CD25 Antibody

Abstract

The present invention provides an antibody that specifically binds to CD25.The present invention also provides a method for producing the described antibody and a method for using the same.For example, CD25 antibody can be used therapeutically to treat cancer or autoimmune disease.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 767,405, filed November 14, 2018, the contents of which are incorporated herein by reference in their entirety. [Background technology]

[0002] CD25 protein is the alpha chain of the interleukin-2 (IL-2) receptor, a transmembrane protein present on regulatory T cells and activated T cells. Under normal conditions, regulatory T cells constitutively express CD25 and act to suppress the proliferation of effector cells. Regulatory T cells maintain a healthy state and inhibit effector T cells from reacting against self-antigens or overreacting to foreign antigens. In a normal protective immune response, effector T cells increase after contact with foreign antigens and overcome the inhibition by regulatory T cells. However, in the case of proliferative diseases, cancer cells increase the amount of regulatory T cells, thereby disabling a healthy immune response by limiting the production of effector T cells against cancer cells. Additional molecular tools are needed to alter the proliferation of regulatory T cells expressing CD25, for example, to weaken the immune system for cancer therapy or to upregulate the immune system for autoimmune diseases, and such tools are provided herein. Summary of the Invention

[0003] Provided herein is an antibody that specifically binds to CD25 (anti-CD25 antibody, herein interchangeably referred to as CD25 antibody). The antibody can be human, chimeric, or humanized. Also provided herein are methods of using the described antibody and methods of making it. For example, CD25 antibody can be used therapeutically to treat cancer, including administering the antibody or a pharmaceutical composition thereof to a subject in need of treatment. Also provided are methods of producing the CD25 antibody described herein.

[0004] In one embodiment, a monoclonal CD25 antibody that binds to human CD25 and has the following characteristics: a. the antibody does not interfere with the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25) and binds to an epitope distinct from that bound by 7G7B6; b. the antibody does not block the binding of the IL-2 ligand to the α chain of the IL-2 receptor (CD25), but blocks trimerization of the β, γ and α chains of the IL-2 receptor (CD25); c. the antibody blocks the binding of an IL-2 ligand to the alpha, beta, and / or gamma chain of the IL-2 receptor and binds to an epitope distinct from that bound by daclizumab or basiliximab; d. the antibody exhibits a higher binding affinity to CD25 at a pH of less than 7.4 when compared to the binding affinity to CD25 at a pH of 7.4; e. the antibody comprises an amino acid sequence of any one of the variable heavy chains presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto; f. the antibody comprises an amino acid sequence of any one of the variable light chains presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto; g. the VH of the antibody comprises any one of the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, Table 5A, and Table 6, or contained in the sequences presented in Figures 3A, 3B, and 5; h. the VL of said CD25 antibody comprises any one of the amino acid sequences of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, Table 5B, and Table 7, or contained in the sequences presented in Figures 4A, 4B, and 6; i. the antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 in any one of the combinations presented in Table 6, and the amino acid sequences of CDRL1, CDRL2, and CDRL3 in any one of the combinations presented in Table 7; Provided herein are monoclonal CD25 antibodies having at least one, at least two, at least three, at least four, at least five, or at least six of:

[0005] In some embodiments, the VH of the antibody comprises the amino acid sequence of a CDRH1, CDRH2, and CDRH3 combination presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, Table 5A, or Table 6, or contained in the sequences presented in Figure 3A, Figure 3B, or Figure 5.

[0006] In some embodiments, the VL of the CD25 antibody comprises the amino acid sequence of a combination of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, Table 5B, or Table 7, or contained in the sequences presented in Figure 4A, Figure 4B, or Figure 6.

[0007] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.

[0008] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.

[0009] In some embodiments, the antibody is a human antibody. In some embodiments, the antibody is a humanized antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, the antibody also binds cynomologous monkey CD25.

[0010] In another aspect, provided herein is a method for treating a subject in need of treatment, comprising administering to the subject a therapeutically effective amount of any one of the antibodies or pharmaceutical compositions described herein. In some embodiments, provided herein is a method for depleting the number of regulatory T cells in a subject, comprising administering to the subject a therapeutically effective amount of any one of the antibodies or pharmaceutical compositions described herein. In some embodiments, the subject suffers from cancer, and in other embodiments, the subject suffers from an autoimmune-related disease or disorder.

[0011] In another aspect, provided herein is a method of depleting the number of regulatory T cells in a sample comprising peripheral blood mononuclear cells, the method comprising contacting the sample with any one of the antibodies described herein.

[0012] In related aspects, provided herein is a pharmaceutical composition or kit comprising any one or more of the antibodies described herein, a nucleic acid sequence encoding any of the antibodies described herein, a vector comprising said nucleic acid, a phage expressing any of the antibodies described herein.

[0013] All of the above features described in this specification (including any accompanying claims, abstract, and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0014] The present application can be understood by reference to the following description taken in conjunction with the accompanying drawings. [Brief description of the drawings]

[0015] [Figure 1] Figure 1 is an exemplary illustration of the desired properties of one of the classes of CD25 antibodies described herein: CD25 antibodies that block only the alpha chain of the IL-2 receptor (CD25), do not block IL-2 binding, do not prevent IL-2 mediated signaling, and result in Treg depletion. Although the data is collected with respect to Fab clones, as provided herein, in some embodiments, the CD25 antibody is a full-length antibody, i.e., a human IgG1 antibody.

[0016] [Diagram 2] FIG. 2 is an exemplary workflow for CD25 antibody discovery, in vitro testing, and in vivo testing.

[0017] [Figure 3A] 3A and 3B depict the heavy chain variable region (VH) amino acid sequences of exemplary CD25 antibodies of the disclosure (SEQ ID NOs: 61-107, 1501, and 432-460). [Figure 3B] FIG. 3A and FIG. 3B depict the heavy chain variable region (VH) amino acid sequences of exemplary CD25 antibodies of the disclosure.

[0018] [Figure 4A]4A and 4B show the light chain variable region (VL) amino acid sequences of exemplary CD25 antibodies of the disclosure (SEQ ID NOs: 703, 705, 707, 709, 715, 717, 722, 724, 725, 727, 728, 739, 742, 745, 747, 749-752, 754-756, 759, 762, 765, 767, 769, 776, 780, 781, 783, 785, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 845, 847, 849-752, 754-756, 759, 762, 765, 767, 769, 776 9, 791, 794, 797, 799, 801, 803, 804, 806, 809~811, 813, 815, 818, 824, 827, 829, 835, 841, 842, 844, 846, 848, 849, 851, 853, 875~880, 882, 884, 886, 888, 892, 897, 901~903, 905~908, 914, 917, 919~922). [Figure 4B] FIG. 4A and FIG. 4B depict the light chain variable region (VL) amino acid sequences of exemplary CD25 antibodies of the disclosure.

[0019] [Diagram 5] FIG. 5 depicts the VH amino acid sequences of exemplary CD25 antibodies of the disclosure (SEQ ID NOs: 868, 869, 1222, 1229-1238, 1316-1318, and 1327-1335).

[0020] [Figure 6] FIG. 6 depicts the VL amino acid sequences of exemplary CD25 antibodies of the disclosure (SEQ ID NOs: 34, 701, 712, 735, 736, 737, 775, 777, 778, 795, 822, 823, 825, 838, 857, 859, 860, 861, 864, 895, and 912).

[0021] [Figure 7] FIG. 7 depicts the identification of non-IL-2 blocking agents using a biosensor-based cross-blocking assay.

[0022] [Figure 8] FIG. 8 depicts phage expressing a Fab of the present disclosure competing with an IL-2 non-blocking antibody, 7G7B6, using a biosensor.

[0023] [Figure 9] FIG. 9 shows that pSTAT5 levels are IL-2 dose dependent and are inhibited by the IL-2 blocking antibody, daclizumab.

[0024] [Figure 10] Figure 10 depicts the effect of the D5 Fab of the present disclosure on pSTAT5 levels. The data indicates that D5 Fab is a partial IL-2 blocker.

[0025] [Figure 11] FIG. 11 depicts the effect of D5 Fab at different concentrations on pSTAT5 levels relative to maximum IL-2 pSTAT5 levels.

[0026] [Figure 12] FIG. 12 depicts the difference in pSTAT5 levels between several Fab clones at 1 ug / mL, 2 ug / mL, and 5 ug / mL compared to controls [IL-2 only, Daclizumab (Dac), and 7G7B6].

[0027] [Figure 13A] Figures 13A-13C depict the difference in Kd and Koff rate constants for several Fab clones reformatted into human IgG1 antibodies (Figure 13A). Some reformatted clones have better affinity and Koff rate constants than commercial antibodies 7G7B6, daclizumab, and basiliximab (Figure 13B, Figure 13C). [Figure 13B] Figures 13A-13C depict the difference in Kd and Koff rate constants for several Fab clones reformatted into human IgG1 antibodies (Figure 13A). Some reformatted clones have better affinity and Koff rate constants than commercial antibodies 7G7B6, daclizumab, and basiliximab (Figure 13B, Figure 13C). [Figure 13C]Figures 13A-13C depict the difference in Kd and Koff rate constants for several Fab clones reformatted into human IgG1 antibodies (Figure 13A). Some reformatted clones have better affinity and Koff rate constants than commercial antibodies 7G7B6, daclizumab, and basiliximab (Figure 13B, Figure 13C).

[0028] [Figure 14A] Figures 14A-14D show representative data from an epitope binning cross-competition assay against IL-2 and commercial antibodies 7G7B6, daclizumab, and basiliximab using Fab clones reformatted into human IgG1 antibodies. The antibodies had different cross-blocking profiles. [Figure 14B] Figures 14A-14D show representative data from an epitope binning cross-competition assay against IL-2 and commercial antibodies 7G7B6, daclizumab, and basiliximab using Fab clones reformatted into human IgG1 antibodies. The antibodies had different cross-blocking profiles. [Figure 14C] Figures 14A-14D show representative data from an epitope binning cross-competition assay against IL-2 and commercial antibodies 7G7B6, daclizumab, and basiliximab using Fab clones reformatted into human IgG1 antibodies. The antibodies had different cross-blocking profiles. [Figure 14D] Figures 14A-14D show representative data from an epitope binning cross-competition assay against IL-2 and commercial antibodies 7G7B6, daclizumab, and basiliximab using Fab clones reformatted into human IgG1 antibodies. The antibodies had different cross-blocking profiles.

