Low-intensity focused ultrasound for treating cancer and metastases

Abstract

Systems and methods for treating cancer and preventing metastases using low intensity focused ultrasound in combination with anti-cancer therapy are disclosed. [Solution] The ultrasound stimulation therapy (APT) system includes a transducer configured to generate acoustic power between 10-1000 W / cm2 spatial peak average intensity in a treatment zone, the ultrasound frequency is in the range of 0.01-10 MHz, the mechanical index is less than 4, and the ultrasound is applied continuously for a time in the range of 0.5-5 seconds for any particular amount in the treatment zone.

Description

[Technical field]

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 170,378, filed June 3, 2015, and U.S. Provisional Patent Application No. 62 / 204,312, filed August 12, 2015, both of which are incorporated herein by reference.

[0002] Government Support Statement This invention was made with Government support under Grant Nos. EB009040 and AI059738 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0003] Throughout this application, various publications are cited in parentheses. Full citations for these publications appear at the end of the specification. The disclosures of these publications, and all patents, patent application publications, and literature referenced herein, are incorporated by reference in their entirety into this application to fully describe the state of the art to which this invention pertains.

[0004] Immune responses against cancer cells are frequently hindered by the immunosuppressive nature of the tumor microenvironment, which also impedes the efficacy of tumor immunotherapy (1 and 2). Multiple mechanisms have been identified that underlie the ability of tumors to generate an immunosuppressive environment, including the secretion of cytokines or other factors with suppressive activity (3-5), recruitment of regulatory T cells and myeloid-derived suppressor cells (6-9), increased expression of ligands for co-inhibitory receptors (10-13), or inhibition of dendritic cell maturation (14 and 15). As a result of such mechanisms, T cells are often unresponsive to tumor antigens (15). Induction of a state of hyporesponsiveness to tumor antigens occurs in both CD4+ and CD8+ T cell populations and often causes the adaptive immune system to be unable to mount an efficient non-tumor response (16-18). Diminished T cell responses to tumor antigens occur in both solid and hematological tumors and appear to be caused by inefficient presentation of antigens by dendritic cells, which results in preferential activation of a tolerogenic program of gene expression that depends on the transcription factors NFAT and Egr2 (18-21). The important role of this process in tumor-induced T cell hyporesponsiveness is highlighted by the fact that genetic mouse models in which induction of this tolerogenic gene expression program was prevented resulted in enhanced antitumor T cell responses and controlled tumor growth (19 and 21).

[0005] Localized tumor treatment with focused ultrasound (FUS) is an image-guided, minimally invasive therapy that uses a range of input energies for in situ tumor ablation (22, 23). The application of FUS to biological tissues is associated with the generation of heat and cavitation effects, which induce changes in the physiology of the targeted cells depending on the delivered energy. High-intensity focused ultrasound (HIFU) has been used clinically to thermally ablate localized tumors (23-26). The substantial thermal energy generated by the FUS treatment modality induces rapid coagulation necrosis of tissue at the targeted focus. Several studies have reported several immunomodulatory effects, including increased lymphocytic infiltration, production of IFNγ producing tumor-specific T cells in lymphoid organs, and maturation and migration of dendritic cells to tumors, while the heat-induced coagulation necrosis resulting from HIFU treatment can also attenuate the release of immunostimulatory molecules within the tumor microenvironment (26, 27). Thus, although it can halt the progression of established primary tumors, HIFU may not be able to prevent local and distant metastases from arising from remaining tumor cells.

[0006] The present invention provides improved tumor and cancer treatment using low intensity focused ultrasound and a method for inducing chemosensitization to increase the effectiveness of cancer therapeutic treatments. Summary of the Invention

[0007] Provided is a method of enhancing the efficacy of chemotherapy in a subject, comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic agent, where the chemotherapeutic agent results in endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in tumor cells, and where the amounts of (i) and (ii) are sufficient to enhance the efficacy of the chemotherapy.

[0008] Also provided is a method of increasing the effectiveness of chemotherapy in a predetermined volume of tissue in a subject, the volume of the tissue being less than the entire subject, comprising: (i) administering to the subject an amount of a chemotherapeutic agent, where the chemotherapeutic agent induces endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in tumor cells; and (ii) administering to the subject an amount of low intensity focused ultrasound (LOFU) to the predetermined volume of tissue, where amounts (i) and (ii) together are sufficient to increase the effectiveness of chemotherapy in the predetermined volume of tissue.

[0009] A method is provided for treating a tumor in a subject that is resistant to a chemotherapeutic agent, the method comprising the steps of identifying the subject as having a tumor that is resistant to a specified chemotherapeutic agent, and administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of the specified chemotherapeutic agent, wherein the amounts (i) and (ii) are sufficient to treat the tumor.

[0010] Also provided is a method of treating a chemotherapy-resistant tumor in a subject, wherein the tumor has become chemotherapy-resistant to a previously administered chemotherapy agent, the method comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of the chemotherapy agent, wherein the amounts of (i) and (ii) are sufficient to treat the chemotherapy-resistant tumor.

[0011] The acoustic priming therapy (APT) system according to various exemplary embodiments of the present invention provides a 10-1000 W / cm 2 ultrasound wave at the treatment zone. 2 The spatial peak time-averaged intensity (I spta ), the frequency of the ultrasound is in the range of 0.01-10 MHz, the mechanical index is less than 4, and the ultrasound is applied continuously for a time in the range of 0.5-5 seconds for any particular volume in the treatment zone. Such treatments are identified herein as ultrasound stimulated therapy (APT) treatments.

[0012] An ultrasound stimulation therapy device according to an exemplary embodiment of the present invention includes: a control system for generating a frequency waveform; and a peak frequency in the range of 0.5 to 5 MHz and 20 to 1000 W / cm 2 one or more transducers each configured to generate an ultrasound beam based on a frequency waveform having an acoustic output intensity of

[0013] In an exemplary embodiment, each transducer is configured to generate a columnated ultrasound wave such that the -3 dB beam profile waist is 5 mm or greater at the treatment zone.

[0014] In an exemplary embodiment, two or more transducers can be operated sequentially or simultaneously to deliver an average spatial peak of 250 J / cm2 in the treatment zone during the treatment period. 2 It is possible to generate ultrasonic waves of

[0015] In an exemplary embodiment, the transducer is operated in a continuous mode in which ultrasound waves are generated in the treatment zone for a treatment period in the range of 0.1 to 10 seconds.

[0016] The system according to an exemplary embodiment of the present invention is an ultrasound stimulation therapy device, comprising a control system for generating a frequency waveform and a power waveform of 1-1000 W / cm at the treatment zone. 2 The spatial peak time-averaged acoustic power intensity (I spta ), wherein the ultrasound is applied continuously for a time period in the range of 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz; a radiation therapy machine; and a control system configured to operate to control the ultrasound stimulation therapy device and the radiation therapy machine such that a first amount of ultrasound and a second amount of radiation therapy are administered to the subject, wherein the first amount and the second amount are sufficient to treat a tumor in the subject.

[0017] A system according to an exemplary embodiment of the present invention includes an ultrasound stimulation therapy device, the ultrasound stimulation therapy device including a control system for generating a frequency waveform and a power waveform having a power of 1-1000 W / cm at a treatment zone. 2 The spatial peak time-averaged acoustic power intensity (I spta ), wherein the ultrasound is applied continuously for a time period in the range of 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz, and the ultrasound stimulation therapy device is used in combination with chemotherapy such that a first amount of ultrasound and a second amount of chemotherapy are administered to the subject, wherein the first amount and the second amount are sufficient to treat a tumor in the subject.

[0018] A system according to an exemplary embodiment of the present invention includes an ultrasound stimulation therapy device, the ultrasound stimulation therapy device including a control system for generating a frequency waveform and a power waveform having a power of 1-1000 W / cm at a treatment zone. 2 The spatial peak time-averaged acoustic power intensity (I spta ), wherein the ultrasound is applied continuously for a time period in the range of 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz, and the ultrasound stimulation therapy device is used in combination with immunotherapy such that a first amount of ultrasound and a second amount of immunotherapy are administered to the subject, wherein the first amount and the second amount are sufficient to treat a tumor in the subject.

[0019] A method of treating a tumor in a subject includes administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy or an amount of radiation therapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) are sufficient to treat the tumor.

[0020] Also provided is a method of inhibiting metastasis of a tumor in a subject, comprising administering to a tumor-bearing subject an amount of low intensity focused ultrasound (LOFU) and an amount of radiation therapy, the amount being sufficient to treat the tumor.

[0021] Further provided is a method of reducing the effective amount of anti-cancer chemotherapy required to treat a tumor in a subject, the method comprising administering to a subject receiving anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the amount of anti-cancer chemotherapy effective to treat the tumor.

[0022] Further provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer treatment, the method comprising administering to the subject, prior to or during the anti-cancer treatment, an amount of ultrasound stimulation therapy effective to sensitize the tumor in the subject to an amount of an additional anti-cancer treatment modality.

[0023] A method of treating a tumor in a subject is provided, the method comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU), which represents an exemplary embodiment of an ultrasound configuration used in an APT system, and (ii) an amount of chemotherapy or an amount of radiation therapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) are sufficient to treat the tumor.

[0024] Further provided is a method of inhibiting metastasis of a tumor in a subject, the method comprising administering to a tumor-bearing subject an amount of low intensity focused ultrasound (LOFU) and an amount of radiation therapy, both of which are sufficient to inhibit metastasis of the tumor in the subject.

[0025] Further provided is a method of reducing the effective amount of anti-cancer chemotherapy required to treat a tumor in a subject, the method comprising administering to a subject receiving anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the effective amount of anti-cancer chemotherapy required to treat the tumor.

[0026] Further provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy, the method comprising administering to the subject, prior to or during the anti-cancer therapy, an amount of low intensity focused ultrasound (LOFU) effective to sensitize the tumor in the subject to the amount of the anti-cancer therapy. [Brief description of the drawings]

