cycle kinetic data were collected to obtain association rate ka (1 / Ms), dissociation rate kd (1 / s), and affinity K D A 1:1 binding model was fitted to determine the apparent kinetics-affinity of rapalogs bound to FKBP for ternary complex formation with mTOR. The rapalogs were diluted in DMSO to a final concentration of 500 μM in DMSO. 6-mTOR (amino acids 2019-2112) was diluted in buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT) to prepare a concentration gradient (6 concentrations / 2-fold dilutions, 15.6-500 nM). 3.1 uL of 500 μM rapalog solution was added to 150 uL of mTOR sample in a 384 deep-well plate (greiner bio-one / 78127) and mixed using a Biomek FX. The mTOR solution gradient was then injected at 45 uL / min for 120 s: contact and dissociation times were 1800 s in running buffer (50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO). Single cycle kinetic data yields the association rate ka (1 / Ms), dissociation rate kd (1 / s), and apparent affinity K for ternary complex formation. D To determine (M), a 1:1 binding model was fitted, see Tables 6 and 7 below.

[0366] The distinct pharmacology of rapalogs can be realized in different cell or tissue types depending on 1) the relative abundance of FKBP homologs in these cells / tissues and 2) the specificity of binding to these various FKBP homologs (Mol. Cell Biol. (2013) 33:1357-1367).

[0367] result In vitro potency of mTOR inhibitors was determined in MEF TSC1- / - cells using pS6 IC 50 (nM).

[0368] [Table 20]

[0369] [Table 21]

[0370] IC50 values ​​are calculated as the average from multiple assays.

[0371] The equilibrium dissociation constants (K D ) are shown below in Table 6.

[0372] [Table 22]

[0373] Apparent affinity K for ternary complex formation D (M) is shown below in Table 7.

[0374] [Table 23]

[0375] Pharmacokinetic profile of compound 2 in rats. To compare the bioavailability of compound 2 vs. RAD001 in rats, the compounds were formulated as solution formulations: compound 2 was formulated in 15% PEG300, 7.5% Solutol, 7.5% Cremophore EL in MilliQ water, and RAD001 was formulated in 10% PEG300, 10% Solutol HS15, 10% Cremophore EL in PBS. Compounds were administered intravenously (iv) at 3 mg / kg po and 1 mg / kg to 7-9 week old rats (N=3 per group) (Figures 3A and 3B). Bioavailability was 16% and 19%, iv terminal half-lives 19h and 9.5h, and clearances 13mL / min / kg and 32mL / min / kg for compound 2 and RAD001, respectively.

[0376] Compound 2 inhibits the mTORC1 pathway in rat liver. The ability of compound 2 to inhibit the mTORC1 pathway in vivo was determined in 4-6 month old rats (Figures 4A and 4B). Single doses of 1, 3, and 10 mg / kg compound 2 (formulated as a custom microemulsion preconcentrate, see, for example, Shavlakadze et al. J Gerontol A Biol Sci Med Sci. 73(7):845-852, 2018) resulted in significant dephosphorylation (inactivation) of S6 in rat liver (compared to vehicle control) (Figures 4A and 4B).

[0377] The inhibitory effect of compound 2 is less dependent on FKBP12 compared to RAD001. First, the phosphorylation level of S6K1 (Thr389) was measured in WT and FKBP12 knockout 293T cells treated with compound 2 or RAD001 (Figures 5A and 5B). S6K1 is a downstream target of mTORC1, and phosphorylation of its rapalog-sensitive Thr389 site is used as a function of mTORC1 activity (Lee, CH, Inoki, K. and Guan, KL (2007). mTOR pathway as a target in tissue hypertrophy. Annu. Rev. Pharmacol. Toxicol. 47, 443-467). In WT 293T cells, both RAD001 and compound 2 were effective in obtaining approximately 80% inhibition of S6K1 (Thr389) phosphorylation (Figure 5A). In the absence of FKBP12, about 70% dephosphorylation of S6K1 (Thr389) was still achieved by Compound 2, whereas RAD001 achieved only about 40% dephosphorylation of S6K1 (Thr389) (Figure 5B). These results indicate that other FKBP homologs may be responsible for the efficacy of Compound 2 in the absence of FKBP12.