[0029] [Figure 15A-1]Figures 15A-15B depict the specific binding of Fab reformatted to human IgG1 in the CD25+ cell line SUDHL-1 and HEK IL-2 reporter cells (Figure 15A), and no binding in the CD25- cell line SUDHL-2 (Figure 15B). [Figure 15A-2] Figures 15A-15B depict the specific binding of Fab reformatted to human IgG1 in the CD25+ cell line SUDHL-1 and HEK IL-2 reporter cells (Figure 15A), and no binding in the CD25- cell line SUDHL-2 (Figure 15B). [Figure 15B] Figures 15A-15B depict the specific binding of Fab reformatted to human IgG1 in the CD25+ cell line SUDHL-1 and HEK IL-2 reporter cells (Figure 15A), and no binding in the CD25- cell line SUDHL-2 (Figure 15B).

[0030] [Figure 16A] Figures 16A-16B show representative dose response curves in the CD25+ cell line SUDHL-1 of human IgG1 reformatted Fab clones compared to commercial antibodies 7G7B6, daclizumab, and basiliximab (Figure 16A). Some clones show better EC50 values ​​than the non-IL-2 blocker 7G7B6 (Figure 16B). [Figure 16B] Figures 16A-16B show representative dose response curves in the CD25+ cell line SUDHL-1 of human IgG1 reformatted Fab clones compared to commercial antibodies 7G7B6, daclizumab, and basiliximab (Figure 16A). Some clones show better EC50 values ​​than the non-IL-2 blocker 7G7B6 (Figure 16B).

[0031] [Figure 17] Figure 17 shows representative data for human IgG1 reformatted Fab clones binding to recombinant cynomolgus CD25 protein (25 nM). The majority of clones bind in a dose-dependent manner (starting at 25 nM, 3-fold dilutions).

[0032] [Figure 18A] Figures 18A-18B show the difference in pSTAT5 levels across several human IgG1 reformatted Fab clones at 5ug / ml compared to IL-2 levels at 0.1ng / mL (Figure 18A). Figure 18B shows pSTAT5 levels in relation to IL-2 dose response curves (starting at 10ng / mL, 10-fold dilutions) using 5ug / mL of each antibody. Several clones were shown to be better IL-2 blockers and IL-2 non-blockers than commercial antibodies 7G7B6, daclizumab, and basiliximab at 0.1ng / mL. [Figure 18B] Figures 18A-18B show the difference in pSTAT5 levels across several human IgG1 reformatted Fab clones at 5ug / ml compared to IL-2 levels at 0.1ng / mL (Figure 18A). Figure 18B shows pSTAT5 levels in relation to IL-2 dose response curves (starting at 10ng / mL, 10-fold dilutions) using 5ug / mL of each antibody. Several clones were shown to be better IL-2 blockers and IL-2 non-blockers than commercial antibodies 7G7B6, daclizumab, and basiliximab at 0.1ng / mL.

[0033] [Figure 19A] Figures 19A-19B show representative data for Fab clones reformatted to human IgG1 at 20ug / mL inducing cell killing in an ADCC assay using PBMC as effector cells and SUHL-1 cells as targets (Figure 19A). Some clones showed higher ADCC than 7G7B6 when using 5-fold dilutions starting at 10ug / mL of antibody (Figure 19B). [Figure 19B]Figures 19A-19B show representative data for Fab clones reformatted to human IgG1 at 20ug / mL inducing cell killing in an ADCC assay using PBMC as effector cells and SUHL-1 cells as targets (Figure 19A). Some clones showed higher ADCC than 7G7B6 when using 5-fold dilutions starting at 10ug / mL of antibody (Figure 19B). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0034] Provided herein is an antibody that specifically binds to CD25. The antibody can be human, chimeric, or humanized. Also provided herein is a method of using and producing the described antibody. For example, CD25 antibody can be used therapeutically to treat cancer, including administering the antibody or a pharmaceutical composition thereof to a subject in need of treatment. Also provided is a method of producing the CD25 antibody described herein.

[0035] definition Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and exemplary methods and materials are described.

[0036] The headings provided herein are not limitations of the various aspects or embodiments of the invention. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0037] Numeric ranges are inclusive of the numbers defining the range.

[0038] As used herein, the term antibody includes, but is not limited to, monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, non-human antibodies, chimeric antibodies, monovalent antibodies, and antigen-binding fragments of antibodies (e.g., Fab fragments, Fab'2 fragments, or scFV). Antibody-drug conjugates, bispecific antibodies, and multispecific antibodies that exhibit specificity for CD25 are also provided herein. Non-human antibodies (e.g., murine antibodies) can be "humanized" using conventional techniques (e.g., by introducing changes in the framework regions while retaining the murine CDRs).

[0039] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. The terms include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms encompass nucleic acids that contain known analogs of natural nucleotides and have similar binding properties and are metabolized in a manner similar to naturally occurring nucleotides, unless specifically limited or indicated otherwise.

[0040] When a nucleic acid or amino acid sequence is said to have a certain percent "sequence identity" or "identity" with another nucleic acid or amino acid sequence, or to be a certain percent "identical," when the sequences are aligned, that percentage of bases or amino acids are the same, and in the same relative positions, when the two sequences are compared.

[0041] The terms "individual," "subject," and "patient" are used interchangeably herein and refer to any subject for whom treatment or therapy is desired. The subject may be a mammalian subject. Mammalian subjects include, for example, humans, non-human primates, rodents (e.g., rats, mice), lagomorphs (e.g., rabbits), ungulates (e.g., cows, sheep, pigs, horses, goats, and others), and the like. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a companion animal (e.g., cat, dog).

[0042] antibody Provided herein are antibodies that specifically bind to CD25. Such antibodies are capable of binding to the CD25 antigen, either alone or in association with other molecules that form the high affinity IL-2 receptor, present on regulatory T cells.

[0043] In some embodiments, the CD25 antibody is a humanized antibody that specifically binds to CD25.

[0044] In some embodiments, the CD25 antibody is a chimeric antibody, eg, a mouse-human chimeric antibody, eg, an antibody comprising a mouse variable domain and a human constant region.

[0045] The CD25 antibody of the present disclosure can be any of human IgA, IgD, IgE, IgG, or IgM antibodies. The IgA antibody can be an IgA1 or IgA2 antibody. The IgG antibody can be an IgG1, IgG2, IgG2a, IgG2b, IgG3, or IgG4 antibody. A combination of any of these antibodies can also be made and used. In some embodiments, the constant region is of IgG type, e.g., human IgG type. In some embodiments, the constant region is of IgG1 type, e.g., human IgG1 type.

[0046] In some embodiments, a CD25 antibody exhibits cross-reactivity with more than one species, e.g., specifically binds to both human CD25 and non-human CD25, e.g., specifically binds to both human CD25 and cynomolgus CD25.

[0047] The KD (affinity constant) of the antibodies provided herein is about 10 -5 nM to about 10 -14 In some embodiments, the KD of the antibodies provided herein is in the range of about 10 -8 nM to about 10 -12 In an exemplary embodiment, the KD of the CD25 antibody is at least about 10 -5 nM, about 10 -6 nM, about 10 -7 nM, about 10 -8 nM, about 10 -9 nM, about 10 -10 nM, about 10 -11 nM, about 10 -12 nM, about 10 -13 nM, or even about 10 -14 nM.

[0048] The Kd (off-rate constant) of the antibodies provided herein is about 10 -2 1 / s to about 10 -6 The range is up to 1 / s.

[0049] In some embodiments, the CD25 antibody exhibits the same affinity (KD) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH. In some embodiments, the CD25 antibody exhibits the same dissociation rate (Kd) for the CD25 antigen at both physiological pH (about 7.4) and non-physiological pH.

[0050] In some embodiments, the CD25 antibodies exhibit different affinities (different KD) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH. In some embodiments, the CD25 antibodies exhibit different dissociation rate constants (different Kd) for the CD25 antigen at physiological pH (about 7.4) and non-physiological pH.

[0051] In some embodiments, the CD25 antibodies exhibit lower affinity (higher KD) for the CD25 antigen at physiological pH (about 7.4) than at lower than physiological pH, e.g., when the pH is 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or less. In exemplary embodiments, the antibodies exhibit higher affinity for the CD25 antigen at a pH of about 6.5 compared to the affinity at a pH of about 7.4. In some embodiments, such antibodies are useful to retain activity or exhibit enhanced activity in acidic, hypoxic environments, e.g., tumor microenvironments.

[0052] In some embodiments, the antibody is a non-IL-2 blocking antibody (non-IL-2 blocker), i.e., the binding of the antibody to CD25 does not block or interfere with the binding of an IL-2 ligand to CD25 (IL-2 α chain) and does not affect IL-2 mediated signaling, e.g., signaling through the IL-2 / JAK3 / STAT-5 signaling pathway. In some embodiments, the antibody does not block the binding of an IL-2 ligand to CD25 (IL-2 α chain) and binds to a different epitope than that bound by the 7G7B6 antibody. In some embodiments, the antibody does not block the binding of an IL-2 ligand to CD25 (IL-2 α chain) but blocks trimerization of the β, γ and α chains of the IL-2 receptor (CD25).

[0053] In some embodiments, the antibody is an IL-2 blocking antibody (IL-2 blocking agent), e.g., the antibody blocks or prevents the binding of an IL-2 ligand to the α, β, and / or γ chain of its receptor and reduces or inhibits IL-2-mediated signaling. In certain embodiments, the antibody blocks or prevents the binding of an IL-2 ligand to CD25. In some embodiments, the antibody blocks or prevents the binding of an IL-2 ligand to CD25 and binds to an epitope that is different from the epitope bound by either daclizumab or basiliximab.

[0054] In some embodiments, the CD25 antibody is a partial blocking antibody (partial IL-2 blocker) that partially, but not completely, blocks binding of the IL-2 ligand to the α, β, and / or γ chains of the IL-2 receptor (CD25) and / or partially, but not completely reduces IL-2-mediated signal transduction.

[0055] In some embodiments, the CD25 antibody blocks or prevents heterotrimerization of the IL-2 α, IL-2 β, and IL-2 γ chains. In some embodiments, the antibody does not block the binding of IL-2 ligand to CD25, but blocks or prevents heterotrimerization of the IL-2 α, IL-2 β, and IL-2 γ chains. In certain embodiments, the antibody selectively binds to regulatory T cells. In other embodiments, the antibody selectively binds to T effector cells.

[0056] In some embodiments, CD25 antibody binding results in depletion of regulatory T cells (Treg) but allows proliferation of effector T cells (Teff).

[0057] In some embodiments, the antibody binds to CD25 in a trans orientation. In other embodiments, the antibody binds to CD25 in a cis orientation. In yet further embodiments, the antibody is capable of binding to CD25 in either a cis or trans configuration.

[0058] In some embodiments, the CD25 antibody exhibits a higher binding affinity to CD25 compared to the binding of 7G7B6 (anti-human CD25 with mouse IgG2a Fc receptor; IL-2 non-blocking agent; BioXcell) to CD25.

