Pharmaceutical composition for the treatment and / or prevention of renal cystic ciliopathies

Abstract

Provided is a pharmaceutical composition for treating and / or preventing renal cystic ciliopathy, the composition containing a retinoic acid receptor (RAR) agonist.

Description

[Technical field]

[0001] The present application relates to a pharmaceutical composition for the treatment and / or prevention of renal cystic ciliopathies. [Background technology]

[0002] Autosomal dominant polycystic kidney disease (ADPKD), an intractable hereditary disease, progressively forms numerous cysts in the kidneys and progresses to end-stage renal failure after middle age. The causative gene for ADPKD is PKD1 in 85% of cases and PKD2 in 15% of cases. Research has been conducted using experimental animals such as disease model mice and rats in which these genes have been modified, but the pathology has not been fully elucidated and no curative treatment has been developed. Tolvaptan, the only vasopressin V2 receptor antagonist approved and used in clinical practice, inhibits cyst growth and renal function decline, but its effect is limited and it is not a curative treatment (Non-Patent Document 1). In addition, tolvaptan's strong diuretic effect requires frequent water intake to prevent side effects such as dehydration and hypernatremia, so patients who take it are subject to various behavioral restrictions, and it is necessary to develop a curative drug that improves the patient's QOL.

[0003] In recent years, active research has been conducted to establish disease-specific iPS cells by introducing mutations into the causative genes of iPS cells established from somatic cells of patients with intractable diseases or from iPS cells derived from healthy individuals, and then inducing differentiation into diseased cell types in vitro to create disease models that reproduce the pathology, and to conduct detailed pathological analysis and search for therapeutic drugs. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Torres VE et al., N Engl J Med. 2012 Dec 20; 367 (25): 2407-18. Summary of the Invention [Problem to be solved by the invention]

[0005] The present application aims to provide a pharmaceutical composition for the treatment and / or prevention of renal cystic ciliopathies. [Means for solving the problem]

[0006] The present application provides a pharmaceutical composition comprising a retinoic acid receptor (RAR) agonist for the treatment and / or prevention of renal cystic ciliopathies. Effect of the Invention

[0007] The present application provides a pharmaceutical composition comprising a retinoic acid receptor (RAR) agonist for the treatment and / or prevention of renal cystic ciliopathies.

[0008] The present inventors have created the first in vitro renal collecting duct cyst model from iPS cells, and have used this model to discover a pharmaceutical composition for treating and / or preventing renal cystic ciliopathies. [Brief description of the drawings]

[0009] [Figure 1] Morphology of cysts on day 5 cultured in the absence (upper right panel) or presence (lower right panel) of 0.1 μM TTNPB. [Diagram 2] Cyst size after treatment with 2.5 μM AVP and 0.1% DMSO or 0.1 μM TTNPB. Data from three independent experiments are shown as mean ± sd (n = 3). Student's t-test was performed. [Diagram 3] Cyst size after treatment with 2.5 μM AVP and 0.1% DMSO, 0.1 μM TTNPB or 0.1 μM ATRA. Data are shown as mean ± sd (n = 3) from three independent experiments. One-way ANOVA with Tukey's test was performed, * p < 0.005. [Figure 4] Morphology of cysts cultured in the absence (left panel) or presence (right panel) of 0.1 μM AM80. [Diagram 5] Cyst size after treatment with 0.1 μM AM80. Data from three independent experiments are shown as mean ± sd (n = 3). Student's t-test was performed. [Figure 6] Cyst growth rate of cysts cultured in the presence of 1 μM of various RAR agonists (CD271, fenretinide, AM580, etretinate, CD1530, Ch55, AGN-195183, and CD5789). [Figure 7] Schematic diagram showing microarray comparison of day 5 cysts cultured in the absence (upper panel) or presence (lower panel) of 0.1 μM TTNPB. [Figure 8] Volcano plot showing DEGs in cysts cultured in the absence or presence of TTNPB as assessed by microarray. [Figure 9] GSEA plot of the TGFβ signaling pathway. [Figure 10] Heatmap showing DEGs between cysts cultured in the absence or presence of TTNPB as assessed by microarray. [Figure 11] Heatmap showing that TTNPB increased the expression of cellular senescence genes as assessed by microarray. [Figure 12] Schematic diagram of intraperitoneal administration of ATRA to ADPKD model mice. [Figure 13] Body weight of mice treated with or without ATRA. Data are shown as mean ± sd (n = 8). One-way ANOVA with Tukey's test showed no significant differences. Non-cystic:Pkd1flox / -: Ksp-Cre, Cystic:Pkd1flox / flox: Ksp-Cre (ADPKD model). [Figure 14] Ratio of two kidney weights (2KW) to body weight (BW). Data are shown as mean ± sd (n = 8). One-way ANOVA with Tukey's test was performed, * p < 0.01. [Figure 15]Cross-sectional images of cystic kidneys from P9 Pkd1flox / flox:Ksp-Cre mice treated with or without ATRA. Scale bar indicates 1 mm. [Figure 16] Cystic index of PKD severity in P9 Pkd1flox / flox:Ksp-Cre mice after treatment with vehicle (DMSO and sunflower oil) alone or vehicle containing ATRA. Data are shown as mean ± sd (n = 8). Student's t-test was performed, * p < 0.05. [Figure 17] BUN levels in P9 Pkd1flox / flox:Ksp-Cre mice treated or not with ATRA. Data are shown as mean ± sd (n=8). One-way ANOVA with Tukey's test was performed, *p<0.005. Non-cystic:Pkd1flox / +:Ksp-Cre mice, Cystic:Pkd1flox / flox:Ksp-Cre mice. [Figure 18] Immunostaining images of cysts cultured in the absence (top) or presence (bottom) of doxycycline (DOX). [Figure 19] Cyst size after addition of doxycycline. Data from three independent experiments are shown as mean ± sd (n = 3). Student's t-test was performed. [Figure 20] Schematic diagram for administering AM80 (Tamibarotene) via intraperitoneal injection to ADPKD model mice. [Figure 21] Enlarged views of kidneys from P9 Pkd1flox / flox:Ksp-Cre mice treated with or without AM80 (Tamibarotene). [Figure 22] Ratio of two kidney weights (2KW) to body weight (BW). Data are shown as mean ± sd. One-way ANOVA with Dunnett's test was performed, * p < 0.05. [Diagram 23] Cross-sectional images of cystic kidneys from P9 Pkd1flox / flox:Ksp-Cre mice treated with or without AM80 (Tamibarotene). [Figure 24]Cystic index of PKD severity in P9 Pkd1flox / flox:Ksp-Cre mice following treatment with vehicle (DMSO and sunflower oil) alone or with AM80 (Tamibarotene). Data are shown as mean ± sd. One-way ANOVA with Dunnett's test was performed, *p<0.05. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] In this disclosure, when a numerical value is accompanied by the term "about," it is intended to include a range of ±10% of that value. For example, "about 20" is intended to include "18-22." A range of numerical values ​​includes all values ​​between and at the endpoints. "About" in reference to a range applies to both endpoints of the range. Thus, for example, "about 20-30" is intended to include "18-33."