[0378] Next, the inhibitory effects (potencies) of compound 2 and RAD001 were evaluated in 293T cells lacking five FKBPs: FKBP12 / 12.6 / 13 / 52 / 51, by measuring the phosphorylation level of S6K1 (Thr389) (Figure 5C). In these cells, RAD001 lost almost all its potency, whereas compound 2 was effective in inhibiting S6K1 (Thr389) (Figure 5C): at the highest concentration tested, compound 2 inhibited S6K1 (Thr389) by about 90% (Figure 5C). This result indicates that in the absence of FKBP12 / 12.6 / 13 / 52 / 51, the pharmacological effect of compound 2 may be mediated by another FKBP homologue.

[0379] To identify the FKBP homolog responsible for the inhibitory effect of compound 2 in the absence of FKBP12 / 12.6 / 13 / 51 / 52, the potency of compound 2 and RAD001 was evaluated by measuring the phosphorylation level of S6K1 (Thr389) in 293T cells lacking FKBP12 / 12.6 / 25 / 52 / 51 (Figure 5D). In these cells, neither RAD001 nor compound 2 was effective in inhibiting S6K1 (Thr389) (Figure 5D). This result indicates that FKBP25 is sufficient to mediate the inhibitory effect of compound 2 in the absence of other FKBP (FKBP12 / 12.6 / 13 / 51 / 52) homologs.

[0380] Without wishing to be bound by theory, in the absence of FKBP12, other FKBPs may potentiate the inhibitory effect of Compound 2. Thus, Compound 2 may target a broader range of cell types, including those with low levels of FKBP12 expression and sufficient levels of other FKBPs, compared to RAD001.