[0059] Tables 1A-1L, 2A-2C, 3A-3C, 4A-4B, 5A-5B, 6, and 7, as well as Figures 3A, 3B, 4A, 4B, 5, and 6 provide exemplary sequences for the CD25 antibodies described herein. It should be noted that the complementarity determining region (CDR) and framework (FR) sequences shown are based on the IMGT convention for antibody annotation. However, one of skill in the art can determine other representations of CDR and framework sequences based on the VH and VL sequences provided using other algorithms / conventions for antibody annotation, such as Kabat and Chothia. Thus, the CDR and FR sequences of the present disclosure are not limited to the exemplary CDR and FR sequences annotated in the tables below, but rather, CDRs will be understood and determined by one of skill in the art given the sequences of the variable regions.

[0060] [Table 1]

[0061] [Table 2]

[0062] [Table 3]

[0063] [Table 4]

[0064] [Table 5]

[0065]

Table 6

[0066]

Table 7

[0067]

Table 8

[0068]

Table 9

[0069]

Table 10

[0070]

Table 11

[0071]

Table 12

[0072]

Table 13

[0073]

Table 14

[0074]

Table 15

[0075]

Table 16

[0076]

Table 17

[0077]

Table 18

[0078]

Table 19

[0079]

Table 20

[0080]

Table 21

[0081]

Table 22

[0082]

Table 23

[0083]

Table 24

[0084] In some embodiments, the CD25 antibody comprises a "VDJ region" heavy chain sequence provided in any one of Tables 2A, 2B, and 2C, and a "VJ region" light chain sequence provided in any one of Tables 3A, 3B, and 3C, or a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the antibody comprises a heavy chain variable region sequence (or a humanized version thereof) from a particular antibody clone so named by a given "ID", and a light chain variable region sequence (or a humanized version thereof) from the same antibody clone (e.g., a light chain from a clone identified by the same "ID"). Thus, the antibody clone of origin can be identified by the ID provided in Tables 2A-2C or Tables 3A-3C. For example, in such an embodiment, the CD25 antibody comprises the heavy chain variable region of antibody clone "AHH03760" (or a humanized version thereof) provided in row 1 of Table 2B, and the light chain variable region of antibody clone "AHH03760" (or a humanized version thereof) provided in row 3 of Table 3B. In other embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a particular antibody clone so named by a given "ID" (or a humanized version thereof), and a light chain variable region sequence from a different antibody clone (e.g., a light chain from a clone identified by the same "ID") (or a humanized version thereof).

[0085] In some embodiments, the CD25 antibody comprises a CDRH1, CDRH2, and CDRH3 presented in any one of Tables 2A, 2B, and 2C, and a CDRL1, CDRL2, and CDRL3 presented in any one of Tables 3A, 3B, and 3C. In such embodiments, the CD25 antibody comprises a CDRH1, CDRH2, and CDRH3 from a particular antibody clone, and a CDRL1, CDRL2, and CDRL3 from the same antibody clone. As discussed above, the antibody clone of origin can be identified by the ID provided in Tables 2A-2C or Tables 3A-3C.

[0086] In some embodiments, the CD25 antibody comprises a heavy chain variable region presented in Table 4A, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. The variable region may comprise a contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequence, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto, capable of forming a complete variable region. In some embodiments, the CD25 antibody comprises a light chain variable region presented in Table 4B, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. The variable region may comprise a contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequence that can form a complete variable region, a humanized version thereof, or an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 4A and a complete light chain variable region as presented in Table 4B, the variable region also includes a humanized version thereof, and an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a particular antibody clone and a light chain variable region sequence from the same antibody clone, the variable region sequence also includes a humanized version thereof, and an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a particular antibody clone and a light chain variable region sequence from a different antibody clone, including humanized versions thereof, and amino acid sequences that comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto.The antibody clones of origin can be identified by the IDs provided in Tables 4A and 4B.

[0087] In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 presented in Table 4A, and CDRL1, CDRL2, and CDRL3 presented in Table 4B. In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a particular antibody clone, and CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a particular antibody clone, and CDRL1, CDRL2, and CDRL3 from a different antibody clone. As discussed above, the antibody clone of origin can be identified by the IDs provided in Tables 4A and 4B.

[0088] In some embodiments, the CD25 antibody comprises a heavy chain variable region as presented in Table 5A, including humanized versions thereof and amino acid sequences with at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. The variable region may comprise a contiguous HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequence that may form a complete variable region, including humanized versions thereof and amino acid sequences with at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. In some embodiments, the CD25 antibody comprises a light chain variable region as presented in Table 5B, including humanized versions thereof and amino acid sequences with at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. The variable region may comprise a contiguous LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, LRF4 sequence that may form a complete variable region, including humanized versions thereof and amino acid sequences that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 5A and a complete light chain variable region as presented in Table 5B, including humanized versions thereof and amino acid sequences that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a particular antibody clone and a light chain variable region sequence from the same antibody clone, including humanized versions thereof and amino acid sequences that have at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith.In other embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a particular antibody clone and a light chain variable region sequence from a different antibody clone, including humanized versions thereof, and amino acid sequences that comprise at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. The antibody clones of origin can be identified by the IDs provided in Tables 5A and 5B.

[0089] In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 presented in Table 5A, and CDRL1, CDRL2, and CDRL3 presented in Table 5B. In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a particular antibody clone, and CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a particular antibody clone, and CDRL1, CDRL2, and CDRL3 from a different antibody clone. As discussed above, the antibody clone of origin can be identified by the IDs provided in Tables 5A and 5B.

[0090] In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the heavy chain variable regions presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the heavy chain variable regions presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, which has been further humanized.

[0091] In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the light chain variable regions presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, or an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto. In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the heavy chain variable regions presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, which has been further humanized using conventional techniques.

[0092] In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the heavy chain variable regions presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, a humanized version thereof, or an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto, and the CD25 antibody comprises the amino acid sequence of any one of the light chain variable regions presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, a humanized version thereof, or an amino acid sequence that comprises at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto.

[0093] In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, or Table 5A, or contained in the sequences presented in Figure 3A, Figure 3B, or Figure 5. In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 6.

[0094] In some embodiments, the VL of the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, or Table 5B, or contained in the sequences presented in Figure 4A, Figure 4B, or Figure 6. In some embodiments, the VL of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 7.

[0095] In some embodiments, the VH of the CD25 antibody comprises the amino acid sequence of CDRH1, CDRH2, and CDRH3 presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, or Table 5A, or contained in the sequence presented in Figure 3A, Figure 3B, or Figure 5, and the VL of the CD25 antibody comprises the amino acid sequence of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, or Table 5B, or contained in the sequence presented in Figure 4A, Figure 4B, or Figure 6. In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 6, and the VL of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 7.

[0096] In some embodiments, the VH of the antibody comprises the amino acid sequences of CDR1, CDR2, and CDR3 presented in Table 5 A. In some embodiments, the VL of the antibody comprises the amino acid sequences of CDR1, CDR2, and CDR3 presented in Table 5 B. In some embodiments, the antibody comprises a VH that comprises the amino acid sequences of CDR1, CDR2, and CDR3 presented in Table 5 A, and a VL that comprises the amino acid sequences of CDR1, CDR2, and CDR3 presented in Table 5B.

[0097] In some embodiments, the antibody comprises the amino acid sequences of D5 CDR1, CDR2, and CDR3, the amino acid sequences of D5 VH and D5 VL, as presented in Tables 1A and 1B, or a humanized version of the amino acid sequences of D5 VH and D5 VL, as presented in Tables 1A and 1B.

[0098] In some embodiments, the antibody comprises the amino acid sequences of D11 CDR1, CDR2, and CDR3, the amino acid sequences of D11 VH and D11 VL, as presented in Tables 1C and 1D, or a humanized version of the amino acid sequences of D11 VH and D11 VL, as presented in Tables 1C and 1D.

[0099] In some embodiments, the antibody comprises the amino acid sequences of D16 CDR1, CDR2, and CDR3, the amino acid sequences of D16 VH and D16 VL, as presented in Tables 1E and 1F, or a humanized version of the amino acid sequences of D16 VH and D16 VL, as presented in Tables 1E and 1F.

[0100] In some embodiments, the antibody comprises the amino acid sequences of D17 CDR1, CDR2, and CDR3, the amino acid sequences of D17 VH and D17 VL, as presented in Tables 1G and 1H, or a humanized version of the amino acid sequences of D17 VH and D17 VL, as presented in Tables 1G and 1H.

[0101] In some embodiments, the antibody comprises the amino acid sequences of D34 CDR1, CDR2, and CDR3, the amino acid sequences of D34 VH and D34 VL, as presented in Tables 1I and 1J, or a humanized version of the amino acid sequences of D34 VH and D34 VL, as presented in Tables 1I and 1J.

[0102] In some embodiments, the antibody comprises the amino acid sequences of D36 CDR1, CDR2, and CDR3, the amino acid sequences of D36 VH and D36 VL, as presented in Tables 1K and 1L, or a humanized version of the amino acid sequences of D36 VH and D36 VL, as presented in Tables 1K and 1L.

[0103] In some embodiments, the CD25 antibody is selected from the group consisting of AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH45 01, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0104] In some embodiments, the CD25 antibody is selected from the group consisting of AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH45 01, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0105] In some embodiments, the CD25 antibody is selected from the group consisting of AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH05287, AH05289, AH05290, AH05291, AH05292, AH05293, AH05294, AH05295, AH05296, AH05297, AH05298, AH05299, AH05300, AH05301, AH05302, AH05303, AH05304, AH05305, AH05306, AH05307, AH05308, AH05309, AH05401, AH05402, AH05403, AH05404, AH05405, AH05406, AH05407, AH05408, AH05409, AH05500, AH05501, AH05502, AH05503, AH05504, AH05505, AH05506, AH05507, AH05508, AH05509, AH05510 Amino acids of CDRH1, CDRH2, and CDRH3 of any one of clones H4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1 and the CD25 antibody comprises the sequence set forth in Table 5B: AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, AH4501, The amino acid sequence of CDRL1, CDRL2, and CDRL3 of any one of clones AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0106] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04507 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0107] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04522 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0108] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04526 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0109] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04527 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0110] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04734 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0111] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04750 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0112] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05214 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0113] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05247 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0114] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05249 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0115] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05251 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0116] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05256 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0117] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05257 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0118] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05258 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0119] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05259 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0120] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05268 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0121] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05271 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0122] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05274 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0123] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05280 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0124] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05285 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0125] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05286 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0126] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4501 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0127] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4502 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0128] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4503 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0129] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4505 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0130] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4509 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0131] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4511 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0132] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4518 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0133] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4523 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0134] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4524 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0135] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4525 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0136] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D11 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0137] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D17 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0138] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D34 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0139] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D36 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0140] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D5 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0141] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of BP003-T2P1C4 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0142] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of BP003-T2P1D10 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0143] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of BP003-T2P1D7 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0144] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of BP003-T2P1E3 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0145] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of BP003-T2P1D1 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0146] In some embodiments, CD25 antibodies are conjugated for a variety of purposes, including but not limited to, use in therapeutics and detection / diagnostics.