[0011] Pharmaceutical Compositions The present application provides a pharmaceutical composition comprising a retinoic acid receptor (RAR) agonist for the treatment and / or prevention of renal cystic ciliopathies.

[0012] Ciliopathies are diseases caused by genetic mutations in primary cilia and their associated structures. Renal cystic ciliopathies refer to ciliopathies associated with renal cysts. Renal cystic ciliopathies include polycystic kidney disease, such as autosomal dominant polycystic kidney disease (ADPKD, also called "autosomal overt polycystic kidney disease") and autosomal recessive polycystic kidney disease (ARPKD, also called "autosomal recessive polycystic kidney disease"), nephronophthisis, Joubert syndrome, Bardet-Biedl syndrome, Meckel-Gruber syndrome, orofacial-digital syndrome type I, Jeune syndrome, Senior-Loken syndrome, and Alström syndrome. In one embodiment, the renal cystic ciliopathies are, for example, polycystic kidney disease, preferably autosomal dominant polycystic kidney disease (ADPKD).

[0013] The retinoic acid receptor (RAR) agonist is not particularly limited as long as it is a substance that binds to and activates RAR. Examples of RAR agonists include 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid (TTNPB, CAS number: 71441-28-6), all-trans retinoic acid (ATRA, CAS number: 302-79-4), 9-cis retinoic acid (alitretinoin, CAS number: 5300-03-8), 13-cis retinoic acid (isotretinoin, CAS number: 5300-03-8), and the like. , CAS number: 4759-48-2), AM80 (also known as Tamibarotene, CAS number: 94497-51-5), AM580 (CAS number: 102121-60-8), AC261066 (CAS number: 870773-76-5), AC55649 (CAS number: 59662-49-6), AGN-190168 (also known as Tazarotene, CAS number: 118292-40-3), Tazarotenic acid (CAS number: 118292-41-4), AGN-19 5183 (CAS number: 367273-07-2), BMS641 (CAS number: 369364-50-1), BMS753 (CAS number: 215307-86-1), BMS961 (CAS number: 185629-22-5), CD271 (also known as adapalene, CAS number: 106685-40-9), CD437 (CAS number: 125316-60-1), CD1530 (CAS number: 107430-66-0), CD2314 (CAS number: 170355-37-0), CD5789 (also known as trifarotene, CAS number: 895542-09-3), Ch55 (CAS number: 110368-33-7), etretinate (CAS number: 54350-48-0), acitretin (CAS number: 55079-83-9), and fenretinide (CAS number: 65646-68-6), and pharma- ceutically acceptable salts and pharma-ceutically acceptable hydrolyzable esters thereof.In one embodiment, the RAR agonist is at least one selected from the group consisting of TTNPB, ATRA, AM80, AM580, AGN-195183, CD271, CD1530, CD5789, Ch55, etretinate, and fenretinide, and their pharma- ceutically acceptable salts, and their pharma-ceutically acceptable hydrolyzable esters. In a further embodiment, the RAR agonist is at least one selected from the group consisting of AM80, its pharma-ceutically acceptable salts, and its pharma-ceutically acceptable hydrolyzable esters. In another embodiment, the RAR agonist is at least one selected from the group consisting of TTNPB, its pharma-ceutically acceptable salts, and its pharma-ceutically acceptable hydrolyzable esters. In another embodiment, the RAR agonist is at least one selected from the group consisting of ATRA, its pharma-ceutically acceptable salts, and its pharma-ceutically acceptable hydrolyzable esters.