[0381] Having thus described several aspects of several embodiments, it is understood that various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure and are intended to be within the spirit and scope of this disclosure. Accordingly, the foregoing description and drawings are by way of example only. The invention as originally claimed in the present application is set forth below. [Claim 1] Formula (I) [ka] (where R 1 -OR a and 5-6 membered heteroaryl; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl, C 3~8 Cycloalkyl C 0~6 is alkyl; R 5 is H or C 1~6 is alkyl; R a H, -P(O)(R b )2, -C(O)R c , -C(O)OR c , C 1~6 Alkyl, and C 1~6 hydroxyalkyl; Each R b H and C 1~6 independently selected from the group consisting of alkyl; and Each R c , H, C 1~6 Alkyl, and C 1~6 hydroxyalkyl) or a pharma- ceutically acceptable salt thereof. [Claim 2] R 1 -OR a 2. The compound of claim 1, wherein: [Claim 3] R 1 is 5- to 6-membered heteroaryl, or a pharma- ceutically acceptable salt thereof. [Claim 4] R 1 is hydroxyl, [ka] and 5-membered heteroaryl, or a pharma- ceutically acceptable salt thereof. [Claim 5] R 2 and R 3 each independently represents H or -OR b The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of: [Claim 6] R 2 and R 3 are independently H, C 1~6 Alkyl, and -C 0~6 Alkylene-SO2R 4 The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of: [Claim 7] R 2 and R 3 are each independently H, hydroxyl, -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of: [Claim 8] The compound according to claim 1 or a pharma- ceutically acceptable salt thereof. (where R1 is hydroxy, [ka] selected from the group consisting of; R 2 and R 3 are independently H, C 1~6 Alkyl, -OR b , -C 0~6 Alkylene-SO2R 4 , and -C(O)OR 5 selected from the group consisting of; R 4 -OR 5 , C 1~6 Alkyl, C 1~6 Haloalkyl, Hetero C 1~6 Alkyl, C 1~6 Hydroxyalkyl and C 3~8 Cycloalkyl C 0~6 is alkyl; and R 5 is H or C 1~6 (It is alkyl). [Claim 9] Structural formula (I)-A or (I)-B: [ka] 9. The compound according to claim 1, or a pharma- ceutically acceptable salt thereof, which has the formula: [Claim 10] Structural Formula (I)-C or (I)-D: [ka] 10. The compound according to claim 1, or a pharma- ceutically acceptable salt thereof, which has the formula: [Claim 11] Structural formula (I)-E or (I)-F: [ka] 10. The compound according to claim 1, or a pharma- ceutically acceptable salt thereof, which has the formula: [Claim 12] 2. The compound of claim 1, wherein the compound is selected from the following: or a pharma- ceutically acceptable salt thereof. [Table 1] [Table 2] [Table 3] [Table 41] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Claim 13] 13. A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of claims 1 to 12, or a pharma- ceutically acceptable salt thereof, and one or more pharma- ceutically acceptable carriers. [Claim 14] 13. A pharmaceutical combination comprising a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof and one or more therapeutically active agents. [Claim 15] 15. A method for treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical composition according to claim 13, or a pharmaceutical combination according to claim 14. [Claim 16] A method for treating a disease or disorder in a subject, wherein a target tissue, organ, or cell associated with the pathology of the disease or disorder has FKBP12 levels insufficient to inhibit mTORC1, the method comprising administering to the subject in need thereof a therapeutically effective amount of a compound described in any one of claims 1 to 12 or a pharma- ceutical composition thereof, or a pharmaceutical combination described in claim 13. [Claim 17] 17. The method of claim 16, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 compared to rapamycin or RAD001. [Claim 18] The method of claim 16 or 17, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a high binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 sufficient to inhibit mTORC1. [Claim 19] The method of any one of claims 16 to 18, wherein the efficacy of the treatment is determined experimentally in comparison to rapamycin or RAD001. [Claim 20] 15. A method for treating a disease or disorder in a subject having, or determined to have, insufficient levels of FKBP12 to inhibit mTORC1, comprising administering to the subject in need thereof a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical composition according to claim 13, or a pharmaceutical combination according to claim 13. [Claim 21] 21. The method of claim 20, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 compared to rapamycin or RAD001. [Claim 22] The method of claim 20 or 21, wherein the subject has or is determined to have an FKBP12 level in a target tissue, organ, or cell that is insufficient to inhibit mTORC1. [Claim 23] The method of any one of claims 20 to 22, wherein the efficacy of the treatment is determined experimentally in comparison with rapamycin or RAD001. [Claim 24] The disease or disorder may be sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy, and / or contraction and / or 24. The method according to any one of claims 15 to 23, wherein the disease is selected from cardiac dysfunction such as diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications resulting from diabetes such as renal failure, blindness, and neuropathy). [Claim 25] The method according to any one of claims 15 to 23, wherein the disorder is liver fibrosis. [Claim 26] A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, wherein the disorder or disease is - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress A method selected from the group consisting of [Claim 27] 27. The method of claim 26, wherein the disorder is a disorder involving fibrotic and / or inflammatory processes. [Claim 28] 27. The method of claim 26, wherein the disorder is selected from a liver disorder and a renal disorder. [Claim 29] 29. The method of claim 28, wherein the liver damage is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis occurring in end stage liver disease. [Claim 30] 29. The method of claim 28, wherein the renal disorder is renal fibrosis. [Claim 31] 31. The method of claim 30, wherein the renal fibrosis occurs as a result of acute kidney injury. [Claim 32] 29. The method of claim 28, wherein the renal disorder is chronic renal disorder. [Claim 33] 29. The method of claim 28, wherein the renal disorder is diabetic nephropathy. [Claim 34] A method for treating an age-related disorder or age-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, wherein the disorder or disease is selected from the group consisting of sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke, ), chronic kidney disease, diabetes related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction such as systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes. [Claim 35] 15. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14. [Claim 36] 36. The method of claim 35, further comprising a PD-1 / PDL-1 inhibitor. [Claim 37] 37. The method of claim 35 or 36, wherein the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and neck cancer. [Claim 38] A compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for use as a medicament. [Claim 39] A compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for use in the treatment of a disorder or disease mediated by the mTOR pathway. [Claim 40] - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress A compound according to any one of claims 1 to 12 or a pharma- ceutical salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for use in the treatment of a disorder or disease selected from the group consisting of: [Claim 41] 15. A compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for use in the treatment of a disorder or disease involving a fibrotic or inflammatory process. [Claim 42] 42. The compound for use according to claim 41, wherein the disorder is selected from hepatic disorder and renal disorder. [Claim 43] 43. The compound for use according to claim 42, wherein the liver damage is selected from liver fibrosis occurring in end stage liver disease, liver cirrhosis, toxic liver failure, non-alcohol related hepatic steatosis or NASH and alcohol related steatosis. [Claim 44] 43. The compound for use according to claim 42, wherein the renal injury is renal fibrosis resulting from acute renal injury. [Claim 45] 43. The compound for use according to claim 42, wherein the renal disorder is chronic renal disorder. [Claim 46] 43. The compound for use according to claim 42, wherein the renal disorder is diabetic nephropathy. [Claim 47] Sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, impaired mobility, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction such as systolic and / or diastolic dysfunction and / or hypertension, 15. The compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or the pharmaceutical composition according to claim 13, or the pharmaceutical combination according to claim 14, for use in the treatment of age-related disorders or age-associated diseases selected from cardiac dysfunction resulting in reduced ejection rate, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes. [Claim 48] A compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for use in the treatment of cancer. [Claim 49] 15. The compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or the pharmaceutical composition according to claim 13, or the pharmaceutical combination according to claim 14, for use in the treatment of kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or neck cancer. [Claim 50] Use of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for the manufacture of a medicament. [Claim 51] Use of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for the manufacture of a medicament for the treatment of a disorder or disease mediated by the mTOR pathway. [Claim 52] - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Smooth muscle cell proliferation and migration, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress Use of a compound according to any one of claims 1 to 12 or a pharma- ceutical composition according to claim 13, or a combination of medicines according to claim 14, for the manufacture of a medicament for the treatment of a disorder or disease selected from the group consisting of: [Claim 53] Use of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for the manufacture of a medicament for the treatment of a disorder or disease involving a fibrotic or inflammatory process. [Claim 54] 54. The use according to claim 53, wherein the disorder is selected from hepatic and renal disorders. [Claim 55] 55. The use according to claim 54, wherein the liver damage is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH and alcohol-related steatosis occurring in end stage liver disease. [Claim 56] 55. The use of claim 54, wherein the renal injury is renal fibrosis resulting from acute renal injury. [Claim 57] 55. The use of claim 54, wherein the renal disorder is chronic renal disorder. [Claim 58] 55. The use of claim 54, wherein the renal disorder is diabetic nephropathy. [Claim 59] Sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction such as systolic and / or diastolic dysfunction and / or hypertension, ejection fraction 15. Use of the compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or the pharmaceutical composition according to claim 13, or the pharmaceutical combination according to claim 14, for the manufacture of a medicament for the treatment of an age-related disorder or age-associated disease selected from cardiac dysfunction resulting in impaired immune function, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to impaired immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes. [Claim 60] Use of a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13, or a pharmaceutical combination according to claim 14, for the manufacture of a medicament for the treatment of cancer. [Claim 61] Use of the compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof, or the pharmaceutical composition according to claim 13, or the pharmaceutical combination according to claim 14, for the manufacture of a medicament for the treatment of kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or neck cancer.