[0147] Nucleic acid sequences encoding any of the CD25 antibodies provided herein are also provided herein. Exemplary nucleic acid sequences encoding the D5, D11, D16, D17, D34, and D36 VH and VL regions are provided in Tables 1A-1L - humanized versions thereof can be used. Also provided herein are vectors comprising any of the nucleic acids encoding the antibodies, phages comprising such vectors, and host cells comprising such vectors.

[0148] Antibody production and testing FIG. 2 is an exemplary, non-limiting workflow for CD25 antibody discovery, in vitro testing, and in vivo testing, although one of skill in the art will recognize that there are alternative ways to approach antibody discovery and testing.

[0149] The CD25 antibodies described herein can be produced by injecting a CD25 full or partial immunogen into an animal, e.g., a mouse or rabbit. CD25 immunogen-positive B cells from the animal can be collected and a phage library can be generated therefrom. In some embodiments, the phage expresses Fab fragments of candidate CD25 antibodies. The phage can be subjected to multiple rounds of screening (referred to herein as phage panning), e.g., against successively lower concentrations of CD25 antigen, to select Fab fragments capable of binding CD25 with high affinity. The phage can be screened against CD25 antigen-coated beads, or, e.g., some other substrate. In some embodiments, the screening is performed at physiological pH (e.g., about pH 7.4). In other embodiments, the screening is performed at a lower pH, e.g., about pH 6.5, to screen for Fab fragments capable of binding CD25 antigen at lower pH for use in therapeutic contexts, e.g., for use in hypoxic acidic tumor microenvironments.

[0150] The CD25 antibodies generated herein can be tested for efficacy using a number of in vitro, in vivo, ex vivo, and / or cell-based assays.

[0151] In some embodiments, the CD25 antibodies herein can be assayed for and further selected based on their ability to deplete regulatory T cells. In certain embodiments, the CD25 antibodies herein can be assayed for and further selected based on their ability to deplete regulatory T cells in an acidic environment, e.g., at a pH lower than physiological pH, e.g., pH 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or less.

[0152] In some embodiments, the CD25 antibodies herein can be assayed and further selected based on a pSTAT5 in vitro assay to assay for signaling through the IL-2 / IL-2 receptor pathway, with maintenance of that signaling indicating that the antibody is not an IL-2 blocking antibody.

[0153] In some embodiments, the CD25 antibodies herein can be assayed using biosensor screens to characterize molecular interactions.

[0154] In some embodiments, the CD25 antibodies herein can be assayed for competition in binding against other known CD25 antibodies with known mechanisms.

[0155] In some embodiments, the CD25 antibodies herein can be assayed for epitope specificity.

[0156] In some embodiments, the CD25 antibodies herein can be assayed for their ability to be non-IL-2 blocking agents, IL-2 blocking agents, or partial IL-2 blocking agents.

[0157] therapeutic use Provided herein are CD25 antibodies for therapeutic use, e.g., for use in a proliferative disease or disorder such as cancer, or for use in an autoimmune disease.

[0158] Thus, provided herein is a method of treating cancer, comprising administering a therapeutically effective amount of a therapeutic CD25 antibody to a subject in need thereof. In some embodiments, the cancer is a primary cancer. In some embodiments, the cancer is a metastatic cancer. In some embodiments, the cancer comprises a solid tumor, and in other embodiments, the cancer comprises a liquid tumor, e.g., a blood-based cancer. In an exemplary embodiment, the CD25 antibody is a non-IL-2 blocking antibody.

[0159] Thus, provided herein is a method of treating an autoimmune-related disease or disorder comprising administering to a subject in need thereof a therapeutically effective amount of a therapeutic CD25 antibody. In an exemplary embodiment, the CD25 antibody is an IL-2 blocking antibody.

[0160] As used herein, a subject refers to any animal classified as a mammal, including humans, domestic and farm animals, as well as zoo, sports, or pet animals, such as dogs, horses, rabbits, cows, pigs, hamsters, gerbils, mice, ferrets, rats, cats, etc. A subject can be male or female.

[0161] Administration of any of the therapeutic CD25 antibodies provided herein can be administered in combination with other known drugs / treatments (e.g., small molecule drugs or biologics). Administration can be sequential or simultaneous.

[0162] In vivo administration of the therapeutic CD25 antibodies described herein may be performed intravenously, intratumorally, intracranially, intralesionally (e.g., intralesional injection, direct contact diffusion), intracavitary (intraperitoneally, intrapleurally, intrauterinely, intrarectally), intraperitoneally, intramuscularly, subcutaneously, topically, orally, transdermally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In an exemplary embodiment, the route of administration is by intravenous injection.

[0163] A therapeutically effective amount of the therapeutic antibody is administered. The appropriate dosage of the therapeutic antibody can be determined based on the severity of the cancer, the subject's clinical condition, the subject's medical history and response to treatment, and the discretion of the attending physician.

[0164] Dosages of the CD25 antibodies provided herein may vary from about 1 ng / kg to about 1000 mg / kg or more of subject body weight per day, depending on the route of administration. For repeated administration over several days or more, depending on the severity of the cancer, treatment may be continued until the desired suppression of symptoms is achieved. Dosing regimens may be useful depending on the pattern of pharmacokinetic decay the physician wishes to achieve. For example, dosing an individual from once per week to 21 times is provided herein. In certain embodiments, the dosing frequency is three times per day, twice per day, once per day, once every two days, once per week, once per two weeks, once per four weeks, once per five weeks, once per six weeks, once per seven weeks, once per eight weeks, once per nine weeks, once per ten weeks, or once per month, once per two months, once per three months, or at longer intervals. The course of treatment may be monitored by conventional techniques and assays. Dosage regimens can vary over time, regardless of the dose used.

[0165] Diagnostic Use The CD25 antibodies provided herein can be used for diagnosis and detection. Depending on the application, the CD25 antibodies can be detected and quantified in vivo or in vitro.

[0166] The CD25 antibodies provided herein can be modified for use in a variety of immunoassays, including, but not limited to, enzyme-linked immunosorbent assay (ELISA), Western blot, radioimmunoassay (RIA), flow cytometry, radioimmunoassay, immunofluorescence assay, spectrophotometry, autoradiography, electrophoresis, high performance liquid chromatography (HPLC), or thin layer chromatography (TLC).

[0167] The CD25 antibodies provided herein may comprise a detectable label, such as a label detectable by spectroscopic, photochemical, biochemical, immunochemical, fluorescent, electrical, optical, or chemical methods. Labels useful in this disclosure include, but are not limited to, fluorescent dyes, radiolabels, enzymes, colorimetric labels, avidin, or biotin.

[0168] In some embodiments, the CD25 antibody is radiolabeled with an isotope useful for imaging with nuclear medicine devices (SPECT, PET, or scintigraphy).

[0169] Pharmaceutical Compositions The present disclosure provides a composition comprising a therapeutic CD25 antibody. In some embodiments, the composition is sterile. A pharmaceutical composition generally comprises an effective amount of a therapeutic antibody in a pharma- ceutical acceptable excipient.

[0170] Kits and Manufactured Products The present disclosure also provides kits comprising any of the CD25 antibodies described herein, for example, for either therapeutic or diagnostic use. In some embodiments, the kit further comprises a component selected from any of the secondary antibodies, reagents for immunohistochemistry analysis, pharma- ceutically acceptable excipients, and instructions, and any combination thereof. In some embodiments, the kit comprises any one or more of the therapeutic compositions described herein, together with one or more pharma- ceutically acceptable excipients.

[0171] The present application also provides an article of manufacture comprising any one of the therapeutic or diagnostic compositions or kits described herein. An example of an article of manufacture includes a vial (e.g., a sealed vial).

[0172] The description provided herein sets forth numerous example structures, methods, parameters, etc. It should be recognized, however, that such description is not intended as a limitation on the scope of the disclosure, but rather is provided as a description of example embodiments.

[0173] The following examples are included for illustrative purposes and are not intended to limit the scope of the invention.

[0174] Enumeration of embodiments Embodiment 1. A monoclonal CD25 antibody that binds to human CD25 and has the following characteristics: a. the antibody does not block the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25) and binds to an epitope distinct from that bound by 7G7B6; b. the antibody does not block the binding of the IL-2 ligand to the α chain of the IL-2 receptor (CD25), but blocks trimerization of the β, γ, and α chains of the IL-2 receptor (CD25); c. the antibody blocks binding of the IL-2 ligand to the alpha chain (CD25), beta chain, and / or gamma chain of the IL-2 receptor and binds to an epitope distinct from that bound by daclizumab or basiliximab; d. the antibody exhibits a higher binding affinity to CD25 at a pH of less than 7.4 when compared to the binding affinity to CD25 at a pH of 7.4; e. the antibody comprises the amino acid sequence of any one of the heavy chain variable regions presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto; f. the antibody comprises the amino acid sequence of any one of the light chain variable regions presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto; g. the VH of the antibody comprises any one of the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, Table 5A, and Table 6, or contained in the sequences presented in Figures 3A, 3B, and 5; h. the VL of the CD25 antibody comprises any one of the amino acid sequences of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, Table 5B, and Table 7, or contained in the sequences presented in Figures 4A, 4B, and 6; i. The antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 in any one of the combinations presented in Table 6, and the amino acid sequences of CDRL1, CDRL2, and CDRL3 in any one of the combinations presented in Table 7. A monoclonal CD25 antibody having at least one of the following:

[0175] Embodiment 2. The antibody of embodiment 1, having at least two, at least three, at least four, at least five, or at least six of the properties provided in embodiment 1.

[0176] Embodiment 3. The antibody of embodiment 1, which does not interfere with the binding of the IL-2 ligand to the alpha chain of the IL-2 receptor (CD25) and which binds to a different epitope than that bound by 7G7B6.

[0177] Embodiment 4. An antibody according to embodiment 1, which does not prevent the binding of an IL-2 ligand to the alpha chain of the IL-2 receptor (CD25), but prevents trimerization of the beta, gamma and alpha chains of the IL-2 receptor (CD25).

[0178] Embodiment 5. The antibody of embodiment 1, which blocks the binding of an IL-2 ligand to the IL-2 receptor and binds to an epitope distinct from that bound by daclizumab or basiliximab.

[0179] Embodiment 6. The antibody of embodiment 1, which exhibits a higher binding affinity to CD25 at a pH of less than 7.4, as compared to the binding affinity to CD25 at a pH of 7.4.

[0180] Embodiment 7. The antibody of embodiment 6, which exhibits a higher affinity for binding to CD25 at a pH of about 6.5.