[0027] [Figure 1] AF. Melanoma tumors suppress CD4+ T cell cytokine production:AB: C57Bl / 6 mice were inoculated with 3x105 B16-F1 melanoma cells in the lumbar flank. Tumors were allowed to grow to a size of 7-8 mm3. CD4+ T cells were isolated from the tumor DLN and the distal contralateral NDLN and stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 and IFNγ were measured by ELISA. CD4+ T cells from tumor-free mice served as controls.CD: OTII mice were inoculated with 3x105 B16-F1-OVA melanoma cells as described. T cells were stimulated with OVA323-339 peptide-loaded splenocytes and IL-2 and IFNγ production was measured by ELISA.EF. Tumors were induced in Tyrp1 mice using B16-F1 cells as described above. Isolated CD4+ T cells were stimulated with anti-CD3 and anti-CD28 antibodies, and IL-2 and IFNγ production was measured by ELISA. Graphs show the mean + SEM from four (AB) or three (CF) independent experiments. Results are presented as the mean + SEM from 3-5 mice per experiment. Data were analyzed using ANOVA with Tukey post-test (***P<0.01; **P<0.01; *P<0.05). [Diagram 2]AD. Treatment of melanoma tumors with LOFU overcomes tumor-induced CD4+ T cell tolerance: AB. Tumors were induced in C57Bl / 6 mice by subcutaneous injection of 3x105 B16-F1 melanoma cells in the lumbar flank. Tumors were left untreated or treated with LOFU. Thirty-six hours after FUS treatment, CD4+ T cells were isolated from tumor DLN or NDLN and stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 and IFNγ production was assessed by ELISA. Results (total cytokine production and ratio of cytokine levels produced by T cells from NDLN and DLN in each group) are presented as mean + SEM from three different mice per condition. Differences between cytokine production of DLN T cells in untreated or treated mice were analyzed using a two-tailed test (*P < 0.05). C. Mice were administered 3x105 B16 melanoma cells to induce tumors. After tumor development, total RNA samples were extracted from CD4+ T cells isolated from DLN and NDLN of cancer-bearing and tumor-free control mice. Expression of anergy-related genes was measured by quantitative RT-PCR. Results are presented as fold induction of gene expression in resident T cells of DLN or NDLN in tumor-bearing mice compared with T cells isolated from tumor-free mice. Data represent mean + SEM from three independent experiments. D. B16-F1 melanoma tumors were induced in untreated or LOFU-treated Tyrp1 mice. Expression of various anergy-related genes was measured by RT-PCR in CD4+ T cells isolated from DLN and NDLN. Expression of anergy-related genes is presented as fold induction (mean + SEM from five independent experiments) over values ​​obtained in T cells from tumor-free Tyrp1 mice. [Diagram 3]AB. Lysates from LOFU-treated B16-F1 melanoma tumors can reverse the hyporesponsive state of anergic T cells 3A. Naive CD4+ T cells were isolated from the spleens and lymph nodes of Tyrp1 mice and differentiated into TH1 cells. Anergy was then induced by leaving the cells untreated or treating them with anti-CD3 for 16 h. The cells were then rested in the strict absence of IL-2 for 72 h and restimulated with anti-CD3 and anti-CD28 antibodies. IL-2 levels were measured by ELISA. Results are shown as mean + SEM from two independent experiments. B. CD11c+ dendritic cells were isolated from the spleens of tumor-free Tyrp1 mice. (3A) Anergic TH1 cells generated from CD4+ T cells from Tyrp1 mice as described in (A) were cocultured with tumor lysates and dendritic cells derived from untreated or LOFU-treated B16-F1 melanoma tumors. Supernatants were collected 24 hours later and analyzed for IL-2 by ELISA. Results are shown as mean + SEM from two independent experiments with three independent sets of tumor lysates used in each experiment. Data were analyzed using analysis of variance with Tukey's test (**P<0.01). [Figure 4]AD. FUS treatment induces changes in the expression and cellular distribution of Hsp70 and calreticulin in B16-F1 melanoma cells. A. Total DLN-resident cells from untreated and LOFU-treated B16-F1 melanoma-bearing mice were isolated and immunostained for CD11c to gate dendritic cells. Surface expression of B7.1, B7.2, and MHCII was then assessed by flow cytometry. Appropriate isotype controls were used for each primary antibody. Representative histograms are shown. B. Representative FACS dot plots of B16 tumor cell suspensions obtained from untreated or LOFU-treated mice were stained with viability markers (Mk live / dead). Relative quantification of dead cells is reported. Boxes and arrows indicate dead cells (MK+ live / dead). C. Fluorescent immunostaining of B16-F1 tumor tissue isolated from untreated or LOFU-treated mice. Tissue sections were stained with antibodies to detect calreticulin or Hsp70 and TRP1. Nuclei were stained with DAPI. Magnification 60x. Cells from tumors of D.LOFU-treated and untreated mice were stained for CD45 and TRP1 expression. CD45-TRP1+B16 cells were then analyzed for Hsp70 expression. Representative histograms are shown. Gates and arrows indicate the populations selected for analysis. [Diagram 5]AB. FUS treatment of melanoma tumors enhances dendritic cell-mediated stimulation of CD4+ T cells: A. CD11c+ splenic dendritic cells were purified from C57Bl / 6 mice and cocultured with responder naive CD4+ T cells isolated from OT-II mice. B16-F1-OVA melanoma tumor lysates were prepared from untreated or LOFU-treated tumor-bearing mice and added to the respective cultures to drive dendritic cell-mediated T cell stimulation. In separate samples, exogenous OVA323-339 peptide was also added together with the tumor lysates. Supernatants were collected 24 hours later and IL-2 production was assessed by ELISA. Results are presented as mean + SEM from four independent experiments and analyzed by one-way ANOVA followed by Tukey's test (*P<0.05; ***P<0.001; ns, not significant). B. B16-F1 melanoma tumors were left untreated or treated with LOFU. Tumor DLN were isolated and depleted of T cells. DLN cells were then co-cultured with naive Tyrp1 CD4+ T cells and stimulated with B16 melanoma tumor lysates obtained from in vitro cultures. Supernatants were collected 24 hours later and analyzed for IL-2 levels by ELISA. Data are presented as mean + SEM from three independent experiments. Differences between cytokine production in cultures using DLN cells from untreated or LOFU-treated mice were analyzed using a two-tailed test (*P<0.05). [Figure 6]AD. FUS followed by hypofractionated IGRT resulted in long-term T cell-mediated primary tumor control and reduced distant metastases: A C57Bl / 6 mice bearing 50 mm3 subcutaneous dorsal right hind limb tumors were divided into one of four treatment groups: no treatment, LOFU, hypofractionated IGRT, or LOGU+IGRT, and tumor growth was monitored for 62 days or until primary tumors grew beyond 300 mm3. Graphs show mean ± SEM of tumor volumes from one of two representative experiments (3-5 mice per group). Data were analyzed by one-way ANOVA followed by Bonferroni correction (before day 29) or two-tailed Student's t-test (after day 29). Significant differences (defined as P < 0.05) between untreated or LOFU-treated mice and IGRT or LOFU+IGRT occurred after day 25, and between IGRT-treated and LOFU+IGRT-treated mice after day 35. Individual graphs showing the distribution of tumor size on specific days are also shown. Experiments similar to those described in BA were performed in BALB / c nude mice. No significant differences were observed in the various groups at any time point. C. C57Bl / 6 mice were monitored for primary tumor progression / recurrence, defined as either recurrence reaching a volume of many 150 mm3 or progression of local metastases to popliteal or inguinal lymph nodes. In addition, animals that died naturally were scored as having recurred or progressing disease. Recurrence-free survival data were analyzed using the Mantel-Cox test. D. Lungs were collected from animals that died naturally, had tumor burdens so large that they required euthanasia, or were sacrificed at the end of the 2-month long experiment. Lung metastases were then measured. Lungs that had coalesced into plaques or had more than 250 nodules were considered too numerous to count and were assigned a maximum value of 250. Representative specimens are shown for each treatment group. Results are shown as mean ± SEM for n = 3-5 mice per group, analyzed by Kruskal-Wallis test followed by Dunn's posttest. *P<0.05. [Figure 7]AG:LOFU induces the UPR. A. LOFU increases the expression of Bip / Grp78 and EDEM mRNA. Real-time PCR analysis of RNA isolated from RM1 tumors treated with LOFU showed a 29.73 ± 0.56-fold increase in Bip / Grp78 and a 9.27 ± 1.18-fold increase in EDEM mRNA levels compared to untreated controls. B. LOFU increases the expression of IRE1α mRNA by 2.8 ± 0.4-fold. Real-time PCR analysis demonstrates that the increase in IRE1α expression induced by LOFU was unchanged by 17AAG treatment. C. LOFU caused splicing of XBP1 mRNA. 17AAG treatment inhibits the splicing of XBP1. XBP1s, XBP1h, and XBP1u represent the spliced, hybrid, and unspliced ​​forms of XBP1, respectively. DG.LOFU+17AAG combination therapy prolongs ER stress in RM1 tumor cells. Western blot and bar graph show that ERP78 (D&E), ERP57 (D&F) and ERp44 (D&G) protein expression was induced in the combination therapy group. [Figure 8]AE: LOFU+17AAG activates the UPR proapoptotic pathway and induces apoptosis in tumor cells. A&B. Western blot of pPERK (A) and peIF2a (B). LOFU+17AAG activates PERK by phosphorylating PERK (pPERK), which further induces phosphorylation of eIF2α (peIF2α). C. Real-time PCR analysis of CHOP mRNA. There was a 25±1.3-fold increase in CHOP transcripts in the LOFU+17AAG-treated group compared to the control. D. Real-time PCR array of RNA isolated from tumors treated with LOFU+17AAG. Heat map analysis showed that the LOFU+17AAG-treated group had several-fold increased transcript levels of apoptotic genes compared to the untreated control or the LOFU group. E. TUNEL staining. Immunohistochemical staining showed predominantly TUNEL-positive cells in the LOFU+17AAG-treated group compared to the control or the LOFU group. Note that 17AAG alone further induced apoptosis in tumor tissues that was enhanced by LOFU. [Figure 9] AC: LOFU+17AAG treatment inhibits chaperone-mediated autophagy (CMA) in RM1 tumor cells. (A&B) Immunoblot analysis showed several-fold downregulation of SMA marker LAMP2a expression levels in the combination therapy group. Treatment with either LOFU or 17AAG upregulates LAMP2a expression levels. (A&C) Combination treatment of LOFU and 17AAG did not alter the expression levels of beclin, a macroautophagy marker. [Figure 10A] Tumor growth retardation of mouse and human prostate tumors following LOFU+17AAG treatment. 10A. Treatment regimen. Palpable tumors were treated with LOFU every 3-4 days for five fractions administered over a 2-week period. Animals received 17AAG three times per week during this time. Tumors were harvested 24 hours after the last fraction of LOFU. [Figure 10B]Tumor growth retardation in mouse and human prostate tumors following LOFU+17AAG treatment. 10B. RM1 tumor. In C57Bl6 mice, LOFU+17AAG combination therapy significantly reduced RM1 tumor growth compared to controls (p<0.004). Note that either LOFU or 17AAG alone failed to significantly control tumors. LOFU sensitized the effects of low doses (25 mg / kg body weight) of 17AAG. [Figure 10C] Tumor growth retardation in mouse and human prostate tumors following LOFU+17AAG treatment. 10C. PC3 tumors. In BalbC nu / nu mice, LOFU+17AAG combination therapy showed a significant reduction in PC3 tumor growth (p<0.007). [Figure 11] AF:LOFU+17AAG treatment reduced the expression of prostate cancer stem cell markers in RM1 cells. Flow cytometry of isolated RM1 tumor cells showed a significant decrease in SCA1 (A&B), CD44 (A&C), CD133 (A&D), and α2β1 integrin (A&E) cell surface expression on RM1 tumor cells after LOFU+17AAG treatment. (11F)qRT-PCR array and subsequent heatmap analysis showed that the LOFU+17AAG combination therapy group downregulated the mRNA levels of stem cell transcription factors. [Figure 12] FIG. 1 is a block diagram of an APT device according to an exemplary embodiment of the present invention. [Figure 13] FIG. 2 is a block diagram of an APT device according to another exemplary embodiment of the present invention. [Figure 14] FIG. 2 is a block diagram of an APT device according to another exemplary embodiment of the present invention. [Figure 15] FIG. 1 is a block diagram of an APT device according to an exemplary embodiment of the present invention including an integrated ultrasound imaging device. [Figure 16] FIG. 1 is a block diagram of an APT device according to an exemplary embodiment of the present invention including an integrated ultrasound imaging device. [Figure 17] FIG. 1 is a block diagram of an APT device according to an exemplary embodiment of the present invention including an integrated ultrasound imaging device. [Figure 18]FIG. 1 is a perspective view of a transducer according to an exemplary embodiment of the present invention. [Figure 19] 1 illustrates a positioning device according to an exemplary embodiment of the present invention; DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Disclosed herein is an ultrasound (US) treatment that delivers reduced levels of energy to the treatment zone compared to HIFU forms. In a typical embodiment, treatment of a specific lesion volume is brief (e.g., 1.5 seconds) at 1 MHz constant power, raising the temperature of the tumor tissue to less than about 45°C. This ultrasound treatment is generated using a concave transducer to modify the ultrasound at the treatment zone, termed herein "low energy non-ablative focused ultrasound" (LOFU), which generates mild mechanical and thermal stress in tumor cells while avoiding tissue-damaging cavitation and coagulation necrosis. A non-ablative "sonic" stress response is induced in tumors, increasing the expression of heat shock proteins without actually killing them. LOFU has the potential to release immunomodulatory factors, including heat shock proteins (28 and 29), and can be effective in inducing tumor-specific immune activation (30 and 31). Using mouse B16 melanoma tumor model, it is disclosed that LOFU treatment reverses tumor-induced resistance and increases tumor antigen-specific effector cytokine production in CD4+ T cells, which is believed to be caused by the release of immunogenic molecules by tumor cells.In addition, the combination of LOFU and ablative hypofractionated cone-beam computed tomography (CT) image-guided radiation therapy (IGRT) results in synergistic control of primary tumors, and further causes a reduction in spontaneous lung metastases and prolongs recurrence-free survival in immune-competent mice (see Example 1).In addition, LOFU has been found to sensitize cancer cells (prostate cancer in the example) to chemotherapy drugs (see Example 2).

[0029] In an exemplary embodiment, LOFU (also referred to herein as "ultrasound stimulation therapy") involves the continuous application of ultrasound for a period ranging from 0.5 to 5 seconds, with 10-1000 W / cm2 in the treatment zone. 2 The spatial peak time-averaged intensity (I spta ), where the frequency is in the range of 0.01-10 MHz and the mechanical index is less than 4. The mechanical index (MI) is the rarefaction pressure in units of MPa over the square root of the central frequency in units of MHz. The energy and intensity of the applied ultrasound are intended to be intermediate between those that cause either a primarily ablative effect or a primarily diagnostic effect.

[0030] As explained in more detail below, the various treatment methods discussed herein provide a radiation intensity of 10-1000 W / cm2 at the treatment zone. 2 The spatial peak time-averaged intensity (I spta I spta ) may be administered using a LOFU or ultrasound stimulation therapy device including a transducer generating an acoustic power of between 100 W / cm2 and 1000 W / cm2. The ultrasound is applied continuously for a time period ranging from 0.5 to 5 seconds or pulsed with a pulse time of 1 to 100 milliseconds and a frequency ranging from 0.01 to 10 MHz. In some embodiments, the frequency ranges from 0.05 to 5 MHz. In some embodiments, the frequency ranges from 0.1 to 2 MHz. In some embodiments, the minimum diameter of any ultrasound beam at the treatment zone is about 1 cm. In one embodiment, the LOFU is 10 to 100 W / cm2 at the area of ​​treatment. 2 I spta In one embodiment, the LOFU is administered at 100-200 W / cm in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 300-400 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 400-500 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 500-600 W / cm2 in the area of ​​treatment. 2I spta In one embodiment, the LOFU is 600-700 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 700-800 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 800-900 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the LOFU is 900-1000 W / cm2 in the area of ​​treatment. 2 I spta In one embodiment, the ultrasound is applied for a time in the range of 0.5 to 1 seconds. In one embodiment, the ultrasound is applied for a time in the range of 1 to 2 seconds. In one embodiment, the ultrasound is applied for a time in the range of 2 to 3 seconds. In one embodiment, the ultrasound is applied for a time in the range of 4 to 5 seconds. In one embodiment, the ultrasound is applied at a frequency of 0.01 to 1 MHz. In one embodiment, the ultrasound is applied at a frequency of 1 to 2 MHz. In one embodiment, the ultrasound is applied at a frequency of 2 to 3 MHz. In one embodiment, the ultrasound is applied at a frequency of 3 to 4 MHz. In one embodiment, the ultrasound is applied at a frequency of 4 to 5 MHz. In one embodiment, the ultrasound is applied at a frequency of 5 to 6 MHz. In one embodiment, the ultrasound is applied at a frequency of 6 to 7 MHz. In one embodiment, the ultrasound is applied at a frequency of 7 to 8 MHz. In one embodiment, the ultrasound is applied at a frequency of 8 to 9 MHz. In one embodiment, the ultrasound is applied at a frequency of 9 to 10 MHz.

[0031] Provided is a method of enhancing the efficacy of chemotherapy in a subject, comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic agent, where the chemotherapeutic agent induces endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in tumor cells, and where the amounts of (i) and (ii) are sufficient to enhance the efficacy of the chemotherapy.

[0032] Also provided is a method of increasing the effectiveness of chemotherapy in a predetermined volume of tissue in a subject, the volume of the tissue being less than the entire subject, comprising: (i) administering to the subject an amount of a chemotherapeutic agent, where the chemotherapeutic agent induces endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in tumor cells; and (ii) administering to the subject an amount of low intensity focused ultrasound (LOFU) to the predetermined volume of tissue, where amounts (i) and (ii) together are sufficient to increase the effectiveness of chemotherapy in the predetermined volume of tissue.

[0033] A method is provided for treating a tumor in a subject that is resistant to a chemotherapeutic agent, the method comprising the steps of identifying the subject as having a tumor that is resistant to a specified chemotherapeutic agent, and administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of the specified chemotherapeutic agent, wherein the amounts (i) and (ii) are sufficient to treat the tumor.

[0034] Also provided is a method of treating a chemotherapy-resistant tumor in a subject, wherein the tumor has become chemotherapy-resistant to a previously administered chemotherapy agent, the method comprising administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of the chemotherapy agent, wherein the amounts of (i) and (ii) are sufficient to treat the chemotherapy-resistant tumor.

[0035] In one embodiment of the method, the chemotherapeutic agent induces endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in the tumor cells.

[0036] In one embodiment of the method, the chemotherapeutic agent has been administered to the subject multiple times, and the tumor was diagnosed as resistant to the chemotherapeutic agent after an initial administration of the chemotherapeutic agent.

[0037] In one embodiment of the method relating to chemoresistance, the method can further include identifying the subject as having a tumor that is chemoresistant to a previously administered chemotherapeutic agent.

[0038] In one embodiment of the method, the chemotherapeutic agent induces a UPR in the tumor cells.

[0039] In one embodiment of the method, the chemotherapeutic agent results in ER stress in the tumor cells.

[0040] In one embodiment of the method, the amounts of (i) and (ii) are sufficient to induce or increase apoptosis of tumor cells.

[0041] In one embodiment of the method, the amount of chemotherapeutic agent alone administered is not an efficacy enhancing dose and is a sub-therapeutic dose with respect to treating the tumor.

[0042] In one embodiment of the method, the administered LOFU is targeted to the location of the tumor in the subject.

[0043] In one embodiment of the method, low intensity focused ultrasound (LOFU) is administered to the subject prior to or simultaneously with chemotherapy, radiation therapy, or immunotherapy. In one embodiment of the method, LOFU is administered to the subject prior to radiation therapy being administered. In one embodiment of the method, LOFU is administered to the subject prior to chemotherapy being administered. In one embodiment of the method, LOFU is administered to the subject prior to immunotherapy being administered. In one embodiment of the method, LOFU is administered to the subject simultaneously with radiation therapy being administered. In one embodiment of the method, LOFU is administered to the subject simultaneously with chemotherapy being administered. In one embodiment of the method, LOFU is administered to the subject simultaneously with immunotherapy being administered.

[0044] In one embodiment of the method, the chemotherapeutic agent is an HSP90 inhibitor. In one embodiment, the HSP90 inhibitor is 17AAG (tanespimycin or 17-N allylamino-17-demethoxygeldanamycinan). In one embodiment, the chemotherapeutic agent is an HSP90 inhibitor. An example of an HSP90 inhibitor is 17AAG (tanespimycin or 17-N allylamino-17-demethoxygeldanamycinan). In one embodiment, the chemotherapeutic agent is an alkylating agent. In one embodiment, the chemotherapeutic agent is trabectedin. In one embodiment, the chemotherapeutic agent is a mustard gas derivative. In one embodiment, the chemotherapeutic agent is a metal salt. In one embodiment, the chemotherapeutic agent is a plant alkaloid. In one embodiment, the chemotherapeutic agent is an antitumor antibiotic. In one embodiment, the chemotherapeutic agent is an antimetabolite. In one embodiment, the chemotherapeutic agent is a topoisomerase inhibitor. In one embodiment, the chemotherapeutic agent is a proteasome inhibitor. In one embodiment, the chemotherapeutic agent is a chemotherapeutic NSAID. In one embodiment, the chemotherapeutic agent is one of the various anti-neoplastic agents listed below.