[0014] A pharmaceutically acceptable salt refers to a salt that does not have significant toxicity and can be used as a medicine. The pharmaceutically acceptable salt is, for example, a base addition salt or an acid addition salt. Examples of base addition salts include alkali metal salts such as sodium salt, potassium salt, and lithium salt; alkaline earth metal salts such as calcium salt and magnesium salt; metal salts such as aluminum salt and iron salt; inorganic salts such as ammonium salt; organic amine salts such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylphenethylamine salt, piperazine salt, tetramethylammonium salt, and tris(hydroxymethyl)aminomethane salt; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate, and aspartate. Examples of acid addition salts include mineral acid salts such as hydrochloride, sulfate, nitrate, etc.; and organic acid salts such as methanesulfonate, paratoluenesulfonate, citrate, oxalate, etc.

[0015] A pharma- ceutically acceptable hydrolyzable ester means an ester that is hydrolyzed in vivo, including those that are easily decomposed in the human body to release the parent compound or a salt thereof. A pharma-ceutically acceptable hydrolyzable ester may be decomposed by esterases in the body to give an active compound. For example, pharma-ceutically acceptable hydrolyzable esters include lower alkyl esters, lower alkenyl esters, lower alkylamino lower alkyl esters, acylamino lower alkyl esters, acyloxy lower alkyl esters, aryl esters, and aryl lower alkyl esters. The term "lower" means, for example, 1 to 6 or 1 to 4 carbon atoms.

[0016] Pharmaceutically acceptable hydrolyzable ester groups can also be derived, for example, from pharma- ceutically acceptable aliphatic carboxylic acids, including alkanoic, alkenoic, cycloalkanoic and alkanedioic acids. The alkyl or alkenyl groups of the pharma-ceutically acceptable aliphatic carboxylic acids have, for example, 6 or fewer carbon atoms. Specific hydrolyzable esters include formates, acetates, phosphates, propionates, butyrates, acrylates and succinates.

[0017] The present application also provides a pharmaceutical composition comprising a vector expressing the CDKN2B gene for the treatment and / or prevention of renal cystic ciliopathies.

[0018] The vector expressing the CDKN2B gene can be a plasmid vector or a viral vector.When the vector expressing the CDKN2B gene is a plasmid vector, the plasmid vector used is not particularly limited, and any plasmid vector such as a cloning plasmid vector and an expression plasmid vector can be used.When the vector expressing the CDKN2B gene is a viral vector, the viral vector used is not limited, but includes an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a retrovirus vector, and a Sendai virus vector.

[0019] The vector expressing the CDKN2B gene may have a regulatory sequence that regulates the expression of the CDKN2B gene. Examples of the regulatory sequence include a promoter, a terminator, an enhancer, a polyadenylation signal sequence, and a replication origin sequence. The regulatory sequence may be arranged so as to be capable of functionally regulating the expression of the vector expressing the CDKN2B gene, and may be arranged based on a known method.

[0020] The pharmaceutical composition of the present application may contain a pharma- ceutically acceptable carrier or additive. Examples of such carriers or additives include isotonicity agents, thickeners, sugars, sugar alcohols, preservatives, bactericides, antibacterial agents, pH regulators, stabilizers, chelating agents, oily bases, gel bases, wetting agents, surfactants, suspending agents, binders, excipients, lubricants, disintegrants, foaming agents, fluidizing agents, dispersants, emulsifiers, buffers, solubilizers, and antioxidants. One or more of the pharma-ceutically acceptable carriers or additives may be used, or two or more of them may be used in combination.

[0021] The administration route of the pharmaceutical composition of the present application includes oral administration or parenteral administration, and is not particularly limited. Various known administration forms can be adopted depending on the target disease. For example, parenteral administration may be systemic administration or local administration, and examples thereof include intratracheal administration, intravenous administration, intraarterial administration, intraportal administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, intranasal administration, and oral administration. In a preferred embodiment, when the subject is an animal, the pharmaceutical composition of the present application is administered intraperitoneally or orally. In a preferred embodiment, when the subject is a human, the pharmaceutical composition of the present application is administered orally.

[0022] Dosage forms for oral administration include granules, fine granules, powders, coated tablets, tablets, suppositories, powders, capsules, microcapsules, chewable tablets, liquids, suspensions, emulsions, etc. Dosage forms for injection can be those commonly used for pharmaceutical preparations, such as intravenous injection preparations, intracoronary administration preparations, drip administration preparations, and preparations for extended release of active substances. Dosage forms for injection can be provided in sealed ampoules or vials, or as lyophilized products that require only the addition of a sterile liquid (e.g., water for injection) immediately before use. Injection solutions or suspensions can be prepared from powders, granules, or tablets. These dosage forms are prepared by formulating them in a conventional manner.