[0181] Embodiment 8. The antibody of any one of embodiments 1 to 7, comprising an amino acid sequence of any one of the heavy chain variable regions presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, and Table 5A, or Figures 3A, 3B, and 5, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto.

[0182] Embodiment 9. The antibody of any one of embodiments 1 to 8, comprising an amino acid sequence of any one of the light chain variable regions presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, and Table 5B, or Figures 4A, 4B, and 6, a humanized version thereof, or an amino acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% sequence identity thereto.

[0183] Embodiment 10. The antibody of any one of embodiments 1-7, wherein the VH of the antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 presented in Table 1A, Table 1C, Table 1E, Table 1G, Table 1I, Table 1K, Table 2A, Table 2B, Table 2C, Table 4A, or Table 5A, or contained in the sequences presented in Figure 3A, Figure 3B, or Figure 5.

[0184] Embodiment 11. The antibody of any one of embodiments 1-7 and embodiment 10, wherein the VL of the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 presented in Table 1B, Table 1D, Table 1F, Table 1H, Table 1J, Table 1L, Table 3A, Table 3B, Table 3C, Table 4B, or Table 5B, or contained in the sequences presented in Figure 4A, Figure 4B, or Figure 6.

[0185] Embodiment 12. The antibody of any one of embodiments 1 to 10, wherein the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 of any one of the combinations presented in Table 6.

[0186] Embodiment 13 The antibody of any one of embodiments 1 to 10, wherein the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of any one of the combinations presented in Table 7.

[0187] Embodiment 14. The antibody of any one of embodiments 1 to 13, which is a human antibody.

[0188] Embodiment 15. The antibody of any one of embodiments 1 to 13, which is a humanized antibody.

[0189] Embodiment 16. The antibody of any one of embodiments 1 to 13, which is a chimeric antibody.

[0190] Embodiment 17. The antibody of embodiment 16, comprising a mouse variable domain and a human constant domain.

[0191] Embodiment 18. The antibody of any one of embodiments 1 to 15, which is an antibody fragment.

[0192] Embodiment 19. The antibody of any one of embodiments 1 to 18, which also binds cynomolgus CD25.

[0193] Embodiment 20. A pharmaceutical composition comprising any one of the antibodies described in any one of embodiments 1 to 19.

[0194] Embodiment 21. A nucleic acid sequence encoding any one of the antibodies described in any one of embodiments 1 to 19.

[0195] Embodiment 22. A vector comprising the nucleic acid sequence of embodiment 21.

[0196] Embodiment 23. A phage expressing any one of the antibodies described in any one of embodiments 1 to 19.

[0197] Embodiment 24. A method of treating a subject in need of treatment comprising administering to the subject a therapeutically effective amount of any one of the antibodies described in any one of embodiments 1-19 or the pharmaceutical composition described in embodiment 20.

[0198] Embodiment 25. A method for depleting the number of regulatory T cells in a subject, comprising administering to the subject a therapeutically effective amount of any one of the antibodies described in any one of embodiments 1 to 19 or the pharmaceutical composition described in embodiment 20.

[0199] Embodiment 26 The method of embodiment 24 or 25, wherein the subject has cancer.

[0200] Embodiment 27 The method of embodiment 24 or 25, wherein the subject is suffering from an autoimmune-related disease or disorder.

[0201] Embodiment 28. A method of depleting the number of regulatory T cells in a sample comprising peripheral blood mononuclear cells, comprising contacting the sample with any one of the antibodies described in any one of embodiments 1 to 19.

[0202] Embodiment 29. A kit comprising any one of the antibodies described in any one of embodiments 1 to 19 or the pharmaceutical composition described in embodiment 20. EXAMPLES

[0203] Example 1 Immunization with CD25 Full-length CD25 conjugated with KLH was injected into five different BalbC mice. All injections were performed via the tail vein. The immunization protocol was as follows: - Day 0: Immunization 1 - Day 14: Immunization 2 - Day 28: Immunization 3 - Day 35: Blood collection

[0204] Four phage libraries were generated using splenocytes and leukocytes from four of the five mice. The phage libraries contained phages expressing antigen-binding fragments (Fab). More specifically, M13 phagemid libraries using materials from immunized animals were constructed as follows: (i) total RNA from leukocytes and splenocytes was extracted; (ii) VH and VL genes were amplified using specific primers; and (iii) VH and VL fragments were inserted into GenScript's M13 phagemid vector by two-step cloning. Library size >2×10 8 the insertion rate was >90% and the in-frame rate was >80%. The library was a highly diverse library with >95% unique sequences.

[0205] Example 2 Phage panning for CD25 binding Three rounds of phage panning of the Fab-containing phage library were performed using an ELISA-based assay. Phages were screened against CD25-coated beads. Each round was performed with decreasing concentrations of CD25. Individual phage clones were expressed in E. coli TG1 cells (plated on LB / carbenicillin). Single colonies were cultured in 0.4 ml 2YT broth at 37° C. for 30 min and then infected with M13 K07 helper phage at 37° C. for 3 h. Then, 50 μg / ml carbenicillin and 10 μg / ml kanamycin were added to the culture, which was then grown overnight at 25° C. The following day, phages were harvested from the culture.

[0206] Positive clones were sequenced as follows: Positive hit clones were grown overnight and plasmid DNA was prepared using Qiagen plasmid miniprep kit. Purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for Sanger sequencing. VH sequences were sequenced using the sequencing primers (ACGCCTGCGAAGTCACCCAT (SEQ ID NO: 1497) ) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC (SEQ ID NO: 1498) The VL sequence was obtained using the sequencing primer (AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 1499) ) or (CGGATAACAATTTCACACAG (Sequence number 1500) ) was obtained.

[0207] Figures 3A, 3B, 4A, and 4B, and Tables 2A, 2B, 3A, and 3B show the VH and VL sequences of the Fabs selected after the second round of panning.

[0208] Figures 5 and 6, and Tables 2C and 3C show the VH and VL sequences of the Fabs selected after the third round of panning.

[0209] Tables 4A, 4B, 5A, and 5B show additional clones following a similar panning protocol.

[0210] Further pH-based phage panning was carried out.

[0211] Example 3 Phage panning for CD25 binding at pH 6.5 Further phage panning was performed to select for Fab candidates that bind CD25 in the lower pH range, for example to select for binders that can bind in the hypoxic acidic tumor microenvironment.

[0212] Using standard phage display protocols (Barbas et al., 2001), four mouse HuCD25-immunized phage libraries (7807, 7808, 7809, 7810) were transformed by electroporation in TG1 and phages were propagated by addition of CM13. Phage-secreting TG1 cultures were PEG-precipitated with PEG / NaCl after 1 h incubation on ice.

[0213] The phage libraries (7807, 7808, 7809, 7810) were subjected to specific pH selection using standard protocols. To remove antibodies that bind with high affinity at physiological pH, first 3×10 IgG antibodies were selected at pH 7.4 by 1 hour absorption on ELISA plates coated with 10 ug / ml full-length CD25 (400 nM) in PBST pH 7.4. 11 pfu phage (3 × 10 8 Subtractive panning was performed by counterselection of 1000× (1000x representation) of 1000 phage clones. The resulting phage supernatant was collected and the pH was adjusted to pH 6.5 with PBST. Subsequent phage panning selections were performed at pH 6.5.

[0214] Panning selections were pre-cleaned with 25 microliters of streptavidin Dynabeads without CD25 antigen after 1 hour incubation. Phages were then added to new pre-blocked Eppendorf LoBind tubes. Biotinylated full-length CD25 antigen was added at 100 nM concentration for 1 hour. Samples were then incubated with 25 microliters of streptavidin beads for 1 hour at room temperature. Samples were pelleted and washed 7-9 times using magnet / magnetic beads with PBST. Tubes were changed twice to remove residual phage.

[0215] To elute the phages, 800 microliters of glycine, pH 2.2, was added to the beads and incubated for 10 minutes. They were then neutralized with high pH Tris 9.0. The eluted phages were added to 1 ml freshly grown (OD600 approx. 0.5) TG1 and incubated for 20-30 minutes. A fractional log dilution series was plated onto the plate and the remainder was transferred to 25 ml 2xYT (2x Yeast Tryptone Broth). These steps were repeated two more times for a total of three panning rounds, followed by phage ELISA and Octet screening of the periplasmic extracts.

[0216] Sequencing Positive hit clones were cultured overnight and plasmid DNA was prepared using the Qiagen plasmid miniprep kit. Purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for Sanger sequencing. VH sequences were amplified using the sequencing primers (ACGCCTGCGAAGTCACCCAT (SEQ ID NO: 1497) ) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC (SEQ ID NO: 1498) The VL sequence was obtained using the sequencing primer (AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 1499)) or (CGGATAACAATTTCACACAG (Sequence number 1500) The VH and VL VDJ arrangements, nucleic acid alignments, and amino acid alignments were identified by IMGT High V-Quest.

[0217] The sequences for selected Fab clones D5, D11, D16, D17, D34, and D36 are presented in Tables 1A-1L.

[0218] Example 4 Phage ELISA Protocol and Biosensor / Octet Screening ELISA / extract preparation Phage ELISA to assess binding of CD25 to Fab-phage and periplasmic extract preparation for Fab Octet screening were performed essentially as described with modifications ( Schwimmer et al., 2013 ).

[0219] CD25 antigen was diluted in PBS, pH 7.4. 50 microliters of antigen solution containing 1 ug of CD25 was made for each well of a 96-well plate to be coated. 50 microliters of antigen solution was added to the ELISA plate wells and incubated overnight at 4°C. After incubation, the wells were washed twice with PBS and the wells were blocked by adding 200 microliters of 1×PBST 2.0% BSA and incubated at 25°C for 2 hours. Phage was diluted 2-fold in 1×PBST 1.0% BSA, pH 6.5. 50 microliters was added and incubated for 5 minutes at room temperature. The blocking solution was shaken out of the wells and 50ul of the diluted phage preparation was added to each well and incubated for 1 hour at room temperature. The ELISA plate wells were washed 3-5 times with 200 microliters of PBST pH 6.5. HRP-conjugated anti-M13 antibody (Abcam, ab50370) was diluted 1:5000 in 1x PBST 1.0% BSA pH 6.5. Fifty microliters of the diluted secondary antibody conjugate was added to each well and incubated at room temperature for 1 hour. The ELISA plate wells were washed 3-5 times with 200 microliters of PBST pH 6.5. ECL Lumo substrate (e.g., Supersignal ELISA Pico Chemiluminescent Substrate) was prepared in a 1:1 mix as described. Fifty microliters of substrate solution was added to each well and incubated at room temperature for 50-60 minutes before reading.