[0045] In one embodiment of the method, the LOFU is delivered by an ultrasound beam from an ultrasound machine that includes a transducer, and the machine and subject are positioned such that at least a portion of the tumor is located at the focal point of the transducer. In one embodiment of the method, the LOFU is delivered to at least a portion of the tumor, and the location of the tumor in the subject is monitored by an imaging technique. In one embodiment of the method, the imaging technique is magnetic resonance imaging. In one embodiment of the method, the imaging technique is computed tomography. In one embodiment of the method, the imaging technique is ultrasound imaging.

[0046] In one embodiment of the method, LOFU is administered at least once to multiple masses within the tumor over a period of less than one hour.

[0047] In one embodiment of the method, the LOFU is non-ablative. In one embodiment of the method, the LOFU does not cause cavitation in the tissue to which it is applied.

[0048] In one embodiment of the method, the ultrasound component of the LOFU is administered at a frequency between 0.5 MHz and 1.5 MHz. In one embodiment of the method, the LOFU is administered for 1-3 seconds. In one embodiment of the method, the in situ intensity in the treatment zone is 250 W / cm at a tissue depth of 1 mm-75 mm in the subject. 2 to 750W / cm 2 The LOFU is performed by an ultrasonic beam so that:

[0049] In one embodiment of the method, LOFU is administered over the entire tumor volume. In one embodiment of the method, the method delivers energy to the tumor in the range of 300-3000 Joules per cc of tumor. In one embodiment of the method, high intensity focused ultrasound (HIFU) is not administered to the subject. In one embodiment, HIFU is focused ultrasound that results in tissue temperatures in the focal zone of 80°C or higher. HIFU increases temperatures up to 60-85°C during exposure times of a few seconds on solid tissue and / or causes thermal ablation in tissue. Thermal ablation is achieved with a frequency of 1 kW / cm at reported frequencies of 0.8-7 MHz. 2 On the other hand, LOFU is usually achieved at power intensities of, for example, 1-3 W / cm 2 and frequencies between 0.5 and 3 MHz (but see other LOFU ranges herein). LOFU can be focused ultrasound that is continuous (100% DC) or pulsed (<100% DC, some literature calls it Low Intensity Pulsed Ultrasound or LIPUS) by adjusting the duty cycle. 2 A continuous LOFU of 0.1°C can be achieved in tissue. In vivo experiments on muscle tissue have shown that ultrasonic treatment at a frequency of 1 MHz can achieve a 0.5 W / cm 2 at 0.04°C / min; 1.0W / cm 2 at 0.16°C / min; 1.5W / cm 2 0.33°C / min at 2.0W / cm 2 4 shows that the temperature is increased at a rate of 0.38°C / min.

[0050] In one embodiment of the method, the effect of the amount of radiation therapy and the amount of LOFU is synergistic in treating the tumor.

[0051] In one embodiment of the method, the subject is a human.

[0052] In one embodiment of the method, the tumor is prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testis, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid, or skin, head and neck tumor, glioma, or soft tissue sarcoma. In one embodiment of the method, the tumor is prostate cancer.

[0053] In one embodiment of the method, the metastasis is a lung metastasis.

[0054] In one embodiment of the method, the LOFU is administered with an apparatus that includes: a control system that generates a frequency waveform and a power of 1-1000 W / cm at the treatment zone. 2 The spatial peak time-averaged acoustic power intensity (I spta ), where the ultrasound is applied continuously at the treatment zone for a period ranging from 0.5-5 seconds, where the ultrasound frequency is in the range of 0.01-10 MHz, and where the mechanical index of any beam is less than 4. In one embodiment of the method, each of the one or more transducers has a center frequency in the range of 0.05-5 MHz and a power waveform of 20-1000 W / cm. 2 In one embodiment of the method, each of the one or more transducers is configured to generate an ultrasound beam based on a frequency waveform having a center frequency in the range of 0.5-1.5 MHz and an acoustic output intensity in the range of 20-1000 W / cm. 2In one embodiment of the method, each transducer is configured to generate an ultrasound beam based on a frequency waveform having an acoustic output intensity of 250 W / cm2 or greater. In one embodiment of the method, each transducer is configured to generate a column of ultrasound waves such that the -3 dB beam profile waist is 5 mm or greater at the treatment zone. In one embodiment of the method, one or more beams are mechanically moved during treatment. In one embodiment of the method, one or more transducers are operated sequentially or simultaneously and are configured to generate an ultrasound beam based on a frequency waveform having an acoustic output intensity of 250 W / cm2 or greater at the treatment zone during the treatment period. 2 In one embodiment of the method, the one or more transducers are configured to generate ultrasound waves having a frequency in the range of 10 kHz to 300 kHz. In one embodiment of the method, the one or more transducers are configured to generate ultrasound waves having a frequency in the range of 300 kHz to 3 MHz. In one embodiment of the method, the one or more transducers operate at a frequency of 300 kHz to 3 MHz and the one or more transducers operate at a frequency of 30-300 kHz. In one embodiment of the method, the two or more ultrasound transducers each have a beam power of 10-500 W / cm. 2 In the intersection zone in the range of I spta In one embodiment of the method, the treatment time is less than 5 seconds per cubic centimeter of tumor. In one embodiment of the method, two transducers generate intersecting ultrasound beams in the treatment zone, each beam having an intensity of 50-500 W / cm. 2 In the intersection zone in the range of I spta In one embodiment of the method, three transducers generate ultrasound beams through the treatment zone, each of 50-500 W / cm 2 In the intersection zone in the range of I spta In one embodiment of the method, the one or more transducers generate ultrasound beams that are substantially in phase with each other in the treatment zone. In one embodiment of the method, two ultrasound beams emanating from separate ultrasound transducers are substantially in phase and intersect in the treatment zone, each beam having an intensity of 70-100 W / cm. 2With acoustic power spatial peak intensity in the crossing zone in the range of 1 to 5 seconds, ultrasound is continuously applied.

[0055] In one embodiment of the method, three ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, each beam having an output of 50-70 W / cm 2 In one embodiment of the method, the ultrasound beams originating from separate transducers each have an acoustic power spatial peak intensity at the treatment zone in the range of about 100-1000 W / cm2, and the ultrasound waves are applied for 1-5 seconds consecutively. 2 I in the range sptaIn one embodiment of the method, at least one transducer generates an ultrasound beam with a dense diameter that is substantially larger in size than the treatment zone and is oriented such that the treatment zone is entirely within the beam. In one embodiment of the method, a focused treatment zone is formed where two or more ultrasound beams intersect in a path, the focused treatment zone being about 1 cm or more perpendicular to the transmitted energy direction and about 1 cm or more parallel to the transmitted direction. In one embodiment of the method, the acoustic pressure applied to the treatment zone from each transducer is 0.1-10 MPa. In one embodiment of the method, the number of transducers providing the focused ultrasound treatment zone is between 1-1000. In one embodiment of the method, ultrasound from one or more transducers is applied continuously for the treatment time. In one embodiment of the method, ultrasound is generated with a duty cycle in the range of 1 on time unit:9 off time units. In one embodiment of the method, the transducers are configured to generate a single frequency sound or a multi-frequency chirp of ultrasound. In one embodiment of the method, the one or more transducers operate sequentially in time. In one embodiment of the method, the total energy delivered to the target tissue and a desired margin around the target during the entire course of application is greater than the total energy delivered to the surrounding tissue. In one embodiment of the method, the one or more transducers are configured such that the ultrasonic frequencies are swept across during application. In one embodiment of the method, the one or more transducers include a two-dimensional phased array. In one embodiment of the method, the one or more transducers include an annular array. In one embodiment of the method, the one or more transducers include a three-dimensional phased array. In one embodiment of the method, the one or more transducers are incorporated into one or more endoscopic devices. In one embodiment of the method, the one or more transducers are incorporated into a magnetic resonance imaging machine.

[0056] In one embodiment of the method, the one or more transducers are incorporated into a radiation therapy machine.

[0057] In one embodiment of the method, the one or more transducers are configured to generate ultrasound waves such that when ultrasound waves are applied to the treatment zone for about 2 seconds or less, the maximum temperature reached in the treatment zone is less than 45°C during treatment.

[0058] In one embodiment of the method, the one or more transducers are configured to generate ultrasound waves such that when ultrasound waves are applied to the treatment zone for about 2 seconds or less, the maximum temperature reached in the treatment zone is less than 50°C during treatment.

[0059] In one embodiment of the method, the one or more transducers are configured to generate ultrasound waves such that when ultrasound waves are applied to the treatment zone for about 2 seconds or less, the maximum temperature reached in the treatment zone is less than 55°C during treatment.

[0060] In one embodiment of the method, the LOFU and radiation therapy are administered by a system that includes: a LOFU device and a control system that generates a frequency waveform; and a radiation therapy frequency of 1-1000 W / cm at the treatment zone. 2 The spatial peak time-averaged acoustic power intensity (I spta ), where the ultrasound is applied continuously for a time period ranging from 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz; a LOFU device; a radiation therapy machine; and a control system operatively configured to control the LOFU device and the radiation therapy machine such that a first amount of ultrasound and a second amount of radiation therapy are administered to the subject, the first amount and the second amount being sufficient to treat a tumor in the subject.

[0061] A method of treating a tumor in a subject includes administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy or an amount of radiation therapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) are sufficient to treat the tumor.

[0062] In one embodiment of the method, the amount of LOFU and that amount of radiation therapy are administered to the subject. In another embodiment of the method, the amount of LOFU and that amount of radiation therapy are administered to the subject. In another embodiment of the method, the amount of LOFU and that amount of immunotherapy are administered to the subject.

[0063] A method of treating a tumor in a subject includes administering to the subject (i) an amount of low intensity focused ultrasound (LOFU) and (ii) an amount of a targeted anti-cancer therapy, wherein the amounts of (i) and (ii) are sufficient to treat the tumor. In one embodiment, the targeted therapy comprises a mAb directed against Her2 or VEGFR. In one embodiment, the targeted therapy comprises a tyrosine kinase inhibitor.

[0064] Further provided is a method of inhibiting metastasis of a tumor in a subject, the method comprising administering to a tumor-bearing subject an amount of low intensity focused ultrasound (LOFU) and an amount of radiation therapy, both of which are sufficient to inhibit metastasis of the tumor in the subject.

[0065] In the method, the radiation therapy can be ablative hypofractionated radiation therapy.

[0066] Preferably, in this method, the LOFU is directed to the location of the tumor in the subject.

[0067] Further provided is a method of reducing the effective amount of anti-cancer chemotherapy required to treat a tumor in a subject, the method comprising administering to a subject receiving anti-cancer chemotherapy an amount of low intensity focused ultrasound (LOFU) sufficient to reduce the effective amount of anti-cancer chemotherapy required to treat the tumor.

[0068] In each embodiment of the method, LOFU is administered to the subject prior to or simultaneously with chemotherapy or radiation therapy or immunotherapy.

[0069] In one embodiment, LOFU is administered to a subject prior to administration of radiation therapy.

[0070] In the method in which anti-cancer chemotherapy is administered, in one embodiment, the anti-cancer chemotherapy comprises administration of an HSP90 inhibitor to the subject. The HSP90 inhibitor can be 17AAG (tanespimycin or 17-N-arylamino-17-demethoxygeldanamycinan). In one embodiment, the chemotherapeutic agent is an alkylating agent. In one embodiment, the chemotherapeutic agent is trabectedin. In one embodiment, the chemotherapeutic agent is a mustard gas derivative. In one embodiment, the chemotherapeutic agent is a metal salt. In one embodiment, the chemotherapeutic agent is a plant alkaloid. In one embodiment, the chemotherapeutic agent is an antitumor antibiotic. In one embodiment, the chemotherapeutic agent is an antimetabolite. In one embodiment, the chemotherapeutic agent is a topoisomerase inhibitor. In one embodiment, the chemotherapeutic agent is a proteasome inhibitor. In one embodiment, the chemotherapeutic agent is a chemotherapeutic NSAID. In one embodiment, the chemotherapeutic agent is one of the various antineoplastic agents listed below.

[0071] In one embodiment of the method, the LOFU is delivered by an ultrasound beam from an ultrasound machine that includes a transducer, and the machine and subject are positioned such that at least a portion of the tumor is located at the focal length of the transducer.

[0072] In one embodiment of the method, the LOFU is delivered to at least a portion of the tumor and the location of the tumor is monitored by imaging techniques. Magnetic resonance imaging can be such an imaging technique.

[0073] In the method, the LOFU can be administered at least once at multiple points within the tumor over a period of less than one hour.

[0074] In one embodiment of the method, the LOFU is non-ablation.

[0075] In one embodiment of the method, LOFU is applied at a frequency between 0.5 MHz and 1.5 MHz.

[0076] In one embodiment of the method, the LOFU is administered for 1.5-3 seconds.

[0077] In one embodiment of the method, at the focus of the ultrasound beam, the in situ intensity is 250 W / cm 2 to 750W / cm 2 In one embodiment of the method, the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam, the in situ intensity is up to 250 W / cm at a tissue depth of 1 mm-75 mm in the subject. 2 to 750W / cm 2 In one embodiment of the method, the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam, the in situ intensity is 350 W / cm at a tissue depth of 1 mm-75 mm in the subject. 2 to 650W / cm 2 In one embodiment of the method, the LOFU is administered by an ultrasound beam such that at the focus of the ultrasound beam, the in situ intensity is 450 W / cm at a tissue depth of 1 mm-75 mm in the subject. 2 to 550W / cm 2 The LOFU is performed by an ultrasonic beam so that:

[0078] LOFU can be administered to the entire tumor volume or to a portion of the tumor volume, hi a preferred embodiment, LOFU is administered to the entire tumor volume.

[0079] In one embodiment of the method, the LOFU delivers at least 500-5000 Joules of energy per cc of tumor tissue through the tumor. In one embodiment of the method, the LOFU delivers at least 1000-4000 Joules of energy per cc of tumor tissue. In one embodiment of the method, the LOFU delivers at least 2000-3000 Joules of energy per cc of tumor tissue through the tumor.

[0080] In one embodiment, high intensity focused ultrasound (HIFU) is not administered to the subject. In one embodiment, high intensity focused ultrasound is not administered to the subject. In one embodiment, high intensity focused ultrasound is not administered to the tumor. In one embodiment, LOFU is administered to the subject before anti-cancer treatment, high intensity focused ultrasound is not administered to the subject after LOFU is administered and before anti-cancer treatment is administered.

[0081] In one embodiment, the anti-cancer therapeutic effect of the amount of radiation therapy and the amount of LOFU is synergistic.

[0082] In one embodiment, the administered LOFU raises the temperature of the tissue / tumor to no more than 40° C.-45° C. In one embodiment, the administered LOFU raises the temperature of the tissue / tumor to no more than 40° C. In one embodiment, the administered LOFU raises the temperature of the tissue / tumor to no more than 45° C. In one embodiment, the administered LOFU raises the temperature of the tissue / tumor to no more than 50° C. HIFU generally raises the temperature of tissue above this.

[0083] In one embodiment, the LOFU is administered for 0.5-3 seconds. In one embodiment, the LOFU is administered for 1.5-3 seconds. In one embodiment, the LOFU is administered with a 100% duty cycle. In one embodiment, the LOFU is administered with one of the following alternative embodiments of a 10, 20, 30, 40, 50, 60, 70, 80, or 90% duty cycle.