[0023] The dosage and frequency of administration of the pharmaceutical composition of the present application can be appropriately determined by a person skilled in the art according to the animal species, health condition, age, body weight, administration route, administration form, etc. of the subject of administration so that an effective amount of the active ingredient is administered to the subject. For example, the pharmaceutical composition of the present application can be administered once to several times a day, or once to several times a day or several days or once or several weeks, for example, once every 1 to 4 weeks, but is not limited thereto. The effective amount in a certain situation can be easily determined by routine experimentation and is within the skill and judgment of an ordinary clinician. For example, when the RAR agonist is TTNPB, about 0.001 to about 100 mg / kg body weight, about 0.01 to about 100 mg / kg body weight, about 0.05 to about 10 mg / kg body weight, or about 0.1 to about 5 mg / kg body weight of the RAR agonist can be orally administered. For example, when the RAR agonist is ATRA, about 0.1 to about 1000 mg, about 1 to about 1000 mg, about 10 to about 500 mg, about 50 to about 100 mg, or about 60 to 80 mg of the RAR agonist may be orally administered per day. For example, when the RAR agonist is 9-cis retinoic acid, about 0.1 to about 1000 mg, about 1 to about 1000 mg, about 5 to about 100 mg, about 10 to about 50 mg, or about 30 mg of the RAR agonist may be orally administered per day. For example, when the RAR agonist is 13-cis retinoic acid, about 0.001 to about 50 mg / kg body weight, about 0.01 to about 50 mg / kg body weight, about 0.05 to about 10 mg / kg body weight, about 0.1 to about 5 mg / kg body weight, or about 0.5 to about 1 mg / kg body weight of the RAR agonist may be orally administered per day. For example, when the RAR agonist is AM80, the dose is about 0.01 to about 100 mg / m per day. 2 , about 0.1~about 100mg / m 2 , about 0.5~about 50mg / m 2 , about 1 to about 10mg / m 2 , or about 6 mg / m 2 The RAR agonist may be administered orally.

[0024] The pharmaceutical composition of the present application may be used alone or in combination with one or more additional active ingredients. The additional active ingredients are, for example, active ingredients for the treatment and / or prevention of renal cystic ciliopathies. The "combination" of ingredients means not only the use of a dosage form containing all the ingredients and the use of a combination of dosage forms containing each ingredient separately, but also the administration of each ingredient simultaneously, sequentially, or with a delay between any of the ingredients, as long as they are used for the treatment and / or prevention of renal cystic ciliopathies. Two or more additional active ingredients may be used in combination.

[0025] As used herein, "treatment" means reducing or eliminating the cause of a disease, slowing or halting the progression of a disease, relieving, alleviating, ameliorating or eliminating the symptoms, and / or inhibiting the worsening of the symptoms in a subject having a disease.

[0026] As used herein, "prevention" refers to preventing the onset of disease in a subject or reducing the likelihood of developing a disease. Here, onset of a disease includes recurrence. A subject may be, for example, a subject who is likely to develop a disease but has not yet developed the disease. A subject who is likely to develop renal cystic ciliopathies but has not yet developed the disease may be, for example, a subject who has a genetic predisposition to renal cystic ciliopathies. Examples of genetic predispositions to renal cystic ciliopathies include gene mutations in the causative genes for ADPKD (such as PKD1 and PKD2), the causative genes for ARPKD (such as PKHD1), the causative genes for nephronophthisis (such as NPHP1 to NPHP13), the causative genes for Joubert syndrome (such as JBTS1 to JBTS17), the causative genes for Bardet-Biedl syndrome (such as BBS1 to BBS15), the causative genes for Meckel-Gruber syndrome (such as MKS1 to MKS10), the causative genes for orofacial-digital syndrome type I (such as OFD1), the causative genes for Jeune syndrome (such as IFT80), the causative genes for Senior-Loken syndrome (NPHP1, NPHP3 to NPHP6, etc.), or the causative genes for Alstrom syndrome (such as ALMS1).

[0027] Subjects for disease treatment and / or prevention include mammals such as mice, rats, hamsters, guinea pigs, cows, horses, pigs, sheep, monkeys, orangutans, chimpanzees, dogs, cats, and humans, preferably primates, and more preferably humans.

[0028] Treatment method The present application also provides a method for treating renal cystic ciliopathies, comprising administering the pharmaceutical composition of the present application to a subject in need thereof. The present application also provides the use of an RAR agonist for the manufacture of a pharmaceutical composition for treating renal cystic ciliopathies. The present application further provides an RAR agonist for use in treating renal cystic ciliopathies. Examples of renal cystic ciliopathies and RAR agonists are as described above.

[0029] Prevention methods The present application also provides a method for preventing renal cystic ciliopathies, comprising administering the pharmaceutical composition of the present application to a subject in need thereof. The present application also provides the use of an RAR agonist for the manufacture of a pharmaceutical composition for preventing renal cystic ciliopathies. The present application further provides an RAR agonist for use in preventing renal cystic ciliopathies. Examples of renal cystic ciliopathies and RAR agonists are as described above. EXAMPLES

[0030] The present invention will be described in more detail below by showing examples, but the present invention is not limited to these examples in any way.