[0220] For 0.1 ml overnight cultures (1 ml cultures in 96-well plates or 4 ml cultures in 14 ml falcon tubes), colonies were inoculated into 0.03-4 ml 2xYT 0.2% glucose. They were incubated at 37°C for 1.5-2 hours at 250-700 rpm until OD600 was approximately 0.5-1.0. Cultures were induced with 50-400 ul IPTG 0.025-0.1 M. In some cases, the temperature was reduced to 30°C with shaking at 250 rpm. They were then incubated overnight. The following day, cultures were harvested by pelleting at 3400 rcf for 10-15 minutes. The supernatant was discarded.

[0221] Cultures were resuspended in 50-75ul PPB buffer (30mM Tris-HCl, pH 8.0, 1mM EDTA, 20% sucrose) containing 1x Halt protease inhibitor and incubated on a rocking platform at room temperature for 15 minutes or at 4°C for 10 minutes. Cultures were resuspended in 150-225ul cold ddH20 containing 1x Halt protease inhibitor and incubated on a rocking platform at room temperature for 1 hour or at 4°C for 1-2 hours. Lysate suspensions were spun at 15000rcf for 10-15 minutes at 4°C. Supernatants were collected and diluted.

[0222] Fab Expression and Purification Protocol For 0.03-0.5 ml overnight cultures or 50 mL cultures in plates, a single E. coli colony was inoculated and grown in 50 2xYT 0.2% glucose. Cultures were incubated at 37°C, 250-700 rpm for 1.5 hours. Cultures were induced with 50ul of 25mM-1M IPTG. Temperature was reduced to 30°C and rpm to 150. Incubation was overnight. 50 ml cultures or plates were harvested by pelleting at 3400rcf for 15 minutes. Supernatant was discarded. Cell pellets from 50 mL cultures were placed in a -80°C freezer for 1 hour while 75uL of PPB with EDTA-free 1xHalt protease inhibitor (Thermo Fisher Scientific) was added to cultures grown in plates and vortexed. Plates were shaken at 1000 rpm for 10 minutes at 4°C. A volume of 225uL of cold water was added to each well along with EDTA-free 1x Halt protease inhibitor (Thermo Fisher Scientific). Samples were mixed and shaken at maximum speed, i.e. 1000rpm, 4°C for 1-2 hours. Plates were spun at 3500rpm, 4°C for 10 minutes. Supernatants (PPE) were transferred to a new plate and stored at -20°C. Cell pellets from 50ml cultures were removed from the freezer and 5ml PBS, 10mM imidazole was added along with 2.5mg / ml lysozyme and EDTA-free 1x Halt protease inhibitor (Thermo Fisher Scientific). Once the pellets were completely thawed / mixed, these were incubated at room temperature for 30 minutes. Lysates were centrifuged at 3400rcf for 15 minutes. The supernatant was removed and the pellet was discarded. 500ul Ni-NTA resin was added (pre-washed and pelleted) or Ni-NTA spin columns were used for Fab purification. The clarified lysates were incubated for 30 min to 1 hr. This was spun at 1500rcf. These were washed 5 times with 1ml PBS, 10mM imidazole. After each spin the buffer was discarded. 1ml PBS, 200mM imidazole was added, mixed, incubated for 30 min, and spun at 1500rcf for 15 min.The eluted proteins were stored at 4° C. or 20° C. after protein concentration determination. A Zeba column was used for desalting / buffer exchange.

[0223] Octet / biosensor screening of Fab For Octet Koff rate constant screening in raw supernatant, 50ul of lysate was used in a 384-well Pall ForteBio Octet plate. Data was collected on an Octet RED 384 (MD ForteBio). Briefly, human CD25 was coupled to an AR2G chip (1ug / ml). For data collection, baseline was assessed for 60 seconds in PBST 1% BSA buffer at pH 6.5. Then, the chip was transferred to 50ul lysate adjusted to pH 6.5 and association was measured for 300 seconds. Finally, the chip was transferred to PBST 1% BSA buffer at pH 6.5. Then, the chip was regenerated with 200mM Tris-glycine, pH 2.5 and neutralized with PBST, 1% BSA, pH 6.5. For data analysis, reference subtraction, double referencing (no CD25 on chip, and blank reference wells) was performed in Octet HT 11.0 software.

[0224] To determine whether the selected Fabs block the binding of IL-2 to CD25, a biosensor assay was performed.

[0225] Octet / biosensor screening of human IgG1 antibodies A subset of the selected 40 Fabs was reformatted to contain human IgG1 (herein referred to as human IgG1 antibodies) and data was collected from these. The Fabs selected for reformatting are shown in Table 5A (heavy chain) and Table 5B (light chain). The Koff rate constants and affinities of the different reformatted IgG1 antibodies were evaluated in a ForteBio® Octet RED384™ bio-layer interferometry instrument. The purified antibodies were covalently immobilized on an amine-reactive biosensor (Fortebio® AR2G) and excess reactive esters were blocked with ethanolamine. The sensor was then placed in running buffer for baseline and transferred to a well containing 300 nM full-length CD25, then transferred back into running buffer. CD25 association and subsequent dissociation were recorded in duplicate. Association of running buffer only (to control for sensor drift) and additional sensors with immobilized IgG from human ND serum (to control for non-specific IgG binding) were run as controls. The observed on and off rates were fitted using a 1:1 binding fit model to calculate the equilibrium binding constant (KD).

[0226] Epitope binning of reformatted human IgG1 antibodies was performed using a cross-competitive assay performed in a classical sandwich format, which involves collecting a baseline, immobilizing the sample antibody on a biosensor, capturing the antigen, and then incubating with a competing analyte. The competing analyte can bind captured CD25 only if its binding epitope does not overlap with that of the immobilized antibody. Purified antibodies were covalently immobilized on an amine-reactive biosensor (Fortebio® AR2G), and excess reactive esters were blocked with ethanolamine. The sensor was bathed in running buffer as a baseline, and then bathed in full-length CD25. The sensor was then transferred to wells containing competing analytes (IL-2, 7G7B6, basiliximab, daclizumab) or running buffer as a reference. Sensors were regenerated, when necessary, by exposing them to three cycles of 0.1 M glycine pH 2.0 for 10 seconds followed by running buffer for 10 seconds.

[0227] result Figure 7 depicts the identification of non-IL-2 and IL-2 blocking agents (Fabs) using a cross-blocking assay at the molecular level. CD25 was coated onto a biosensor chip and contacted with the indicated Fabs. IL2 was then added. An increase in signaling indicates that the Fabs and IL2 have different binding sites on CD25.

[0228] Table 8 shows that the Fab clones tested exhibited similar binding kinetics at physiological and acidic pH.

[0229] [Table 25]

[0230] Figure 8 depicts phage expressing Fabs of the present disclosure that compete with IL-2 non-blocking antibody, 7G7B6. Biosensor chips were coated with antibody 7G7B6 and contacted first with CD25, then with the indicated Fabs, or with basiliximab, a known IL2 blocking antibody. When 7G7B6 is bound to CD25, clones D11, D34, and D36 do not bind. Clones D5, D16, and D17 bind but quickly release, indicating possible cross-blocking function.

[0231] Figures 13A-13C show kinetic analysis of Koff rate constants and affinity for reformatted human IgG1 antibody clones (Figure 13A). Antibody KD values ​​ranged from 4.4E-10 to 8.4E-09, and Koff values ​​ranged from 6.4E-05 to 1.9E-03. Some antibodies had higher affinity (Figure 13B) and Koff values ​​(Figure 13C) than commercial antibodies 7G7B6, daclizumab, and basiliximab (Kd values ​​2.6E-09, 4.5E-10, 4.7E-10, respectively, and Koff rate constants of 2.3E-04, 1.1E-04, 1.9E-04, respectively). Clones BP003-T2P1D7, AH0580, AH05268, D36, D11, AH05259, BF003-T2P1D1, and D34 have better Kd values ​​than 7G7B6 in this analysis, and clones D17, AH04526, AH04750, AH05285, AH05256, and AH04527 have better Kd values ​​than daclizumab and basiliximab in this analysis (Figure 13B). Clones AH05256, AH04527, AH04526, AH05251, AH05285, AH05259, D17, and AH04750 have better Koff rate constants than 7G7B6 in this analysis (Figure 13C).

[0232] Figures 14A-14D: Epitope binning was performed to evaluate the binding of the reformatted human IgG1 Fab to the commercially available anti-human CD25 antibodies, 7G7B6, daclizumab, and basiliximab, as well as to the epitopes that overlap with IL-2. The blocking profiles of the clones are: (Figure 14A) blocked by 7G7B6, but not by IL-2, daclizumab, or basiliximab; (Figure 14B) blocked by IL-2, daclizumab, and basiliximab, but not by 7G7B6; (Figure 14C) blocked by 7G7B6 and daclizumab, but not by basiliximab; (Figure 14D) blocked by IL-2, daclizumab, and basiliximab. These blocking profiles indicate the binding of the antibodies to different epitopes from different approach angles.

[0233] Additional epitope mapping of functional epitopes is performed by alanine mutagenesis. This method is used as an orthogonal method for binning antibodies because it operates on functional epitopes rather than structural epitopes defined by competitive assays. Various pairs of surface accessible residues are selected for mutagenesis. Computational modeling is used to ensure that the alanine mutations selected for use in these assays do not affect global or local stability.

[0234] Example 5 Binding assays Cell-binding assay for CD25-specific binding of human IgG antibodies To confirm antibody binding and specificity with CD25 on cells, three cell lines, SUDHL-1 and SUDHL-2 (human large diffuse histiocytic lymphoma cell line, ATCC), as well as HEK IL-2 reporter cells (Invivogen), were used to test for CD25 binding. SUDHL-1 and HEK IL-2 reporter cell lines are CD25+, while SUDHL-2 is a CD25- cell. For each cell line, 100,000 cells were plated in cell buffer (PBS+2%HI FBS) in a 96-well round bottom plate and centrifuged. Binding of each antibody was tested using antibody concentrations from 1-10ug / mL. Cells were resuspended in 100uL of antibody / well and incubated on ice for 20 minutes. After incubation, cells were centrifuged at 300xg for 5 minutes at room temperature, resuspended and washed with ice-cold cell buffer. Cells were then stained with anti-human Fc secondary antibody conjugated to AF647 (Biolegend) and incubated for 20 min on ice in the dark. Cells were centrifuged, washed, resuspended in cold cell buffer containing DAPI, and analyzed using flow cytometry (Cytoflex, Becton Dickinson). DAPI+ cells were excluded from the analysis. Mean fluorescence intensity was calculated using the median (FlowJo, TreeStar).