[0084] Further provided is a method of sensitizing a tumor of a subject to an amount of anti-cancer therapy, comprising administering to the subject an amount of low intensity focused ultrasound (LOFU) effective to sensitize the tumor of the subject to the amount of anti-cancer therapy before, during, or after the anti-cancer therapy. In one embodiment, the anti-cancer therapy comprises chemotherapy, radiation therapy, or immunotherapy, or targeted therapy, or surgery. In one embodiment, the anti-cancer therapy comprises chemotherapy. In one embodiment, the anti-cancer therapy comprises immunotherapy. In one embodiment, the anti-cancer therapy comprises radiation therapy. In one embodiment, the anti-cancer therapy comprises surgery, for example, to remove the tumor. The method can further comprise administering the anti-cancer therapy to the subject. Sensitizing the tumor to an amount of anti-cancer therapy makes the tumor more vulnerable to the treatment. For example, a parameter that can measure tumor treatment, such as a reduction in tumor volume, is greater for a given amount of anti-cancer therapy applied to a sensitized tumor compared to the same amount of anti-cancer therapy, vascularity, location, and type applied to a comparable amount of a non-sensitized tumor in the same or comparable subject. In one embodiment, the amount of LOFU and anti-cancer therapy effective to sensitize a subject's tumor to an amount of the anti-cancer therapy are synergistic in effect.

[0085] In any of the methods described herein, the subject is a mammal. In one embodiment, the subject is a human.

[0086] The tumor referred to in the method is a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testis, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid, or skin, head and neck, or is a glioma, or a soft tissue sarcoma. In one embodiment, the tumor is prostate cancer. In one embodiment, the tumor is a soft tissue sarcoma. In one embodiment, the primary tumor is treated. In one embodiment, a secondary tumor is treated. In one embodiment, the treatment of the tumor reduces the likelihood of a secondary tumor. In one embodiment, the metastasis includes one or more lung metastases.

[0087] The term "tumor," as used herein, unless otherwise specified, refers to a proliferation of neoplastic cells and includes precancerous and cancerous cells and tissues. A tumor usually appears as a lesion or lump. In one embodiment, the tumor is a malignant neoplasm.

[0088] As used herein, "metastasize" (or grammatical equivalents), in reference to a cancer or tumor, means the spread of the cancer or tumor from one organ or tissue of a subject to another organ or tissue of the subject that is spatially distant from the first organ or tissue.

[0089] As used herein, "treating" a tumor means that one or more symptoms of the disease, such as the tumor itself, the vascularization of the tumor, or other parameters that characterize the tumor, are reduced, ameliorated, inhibited, placed in remission, or maintained in remission. "Treating" a tumor further means that one or more characteristics of the tumor may be eliminated, reduced, or prevented by treatment. Non-limiting examples of such characteristics include uncontrolled degradation of the basement membrane and proximal extracellular matrix, migration, division, and organization of endothelial cells into new functional capillaries, and the persistence of such functional capillaries. In one embodiment, treating a tumor means reducing the size or mass of the tumor.

[0090] As used herein, "inhibiting metastasis" of a tumor in a subject means that one or more symptoms or one or more other parameters thereof that are characterized are reduced, ameliorated, or inhibited. Non-limiting examples of such parameters include uncontrolled degradation of basement membrane and proximal extracellular matrix, migration of tumor cells through the bloodstream or lymphatics, invasion, dysregulated adhesion, and proliferation at a second site, either distal or local. In one embodiment, treating metastasis means reducing the occurrence or inhibiting the progression of metastasis.

[0091] Radiation therapy is well known in the art. Radiation therapy as encompassed herein includes medical therapeutic radiation delivered by a machine outside the body (external beam radiation therapy), medical therapeutic radiation delivered from a radioactive material placed in the body near the cancer cells (internal beam radiation therapy), or total body radiation therapy. Radiation therapy as encompassed herein includes three-dimensional conformal radiation therapy (3D-CRT), intensity modulated radiation therapy (IMRT), image-guided radiation therapy (IGRT), and tomotherapy. Radiation therapy can also be part of stereotactic radiosurgery or stereotactic body radiation therapy (SBRT). For example, delivery by any particle beam known in the art is also encompassed, such as proton therapy, carbon ion therapy, or other charged particle beams depending on the type and location of the tumor.

[0092] In one embodiment, the radiation therapy is CT image-induced. In one embodiment, the radiation therapy is hypofractionated cone beam radiation therapy. In one embodiment, the radiation therapy is hypofractionated cone beam CT image-induced radiation therapy. All combinations of the various elements described herein are within the scope of the present invention unless otherwise specified herein or clearly contradicted by context.

[0093] There are various types of chemotherapy drugs that can be used in the present invention. Examples of chemotherapy drugs include: alkylating agents (e.g., trabectidin ((1'R,6R,6aR,7R,13S,14S,16R)-6',8,14-trihydroxy-7',9-dimethoxy-4,10,23-trimethyl-19-oxo-3',4',6,7,12,13,14,16-octahydrospiro[6,16-(epithiopropano-oxymethano)-7,13-imino-6aH-1,3-dioxolo[7,8]isoquino[3,2-b][3]benzazocin-20,1'(2'H)-isoquinoline]-5-yl acetate); Mustard gas inducers (e.g., mechlorethamine, cyclophosphamide, chlorambucil, melphalan, and ifosfamide); Ethylenimines (e.g., thiotepa and hexamethylmelamine); Alkyl sulfonates (e.g., busulfan); Hydrazines and triazines (e.g., altretamine, procarbazine, dacarbazine, and temozolomide); nitrosureas (such as carmustine, lomustine, and streptozocin); Metal salts (e.g., carboplatin, cisplatin, and oxaliplatin); Plant alkaloids (e.g., vinca alkaloids such as vincristine, vinblastine, and vinorelbine, taxanes such as paclitaxel and docetaxel, podophyllotoxins such as etoposide and teniposide, camptothecan analogues (topoisomerase inhibitors) such as irinotecan and topotecan); Antitumor antibiotics (such as various of the anthracyclines: doxorubicin, daunorubicin, epirubicin, mitoxantrone, and idarubicin; chromomycins: dactinomycin and plicamycin; mitomycin and bleomycin); Antimetabolites (e.g., folate antagonists: methotrexate; pyrimidine antagonists: 5-fluorouracil, foxuridine, cytarabine, capecitabine, and gemcitabine; purine antagonists: 6-mercaptopurine and 6-thioguanine; adenosine deaminase inhibitors: cladribine, fludarabine, nelarabine, and pentostatin); Topoisomerase inhibitors (e.g., irinotecan, topotecan; amsacrine, etoposide, etoposide phosphate, teniposide); Proteasome inhibitors; NSAIDs for chemotherapy; and Various antineoplastic agents (e.g. ribonucleotide reductase inhibitors: hydroxyurea; corticosteroid inhibitors: mitotane; enzymes: asparaginase and pegaspargase; microtubule inhibitors: estramustine; retinoids: bexarotene, isotretinoin, tretinoin (ATRA)).

[0094] Chemotherapeutic agents that cause endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in cells are known in the art. For example, proteasome inhibitors such as bortezomib (Velcade; previously known as PS-341) induce ER stress response. Proteasome inhibitors such as bortezomib also induce UPR. Histone deacetylase (HDAC) inhibitors induce ER stress response. Chemotherapeutic NSAIDs (e.g., indomethacin, diclofenac, and celecoxib) can induce ER stress response and can induce UPR. Estrogen receptor alpha inhibitor, BHPI (1,3-dihydro-3,3-bis(4-hydroxyphenyl)-7-methyl-2H-indol-2-one), can activate UPR. Platinum-containing anticancer drug: cisplatin is known to induce ER stress response. Taxane family of drugs: Paclitaxel is known to induce ER stress response. Anthracyclines such as doxorubicin are known to induce ER stress. Cyclophosphamide is known to induce ER stress. See also Table 2 of Hetz et al, Nature Reviews, Drug Discovery, 12:703-719 (Sept., 2013), incorporated herein by reference.

[0095] The endoplasmic reticulum (ER) is the site of synthesis and folding of secreted membrane-bound proteins and some organelle-targeted proteins. The ER is highly sensitive to stresses that perturb cellular energy levels, redox state, or Ca2+ concentrations. Such stresses reduce the protein folding capacity of the ER, which can result in the accumulation and aggregation of unfolded proteins and / or an imbalance between the load of endogenous and transport proteins in the ER and the capacity of the organelle to handle that load. This condition is referred to herein and in the art as "ER stress." The ER stress response can promote cell repair and sustained survival by relieving the load of unfolded proteins through a global attenuation of protein synthesis and / or upregulation of ER chaperones, enzymes, and structural components that enhance protein folding. This response is collectively termed the unfolded protein response (UPR). Accumulation of unfolded proteins causes dissociation of GRP78 from PERK, ATF6, and IREl, thereby initiating the UPR.

[0096] [Table 1-1]

[0097] [Table 1-2]

[0098] [Table 1-3]

[0099] [Table 1-4]

[0100] In an embodiment of the method, the chemotherapeutic agent is an HSP90 inhibitor. An example of an HSP90 inhibitor is 17AAG (tanespimycin or 17-N-allylamino-17-demethoxygeldanamycin). In one embodiment, the chemotherapeutic agent is an alkylating agent. In one embodiment, the chemotherapeutic agent is trabectidine. In one embodiment, the chemotherapeutic agent is a mustard gas derivative. In one embodiment, the chemotherapeutic agent is a metal salt. In one embodiment, the chemotherapeutic agent is a plant alkaloid. In one embodiment, the chemotherapeutic agent is an antitumor antibiotic. In one embodiment, the chemotherapeutic agent is an antimetabolite. In one embodiment, the chemotherapeutic agent is a topoisomerase inhibitor. In one embodiment, the chemotherapeutic agent is a proteasome inhibitor. In one embodiment, the chemotherapeutic agent is a chemotherapeutic NSAID. In one embodiment, the chemotherapeutic agent is one of the various antineoplastic agents listed above.

[0101] Other non-limiting examples of chemotherapeutic agents or drugs encompassed by the present invention include anthracyclines, maytansinoids, alkylating agents, antimetabolites, plant alkaloids or terpenoids, and cytotoxic antibiotics, unless otherwise stated. In one embodiment, the chemotherapeutic agent is cyclophosphamide, bleomycin, etoposide, platinum agents (cisplatin), fluorouracil, vincristine, methotrexate, taxol, epirubicin, leucovorin (folinic acid), or irinotecan.

[0102] Antitumor immunotherapies encompassed herein include: (i) monoclonal antibodies (naked, chemically-, radio- or toxin-conjugated antibodies, as well as bispecific antibodies), and associated antigen-binding fragments thereof, such as fragments composed of Fab or scFv fragments, that bind with high affinity to biomolecular targets associated with cancer; (ii) those that are non-specific with respect to tumor cells and tumor cell antigens; antitumor immunotherapeutic agents that bind to cytokines or cytokine receptors, such as cytokines, interleukins, interferons, GM-CSF, small organic molecules (e.g., 1,500 daltons or less), or other drugs; and checkpoint targeting agents, including, but not limited to, one of CTLA-4, PD-1, PDL-1, and other small organic molecules, peptides, and aptamers, that target the immune response. In one embodiment, immunotherapy as used herein excludes bacteria-based anticancer or antitumor immunotherapy. In one embodiment, immunotherapy as used herein excludes Listeria-based immunotherapy.

[0103] In one embodiment, increasing the efficacy of a treatment refers to an increase in the extent of therapeutic effect achieved relative to the extent achieved for the same amount of treatment (e.g., a given treatment dose) in the absence of an applied method of increasing the efficacy.

[0104] Also provided is an ultrasound stimulation therapy device that includes: a control system for generating a frequency waveform; and a frequency waveform having a power of 1 to 1000 W / cm at a treatment zone. 2 The temporal average acoustic power intensity (I spta ) where the ultrasound is applied continuously to the treatment zone for a time period ranging from 0.5 to 5 seconds, the ultrasound frequency is in the range of 0.01 to 10 MHz, and the mechanical index of any beam is less than 4.

[0105] In one embodiment of the device, each of the one or more transducers has a frequency waveform with a center frequency in the range of 0.05 to 5 MHz and a power of 20 to 1000 W / cm 2 The ultrasonic beam is configured to generate an ultrasonic beam based on the acoustic output intensity of the ultrasonic beam.

[0106] In one embodiment of the device, each of the one or more transducers has a frequency waveform with a center frequency in the range of 0.5 to 1.5 MHz and a power of 20 to 1000 W / cm 2 The ultrasonic beam is configured to generate an ultrasonic beam based on the acoustic output intensity of the ultrasonic beam.

[0107] In one embodiment of the device, each transducer is configured to generate a columnated ultrasound wave such that the waist of the beam profile at -3 dB is at least 5 mm in the treatment zone.

[0108] In one embodiment of the device, one or more beams are mechanically moved during the procedure.

[0109] In one embodiment of the device, one or more transducers are operated in sequence or in unison and produce an average spatial peak of 250 W / cm in the treatment zone during the treatment period. 2 The ultrasonic transducer includes two or more transducers configured to generate ultrasonic waves of

[0110] In one embodiment of the device, the one or more transducers are configured to generate ultrasound waves having a frequency in the range of 10 kHz to 300 kHz.

[0111] In one embodiment of the device, the one or more transducers are configured to generate ultrasound waves having a frequency in the range of 300 kHz to 3 MHz.

[0112] In one embodiment of the device, one or more transducers operate at a frequency between 300 kHz and 3 MHz, and one or more transducers operate at a frequency between 30 and 300 kHz.

[0113] In one embodiment of the device, two or more ultrasound transducers generate ultrasound beams that pass through the treatment zone, each beam having a power of 10-500 W / cm 2 In the intersection zone, I spta It has.

[0114] In one embodiment of the device, treatment time is less than 5 seconds per cubic centimeter of tumor.

[0115] In one embodiment of the device, two transducers generate intersecting ultrasound beams within the treatment zone, each beam having an intensity of 50-500 W / cm 2 In the intersection zone, I spta It has.

[0116] In one embodiment of the device, three transducers generate ultrasound beams that pass through the treatment zone, each beam having an intensity of 50-500 W / cm. 2 In the intersection zone, I spta It has.

[0117] In one embodiment of the device, one or more transducers generate ultrasound beams that are substantially in phase with each other within the treatment zone.

[0118] In one embodiment of the device, two ultrasound beams emitted from separate ultrasound transducers approximately coincide and intersect within the treatment zone, each beam having an intensity of 70-100 W / cm 2 The ultrasound has a spatial peak intensity of acoustic power in the crossing zone in the range of 1 to 5 seconds.

[0119] In one embodiment of the device, three ultrasound beams emitted from separate ultrasound transducers approximately coincide and intersect within the treatment zone, each beam having an output of 50-70 W / cm 2 The ultrasound has a spatial peak intensity of acoustic power in the crossing zone in the range of 1 to 5 seconds, and is applied continuously for 1 to 5 seconds.

[0120] In one embodiment of the device, the ultrasound beams generated by the separate transducers each have an intensity of approximately 100-1000 W / cm at the treatment zone. 2 I in the range spta Generate.

[0121] In one embodiment of the device, at least one transducer generates an ultrasound beam having a high intensity diameter that is substantially larger in size than the treatment zone and oriented such that the treatment zone is entirely within the beam.

[0122] In one embodiment of the device, a focal treatment zone is formed where two or more ultrasound beams traverse a path, the focal treatment zone being about 1 cm or more perpendicular to the direction of the transmitted energy, and the focal treatment zone being about 1 cm or more parallel to the transmitted direction.

[0123] In one embodiment of the device, the acoustic pressure applied to the treatment zone from each transducer is between 0.1 and 10 MPa.

[0124] In one embodiment of the device, the number of transducers providing the focused ultrasound treatment zone is between 1 and 1000.

[0125] In one embodiment of the device, ultrasound from one or more transducers is applied continuously during the treatment period.

[0126] In one embodiment of the device, ultrasound waves are generated with a duty cycle ranging from 1 on time unit to 0 to 9 off time units.

[0127] In one embodiment of the device, the transducer is configured to generate a single frequency tone or a multi-frequency chirp.