[0031] Materials and Methods Generation of PKD1 knockout induced pluripotent stem (iPS) cells Experiments using human induced pluripotent stem cells were approved by the ethical committee of the Kyoto University Faculty of Medicine and Graduate School of Medicine. The human iPS cell line used was the 1383D2 line. PKD1 knockout iPS cells were generated using the previously reported DNA transposon-based CRISPR-Cas9 regulated transcription and nuclear shuttling (CRONUS) system (Ishida K. et al., Sci Rep. 8:310 (2018); Shimizu T. et al., Biochem Biophys Res Commun. 529, 1186-1194 (2020)). The CRONUS-Puro vector (pPV-TetO-SphcCas9-GR-iC-A-EF1α-rtTA-iP, Addgene ID 100596) and the piggyBac vector for cloning sgRNA (pPV-H1-ccdB-mEF1α-RiH, Addgene ID 100598) were transfected consecutively into cells with the piggyBac transposase expression plasmid (pHL-EF1α-hcPBase-A, Addgene ID 100599) by lipofection using FuGENE6 (Promega). The CRONUS-Puro vector and the piggyBac vector for cloning sgRNA were compatible with puromycin and hygromycin selection, respectively. The following sequence was used to clone a gRNA sequence targeting the PKD1 exon 34 splicing acceptor site into the pPV-H1-ccdB-mEF1α-RiH vector: 5'-GAGACCACTTGGATCC GGGATCAGGTCTTCATCTAG GTTTTAGAGCTAGAAATAGCA-3' (SEQ ID NO: 1, target site underlined). Drug selection of transfected cells resulted in the production of RFP +Colonies were manually picked and treated with doxycycline and dexamethasone to induce genome editing. Individual colonies were screened for genome editing efficiency by Sanger sequencing of bulk genomic DNA. Single cells were then isolated by flow cytometry, clonally grown in 24-well culture plates (Corning) coated with iMatrix-511 (Nippi), and genotyped by Sanger sequencing. Genome editing had resulted in a frameshift and a premature stop codon. Two bases (AG) at different sites within exon 34 served as splicing acceptor sequences, resulting in the generation of two types of PKD1 mutant mRNA. The primer sequences used in this example are shown in Table 1. [Table 1]

[0032] Differentiation of PKD1 knockout iPS cells into ureteric bud organoids PKD1 knockout iPS cells were induced into ureteric bud organoids as previously described (Mae, S. I. & Ryosaka, M. et al. Cell Reports 32, 4, 107943).

[0033] Preparation of ureteric bud tip cells Ureteric bud organoids derived from PKD1 knockout iPS cells were treated with Accutase (Innovative Cell Technologies) at 37°C for 5 min and then dissociated into single cells by pipetting. Cells were suspended in DMEM / F12 medium (Gibco) containing B27 supplement (without vitamin A) (Gibco), 3 μM CHIR99021 (StemRD), 0.1 μM TTNPB (Santa cruz), 200 ng / ml FGF1 (R&D systems), 100 ng / ml GDNF (R&D systems), 10 μM Thiazovivin (Santa Cruz Biotechnology) and 1 μM A83-01 (Wako). Single cells were plated at 1.0x10 onto one well of a 48-well plate coated with 150 μL hydrogel.5 Cells were seeded at 100 x 100 / well. Hydrogels consisted of 50% Matrigel (BD Biosciences) in DMEM / F12 medium and were allowed to solidify for 1 h at 37°C before use. Single cells established ureteric bud tip cell colonies after 7 days. Medium was changed every 2–3 days.

[0034] Subculture of ureteric bud tip cells The hydrogel was dissolved with Cell Recovery Solution (Corning) for 30 min at 4°C to isolate ureteric bud tip cell colonies. After further washing with Cell Recovery Solution for 30 min at 4°C, the ureteric bud tip cell colonies were centrifuged at 500g for 5 min at room temperature. The ureteric bud tip cell colonies were treated with Accutase for 5 min at 37°C and then dissociated into single cells by pipetting. The cells were suspended in DMEM / F12 medium containing B27 supplement (without vitamin A), 3 μM CHIR99021, 0.1 μM TTNPB, 200 ng / ml FGF1, 100 ng / ml GDNF, 10 μM Thiazovivin and 1 μM A83-01. The cells were plated at 1.0x10 cells per well of a 48-well plate coated with 150 μL hydrogel. 5 Cells were seeded at 100x the volume of the hydrogel per well. The hydrogel consisted of 50% Matrigel in DMEM / F12 medium and was allowed to solidify at 37°C for 1 h before use. Ureteric bud tip cell colonies were generated by culturing single cells at 37°C and 5% CO2 for 7 days. The medium was changed every 2–3 days. The tip cell colonies were similarly subcultured every 7 days. Tip cell colonies cultured for 4–6 weeks or more were used for the reconstruction of collecting duct organoids as follows.

[0035] Reconstruction of collecting duct organoids from ureteric bud tip cells The hydrogel was dissolved with Cell Recovery Solution for 30 min at 4°C to isolate ureteric bud tip cell colonies. After further washing with Cell Recovery Solution for 30 min at 4°C, the ureteric bud tip cell colonies were centrifuged at 500g for 5 min at room temperature. The ureteric bud tip cell colonies were treated with Accutase for 5 min at 37°C and then dissociated into single cells by pipetting. The cells were suspended in Essential 6 medium (Gibco) containing 3 μM CHIR99021, 0.1 μM TTNPB, 200 ng / ml FGF1, 100 ng / ml GDNF, 10 μM Thiazovivin and 1 μM A83-01. The cells were plated in 96-well low attachment plates (Sumitomo Bakelite) at 5.0 x 10 3 Single cells were seeded at 100 cells / well and cultured at 37°C and 5% CO2 for 2 days to generate spheroids.

[0036] The spheroids were suspended in Essential 6 medium containing 10% Afamin / Wnt3a conditioned medium (MBL), 200ng / ml R-spondin 1 (R&D systems), 0.1μM LDN193189 (Axon medchem), 200ng / ml FGF1, 200ng / ml FGF8 (Peprotech), 100ng / ml GDNF, 0.1μM TTNPB, 50ng / ml EGF (R&D systems), 1μM A83-01, and 10% Matrigel, and distributed at 2.5-3mL / dish into 35mm low-attachment dishes (Sumitomo Bakelite). The medium was changed every 3-4 days. The spheroids were cultured at 37℃, 5% CO2 for 14-21 days to produce artificial collecting duct organoids.