Claims

1. Formula (I) 【Chemistry 1】 (Here, R １ is -OR ａ and 5-6 membered heteroaryl; R ２ and R ３ are each independently H, C １～６ Alkyl, -OR ｂ , -C ０～６ Alkylene-SO ２ R ４ and -C(O)OR ５ selected from the group consisting of: R ４ is -OR ５ , C １～６ Alkyl, C １～６ Haloalkyl, Hetero C １～６ Alkyl, C １～６ Hydroxyalkyl, C ３～８ Cycloalkyl C ０～６ is alkyl; R ５ is H or C １～６ is alkyl; R ａ is H, -P(O)(R ｂ ) ２ , -C(O)R ｃ , -C(O)OR ｃ , C １～６ Alkyl, and C １～６ hydroxyalkyl; Each R ｂ is H and C １～６ independently selected from the group consisting of alkyl; and Each R ｃ is H, C １～６ Alkyl, and C １～６ hydroxyalkyl) or a pharma- ceutically acceptable salt thereof.

2. R １ is -OR ａ 2. The compound of claim 1, wherein:

3. R １ is 5-6 membered heteroaryl, or a pharma- ceutically acceptable salt thereof.

4. R １ is hydroxyl, 【Chemistry 2】 and 5-membered heteroaryl, or a pharma- ceutically acceptable salt thereof.

5. R ２ and R ３ are each independently H or -OR ｂ The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of:

6. R ２ and R ３ are each independently H, C １～６ Alkyl, and -C ０～６ Alkylene-SO ２ R ４ The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of:

7. R ２ and R ３ are each independently H, hydroxyl, -C ０～６ Alkylene-SO ２ R ４ and -C(O)OR ５ The compound according to any one of claims 1 to 4, or a pharma- ceutically acceptable salt thereof, selected from the group consisting of:

8. The compound according to claim 1 or a pharma- ceutically acceptable salt thereof. (where R1 is hydroxy, 【Chemistry 31】 selected from the group consisting of: R ２ and R ３ are each independently H, C １～６ Alkyl, -OR ｂ , -C ０～６ Alkylene-SO ２ R ４ and -C(O)OR ５ selected from the group consisting of: R ４ is -OR ５ , C １～６ Alkyl, C １～６ Haloalkyl, Hetero C １～６ Alkyl, C １～６ Hydroxyalkyl, and C ３～８ Cycloalkyl C ０～６ is alkyl; and R ５ is H or C １～６ (alkyl).

9. Structural formula (I)-A or (I)-B: 【Chemistry 4】 The compound according to any one of claims 1 to 8, or a pharma- ceutically acceptable salt thereof, having the formula:

10. Structural formula (I)-C or (I)-D: 【Chemistry 5】 The compound according to any one of claims 1 to 9, or a pharma- ceutically acceptable salt thereof, having the formula:

11. Structural formula (I)-E or (I)-F: 【Chemistry 6】 The compound according to any one of claims 1 to 9, or a pharma- ceutically acceptable salt thereof, having the formula:

12. 2. The compound of claim 1, wherein the compound is selected from the following: or a pharma- ceutically acceptable salt thereof. 【Table 1】 【Table 2】 【Table 3】 【Table 41】 【Table 5】 【Table 6】 【Table 7】 【Table 8】 【Table 9】 【Table 10】 【Table 11】 【Table 12】 【Table 13】 【Table 14】 【Table 15】

13. A pharmaceutical composition comprising a compound according to any one of claims 1 to 12, or a pharma- ceutically acceptable salt thereof, and one or more pharma- ceutically acceptable carriers.

14. A pharmaceutical composition comprising a compound according to any one of claims 1 to 12, or a pharma- ceutically acceptable salt thereof, and one or more therapeutically active agents.

15. A pharmaceutical composition for the treatment of a disorder or disease mediated by the mTOR pathway, comprising a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof.

16. 13. A pharmaceutical composition for treating a disease or disorder in a subject, wherein a target tissue, organ, or cell associated with the pathology of the disease or disorder has an insufficient level of FKBP12 to inhibit mTORC1, comprising a compound according to any one of claims 1 to 12, or a pharma- ceutical acceptable salt thereof.

17. 17. The pharmaceutical composition of claim 16, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 compared to rapamycin or RAD001.

18. The pharmaceutical composition of claim 16 or 17, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a high binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 sufficient to inhibit mTORC1.

19. The pharmaceutical composition according to any one of claims 16 to 18, wherein the therapeutic efficacy is determined experimentally in comparison with rapamycin or RAD001.

20. 13. A pharmaceutical composition for treating a disease or disorder in a subject having, or determined to have, insufficient levels of FKBP12 to inhibit mTORC1, comprising a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical acceptable salt thereof.

21. 21. The pharmaceutical composition of claim 20, wherein the compound of formula (I) or a pharma- ceutically acceptable salt thereof has a higher binding affinity for FKBP12, FKBP25, FKBP51, and / or FKBP52 compared to rapamycin or RAD001.

22. 22. The pharmaceutical composition of claim 20 or 21, wherein the subject has or is determined to have an FKBP12 level in a target tissue, organ, or cell that is insufficient to inhibit mTORC1.

23. The pharmaceutical composition according to any one of claims 20 to 22, wherein the therapeutic efficacy is determined experimentally in comparison with rapamycin or RAD001.