[0128] In one embodiment of the device, one or more transducers are activated sequentially in time.

[0129] In one embodiment of the device, the total energy delivered to the target tissue and a desired margin around the target tissue over the course of application is greater than that delivered to the surrounding tissue. In one embodiment of the device, the one or more transducers are configured such that the frequency of the ultrasound is swept during application. In one embodiment of the device, the one or more transducers comprise a two-dimensional phased array. In one embodiment of the device, the one or more transducers comprise an annular array. In one embodiment of the device, the one or more transducers comprise a three-dimensional phased array. In one embodiment of the device, the one or more transducers are incorporated into one or more endoscopic devices. In one embodiment of the device, the one or more transducers are incorporated into a magnetic resonance imaging machine. In one embodiment of the device, the one or more transducers are incorporated into a radiation therapy machine.

[0130] In one embodiment of the device, the one or more transducers are configured to generate ultrasound waves such that the maximum temperature reached in the treatment zone during a treatment in which ultrasound waves are applied to the treatment zone for about 2 seconds or less is less than 45° C. In one embodiment of the device, the one or more transducers are configured to generate ultrasound waves such that the maximum temperature reached in the treatment zone during a treatment in which ultrasound waves are applied to the treatment zone for about 2 seconds or less is less than 50° C.

[0131] In one embodiment of the device, the one or more transducers are configured to generate ultrasound waves such that the maximum temperature reached in the treatment zone is less than 55° C. during a treatment in which ultrasound waves are applied to the treatment zone for about 2 seconds or less.

[0132] Also, a system comprising: 1. An ultrasound stimulation therapy device comprising: a control system for generating a frequency waveform; 1-1000W / cm in treatment zone 2 The temporal average acoustic power intensity (I spta) wherein the ultrasound is applied continuously for a time period ranging from 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz. An acoustic stimulator including; Radiation therapy machines; and A control system configured to be operable to control an ultrasound stimulation therapy device and a radiation therapy machine to administer a first amount of ultrasound and a second amount of radiation therapy to a subject, wherein the first and second amounts are together sufficient to treat a tumor in the subject. A system is also provided that includes:

[0133] Also provided is a system including an ultrasound stimulation therapy device: The ultrasound stimulation therapy device comprises: a control system for generating a frequency waveform; 1-1000W / cm in treatment zone 2 The temporal average acoustic power intensity (I spta ) wherein the ultrasound is applied continuously for a time period ranging from 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz. Including, The ultrasound stimulation therapy device is used in combination with chemotherapy such that a first amount of ultrasound and a second amount of chemotherapy are administered to the subject, where the first and second amounts together are sufficient to treat a tumor in the subject.

[0134] Also provided is a system including an ultrasound stimulation therapy device: The ultrasound stimulation therapy device comprises: A control system for generating a frequency waveform; 1-1000W / cm in treatment zone 2 The temporal average acoustic power intensity (I spta) wherein the ultrasound is applied continuously for a time period ranging from 0.5 to 5 seconds, and the ultrasound frequency is in the range of 0.01 to 10 MHz. Including, The ultrasound stimulation therapy device is used in combination with immunotherapy such that a first amount of ultrasound and a second amount of immunotherapy are administered to the subject, where the first and second amounts together are sufficient to treat a tumor in the subject.

[0135] The present invention will be better understood from the following examples, however, those skilled in the art will readily recognize that the specific methods and results discussed are merely illustrative of the invention as more particularly described in the appended claims below.

[0136] <Example 1> B16 melanoma tumors abrogate IL-2 and IFNγ production by tumor-specific CD4+ T cells: To determine how melanoma cells modulate tumor-induced effector CD4+ T cell responses, three different mouse models were used. First, B16-F1 melanoma tumors were induced in C57B1 / 6J mice by subcutaneous injection of B16 cells into the lumbar flank. Tumors were allowed to grow to a size of 7-8 mm, after which CD4+ T cells were isolated from both ipsilateral inguinal draining lymph nodes (DLN) and distal contralateral non-draining cervical lymph nodes (NDLN). T cells were also obtained from control mice that did not bear tumors. Supporting previous reports of tumor antigen-specific T cell tolerance in murine melanoma (18, 21), CD4+ T cells isolated from tumor DLN produced significantly less IL-2 upon ex vivo stimulation with anti-CD3 and anti-CD28 antibodies than cells isolated from the distal contralateral NDLN of the same mice or from lymph nodes of control tumor-free mice. A similar, but less pronounced, effect was also observed for IFNy (Fig. 1, A and B).

[0137] To confirm these data, we used the B16-F1 melanoma cell line stably transfected to express OVA as a surrogate tumor antigen. These cells were subcutaneously injected into OT-II mice, mice whose T cells express a transgenic MHC class II-restricted TCR that recognizes the OVA323-339 peptide. T cells were collected from these mice as described and stimulated ex vivo using splenocytes that had been challenged with the OVA323-339 peptide. Regenerated CD4+ T cells from ipsilateral DLN produced significantly reduced amounts of IL-2 and IFNγ compared to cells from contralateral NDLN or tumor-free mice (Figure 1C and D).

[0138] These results were further confirmed in a third model using Tyrp1 mice, which are deficient in tyrosinase-related protein 1 and harbor T cells expressing MHC class II-restricted TCRs specific for the TRP-1113-127 peptide of this endogenous melanocyte differentiation antigen. The mice were injected with B16-F1 cells. As in the previous two models, IL-2 and IFNγ production by CD4+ T cells harvested from ipsilateral DLN was significantly reduced compared to cells harvested from contralateral NDLN or tumor-free mice (Figure 1E and F). Collectively, these results support that melanoma tumors induce hyporesponsiveness of tumor antigen-specific CD4+ T cells, which translates in a reduced ability to produce effector cytokines after restimulation.

[0139] Treatment of primary B16 melanoma with LOFU overcomes tumor-induced resistance in CD4+ T cells: HIFU is currently used to predominantly cause tumor ablation by the generation of high thermal mass inside tumor tissue leading to coagulation necrosis. Although HIFU is a highly effective and non-invasive ablative procedure to achieve local tumor control, it destroys vasculature and tissue infrastructure almost instantaneously, thereby limiting the infiltration of dendritic and immune cells for antigen presentation and recognition. We investigated whether administration of LOFU induces non-lethal thermal / mechanical stress in tumor tissue that generates new tumor antigens and / or induces the expression of stress-induced proteins that can increase tumor immunogenicity and overcome tumor-induced resistance in CD4+ T cells. To examine this possibility, primary B16-F1 melanoma tumors grown on separate groups of C57Bl / 6J mice were left untreated or treated with LOFU. Thirty-six hours after LOFU treatment, DLN- and NDLN-resident CD4+ T cells were isolated from both groups of mice and restimulated ex vivo with anti-CD3 and anti-CD28 antibodies. CD4+ T cells from DLN of mice treated with LOFU produced significantly more IL-2 compared to cells from the group of mice in which tumors were left untreated. In contrast, T cells from the corresponding NDLN produced comparable amounts of IL-2 in treated and untreated mice (Figure 2A). A similar, but less pronounced, effect was observed on IFNγ production in these same experimental groups of mice (Figure 2B). Overall, these results indicate that LOFU treatment of B16 melanoma tumors appears to support CD4+ T cells to overcome a state of hyporesponsiveness induced by the melanoma tumor microenvironment, suggesting improved activation and reduced tumor-induced T cell tolerance.

[0140] It has been previously shown that melanoma tumors can induce an NF-ATI-dependent program of gene expression generating a set of proteins that interfere with TCR signaling and directly inhibit cytokine expression, resulting in the establishment of functional anergy in CD4+ T cells (21). To determine whether LOFU treatment could inhibit tumor-induced T cell tolerance by preventing anergy induction and be responsible for the increased cytokine expression observed in DLN-resident CD4+ T cells after treatment with LOFU, we first monitored the expression of such anergy-related genes in CD4+ T cells isolated from the DLN of B16 tumor-bearing mice and compared it with the expression of genes in T cells taken from the NDLN of the same mice. T cells from the DLN of cancer-bearing mice expressed higher levels of anergy-related genes, including the E3 ubiquitin ligases Grail, Cbl-b, and Itc, and the transcription factor Egr2 (Figure 2C). However, no difference in Foxp3 expression was observed between DLN and NDLN T cells from tumor-bearing mice, suggesting that the increased presence of regulatory T cells was likely not due to a decrease in CD4+ T cell responses under the conditions used in this study (Figure 2C).

[0141] We then determined whether treatment of B16 melanoma with LOFU had an effect on the expression of such anergy-related genes in T cells. To evaluate responses induced by endogenous tumor antigens, B16 tumors growing on Tyrp1 mice were left untreated or treated with LOFU. CD4+ T cells were isolated from DLN and NDLN and the expression of various anergy-related genes was evaluated. DLN-derived T cells showed various degrees of upregulation of six of the seven anergy genes analyzed, including Grail, Itch, and Cblb, as well as the transcription factors Egr2 and Grg4, and the protease Caspase3 (Figure 2D). Another transcription factor (Ikaros), which is also upregulated in various in vitro and in vivo T cell anergy models, was not significantly upregulated in this melanoma model of tumor-induced anergy, and its levels remained largely similar in both DLN- and NDLN-derived T cells (Figure 2D). Interestingly, when tumors were treated with LOFU, the expression of five of these genes, Grail, Itch, Cblb, Egr2, and Grg4, in T cells isolated from DLN was not upregulated and showed levels comparable to those of these genes in NDLN (Figure 2D), supporting that LOFU treatment inhibited the induction of anergy-inducing gene expression in tumor antigen-specific CD4+ T cells.

[0142] Melanoma tumors treated with LOFU can reactivate anergic tumor antigen-specific T cells: the results supported that tumor-induced T cell tolerance could be overcome after LOFU treatment. This observation was substantiated by the fact that the expression of various anergy-related genes was decreased in T cells derived from tumor DLN after LOFU treatment at the tumor site, while activation-induced cytokine expression was restored to levels close to those detected in T cells isolated from distal NDLN or from control tumor-free mice.

[0143] We investigated whether LOFU not only prevents the induction of tumor antigen-specific T cell anergy, but also reverses established anergy and generates productive effector responses in previously tolerized T cells. Naive CD4+ T cells were isolated from the spleens and lymph nodes of Tyrpl mice, differentiated in vitro into TH1 cells, and anergized by activating them by partial stimulation with anti-CD3 antibodies in the absence of costimulation. As expected, T cells became hyporesponsive and showed a severe reduction in IL-2 production after restimulation with anti-CD3 and anti-CD28 antibodies (Figure 3A). These anergic cells were then reactivated with CD11c+ dendritic cells fed with lysates derived from either untreated or LOFU-treated melanoma tumors. As expected, anergic Tyrp1 T cells stimulated with dendritic cells fed with tumor lysates from untreated B16-F1 melanoma produced negligible amounts of IL-2. However, when dendritic cells were challenged with tumor lysates prepared from LOFU-treated tumors, previously anergized T cells produced significantly more IL-2 than those activated with untreated lysates (Figure 3B). These results suggest that LOFU treatment of melanoma tumors allows dendritic cells to deliver activation signals capable of breaking tolerance, and results in the production of immunogenic molecules that can otherwise enable anergic T cells to respond to re-encounter with antigen and generate a productive response.

[0144] Treatment of melanoma with LOFU induces changes in the expression and intracellular distribution of molecular chaperones calreticulin and Hsp70 in melanoma tumor cells: Activation of melanoma-specific T cells by dendritic cells is a critical event in determining their fate. A successful antigen-presenting event capable of eliciting an effector T cell response is highly dependent on the activation state of dendritic cells that convey tolerogenic stimuli. The results show that treatment of melanoma tumors with LOFU led to an increase in CD4+ T cell activation as a result of the disruption of tumor-induced T cell tolerance. This could potentially be attributed to the generation of a more immunogenic dendritic cell population. To test the effect of LOFU on the ability of dendritic cells to efficiently present antigens to T cells, total cells from the DLN of tumor-bearing mice were first isolated, untreated or treated with LOFU, and immunostained to measure the expression of B7.1, B7.2, and MHCII on the CD11c+ dendritic cell population by flow cytometry. No significant enhancement of the expression of these proteins in mice treated with LOFU was detected (FIG. 4A).

[0145] Transport of tumor antigens by molecular chaperones, including calreticulin and Hsp70, is also important for subsequent productive presentation of antigens to T cells (32-35). Both in vivo and in vitro methods were used to detect membrane calreticulin and Hsp70 in untreated and LOFU-treated B16 melanoma tumors. Tumors, either left untreated or treated with LOFU, were harvested from tumor-bearing mice, made into single cell suspensions, and stained with live / dead markers to assess cell viability. No differences in cell viability were observed in response to LOFU treatment, supporting the idea that the low-energy form of FUS did not directly induce tumor cell death (Figure 4B). B16 melanoma tumors were left untreated or exposed to LOFU treatment, and tumor tissue sections were placed on slides. Slides were exposed to staining with anti-Hsp70 or anti-calreticulin antibodies for subsequent detection by immunofluorescence. Immunofluorescence analysis of LOFU-treated melanoma confirmed that LOFU induced increased expression of Hsp70 (Figure 4C). Interestingly, compared to untreated cells, LOFU-treated cells also showed an altered distribution of calreticulin, which appeared to accumulate at discrete sites of the plasma membrane on B16 cells (Figure 4C). To determine whether the increase in Hsp70 expression also correlated with an increased membrane presence of this protein, non-permeabilized CD45-TRP-1+B16 melanoma cells were stained for Hsp70 and cell surface expression after LOFU treatment was assessed by FACS. This analysis confirmed that LOFU treatment of B16 melanoma caused an increased membrane presence of Hsp-70 in tumor cells (Figure 4D).

[0146] LOFU treatment of melanoma tumors enhances dendritic cell-mediated tumor antigen presentation to induce stronger CD4+ T cell responses: To determine the possibility that LOFU treatment of tumors may result in an increased stimulatory capacity of endogenous dendritic cells, we directly tested whether lysates prepared from LOFU-treated mice induce increased stimulation of antigen-specific T cells to generate more robust effector responses. For this experiment, B16-F1-OVA melanoma cells were used to induce tumors in C57BL / 6 mice. Lysates were prepared from untreated and LOFU-treated tumors. Splenic dendritic cells and responder naive CD4+ T cells were isolated from C57BL / 6 and OT-II tumor-free mice, respectively, and co-cultured in the presence or absence of the different tumor lysates described above. Although OVA containing tumor lysates could act as a source of tumor antigens to stimulate responder T cells, exogenous OVA323-339 peptide was also added to ensure uniform loading of dendritic cells with this peptide under all conditions to more precisely determine the tolerogenic or activating properties of the different tumor lysates.

[0147] As expected, control responder OT-II T cells showed a strong response with high levels of IL-2 production after activation by dendritic cells fed with OVA323-339 peptide. However, lysates from untreated tumors significantly inhibited OT-II responses, resulting in a severe reduction in IL-2 production, even when exogenous OVA323-339 peptide was added to the cultures (Figure 5A). Interestingly, in contrast to untreated lysates, lysates from LOFU-treated tumors not only had no negative effect on the response of OT-II cells to OVA323-339, but were also able to induce a strong activation of OT-II responder T cells even in the absence of exogenous peptide (Figure 5A). These results extended further the observation that LOFU treatment of B16 melanoma tumors prevents the negative effects on the T cell stimulatory capacity of dendritic cells that normally occur in the intratumoral microenvironment.