[0037] RNA sequencing analysis RNA-seq library preparation, sequencing, mapping and gene expression analysis were performed in DNAFORM. Total RNA quality was assessed by Bioanalyzer (Agilent Technologies) to ensure that the RNA integrity number was 7.0 or higher. After enrichment of poly (A) + RNA by NEBNext Poly (A) mRNA Magnetic Isolation Module (New England BioLabs), double-stranded cDNA libraries (RNA-seq libraries) were prepared using SMARTer Stranded Total RNA Seq Kit v2 Pico Input Mammalian (Clontech) according to the manufacturer's instructions. RNA-seq libraries were sequenced using paired-end reads (50 nt read 1 and 25 nt read 2) on a NextSeq 500 instrument (Illumina). The resulting reads were mapped to the human GRCh38 genome using STAR (version 2.7.2b) or Hisat2 (version 2.1.0). Reads of annotated genes were counted using featureCounts (version 1.6.1). FPKM and TPM values ​​were calculated from the mapped reads by normalizing with the total counts. Differentially expressed genes (DEGs) were detected using the DESeq2 package (version 1.26.0). The list of DEGs detected by DESeq2 was used for GSEA. Heatmaps and volcano plots were generated using the bioinfokit package (version 2.0.1).

[0038] Microarray analysis To comprehensively profile human protein-coding transcripts, microarray analysis was performed using the Human 8x60K LncRNA expression array (ArrayStar) at Filgen. Sample labeling and array hybridization were performed according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent Technology). Data were collected using Agilent's Feature Extraction software. Raw signal intensities were normalized using the quantile normalization method in GeneSpring GX v12.1. Statistically significantly differentially expressed mRNAs between the two groups were extracted by Volcano plot, heatmap generation, and GSEA analysis were performed.

[0039] Animal models Pkd1flox / flox:Ksp-cre mice, an ADPKD model mouse, progressively develop numerous cysts from birth and die of renal failure approximately 14 days after birth. The mouse strain was maintained as heterozygous Pkd1flox / +: Ksp-Cre, and Pkd1flox / flox: Ksp-cre mice were generated by crossing mice of the same strain.

[0040] ATRA treatment On day 3 after birth, Pkd1flox / flox: Ksp-cre mice (cystic) and Pkd1flox / +: Ksp-Cre mice (non-cystic) were intraperitoneally administered 10 mg / kg of ATRA (Sigma, #R2625) dissolved in sunflower oil (vehicle) containing 2% DMSO. A group of mice intraperitoneally administered with vehicle alone served as negative control. Mice were euthanized on day 9 after birth, and kidney tissue and blood samples were collected.

[0041] AM80 Processing On postnatal day 3, Pkd1flox / flox: Ksp-cre mice (cystic) and Pkd1flox / -: Ksp-Cre mice (non-cystic) were intraperitoneally administered AM80 (Tamibarotene; Tocris, #3507) at 5 or 10 mg / kg in sunflower oil containing 2% DMSO (vehicle). Mice that received vehicle alone served as negative controls. Mice were euthanized on postnatal day 9, and kidney tissue samples were collected.

[0042] Measurement of blood urea nitrogen (BUN) BUN in mouse serum was measured using an UN-L kit (Serotec, #A667-00).

[0043] Hematoxylin-eosin (HE) staining and cystic index measurement The kidneys were fixed in 4% paraformaldehyde solution and 4 μm-thick paraffin sections were prepared. After deparaffinization, HE staining was performed and the kidney tissue was photographed under an optical microscope. The cystic index was calculated as the total cyst area / total kidney tissue area x 100 using image analysis and measurement software (WinROOF, Mitani Shoji).

[0044] [result] Examination of compounds that suppress cyst growth Using PKD1 knockout iPS cells of the 1383D2 line, we induced artificial collecting duct organoids with cystic structures by the method described above. We investigated compounds that suppress cyst growth using the following protocol. 1. Organoids undergoing cyst formation were collected into a tube. 2. The medium was removed and 2 ml of Cell Recovery Solution was added. (4°C, 30 minutes) 3. Dissolve the gel by gently pipetting with a P-1000 pipetman and centrifuge (500g, 2 min). 4. The supernatant from step 3 was removed, 5 ml of medium containing FBS (STO medium) was added, and the cysts were separated from the organoids by pipetting. 5. Using a stereomicroscope, the cysts were collected into a 15 ml tube. 6. The supernatant was removed, and 2 ml of Accutase was added and treated at 37°C for 5 minutes. 7. The cells were dissociated into single cells by pipetting using a P-1000 pipette. 8. After passing through the filter, the cells were counted. 9. After counting the number of cells, the cell suspension containing the required number of cells was transferred to a tube, and 5 ml of FBS-containing medium (STO medium) was added to stop the Accutase reaction. 4 The amount of cell suspension required to seed cells / well was calculated. 10. Centrifuge (200g, 5 minutes) to prepare a pellet. 11. The supernatant was completely removed, and DMEM / F12+B27 w / o VA medium (10% Afamin / Wnt3a CM, 200ng / ml R-Spondin 1, 200ng / ml FGF1, 10μM Forskolin, 2.5μM AVP, 10μM Y27632) was added and suspended. 4 The amount of medium required to seed cells / well was calculated. 12. Add 5x10 cells of the cell suspension from step 11 to the 50% Matrigel plate that you have prepared in advance. 4 The cells were seeded at 1000 cells / well. The cell suspension was added slowly to prevent the Matrigel from collapsing. 13. Cyst structures were created by culturing at 37°C and 5% CO2 for 2 days. 14. The medium was removed, and DMEM / F12+B27 w / o VA medium was supplemented with 200 ng / ml FGF1 and 2.5 μM AVP, followed by culturing at 37°C, 5% CO2 for 3 days. 15. Nine locations inside the well were photographed using a 4x objective lens under a fluorescence microscope (Keyence, BZ-X700), and the cyst area was measured using a BZ-X Analyzer and the average value was calculated. In step 14, the compounds to be evaluated for their inhibitory effects on cyst growth were added. TTNPB (Santa Cruz, #sc-203303), AM80 (Cyman, #CAY-71770), and ATRA (Sigma, #R2625) were added at 0.1 μM. RAR agonists (CD271, fenretinide, AM580, etretinate, CD1530, Ch55, AGN-195183, and CD5789) were added at 1 μM.