24. The disease or disorder may be sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy, systolic and / or diastolic dysfunction, and 24. The pharmaceutical composition according to any one of claims 15 to 23, wherein the therapeutic effect of the present invention is selected from the group consisting of cardiac dysfunction selected from hypertension and hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes (including complications resulting from diabetes selected from renal failure, blindness, and neuropathy).

25. The pharmaceutical composition according to any one of claims 15 to 23, wherein the disorder is liver fibrosis.

26. A pharmaceutical composition for treating a disease or disorder in a subject in need thereof, comprising a therapeutically effective amount of a compound according to any one of claims 1 to 12 or a pharma- ceutical acceptable salt thereof, said disorder or disease being - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - proliferation and migration of smooth muscle cells, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - neurodegenerative diseases, - cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress 2. A pharmaceutical composition selected from the group consisting of

27. 27. The pharmaceutical composition of claim 26, wherein the disorder is a disorder involving fibrotic and / or inflammatory processes.

28. 27. The pharmaceutical composition of claim 26, wherein the disorder is selected from hepatic disorder and renal disorder.

29. 29. The pharmaceutical composition of claim 28, wherein the liver damage is selected from hepatic fibrosis, cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH, and alcohol associated steatosis occurring in end stage liver disease.

30. 29. The pharmaceutical composition of claim 28, wherein the renal disorder is renal fibrosis.

31. The pharmaceutical composition of claim 30, wherein the renal fibrosis occurs as a result of acute kidney injury.

32. 29. The pharmaceutical composition of claim 28, wherein the renal disorder is chronic renal disorder.

33. 29. The pharmaceutical composition of claim 28, wherein the renal disorder is diabetic nephropathy.

34. A pharmaceutical composition for treating an age-related disorder or age-associated disease in a subject in need thereof, comprising a therapeutically effective amount of the compound according to any one of claims 1 to 12 or a pharma- ceutical acceptable salt thereof, wherein the disorder or disease is selected from the group consisting of sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, and liver function disorders. disorders, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy, systolic and / or diastolic dysfunction, and cardiac dysfunction selected from hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes.

35. 13. A pharmaceutical composition for treating cancer in a subject in need thereof, comprising a compound according to any one of claims 1 to 12 or a pharma- ceutically acceptable salt thereof.

36. 36. The pharmaceutical composition of claim 35, further comprising a PD-1 / PDL-1 inhibitor.

37. 37. The pharmaceutical composition of claim 35 or 36, wherein the cancer is selected from kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma and neck cancer.

38. 15. A pharmaceutical composition according to claim 13 or 14 for use as a medicament.

39. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament.

40. 13. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of a disorder or disease mediated by the mTOR pathway.

41. - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - proliferation and migration of smooth muscle cells, which cause vascular intimal hyperplasia, vascular occlusion, coronary arteriosclerosis obliterans, and restenosis; - autoimmune diseases and inflammatory conditions, - Asthma, - multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - neurodegenerative diseases, - cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress 13. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of a disorder or disease selected from:

42. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of a disorder or disease involving a fibrotic or inflammatory process.

43. 43. The use according to claim 42, wherein the disorder is selected from hepatic and renal disorders.

44. 44. The use according to claim 43, wherein the liver damage is selected from hepatic fibrosis, cirrhosis, toxic liver failure, non-alcohol associated hepatic steatosis or NASH and alcohol associated steatosis occurring in end stage liver disease.

45. 44. The use of claim 43, wherein the renal injury is renal fibrosis resulting from acute renal injury.

46. 44. The use of claim 43, wherein the renal disorder is chronic renal disorder.

47. 44. The use of claim 43, wherein the renal disorder is diabetic nephropathy.

48. 13. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of age-related disorders or age-associated diseases selected from sarcopenia, atrophy of the skin, cherry angiomas, seborrheic keratosis, brain atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes mellitus-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes.

49. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of cancer.

50. 13. Use of a compound according to any one of claims 1 to 12 for the manufacture of a medicament for the treatment of kidney cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or neck cancer.

51. The use of claim 48, wherein the cardiac dysfunction is selected from the group consisting of cardiac hypertrophy, systolic and / or diastolic dysfunction, hypertension, and cardiac dysfunction resulting in reduced ejection fraction.

Images