[0148] We next determined whether resident antigen-presenting cells of tumor DLNs would be functionally more effective in activating target T cells following LOFU treatment of melanoma tumors. To this effect, B16-F1 melanomas were induced in C57BL / 6 mice and left untreated or treated with LOFU. DLN cell suspensions were depleted of T cells and used to test the ability of DLN antigen-presenting cells to activate tumor antigen-specific live T cells. Thus, T cell-depleted DLN cells were co-cultured for 24 h with naive Tyrp1 CD4+ T cells and lysates prepared from in vitro cultures of B16. IL-2 production was measured by ELISA to monitor the stimulation of responder T cells. Cells isolated from DLNs of tumor-bearing mice treated with LOFU showed a significantly increased ability to activate Tyrp1 CD4+ T cells compared to cells isolated from untreated mice (Figure 5B). These data support that LOFU treatment of B16 melanoma results in the generation of antigen-presenting cells that are functionally more effective in activating tumor antigen-responder T cells.

[0149] LOFU followed by tumor resection with hypofractionated IGRT resulted in enhanced T cell-mediated control of primary melanoma lesions: To further validate the observation that LOFU treatment can modulate tumor immunogenicity and enhance antitumor immune responses, a series of in vivo treatment strategies evaluating primary tumor control was performed using LOFU with or without tumor resection using daily hypofractionated IGRT of 10 Gy up to a total dose of 30 Gy per mouse bearing established B16-M1 tumors located subcutaneously in the right dorsal hind limb. 3 Treatment was initiated for all mice when tumor volumes reached 62 days. Tumor volumes in each group were then measured three times a week for up to 62 days (Figure 6A). Only untreated C57BL / 6 or LOFU-treated mice continued to experience rapid primary tumor growth, reaching ≥300 mm within 10 days of treatment. 3The tumors reached a volume of >300 mm at which point a below-the-knee amputation (BKA) was performed (Figure 6A). In contrast, mice in the hypofractionated IGRT or LOFU+IGRT groups experienced significant growth delay for up to 3 weeks after treatment, after which mice treated with IGRT alone began to show regrowth of the primary tumor, reaching >300 mm in approximately 5 weeks. 3 The tumor volume reached 100%. Remarkably, mice in the LOFU+IGRT group had a sustained response, with tumor growth restricted for more than 6 weeks after treatment. The reduction in tumor volume in the groups receiving LOFU+IGRT or IGRT was statistically significant (P<0.05) up to day 25 compared to the untreated or LOFU only groups. Furthermore, the reduction in tumor volume in the LOFU+IGRT group was statistically significant (P<0.05) up to day 35 compared to IGRT only, and remained statistically significant over the duration of the experiment (Figure 6A). In addition, mice in the LOFU+IGRT group demonstrated tumor regression from baseline measurements, with complete tumor-free responses confirmed in 4 of 5 mice.

[0150] To confirm the immunomodulatory effect of LOFU, similar experiments were performed using an immunocompromised BALB / c nude model. In these mice, B16-M1 tumors grew very rapidly, reaching ≥300 mm approximately 1 week faster than in C57BL / 6 mice. 3 The overall treatment response was similar, with untreated and LOFU alone not resulting in significant primary tumor control, while IGRT and LOFU+IGRT delayed primary tumor growth (Fig. 6B). However, primary control was short-lived in both IGRT and LOFU+IGRT treatments. In fact, BKA was required in the IGRT group 2 weeks after the start of treatment, and in the LOFU+IGRT group less than 3 weeks. In addition, LOFU+IGRT in immunocompromised mice failed to result in statistically significant primary tumor control when compared with IGRT alone (Fig. 6B).

[0151] LOFU followed by hypofractionated IGRT results in prolonged recurrence-free survival and reduced lung metastases: Based on the data, the enhanced antitumor T cell response induced by LOFU may augment therapeutic IGRT to achieve better control of not only local disease but also microscopic disease and distant metastases. B16-F10 is an aggressive cell line that grows rapidly to unacceptable sizes if not treated, so the treatment is limited to patients with >300 mm 3 Mice bearing primary tumors of 10-20% required BKA. Notably, by the time BKA was performed, cells from the primary tumor had already spread to the draining popliteal LNs (data not shown). Within the following weeks, the draining popliteal LNs grew rapidly and became visibly larger, while the more distal inguinal LNs became clearly palpable. Once the tumors reached this point, no procedures could be performed to alleviate the discomfort, and these mice were sacrificed. Consequently, overall survival cannot be adequately assessed in mice bearing large tumor burdens. It was therefore decided to evaluate two other parameters: recurrence-free survival, where animals that died naturally or were sacrificed with excessive local recurrent tumor burden were recorded as positive events; and progression of pulmonary metastases.

[0152] The combination of LOFU+IGRT conferred a statistically significant (P=0.04) recurrence-free survival advantage over either treatment alone in C57BL / 6 mice (Figure 6C). Strikingly, in all groups except C57BL / 6 LOFU+IGRT, local metastases to the draining popliteal or inguinal LNs frequently necessitated the use of sacrifice. Furthermore, mice treated with LOFU+IGRT showed strict control of pulmonary metastases, whereas in the other three groups, even animals with relatively small local recurrences ultimately succumbed to overwhelming pulmonary metastases (Figure 6D).

[0153] <Consideration> The adaptive immune system constantly surveys malignantly transformed cells. This is primarily achieved by the recognition of tumor-associated antigens, which stimulate the appropriate T cell repertoire to initiate an antitumor immune response. However, tumors also utilize diverse mechanisms to evade the adaptive immune system and thwart antitumor T cell responses (1). As a result, successful treatments for cancer must overcome the major obstacle of tumor-induced resistance (36). Various mechanisms have been described to explain how tumors induce resistance in different T cell subtypes, including defective presentation of tumor antigens and inappropriate activation of antigen-presenting cells, signaling through co-inhibitory receptors, immune suppression by factors released within the tumor microenvironment, and local recruitment of suppressor cells (9, 15-17, 20, 37-39). Treatments that promote immunogenic cell death (ICD) of cancer cells can attenuate resistance and drive its reversal. Hallmarks of ICD include the release of damage-associated molecular patterns (DAMPs), translocation of specific chaperone complexes to the cell surface, and increased dendritic cell-mediated cross-presentation of tumor-associated antigens (40). In this study, we sought to determine whether a novel treatment of melanoma using non-ablative LOFU would result in the prevention, reversal, or mitigation of tumor-induced resistance and therefore an enhancement of the antitumor immune response.

[0154] While thermal ablative HIFU can control primary tumors, it is typically ineffective at preventing micrometastatic invasion in surrounding or distant tissues, suggesting that cell death caused by this FUS modality does not sufficiently stimulate adaptive antitumor immune responses. Indeed, local or distant micrometastatic invasion may be prevented or ameliorated by a sufficiently stimulated immune system capable of eliminating the relatively small tumor burden of cells that escape the initial ablative treatment. In this study, using a B16 mouse melanoma model, we show that the use of nonablative LOFU treatment enhances T cell effector responses by overcoming the tolerizing effect of the intratumoral microenvironment and prevents local recurrence and distant metastasis when administered prior to ablative treatment.

[0155] The development of T cells hyporesponsive to tumor antigens has been described in various mouse tumor models and in T cells in human cancers (15, 18, 41). This laboratory has previously reported that tumor antigen-specific CD4+ T cells express a series of anergy-related genes that have been shown to render tumor-bearing mice anergic and impede their ability to proliferate and produce effector cytokines (21, 42). Furthermore, two transcription factors that contribute to the expression of genes that induce anergy (43-45), prevention of the expression of these genes in mice lacking NFAT1 or Egr2 leads to inhibition of tumor antigen-specific T cell hyporesponsiveness and improved control of local tumor growth (19, 21). Using two different B16 mouse melanoma models, data confirmed that resident tumor antigen-specific CD4+ T cells in tumor DLN upregulate the expression of anergy-related genes, including Grail, Itch, Cblb, Grg4, and Egr2. Activation of this program of gene expression correlated well with a decreased ability to produce cytokines after ex vivo restimulation, supporting that B16 melanoma induces an inherent state of hyporesponsiveness in tumor antigen-specific CD4+ T cells. Importantly, treatment of primary tumors with LOFU resulted in an increased ability of those tumor antigen-specific CD4+ T cells to produce cytokines after restimulation. US-induced restoration of responsiveness to TCR engagement was accompanied by a reduction in the expression of most anergy-inducing genes to different extents in otherwise anergic cells. However, the lack of FUS-induced changes in Foxp3 transcripts in resident CD4+ T cells of DLN in tumor-bearing mice suggests that FUS does not affect migration or differentiation of Foxp3+ Tregs and that LOFU prevented tumor-induced tolerance by inhibiting T cell anergy.

[0156] Early investigations into tumor-induced T cell anergy identified the important role played by antigen-presenting cells in this process, and incomplete dendritic cell maturation was defined as the main determinant of inefficient stimulation of tumor antigen-specific T cells (20, 46). Recently, it has been shown that unstable immunological synapses formed between T cells and tumor antigen-presenting dendritic cells result in delayed nuclear export of NFAT and possible activation of a tolerogenic NFAT-dependent program of gene expression, including Egr2 (47). The increased T cell activation following LOFU treatment of B16 melanoma could potentially result from a variety of different phenomena. First, treatment of tumors with LOFU conveys both thermal and mechanical stress to tumor cells. This stress can support the generation of new unique “non-self” tumor antigens, which in turn may render tumors more immunogenic and less able to induce tolerance. Alternatively or additionally, the release of stress-induced danger signals by tumor cells can generate an intratumoral microenvironment in which targeting dendritic cells proves less conducive to inducing tolerance in T cells. Stress-related molecular chaperones, including heat shock proteins and calreticulin, have been implicated in dendritic cell maturation and enhanced antitumor immunity (32, 48-51). There is evidence that primary tumor lysates are enriched in heat shock proteins that can trigger maturation signals in dendritic cells (52). Importantly, heat shock proteins can also bind and deliver antigenic peptides from tumor cells to dendritic cells, and their presence in the plasma membrane of tumor cells has been associated with enhanced immune responses (53-55). Calreticulin has also been described to play an important role in antitumor responses, and its translocation to the surface of tumor cells has been associated with increased phagocytosis of cells by dendritic cells and immune activation (56, 57). Previous studies using HIFU in a mouse adenocarcinoma model showed that this treatment significantly increased the expression of costimulatory molecules on dendritic cells, which in turn produced higher levels of IL-12 and consequently increased CTL activity (58, 59).The data show that LOFU induces a redistribution of calreticulin in B16 cells and an increase in the expression of the inducible heat shock protein Hsp70, suggesting that LOFU-mediated cellular stress can induce changes in the expression of such stress-induced proteins. Although no significant differences in the expression of MHC-II or B7 proteins were detected, it cannot be ruled out that LOFU may also induce other changes in dendritic cell function that may contribute to the enhanced effective presentation of tumor antigens. In any case, the data support that the thermal / mechanical stress imposed by LOFU is likely due to the enhancement of tumor immunogenicity and the promotion of anergic T cell activation.

[0157] Tumor antigen-induced T cell tolerance remains a major obstacle in the treatment of cancer. Effective reversal of tolerance in tumor-specific T cells is an important goal in clinical antitumor strategies. Data have found that lysates prepared from LOFU-treated melanoma tumors can reverse pre-established anergy in T cells. This observation opens the possibility that LOFU treatment of tumors can release new immunogenic molecules from tumor cells that not only prevent but also reverse pre-established tumor tolerance in T cells. Signaling through the IL-2 receptor has long been known to prevent and reverse clonal anergy in T cells (60-62). However, elevated amounts of IL-2 could not be detected in either untreated or LOFU-treated lysates (data not shown), making the presence of IL-2 an unlikely candidate for causing the reversal of anergy in this experiment. However, it is possible that other factors may contribute to this phenotype. Indeed, costimulation of T cells with the TNFR family member OX-40 ligand has also been shown to prevent and overcome T cell anergy, in addition to enhancing effector responses of both CD4+ and CD8+ T cells (63-65). Binding of CD137, CD40, and blockade of PD1 have also been reported to prevent and reverse pre-established CD8+ T cell tolerance in vivo (66-68).

[0158] Pretreatment of melanoma tumors with LOFU prior to ablative treatment using hypofractionated IGRT resulted in significant delay of tumor growth, and in various cases, complete tumor regression was observed only in immunocompetent mice. Recurrence-free survival of these mice was also significantly improved following the protocol. In addition, the incidence of lung metastases was minimal in mice that underwent LOFU prior to tumor resection, compared to mice that received ablative IGRT alone. Remarkably, LOFU did not provide similar protection when a similar experiment was performed in T-cell-deficient nude mice. This observation indicates that the protective effect of LOFU is not only limited to controlling the primary tumor, but can also prevent the establishment of metastatic foci, either locally or distantly. Such protection from metastasis could possibly result from the prevention / reversal of T-cell tolerance to tumor antigens, or both. Pretreatment with LOFU not only controlled tumor growth more effectively, but also likely led to the generation of potently immunogenic IGRT-induced tumor death, which, as shown previously, provided protection from metastasis and ensured longer recurrence-free survival.

[0159] Prevention of T cell tolerance to endogenous tumor antigens is of paramount importance in treating cancer. The studies herein show that treatment of primary tumors with LOFU can achieve this, making it a candidate therapy for the development of in situ autologous tumor vaccines. FUS treatment of solid tumors, in combination with resection methods, may prove to enhance the effect of primary tumor eradication as well as the prevention of metastasis.

[0160] Methods and Materials

[0161] Mice: 6-8 week old C57BL / 6, B6.Cg-RagltmlMomTyrplB-wTg(TcraTcrb)9Rest / J(Tyrpl) and B6.Cg-Tg(TcraTcrb)425Cbn / J(OT-II) mouse strains were purchased from The Jackson Laboratory. BALBc / nude mice were obtained from the National Cancer Institute via the Charles River. All mice were housed and maintained in a pathogen-free facility.

[0162] B16 cell lines and primary CD4+ T cell culture: B16-F1 and B16-F10 melanoma cell lines were purchased from the American Type Culture Collection (ATCC). A highly aggressive subclone of B16-F10 (B16-M1) was generated by isolating and expanding a metastatic clone that arose in C57BL / 6 mice 6 weeks after surgical resection of an established primary tumor. The B16-OVA melanoma cell line was kindly provided by EM Lord (University of Rochester Medical Center, Rochester, NY). Expression of OVA by B16-OVA cells was confirmed by real-time PCR. All melanoma cells were cultured in DMEM (Thermo Scientific) supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, and 250 IU penicillin / streptomycin.

[0163] CD4+ T cells were isolated using anti-CD4-conjugated magnetic Dynabeads (Life Technologies) according to the manufacturer's protocol. As indicated here, CD4+ T cells were incubated with plate-bound anti-CD3Σ (clone 2C11; 10 μg / ml) in the presence of mouse IL-12 (10 ng / mL) (eBioscience), anti-mouse IL-4 antibody (clone 11C.11; 10 μg / ml), and 10 U / mL recombinant human IL-2 (Biological Resources Branch of the National Cancer Institute).

[0164]

number

[0165]

number

[0166]

number

[0167] Tumor model: 3 × 10 cells suspended in Hank's balanced salt solution (Invitrogen) 5 B16-F1 melanoma cells were injected subcutaneously into the lumbar flank of the mice. 2 × 10 5 Melanoma tumors were induced in the footpad by injection of B16-M1 cells.

[0168] Tumor growth monitoring: Primary B16-M1 melanoma dorsal hindlimb tumors were measured three times a week with a vernier caliper. Tumor volume was calculated using the formula for an ellipsoid: V = (π / 6 x length x width x height). Primary dorsal hindlimb tumors ranged from 30-50 mm 3 Stage I volume: 90-150mm 3 and 300-500mm 3 The treatment effect was therefore evaluated as 90-150 mm 3 The tumors are determined by determining the tumor growth delay (TGD) from 300-500 mm 3 Tumors reaching the peritoneal cavity begin to enter phase III due to anatomical and vascular limitations. Consequently, below-knee amputations are performed according to IACUC-approved protocols for tumors >300-500 mm. 3 The study was performed on mice bearing tumors of the same species.