[0235] Recombinant CD25 Cynomolgus Monkey Binding Human IgG1 Clones To test for binding to recombinant cyno CD25, microtiter plates were coated with 80ul of 1ug / ml Cyno CD25 in 50mM sodium carbonate, pH 9.6, overnight at 4°C. The following day, the protein was removed from the wells and blocked with 200ul PBS / 0.1%BSA / 0.05% tween20. Plates were incubated for 1 hour at room temperature. Human IgG1 reformatted Fab clones (human IgG1 antibodies) were serially diluted 3-fold in PBT buffer starting at 25nM and added to the plates for 1 hour incubation at RT. Plates were then washed, followed by the addition of a 1:2500 dilution of HRP-conjugated anti-Fab antibody. Plates were washed 5-10 times with PBS / tween20 to remove non-specific binders. TMB peroxidase substrate and peroxidase solution were added and incubated for the time required for color development, at the end of which 80 uL of ELISA stop solution was added, after which OD readings were taken at 450 nM using a plate reader (SpectraMax iD3 plate reader, Molecular Devices).

[0236] Figures 15A-15B show confirmation of specific binding of all antibody clones (10ug / mL) to CD25+ cell lines, both SUDHL-1 and HEK cells, and no binding to the CD25- SUDHL-2 cell line. Additionally, the majority of antibodies bound similarly to the controls 7G7B6, daclizumab, and basiliximab.

[0237] Figures 16A-16B show dose response curves of clones that bound in 5-fold serial dilutions starting at 10ug / mL in SUDHL-1 CD25+ cell line (Figure 16A). Most of the clones bound in a dose-dependent manner and had better EC50 values ​​than commercial 7G7B6 (Figure 16B, Table 9) (clone names refer to those presented in the above table of this disclosure). Some clones in Table 9 have better EC50 values ​​than 7G7B6.

[0238] [Table 26] TIFF0007619941000107.tif62165

[0239] Figure 17 shows the dose response curves of several clones bound to recombinant cyno CD25. Daclizumab and basiliximab were used as positive controls.

[0240] Example 6 pSTAT5 assay using primary cells pSTAT5 assay for screening biological activity of Fab clones in highly purified human regulatory T cells The IL-2 / JAK3 / STAT-5 signaling pathway is involved in the survival and proliferation of Tregs. This pathway initiates and maintains the expression of the transcription factor Foxp3, a factor essential for the suppressive activity of Tregs. When IL-2 binds to the IL-2R, JAK proteins are activated; they are tyrosine kinases that bind to the cytoplasmic domain of the IL-2 receptor. This initiates transphosphorylation on specific tyrosine residues, creating docking sites for STAT proteins to be recruited and phosphorylated. The dimerized and phosphorylated STATs then translocate to the nucleus, bind specific DNA sequences, and regulate the transcription of several target genes, such as Foxp3 and CD25, in Tregs.

[0241] In this example, the functionality of selected Fabs was evaluated when binding to CD25 on primary human regulatory T cells. This assay allowed the determination of which IL-2 blockers, non-blockers, and partial blockers, as well as potency, based on pSTAT5 levels. Controls used in the assay included a known IL-2 blocker (daclizumab) and a non-IL-2 blocker (7G7B6). First, fresh PBMC cells were isolated from leukocyte reduction system chambers (Stanford Blood Center). An equal volume of cell buffer (PBS + 2% HI FBS) was added to each blood sample and added to Ficoll Paque (Stem Cell Technologies) packed inside a 50 mL SepMate conical tube, and the standard protocol for PBMC isolation using SepMate tubes was followed. To isolate human regulatory T cells from PBMCs, EasySep Human CD4+CD127low CD25+ Regulatory T Cell Isolation Kit (Stem Cell Technologies) and Regulatory Human CD4+CD25+ T Cell Kit (Dynabeads) were used. The respective isolation kit protocols were used for magnetic-based isolation of cells. Treg isolation was confirmed by staining of cells with anti-human CD4, CD25, CD127 antibodies, and intracellular Foxp3 staining (BD Biosciences). For pSTAT5 assay, 100,000 Tregs were plated in 96-well round-bottom plates and centrifuged. Antibody concentrations of 1-5ug / mL were used. Tregs were resuspended in 50uL of antibody / well and incubated for 15 minutes in a 37°C incubator. Dilutions for IL-2 were then prepared at 10-fold dilutions starting from a concentration of 100ng / mL in cell culture medium. IL-2 dilutions were added to wells at 50 uL / well for 10 minutes in a 37° C. incubator. After incubation, plates were centrifuged at 300×g for 5 minutes at room temperature and resuspended in 100 uL / well of room temperature fixation buffer (BD Biosciences) for 15 minutes at room temperature. Cells were spun down and resuspended in cold cell buffer (PBS+2% HI FBS).Cells were then resuspended in 100 uL / well of ice-cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 min. Cells were washed with cell buffer and resuspended in 50 uL of prepared pSTAT5 antibody for analysis using flow cytometry (Cytoflex, Becton Dickinson).

[0242] pSTAT5 assay to screen antibody clones for biological activity using HEK IL-2 reporter cells In this example, clones were tested using the HEK IL-2 reporter cell line (Invivogen). This cell line was generated by Invivogen to monitor the activation of the JAK-STAT pathway upon binding of IL-2. To obtain a fully active human IL-2 signaling pathway, the reporter cell line was generated by stably transfecting HEK293 cells with human IL-2Rα, IL-2Rβ, and IL-2Rγ genes, as well as JAK3 and STAT5 genes. This assay provides a high-throughput method to evaluate IL-2 physiology and characterization of IL-2 blockers, non-blockers, and partial blockers by addition of antibodies and competitors in the presence of IL-2 based on pSTAT5 levels. Controls used in the assay include known IL-2 blockers (daclizumab and basiliximab) and an IL-2 non-blocker (7G7B6). For the pSTAT5 assay, 100,000 cells were plated in 96-well round bottom plates and centrifuged. Antibody concentrations of 1-5ug / mL were used. HEK cells were resuspended in 50uL of antibody / well and incubated for 15 minutes in a 37°C incubator. Dilutions for IL-2 were then prepared at 10-fold dilutions starting from a 10ng / mL concentration in cell culture medium. IL-2 dilutions were added to the wells at 50uL / well for 10 minutes in a 37°C incubator. After incubation, plates were centrifuged at 300xg for 5 minutes at room temperature and resuspended in 100uL / well of room temperature fixation buffer (BD Biosciences) for 15 minutes at room temperature. Cells were spun down and resuspended in cold cell buffer (PBS+2%HI FBS). Cells were then resuspended in 100uL / well of ice-cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 minutes. Cells were washed with cell buffer and resuspended in 50 uL of prepared pSTAT5 antibody for analysis using flow cytometry (Cytoflex, Becton Dickinson). The percent pSTAT5+ cells were quantified based on the parent population and values ​​were normalized to IL-2 at a concentration of 10 ng / mL.

[0243] result Figure 9 shows that pSTAT5 signaling is IL-2 dose-dependent and inhibited by daclizumab (IL-2 blocker). pSTAT5 levels correlate with the dose of IL-2, with higher IL-2 doses increasing pSTAT5 levels, while lower levels of IL-2 resulted in lower levels of pSTAT5. In addition, when daclizumab, an anti-human IL-2 antibody IL-2 blocker, was added at a constant concentration of 2ug / mL, it inhibited the JAK-STAT5 signaling pathway and resulted in lower pSTAT5 levels.

[0244] Figures 10 and 11 show the testing of D5 Fab in pSTAT5 assay. The data in Figure 10 shows that the pSTAT5 assay was able to distinguish the difference in D5 Fab activity at 1ug / mL, 2ug / mL, and 5ug / mL compared to daclizumab and IL-2 alone. At different concentrations of D5, there was a dose-dependent decrease in the levels of pSTAT5, suggesting that D5 partially blocks the binding of IL-2 to IL-2R, even at the lowest concentration of 1ug / mL. The data is presented by raw MFI levels (mean fluorescence intensity) and by comparing pSTAT5 levels to the maximum pSTAT5 levels produced by the highest dose of IL-2 (100ng / mL) (Figure 11).

[0245] Figure 12 shows preliminary Fab screening data from one donor. This assay from one donor shows the difference in pSTAT5 levels between several Fab clones at 1ug / mL, 2ug / mL, and 5ug / mL compared to controls (IL-2 only, daclizumab (Dac, an IL-2 blocker), and 7G7B6 (non-IL-2 blocker)). Some clones appear to be better IL-2 non-blockers than 7G7B6, while others are better IL-2 blockers than daclizumab. Complete IL-2 non-blockers are expected to have similar pSTAT5 levels as IL-2 and are not expected to be concentration dependent. Data is presented by raw MFI levels (mean fluorescence intensity) and by comparing pSTAT5 levels to the maximum pSTAT5 levels produced by 7G7B6. Additionally, the data can be used to observe differences in IC50 potency values ​​of the Fab clones (Table 10).

[0246] [Table 27]

[0247] Subsequent assays will include Fab versions of daclizumab and 7G7B6, as well as multiple donor testing of the same Fab clone. Additionally, pSTAT5 assays will be performed at lower pH levels (pH 6.4-6.7) to also take advantage of the pH of the tumor microenvironment versus clone activity at physiological pH.

[0248] Figures 18A-18B show the functional characterization of reformatted human IgG1 clones (5ug / mL) as IL-2 blockers, non-blockers, and partial blockers by measuring pSTAT5 in a HEK IL-2 reporter cell line at IL-2 concentrations starting at 10ng / ml and 10-fold serial dilutions. At an IL-2 concentration of 0.1ng / mL (closer to physiological levels), clones such as AH04503, AH04750 are better IL-2 blockers than either daclizumab or basiliximab, while clones AH05280 and AH02571 may be better IL-2 non-blockers than 7G7B6 at 5ug / mL (A). Clones AH05251, AH05257 are examples of IL-2 partial blockers (Figure 18A). The IL-2 dose response curves clearly delineate the clones that are IL-2 non-blockers from the clones that are IL-2 blockers, with the curve shifted to the left with 7G7B6 and the curve shifted to the right with daclizumab and basiliximab, respectively (Figure 18B).

[0249] Continued pSTAT5 studies can be performed to test these antibody clones with primary Tregs and multiple donors.

[0250] Example 7 Antibody-dependent cytotoxicity (ADCC) Functional cell killing assays ADCC and ADCP One of the mechanisms for Treg depletion is through antibody-dependent cellular cytotoxicity (ADCC). This is a cell-mediated immune defense mechanism that usually results in cell death triggered by immune / effector cell recognition of antibodies bound to specific antigens on target cells. To induce ADCC, an antibody with a human Fc subclass, IgG1, is commonly selected for its effector function with the ability to bind to three Fc receptors: FcγRI (CD64), FcγRII (CD32), and FcγRIIIA (CD16), which are expressed on immune cells such as NK cells, monocytes, and granulocytes. NK cells mainly express FcγRIIIA and are thought to be the main effector cells in ADCC.