[0045] The effect of TTNPB, a potent retinoic acid receptor (RAR) agonist, was examined as a compound that inhibits cyst growth. Figure 1 shows morphological photographs of cysts on day 5 cultured in the absence (upper right panel) or presence (lower right panel) of 0.1 μM TTNPB. The results of quantifying the size of these cysts are shown in Figure 2. It was shown that TTNPB treatment significantly reduced the cyst size.

[0046] TTNPB is an analogue of all-trans retinoic acid (ATRA). ATRA treatment also reduced cyst size (Figure 3).

[0047] Next, the effect of AM80 (Tamibarotene) was examined as a compound that inhibits cyst growth. Figure 4 shows morphological photographs of cysts cultured in the absence (left panel) or presence (right panel) of 0.1 μM AM80. The morphological photographs in Figure 4 show that AM80 reduces cyst size. Figure 5 shows the results of quantifying the size of these cysts. It was shown that AM80 significantly reduced cyst size. These results suggest that retinoic acid receptor (RAR) agonists have an inhibitory effect on cyst growth.

[0048] Next, the effects of various RAR agonists (CD271, fenretinide, AM580, etretinate, CD1530, Ch55, AGN-195183, and CD5789) were examined. The cyst growth rate for RAR agonists (1 μM) was calculated by setting the cyst growth rate for 10 μM forskolin as 100% and the cyst growth rate for 0.1 μM rapamycin as 0% (Figure 6). Compared to DMSO (control), eight RAR agonists were found to have an inhibitory effect on cyst growth. From the above, it was found that various RAR agonists have an inhibitory effect on cyst growth.

[0049] Mechanism of action of TTNPB To clarify the mechanism of action of TTNPB, gene expression in cyst cells cultured with or without TTNPB was compared by microarray (Figs. 7 and 8). In Fig. 8, the gray plots on the right side indicate genes with a 2-fold or greater difference in expression in cyst cells cultured with TTNPB, and the gray plots on the left side indicate genes with a 2-fold or greater difference in expression in cyst cells cultured without TTNPB. Gene set enrichment analysis (GSEA) showed that the TGFβ signaling pathway, which is an important pathway for cyst growth and fibrosis, was suppressed by TTNPB (Fig. 9).

[0050] The heat map showed that TTNPB decreased the expression of MMP1, SLC2A1, CFTR, and HMGCR (Figure 10). The following is known about each gene: MMP1 is secreted in large amounts into the blood of ADPKD patients (Nakamura T. et al., Am J Nephrol. 2000; Ameku T. et al., Sci Rep. 2016); a decrease in the amount of glucose taken up into cells through SLC2A1 reduces energy production through glycolysis and suppresses cyst growth (Rowe I. et al., Nat Med. 2013); secretion of cyst fluid via CFTR causes cyst growth (Hanaoka K. & Guggino WB., J Am Soc Nephrol. 2000); HMG-CoA reductase inhibitors (statins) suppress cyst growth (Zafar I. et al., Am J Physiol Renal Physiol. 2007; Cadnapaphornchai MA. et al., Clin J Am Soc Nephrol. 2014). Therefore, the results indicate that TTNPB suppressed the expression of these genes related to cyst growth.

[0051] Furthermore, the heat map showed that TTNPB promoted the expression of cellular senescence marker genes such as CDKN2B(p15) (Figure 11). This result is consistent with the report that cellular senescence suppresses the progression of ADPKD.

[0052] These results suggest that retinoic acid agonists such as TTNPB and ATRA suppress the growth of collecting duct cysts, and that retinoid signaling is one of the mechanisms by which cyst growth is suppressed.

[0053] Therapeutic effect of ATRA on ADPKD model mice Since ATRA is already used as a therapeutic agent for patients with acute promyelocytic leukemia (APL), we investigated the efficacy of ATRA in ADPKD model mice from the perspective of drug repositioning. To reflect the in vitro results of ATRA on collecting duct cyst growth in vivo, we used Pkd1 gene, which conditionally inactivates Pkd1 alleles under the expression of kidney-specific Ksp-Cre recombinase in the distal part of the nephron and collecting duct. flox / flox :Ksp-Cre mice were used. These mice develop renal failure due to progressive cyst formation from birth and die approximately 2 weeks after birth. Since Ksp cadherin is specifically expressed in the collecting duct and distal tubule, cysts derived from the collecting duct and distal tubule are formed in these ADPKD model mice. Mice were intraperitoneally administered 10 mg / kg ATRA on postnatal day 3 (P3) and sacrificed at P9 (Figure 12).