[0169] ELISA: 1.5-2.5×10 4 T cells were either left resting or stimulated with anti-CD3Σ+ anti-CD28 antibodies, T cell-depleted splenocytes fed with OVA peptide 323-339 (OVA323-339) at a T cell:splenocyte ratio of 1:5, or CD11c+ purified dendritic cells (using CD11c- beads; Miltenyi Biotech) fed with OVA323-339 or melanoma tumor lysate at a dendritic cell:T cell ratio of 1:3. Culture supernatants were typically harvested 24 hours after stimulation, and levels of IL-2 or IFN were measured by sandwich ELISA (BD Biosciences).

[0170] Tumor lysates: Tumors were excised from tumor-bearing mice and cut into 1-2 mm pieces.

[0171]

number

[0172] Immunofluorescence staining. Tumor tissues were separated, washed in PBS, and embedded in OCT compound (ElectronMicroscopy Sciences). Tissue sections (5 μm) were prepared, permeabilized with acetone for 5 min, and incubated with goat serum for 30 min to block nonspecific protein-protein interactions. Tissue sections were incubated overnight with the following antibodies: anti-calreticulin (Pierce, PA5-25922), anti-Trpl (Abeam, ab3312; clone TA99), and anti-Hsp70 (Novus Biologicals, NBP1-77455). Appropriate secondary antibodies were used for 30 min at room temperature. Nuclei were detected using DAPI (Invitrogen). At least 10 fields / sample were analyzed blindly on an Inverted Olympus 1X81 fluorescent microscope.

[0173] Focused ultrasound therapy system. A treatment and imaging probe system (TIPS, Philips Research North America, Briarcliff Manor, NY, USA) was utilized for all ultrasound exposures. The system is capable of delivering focused and spatiotemporally controlled ultrasound energy and consists of a treatment control workstation, an RF generator and control electronics, an eight-element spherical shell annular array ultrasound transducer (80 mm radius of curvature, 80 mm aperture), as well as a translation stage that allows transducer motion in-plane and precise positioning perpendicular to the ultrasound beam axis. The focused ultrasound beam can also be steered approximately ±15 mm out-of-plane using electronic deflection of the focal spot. The ultrasound beam is spread perpendicularly to the target through a thin (25 μm) circular plastic membrane, and acoustic coupling is provided by degassed water. During treatment, the system allows adjustment of acoustic output power, ultrasound exposure duration, duty cycle, and ultrasound frequency.

[0174] In vivo focused ultrasound (FUS) therapy. Mice were anesthetized with a continuous flow of 1.5 liters / min of 1.5% isoflurane in pure oxygen. The tumor-bearing leg or lumbar flank was carefully shaved to ensure proper acoustic coupling. Once the animal was positioned for treatment, the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel. The center of the tumor was then placed at a focal distance of 80 mm from the transducer. Ultrasound exposure was delivered to the tumor using a 1 mm grid pattern that extended across the entire tumor volume. Two layers of grid points (spaced 5 mm apart) were placed in each tumor, resulting in approximately 160 discrete foci per tumor and a 5-minute exposure period. The ultrasound transducer was operated at 1.0 MHz, resulting in an elliptical focus of approximately 1.5 mm in diameter and 12 mm in length (at -6 dB pressure) as measured along the elliptical axis. Ultrasound exposure was delivered to the tumor using a 1 mm grid pattern extending across the entire tumor volume. Prior to treatment, tumor volume was measured to calculate the grid size for a particular treatment. The duration of ultrasound exposure at each grid point was 1.5 seconds, after which the transducer was automatically positioned on the next grid point and the procedure was repeated until the entire tumor volume was covered. Two layers of grid points were provided in each tumor. The therapeutic ultrasound device was operated in continuous wave mode with a specific acoustic power / pressure regime: acoustic power 3 W, peak negative pressure = 2.93 MPa (focal length of 80 mm) / 3.81 MPa (focal length of 85 mm), resulting in non-ablative low-energy FUS (LOFU). The resulting in situ density (Ispta) at the focal point was 550 W / cm at a depth of 4 mm in tissue. 2 The total energy delivered to the tumor was estimated to be approximately 900 J.

[0175] In vivo hypofractionated cone-beam CT image-guided radiation therapy (IGRT): All radiation was delivered using Xstrahl Limited's Small Animal Radiation Research Platform (SARRP) to deliver a dose of 10 Gy to the target tumor in 341 seconds. Anesthetized animals were placed on a stage attached to a motorized platform and the tumor-bearing right hind limb was extended, elevated, and immobilized to a 1.5 cm adhesive platform to minimize external tissue exposure. Once immobilized, cone-beam computed tomography (CBCT) was performed and data were opened in a 3D slicer for tissue segmentation and treatment planning. 10 Gy was delivered on three consecutive days for a total hypofractionated dose of 30 Gy. In the combined therapy group, LOFU was performed 2-4 hours before CBCT.

[0176] Assessment of pulmonary metastases: Lungs were isolated from animals that died spontaneously, were euthanized, or were sacrificed at the end of the 8-week experiment. Lungs were insufflated with 1 mL of Fekete's solution (ethanol, glacial acetic acid, and formaldehyde-based bleach-fix solution). The trachea was then clamped, and the lungs and heart were removed en bloc and washed with PBS. Lungs were then placed in Fekete's solution and bleached for 48 h before analysis. The left lung and the four lobes of the right lung were separated and nodules were counted with the aid of a dissecting microscope. Indistinct or confluent nodules could not be reliably counted; therefore, lungs were labeled as too numerous to be taken into account and assigned an arbitrary number of metastases of 250. Statistical analysis was performed using the nonparametric Kruskal-Wallis test, followed by Dunn's posttest for multiple comparisons.

[0177] Recurrence-free survival: The following events were scored as positive events in our recurrence-free survival analysis: spontaneous death due to necropsy confirmation of tumor lesions, euthanasia due to extensive local metastasis to draining popliteal or inguinal lymph nodes, or euthanasia due to moribundity indicative of extensive systemic tumor burden. The following non-tumor-dependent deaths were treated as censored data: death within 24-48 hours of amputation or sacrifice of any animal at the end of the 8-week experiment. To prevent selective sacrifice of control or treated animals, cages were labeled using an alphanumeric code such that the animal laboratory veterinarian was blinded from the treatment and control groups. Recurrence-free survival was analyzed using the Mantel-Cox test, and statistical significance was defined as P<0.05.

[0178] Real-time PCR: Total RNA was extracted from cells using the RNeasy Micro kit (Qiagen) and cDNA was synthesized using qScript cDNA supermix (Quanta Biosciences). cDNA samples were subjected to real-time PCR using PowerSYBR (Applied Biosystems) as the reporter dye on a StepOnePlus real-time PCR system (Applied Biosystems). Expression of the tested transcripts was normalized to beta-actin. The primer sets used were: actinb:F-GTGACGTTGACATCCGTAAAGA(SEQ ID NO:1), R-GCCGGACTCATCGTACTCC(SEQ ID NO:2); Cblb:F-GCAGCATCATTGACCCTTTCA(SEQ ID NO:3), R-ATGTGACTGGTGAGTTCTGCC(SEQ ID NO:4); Grail:F-ATGCAAGAGCTCAAAGCAGGAAGC(SEQ ID NO:5), R-GTGCGCAGCTGAAGCTTTCCAATA(SEQ ID NO:6); Ikaros:F-GCTGGCTCTCGGAGGAG(SEQ ID NO:7), R-CGCACTTGTACACCTTCAGC(SEQ ID NO:8); Caspase3:F-ACGCGCACAAGCTAGAATTT(SEQ ID NO:9), R-CTTTGCGTGGAAAGTGGAGT(SEQ ID NO:10); Egr2:F-TCAGTGGTTTTATGCACCAGC(SEQ ID NO:11), R-GAAGCTACTCGGATACGGGAG(SEQ ID NO:12); Grg4:F-TCACTCAAGTTTGCCCACTG(SEQ ID NO:13), R-CACAGCTAAGCACCGATGAG(SEQ ID NO:14); Itch:F-GTGTGGAGTCACCAGACCCT(SEQ ID NO:15), R-GCTTCTACTTGCAGCCCATC(SEQ ID NO:16); Foxp3:F-GGCCCTTCTCCAGGACAGA(SEQ ID NO:17); R-GCTGATCATGGCTGGGTTGT(SEQ ID NO:18).

[0179] Flow cytometry: Cells were preblocked with Fc-blocking (CD16 / CD32) antibodies before immunostaining. The following fluorochrome-conjugated antibodies were used: anti-B7.1, B7.2, CD11c, MHC-II, CD45, as well as their respective isotype control antibodies (eBiosciences); anti-Hsp70 (Novus Biologicals) and anti-TRP1 (Abcam). Dead cells were detected by using UV LIVE / DEAD Fixable Dead Cell Stain kit (Invitrogen). Immunostained cells were analyzed on an LSR-II Flow Cytometer (Becton Dickinson) and post-acquisition analysis was performed using FlowJo software.

[0180] Example 2 A hypoxic tumor microenvironment results in oxidative endoplasmic reticulum (ER) stress, which in turn leads to protein misfolding and the unfolded protein response (UPR). The UPR induces several molecular chaperones, including heat shock protein 90 (HSP90), that correct protein misfolding and improve cancer cell survival and resistance to tumoricidal treatment, whereas prolonged activation of the UPR induces cell death. The HSP90 inhibitor, 17AAG, has shown promise against various solid tumors, including prostate cancer (PC). However, therapeutic doses of 17AAG elicit systemic toxicity. Herein, a new paradigm is disclosed, in which combination therapy of non-ablative and non-invasive low-energy focused ultrasound (LOFU) with non-toxic low doses of 17AAG causes synthetic lethality and significant tumoricidal effects in mouse and human PC xenografts. LOFU induces ER stress and UPR in tumor cells without inducing cell death. Treatment with a non-toxic dose of 17AAG further increased ER stress in LOFU-treated PCs and switched the UPR from a cytoprotective response to an apoptotic response in tumors, resulting in significant induction of apoptosis and tumor growth retardation. LOFU-induced ER stress renders ultrasound-treated tumors more sensitive to chemotherapeutic agents such as 17AAG. LOFU-induced chemosensitization is a new treatment that can be used against tumors, for example, locally advanced and recurrent tumors.

[0181] Treatment plan and toxicity of LOFU and 17AAG treatment: For each grid location, LOFU was administered for 1.5 seconds using a 100% duty cycle, acoustic power of 3 W, and an ultrasound frequency of 1 MHz. The protocol consisted of 270 W / cm 2This resulted in an in situ spatial-peak time-averaged acoustic density of approximately 1.2 mg / kg, resulting in a predicted mean intratumoral temperature increase of 3.2°C. There were no signs of normal tissue toxicity, such as hair loss, thermal damage, or skin wounds, following treatment. Preclinical pharmacokinetic studies in mice showed that 17AAG is widely distributed and undergoes extensive hepatic metabolism. Systemic administration of 17AAG is known to be associated with significant hepatotoxicity, characterized by increases in transaminases and bile acids, and drug-related histopathological lesions in the gallbladder, common bile duct, and gastrointestinal tract. Therefore, a dose of 17AAG that was non-toxic for our treatment was determined. C57Bl / 6 mice were treated with intraperitoneal injections of 17AAG (25-75 mg / kg body weight) three times per week. Control mice were injected with an equivalent volume of the vehicle DMSO, which was used to make 17AAG soluble. Higher dose 17AAG (50-75 mg / kg of body weight) treatment achieved significant tumor growth retardation compared to untreated controls (untreated tumors, 1879 ± 98.65 mm, respectively). 3 17AAG 75mg / kg body weight (bw), 485±24.25mm 3 , p<0.003 and 50 mg / kg bw, 964 mm 3 and p<0.007), but the Kaplan-Meier method showed death in 50% of mice after 21 days of treatment at a dose of 75 mg / kg of body weight.

[0182] The low doses of 17AAG that were found to be non-toxic were 25 mg / kg in C57Bl / 6 mice and 14 mg / kg in Balb / c nude mice. Therefore, these dose levels were selected for the current study. The aim was to combine two treatments that are sub-therapeutic but non-toxic, and to test whether the combination could be therapeutic. LOFU+17AAG combination treatment amplifies ER stress: the accumulation of misfolded proteins in the ER triggers a stress response with the induction of chaperone proteins that help correct protein misfolding. To detect the level of ER stress, the expression levels of ER chaperones, ERp44, ERp57, and ERp72, were quantified among the different treatment groups. ERp44 is responsible for oxidative protein folding

[69] . ERp57 is an ER-resident disulfide oxidoreductase

[70] , while Erp72 is a disulfide isomerase. All these proteins are involved in the protein folding mechanism in the ER. Compared with tumor tissues from animals that received no treatment or LOFU or 17AAG alone, immunoblot analysis demonstrated a significant increase in the expression of protein levels of ERp78 (p<0.03, Figures 7D and 7E), ERp44 (p<0.05, Figures 7D and G), and ERp57 (p<0.04, Figures 7D and F) in tumor tissues after combination therapy with LOFU+17AAG, suggesting that 17AAG-mediated inhibition of HSP90 may increase the unfolded protein load in the ER, thereby prolonging ER stress.

[0183] LOFU+17AAG activates the proapoptotic pathway of UPR and induces apoptosis in mouse and human prostate cancer tissues: ER stress simultaneously activates the three arms of UPR, thereby simultaneously generating antagonistic cytoprotective and apoptotic signals. The fate of a cell depends on the ability of its protein corrective mechanisms to reduce ER stress, thereby attenuating UPR. If ER stress persists, the cytoprotective pathways are eventually overwhelmed with chronic activation of the PERK-mediated apoptotic pathway, which leads to cell death. Since phosphorylation of PERK at Thr980 serves as a marker for its activation state, we performed immunoblot analysis that showed a significant increase in pPERK levels in tumor tissues after treatment with 17AAG (Figure 8A). Phosphorylated PERK levels were absent in untreated and LOFU-treated tumors. However, combination therapy of LOFU+17AAG showed the highest level of PERK phosphorylation (Figure 8A).

[0184] Because prolonged PERK activation attenuates protein synthesis in response to ER stress through phosphorylation of the translation initiation factor eIF2a at serine 51, the levels of phosphorylated eIF2α were determined. Treatment of RM1 tumors with 17AAG induced phosphorylation of eIF2α above basal levels in untreated controls. LOFU treatment resulted in a slight decrease in phosphorylated eIF2α levels. However, the highest levels of phosphorylated eIF2α were found in tumors that received combination therapy with LOFU+17AAG (Figure 8B), corroborating the highest activation of PERK phosphorylation in these tumors compared to the other groups.

[0185] Phosphorylated eIF2α reduces the translation of most cellular proteins, including pro-survival and anti-apoptotic proteins, but increases the translation of ATF4, a transcription factor responsible for inducing the transcription of pro-apoptotic genes, such as CCAAT / enhancer-binding protein homologous protein (CHOP), thereby preparing cells for programmed cell death if misfolded proteins are not repaired and ER stress persists

[71] . As expected, LOFU treatment failed to induce CHOP levels (1.6 ± 0.7-fold) over untreated controls. In contrast, treatment with 17AAG alone induced CHOP transcript levels by 14.8 ± 2-fold, which was further increased by 25 ± 1.3-fold (p < 0.006) in the LOFU + 17AAG combination therapy group compared to untreated controls (Figure 8C).