[0251] In this example, ADCC was quantified using a lactate dehydrogenase (LDH) cytotoxicity plate-based colorimetric assay (Thermo Fisher). In this assay, the release of LDH is proportional to the amount of cell killing. Lactate dehydrogenase (LDH) is a cytoplasmic enzyme present in all cells and is released when the plasma membrane is damaged. Extracellular LDH in the medium is quantified by a coupled enzyme reaction in which LDH catalyzes the conversion of lactate to pyruvate via reduction to NAD+NADH. Upon addition of diaphorase, NADH is reduced to a tetrazolium salt (INT) to form a formazan product that can be measured at 490 nm. Controls for the assay include the use of rituximab (an anti-CD20 antibody) in the human Raji lymphoma cell line and daclizumab in SUDHL-1 cells (both antibodies are known to induce ADCC). Additional controls included: non-glycosylated human IgG1 as a negative control, and non-fucosylated human IgG1 as a positive control. As a first initial screen, the reformatted clones were tested in an ADCC assay at one concentration (10ug / mL) using PBMCs from a single donor. Human PBMCs (ASTARTE Biologics) were thawed the day before and cultured overnight at 37°C in a 5% CO2 incubator using X-VIVO 15 or 20 medium (Lonza). On the day of the experiment, PBMCs and SUDHL-1 target cells were counted and resuspended in X-VIVO 15 (Lonza, phenol red) serum-free medium. Antibody dilutions were prepared by 5-fold serial dilutions starting at 10ug / ml. Target cells were then plated in 96-well white flat-bottom opaque plates (CORNING ref. #3917) at 50 μL / well, and 10 μL / well of antibody dilutions were added to the target cells and incubated for 30 minutes in a 37° C., 5% CO2 incubator. After incubation, PBMCs were added to the target cells (50 μL / well). For control target cells for spontaneous and maximum LDH release calculations, 50 μL / well of assay medium (X-VIVO15, no phenol red) was added.Co-incubation (ADCC induction) was performed by incubating the plates for 4 hours in a 37°C, 5% CO2 incubator, and 45 minutes before the co-incubation was completed, 10% Triton X100 solution (in PBS) was added to the wells (10 μL / well, 11× dilution ratio) to calculate Max LDH release. After incubation, 50 μL / well of reaction substrate was plated in a 96-well plate (clear flat bottom), and then 50 μL / well of the assay plate supernatant was transferred to the reaction substrate. The plate was developed in the dark at RT for 30 minutes. After incubation, 50 μL / well of stop solution was added, and the absorbance at 490 nm and 680 nm was measured by using a plate reader (SpectraMax iD3 plate reader, Molecular Devices).

[0252] Additionally, a functional antibody-dependent cellular phagocytosis (ADCP) assay is also performed to test the activity of macrophages to phagocytose Treg cells upon antibody binding. This may be an additional mechanism of action for Treg depletion. The Fc receptor FCγRIIa (CD32b) on macrophages is thought to be the dominant inducer for ADCP. In this assay, primary Tregs are used as target cells with human monocyte-derived macrophages as effector cells. PBMCs are isolated from leukapheresis system chambers (Stanford Blood Center) for monocyte isolation using CD14 microbeads (Miltenyi Biotec) and for Tregs using regulatory human CD4+CD25+ T cell kit (Dynabeads) and human Treg cell differentiation kit (R&D Systems). Monocytes are cultured for 5-7 days with human serum or M-CSF in culture medium. On days 5-7, macrophages are co-cultured with pre-labeled Tregs (labeled with fixable viability dye (Invitrogen)) at an effector:target ratio of 10:1 with anti-CD25 antibodies and controls for 2-4 hours and fixed with fixation buffer (BD Bioscienes). To identify macrophages from labeled Tregs, macrophages are stained for CD14 and analyzed by flow cytometry for phagocytic populations defined as CD14+ and labeled Treg+ populations. Anti-CD25 antibodies are expected to also induce ADCP.

[0253] result Figures 19A-19B show functional ADCC activity of all reformatted clones. In the first screen, clones bound CD25+ cells, induced ADCC, and cell killing ranged from 18.2% to 26.7% lysis (Raji cell killing is used as a reference; Figure 19A). To validate these findings, the assay was repeated with dose-response curves for selected clones. Results showed a range of ADCC activity from 2-fold to 6-fold over baseline lysis, with clones AH04511, AH05274, D11, D34, and D36 inducing the most potent ADCC and with higher potency than the 7G7B6 antibody, as measured by fold change over % background lysis.

[0254] Next studies will include additional donors of PBMC and NK cells as effectors for functional ADCC killing assays.

[0255] Example 8 Functional characterization of CD25 antibodies In vitro characterization Subsequent in vitro characterization includes T cell activation and Treg suppression studies to assess the impact of CD25 antibodies on T effector cell responses in the absence and presence of Treg cells. Readouts for activation include intracellular granzyme B, proliferation, and cytokine release (e.g., IL-2, IFNγ, TNF-α). Specifically, human primary conventional T cells (T conv cells) from healthy donors and donors with specific antigen responses (e.g., human cytomegalovirus or influenza antigens) are labeled with a cell proliferation dye (e.g., ThermoFisher), treated with various concentrations of CD25 and control antibodies (1-10ug / mL), and then activated with CD3 / CD28 beads and incubated with or without Tregs for 48-72 hours of incubation at 37°C, 5% CO2. To assess T cell activation, supernatants are collected for cytokine analysis and cells are stained with fixable viability dyes (e.g., Thermofisher) and surface anti-human T cell markers: CD3, CD4, CD8, CD45RA, CD25, followed by fixation and permeabilization for staining of intracellular Granzyme B and Foxp3. Cells are analyzed by flow cytometry for Granzyme B positive cells and proliferating cells.

[0256] In vivo characterization In vivo activity of CD25 antibodies using mouse xenograft tumor models. These experiments serve to distinguish between CD25 antibodies based on CD25+ tumor depletion by ADCC and / or ADCP. Candidate antibodies are produced as mouse IgG2a isotype antibodies and used in immunodeficient RAG- / - knockout mice (which have functional NK and APC cells but no mature B or T lymphocytes). Animals are subcutaneously implanted with CD25+ human cell lines (e.g., SUDHL-1, CD25+ anaplastic large cell lymphoma). Tumors of various sizes (palpable, 100-500 mm3) can be used to recognize differences between antibodies. Animals are treated with different doses of CD25 antibodies (e.g., 1-10 mg / kg, 3 times a week or once a day) and monitored for changes in body weight and TGI.

[0257] Drug efficacy and MOA studies in mouse xenograft tumor models in humanized mice Antibodies that are more effective at inhibiting tumor growth by Treg depletion and increasing intratumoral Teff / Treg ratios along with increasing T effector cell activity are tested in various human tumor models (e.g., liver cancer, breast cancer, melanoma, gastric cancer, NSCLC, and colon cancer) to establish efficacy and mechanism of action. Some studies may include using triple-negative breast cancer cell line MDA-MB-231, gastric cell line, melanoma cell line A375, and liver cancer cell line Huh-7, as well as human PDX models that have been well characterized and have shown a correlation between infiltrating Tregs and tumor growth, and / or have been treated with PD-1 antibody combinations in humanized mice engrafted with human PBMCs and / or CD34+ cells. In these models, tumors are implanted subcutaneously, and once the tumors reach a size range from palpable to 100-500 mm3, they are treated with various doses of CD25 antibodies and dosing schedules (e.g., 1-10 mg / kg, 3 times a week or once a day). Animal health scoring, body weight, tumor growth, as well as blood and tumor immunophenotyping will be performed using flow cytometry, Meso Scale Discovery multi-plates, and histology to characterize tumor and immune cell composition and tumor infiltrating cells, as well as cytokine secretion.

[0258] Combination studies in mouse xenograft tumor models in humanized mice. Once lead candidates and indications are established based on efficacy and MOA studies, we will carry out combination studies using a wide variety of agents (e.g., chemotherapy, checkpoint inhibitors, TLR agonists, vaccines) to increase immunogenicity and activate other pathways for immune activation. Combination experiments will be carried out in similar tumor models used in efficacy and MOA studies.

[0259] All patents, patent applications, publications, documents, web links, and articles cited herein are hereby incorporated by reference in their entirety.

Claims

1. A monoclonal CD25 antibody that binds to human CD25, comprising amino acid sequences of CDRH1, CDRH2, and CDRH3, and amino acid sequences of CDRL1, CDRL2, and CDRL3 that are any one of combinations (1) to (278) set forth in the table below. 【Table 1】

2. Any one of the amino acid sequences of the heavy chain variable regions set forth in SEQ ID NOs: 2, 17, 32, 38, 44, 60-107, 431-460, 868, 869, 1222, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1238, 1237, 1299, 1316, 1318, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, and 1335, or a humanized version thereof. or an amino acid sequence having at least 90% sequence identity thereto, and comprising a heavy chain variable region selected from the group consisting of SEQ ID NOs: 10, 25, 34, 40, 50, 59, 701, 703, 705, 707, 709, 712, 715, 717, 722, 724, 725, 727, 728, 735, 736, 737, 739, 742, 745, 747, 749, 750, 751, 752, 754, 755, 756, 759, 762, 765, 76 7, 769, 775, 776, 777, 778, 780, 781, 783, 785, 787, 789, 791, 794, 795, 797, 799, 801, 803, 804, 806, 809, 810, 811, 813, 815, 818, 822, 823, 824, 825, 827, 829, 835, 838, 841, 842, 844, 846, 848, 849, 851, 853, 857, 859, 860, 861, 864, 875, 876, 877, 878, 879, 880, 882, 884, 886, 888, 892, 895, 897, 901, 902, 903, 905, 906, 907, 908, 912, 914, 917, 919, 920, 921, and 922, a humanized version thereof, or an amino acid sequence comprising at least 90% sequence identity thereto; The monoclonal CD25 antibody of claim 1.

3. It is a human antibody; It is a humanized antibody; It is a chimeric antibody; Contains a mouse variable domain and a human constant domain; is an antibody fragment; or Also binds cynomolgus monkey CD25; A monoclonal CD25 antibody according to claim 1 or 2.

4. A pharmaceutical composition comprising the monoclonal CD25 antibody of any one of claims 1 to 3.

5. A nucleic acid encoding a monoclonal CD25 antibody according to any one of claims 1 to 3.

6. A vector comprising the nucleic acid of claim 5.

7. A phage expressing the monoclonal CD25 antibody according to any one of claims 1 to 3.

8. A composition comprising a monoclonal CD25 antibody according to any one of claims 1 to 3 for treating cancer, an autoimmune disease, an autoimmune disorder or for depleting regulatory T cells.

9. A kit comprising the monoclonal CD25 antibody of any one of claims 1 to 3 or the pharmaceutical composition of claim 4.

Images