[0054] Since no significant weight loss was observed with ATRA treatment, it was thought that ATRA did not have any major side effects (Figure 13). On the other hand, when ATRA was administered to ADPKD model mice, the kidney weight to body weight ratio (2KW / BW) was significantly decreased (Figure 14).

[0055] Next, renal tissue sections were evaluated by hematoxylin-eosin (HE) staining (Figure 15). ATRA treatment suppressed the increase in kidney size and tended to suppress cyst formation in the cortical side. The ratio of the area occupied by cysts in the renal tissue (cystic index) was significantly decreased by ATRA treatment (Figure 16).

[0056] In ADPKD model mice, the blood urea nitrogen (BUN) level, an indicator of renal failure, was elevated, and renal failure occurred. The BUN level in ATRA-treated mice was significantly lower than that in vehicle-treated control mice (Figure 17). This result indicates that ATRA treatment inhibited the progression of renal failure.

[0057] These results suggest that ATRA suppresses cyst formation in the collecting duct and distal tubule in an in vivo ADPKD model. ATRA has been shown to exert therapeutic effects in both in vitro and in vivo ADPKD models.

[0058] Overexpression of CDKN2B inhibits cyst growth Using the protocol described below, we investigated the inhibitory effect of CDKN2B overexpression on cyst growth. 1. The CDKN2B ORF with a Kozak sequence was introduced into the PB-TAG-ERN vector (addgene, #80476) by Gataway cloning. 2. The above vector and a vector containing PBase were introduced into PKD1 homozygous mutant iPS cells by lipofection. 3. Drug selection using Neomycin was performed from the second day after induction. 4. Single-cell derived colonies were produced from drug-resistant iPS cells by limiting dilution. 5. Six colonies were picked and established to produce renal collecting duct cyst organoids. 6. Cysts were dissected from the organoids and seeded on 50% Matrigel to form cyst structures, in the same manner as in the protocol used to examine compounds that suppress cyst growth (step 12). 7. After cyst formation (2 days later), 2 mM doxycycline was added and the cells were cultured for an additional 3 days. 8. After photographing with a fluorescence microscope (Keyence, BZ-X700), the average area of ​​the cysts was calculated.

[0059] We established iPS cells in which CDKN2B expression could be conditionally induced by doxycycline, and created renal collecting duct cysts. Figure 18 shows immunostained images of cysts cultured in the absence (upper panel) or presence (lower panel) of doxycycline. Figure 19 shows the results of quantifying the size of these cysts. It was shown that the overexpression of CDKN2B by adding doxycycline significantly reduced the size of the cysts. This result suggests that the expression of CDKN2B has an inhibitory effect on cyst growth.

[0060] Therapeutic effect of AM80 on ADPKD model mice We investigated the efficacy of AM80 in ADPKD model mice. To reflect the in vitro results of AM80 on collecting duct cyst growth in vivo, we used Pkd1 β-blocker (PcB1 β-blocker), which conditionally inactivates the Pkd1 allele under the expression of kidney-specific Ksp-Cre recombinase in the distal part of the nephron and collecting duct. flox / flox :Ksp-Cre mice were used. These mice develop renal failure due to progressive cyst formation from birth and die approximately 2 weeks after birth. Since Ksp cadherin is specifically expressed in the collecting duct and distal tubule, cysts originating from the collecting duct and distal tubule are formed in these ADPKD model mice. Mice were intraperitoneally administered 5 or 10 mg / kg AM80 on postnatal day 3 (P3) and sacrificed at P9 (Figure 20).

[0061] When 10 mg / kg of AM80 was administered to ADPKD model mice, the ratio of kidney weight to body weight (2KW / BW) was significantly reduced (FIGS. 21 and 22).

[0062] Next, kidney tissue sections were evaluated by hematoxylin-eosin (HE) staining (Figure 23). Treatment with 10 mg / kg AM80 suppressed the increase in kidney size and tended to suppress cyst formation in the cortical side. The ratio of the area occupied by cysts in the kidney tissue (cystic index) was significantly decreased by treatment with 10 mg / kg AM80 (Figure 24).

[0063] These results suggest that AM80 suppresses cyst growth in collecting ducts and distal tubules in an in vivo ADPKD model. AM80 has been shown to exert therapeutic effects in both in vitro and in vivo ADPKD models.

Claims

1. A pharmaceutical composition for the treatment and / or prevention of autosomal dominant polycystic kidney disease (ADPKD), comprising at least one retinoic acid receptor (RAR) agonist selected from the group consisting of TTNPB, ATRA, AM80, AM580, AGN-195183, CD271, CD1530, CD5789, Ch55 and etretinate, and pharma- ceutical acceptable salts thereof, and pharma-ceutical acceptable hydrolyzable esters thereof.

2. 2. The pharmaceutical composition of claim 1, wherein the RAR agonist is at least one selected from the group consisting of AM80, a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable hydrolyzable ester thereof.

3. 2. The pharmaceutical composition of claim 1, wherein the RAR agonist is at least one selected from the group consisting of all-trans retinoic acid (ATRA), a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable hydrolyzable ester thereof.

4. The pharmaceutical composition of claim 1, wherein the RAR agonist is at least one selected from the group consisting of 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid (TTNPB), a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable hydrolyzable ester thereof.

Images