[0186] To examine whether downstream apoptotic genes were expressed after CHOP induction by LOFU+17AAG combination therapy, mouse UPR qRT-PCR Array was used on total RNA isolated from tumor tissues of various treatment groups. Heatmap analysis demonstrated that proapoptotic target genes, such as Bax, Vcp, Pdia3, Armet, Ddit3, Mapk8, Mapk9, and Mapk10, were induced several-fold after LOFU+17AAG combination therapy compared to untreated controls (Figure 8D). Treatment with LOFU alone or 17AAG alone resulted in minimal induction of proapoptotic genes. This result indicates that LOFU+17AAG combination therapy activates PERK, induces CHOP, and switches on the proapoptotic pathway of UPR. Indeed, TUNEL staining demonstrated that LOFU induced minimal apoptosis over untreated controls. Treatment with 17AAG induced significant apoptosis in prostate tumors, which was further increased by LOFU (p<0.004) (Figure 8E). Thus, 17AAG-mediated inhibition of HSP90 and activation of CHOP by the combination of LOFU+17AAG switched on apoptotic cell death in prostate tumors. LOFU+17AAG inhibits chaperone-mediated autophagy (CMA) in tumor cells.

[0187] The degradation of misfolded proteins is mediated by the proteosome pathway and autophagy. Autophagy has been implicated in the tumorigenesis process in a context-dependent role, where it may provide amino acids and other essential nutrients to the metabolic pathways of nutrient-deficient, hypoxic tumors

[72] . In fact, increased CMA activity has been found in a wide variety of human tumors, and CMA has been implicated in tumor cell survival, proliferation, and metastasis

[73] . Therefore, we quantified the levels of two key proteins involved in autophagy, namely, beclin, a marker of macroautophagy, and LAMP-2A lysosomal receptor, a marker of CMA, in tumor tissues of different treatment cohorts. As shown in Figure 10, the levels of beclin remained unchanged with LOFU or 17AAG, or combination therapy (Figure 9A and C), indicating that macroautophagy was not altered with ultrasound therapy. However, LOFU alone or 17AAG alone induced the expression of LAMP-2A (Figure 9A and B), indicating a compensatory increase in CMA after treatment that increases the load of misfolded proteins in the ER. Interestingly, the combination of LOFU+17AAG inhibited the levels of LAMP-2A below the basal levels seen in these tumors. This suggests that the combination therapy reduces tumor cell proliferation and induces apoptosis by increasing ER stress while suppressing CMA.

[0188] LOFU sensitizes human and mouse prostate cancer xenografts to non-toxic low doses of 17AAG: treatment with LOFU alone or low doses of 17AAG (25 mg / kg body weight) alone showed no toxic effects on normal tissues but failed to inhibit tumor growth. However, combination therapy of LOFU+17AAG reduced the growth of murine RM1 tumors (Figure 10B). The mean estimated tumor growth was 5% (p<0.0001), 9% (p<0.0001), and 11% (p<0.0001) slower in the LOFU, 17AAG, and LOFU+17AAG cohorts compared to the control group. Tumor size 2000 mm in control, LOFU, and LOFU+17AAG 3The median times to achieve this size were 18, 22, and 42 days, respectively. All animals in the 17AAG group achieved that size within the 26-30 day time interval.

[0189] A similar degree of chemosensitization was observed in human PC3 tumors in BalbC nu / nu mice by applying LOFU together with a non-toxic low dose of 17AAG (14 mg / kg of body weight), achieving significant tumor growth retardation (p<0.007) without immediate adverse side effects (Figure 5C).

[0190] LOFU+17AAG treatment reduces prostate cancer stem cell population in tumor tissue: The effect of LOFU+17AAG-induced ER stress on PC stem / progenitor population was assessed by flow cytometry analysis of PC stem / progenitor cell surface markers [24, 25]. The percentage of cells expressing cell surface SCA1 (Figure 11A and B) (p<0.004), CD44 (Figure 11A and C) (p<0.003), CD133 (Figure 11A and D) (p<0.007), and α2β1 integrin (p<0.005) (Figure 11A and E) was significantly reduced in the combination therapy group compared to control or single treatment cohorts. The mean fluorescence intensity (MFI) of all these markers remained unchanged in all three groups. qRT-PCR arrays of stem cell transcription factors demonstrated increased (>2-fold) mRNA levels of TIx3, Hoxa11, Pcna, Gli2, Runx1, Foxa2, Sp1, Tbx5, Hoxa10, Nfatc1, Gata6, and Notch2 (FIG. 11F), indicating that LOFU induces PC stem cell transcriptional signaling. Treatment with 17AAG also increased the expression of several transcription factor mRNAs present in LOFU-treated tumors, such as FoxP1, Nrf2f, and Pou5f1. However, tumors treated with LOFU+17AAG downregulated the expression of these genes, suggesting that maximizing ER stress by combination therapy may decrease the PC stem / progenitor cell population in tumors.

[0191] <Discussion> The results demonstrate that the combination of LOFU and chemotherapy reprograms the expression of proapoptotic genes in tumors and induces widespread apoptosis in tumor xenografts, resulting in significant tumor growth retardation in mouse and human PC tumors. The effect of LOFU can improve resistance to chemotherapy and achieve chemosensitization.

[0192] Methods and Materials <Animal> Male C57Bl / 6 (NCI-Fort Dietrich, MD, USA) and athymic nude (BalbCnu / nu mice, Jackson Laboratory, Bay Harbor, ME, USA) mice, aged 5–6 weeks, were maintained ad libitum and all studies were performed under the guidelines and protocols of the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.

[0193] Tumor Models and Treatments 1 × 10 5 RM-1 (mouse prostate cancer cell line) and 1 × 10 6 Cells of PC3 (human prostate cancer cell line) were injected subcutaneously. Approximately 10 days later, when tumors were palpable (3-5 mm in diameter), LOFU treatment was initiated. Mice were divided into four groups (n=5 / group): no treatment, LOFU, 17AAG (InvivoGen, San Diego, CA, USA), and 17AAG+LOFU. Palpable tumors were treated with LOFU every 3-4 days for five fractions administered over a 2-week period. Animals received 17AAG three times per week during this time. Measurements of tumor volume were performed twice weekly using calipers, with simultaneous physical assessment of signs of systemic toxicity (malaise and diarrhea).

[0194] <LOFUシステム> A therapeutic and imaging probe system (TIPS, Philips Research North America, Briarcliff Manor, NY, USA) was utilized for all ultrasound irradiations. The system includes, in addition to an 8-element spherical shell annular array transducer (80 mm radius of curvature, 80 mm aperture), a moving stage that enables movement and precise positioning of the transducer. The transducer was operated at 1.0 MHz, resulting in a focal point with a diameter of approximately 1.5 mm and a length of 12 mm (-6 dB pressure) [12, 13].

[0195] <LOFU treatment protocol> On the treatment day, the animals were anesthetized with ketamine and xylazine (7:1 mg / ml for 100 l / mouse, intraperitoneally (i.p.)). Once positioned for treatment, the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel.

[0196] The ultrasound irradiation parameters were as follows: Assuming an attenuation coefficient of 0.5 dB cm-1 MHz-1

[75] , 3 W of acoustic power and a 100% duty cycle, which resulted in an approximate in-situ spatial peak temporal average density (Ispta) of 270 W / cm at an ultrasound treatment depth of 3 mm in tissue

[74] . The ultrasound irradiation was delivered to the tumor using a 2 mm grid pattern that extended across the entire tumor volume. Prior to LOFU, the tumor volume was measured to calculate the grid size for a specific treatment. The duration of LOFU irradiation at each grid point was 1.5 seconds, after which the transducer was automatically positioned onto the next grid point and the procedure was repeated until the entire tumor volume was covered. This resulted in a non-uniform energy delivery to the tumor. 2

[0197] <In vitro temperature rise prediction> Predicting intratumoral temperature by invasive means may unnecessarily modulate the therapeutic effect of combination therapy. Therefore, to predict intratumoral temperature rise using the setup and treatment protocol described above, ultrasound exposures were performed within a 6 mm × 6 mm area in a tissue-mimicking phantom,

[76] where a T-type thermocouple (diameter 200 μm) was embedded at a depth of 3 mm. These in vitro exposures were repeated five times and the results were averaged.

[0198] In situ detection of apoptosis Apoptotic cells were detected in situ by performing TUNEL (TdT-mediated digoxigenin-labeled dUTP nick end labeling) staining. Briefly, paraffin-embedded sections were deparaffinized, rehydrated through graded alcohols, and stained using the ApopTag kit (Intregen Co, Norcross, GA, USA). The proportion of apoptosis in tumor cells was quantified by counting the percentage of apoptotic cells in each high-power field.

[0199] <Immunoblot analysis> Twenty-four hours after LOFU, tumor cells were harvested, washed with phosphate-buffered saline, and lysed using TPER (Thermo Fisher Scientific, Rockford, IL, USA). Cell lysates were subjected to SDS-PAGE, transferred to polyvinylidene difluoride membranes, and immunoblotted with primary antibodies against PERK, pPERK, eIF2, peIF2, ERp72, ERp44, ERp57, Beclin (Cell Signaling, Danvers, MA, USA), Lamp2a (Abcam, Cambridge, MA, USA), and horseradish peroxidase-conjugated secondary antibodies. Blots were developed using an ECL kit (GE Healthcare, Piscataway, NJ, USA). Densitometric analysis of the immunoreactive bands of each blot was photographed, and then the images were digitized and analyzed by using a Gel Doc XR system (Bio-Rad, Hercules, CA, USA).

[0200] Real-time PCR analysis of UPR target genes. Twenty-four hours after LOFU treatment, RM1 tumor cells were lysed using RLT buffer mixed with 1% β-mercaptoethanol from the RNeasy Mini kit (Qiagen, Valencia, CA, USA).

[0201] RNA was isolated from tumor lysates using Qiagen's protocol for the RNeasy Mini kit with on-column DNA digestion. RNA samples were stored at -80°C before further use. Isolated RNA was subjected to cDNA synthesis using the SuperScript™ First-Strand Synthesis System (Invitrogen, Grand Island, NY, USA). Splicing of XBP1 RNA was detected using the following primer pair 5'-ACTCGGTCTGGAAATCTG-3' (SEQ ID NO:19) and 5'-TAGCCAGGAAACGTCTAC-3' (SEQ ID NO:20) (Fisher Scientific, Pittsburg, PA, USA)

[77] . Real-time PCR was performed in a Light Cycler real-time PCR machine (Bio Rad Laboratories, Hercules, CA, USA) using Absolute QPCR SYBER Green Mix (ABgene, Rochester, NY, USA) according to standard ABgene protocols. To confirm the specificity of primer amplification, melting curves were generated at the end of PCR, and different samples containing the same primer pairs showed consistent amplicon melting temperatures.

[0202] Primers used for real-time PCR included GRP78 5'TTGCTTATGGCC TGGATAAGAGGG3' (SEQ ID NO:21) and 5'TGTACCCTTGTCTTCAGCTGTCAC3' (SEQ ID NO:22); EDEM 5'TCATCCGAGTTCCAGAAAGCAGTC' (SEQ ID NO:23) and 5'TTGACATAGAGTGGAGGGTCTCCT3' (SEQ ID NO:24) (Fisher Scientific). All qRT-PCR and real-time PCR experiments were repeated three times. qRT-PCR and PCR arrays for apoptotic genes and stem cell transcription factors were performed by SA Biosciences PCR array system (Frederick, MD, USA) according to the manufacturer's protocol. In brief, RT 2 cDNA was prepared from purified total RNA using the First Strand kit (Qiagen), and then PCR arrays were performed using the SA Bioscience PCR array kit. Data were analyzed by web-based PCR array data analysis software from SA Biosciences.

[0203] <Flow cytometry analysis> Flank tumors were treated with LOFU, 17AAG, and LOFU+17AAG in various cohorts. 24 hours after treatment, tumor cells were isolated by collagenase digestion and analyzed by flow cytometry for the expression of prostate cancer stem cell markers, SCA1, CD44, and CD133. Isolated tumor cells were stained with anti-SCA1 conjugated with FITC (BD Biosciences, La Jolla, CA, USA), anti-CD133 conjugated with pacific blue (eBioscience, San Diego, CA, USA), and anti-CD44 conjugated with PE (BD Biosciences, La Jolla, CA, USA). Data acquisition was performed using an LSRII (BD Biosciences) and analyzed by FlowJo v.7.1 (Treestar Inc, Ashland, OR, USA) software.

[0204] <Kaplan-Meier method> Mouse survival / mortality in the different treatment groups was analyzed by the Kaplan-Meier method according to radiation dose using Sigma-Plot and GraphPad Prism (version 4.0 for OS X, San Diego, CA, USA) software.

[0205] <Statistical analysis> For digital images, sampling areas were randomly selected for digital acquisition for data quantification. Digital image data were evaluated in a blinded manner for all treatments. A two-tailed Student's t-test was used to determine significant differences (p<0.05) between experimental cohorts with representative standard error of the mean (SEM).

[0206] FIG. 12 illustrates an ultrasound stimulation therapy (APT) device, generally designated by reference character (1), in accordance with an exemplary embodiment of the present invention. The APT device (1) is powered by a power source (not shown) and includes a control system (10), an amplifier (12), a matching transformer (14), and a transducer (16). To provide treatment, the ultrasound transducer (16) may be positioned near or within an area of ​​the patient's body (1000). A clinician may use a function generator in the control system (10) to make appropriate adjustments to the frequency and duration of the ultrasound pulses delivered by the transducer (16). When the ultrasound transducer (16) is excited, the transmission surface of the transducer element generates pressure waves in the bodily fluid surrounding the ultrasound transducer (16). The pressure waves then propagate through the fluid and tissue within the patient's body (1000) and ultimately reach the target site, thereby causing non-ablative acoustic stress to the target tissue. As described in further detail herein, sonic stress delivered to tissue can have many therapeutic applications, for example, in the case of cancer therapy, such stress of cancer cells in a tumor can result in modulation of immunogenicity, radiosensitization, and chemosensitization. The ultrasound transducer (16) may be repositioned to adjacent areas of the patient's body for further treatment.

[0207] The matching transformer (14) provides an impedance transformation between the power source and the ultrasonic transducer.

[0208] The amplifier (12) generates a transducer drive signal for driving the transducer (16) based on the output signal of the control system (10). In an exemplary embodiment, the amplifier (12) may be a switched resonant power amplifier, an example of which is disclosed in U.S. Patent No. 7,396,336, the contents of which are incorporated herein by reference in their entirety. In another embodiment, a low impedance ultrasonically driven transducer system may be used

[78] .

[0209] The transducer (16) delivers 10 to 1000 W / cm at the treatment area. 2 The spatial peak time average density (I spta ) of acoustic power. The ultrasound is applied continuously for a time period ranging from 0.5 seconds to 5 seconds, where the frequency is in the range of 0.01 to 10 MHz. In some embodiments, the minimum diameter of the ultrasound beam in the treatment area is about 1 cm.

[0210] In the embodiment shown in Figure 12, the frequency of the ultrasound generated by the APT device 1 is in the range of about 10 kHz to about 300 kHz. However, an APT device according to the present invention may generate higher frequencies, such as, for example, frequencies in the range of about 300 kHz to about 3 MHz. As shown in Figure 13, one embodiment of such an APT device, generally designated by reference numeral (100), may include a control system (110), an amplifier (112), a matching transformer (14), and a transducer (116), such components having the same functions and structures as those described in connection with Figure 12. In an embodiment, the transducer (116) may be a planar or concave piston-type transducer composed of single or multiple elements that convert another type of energy into acoustic energy.

[0211] As shown in FIG. 14, APT device (1) and APT device (100) may be integrated into a single system generally designated by reference character (200) resulting in improved efficacy and / or lower overall energy input. The integrated system (200) provides focused low frequency and collimated high frequency beams for APT treatment. In some embodiments, the low frequency ultrasound is substantially focused according to what is achievable for a given frequency or range of frequencies, and the intermediate frequencies are collimated. In some embodiments, the transducers used to generate the low frequencies are concave and the transducers used to generate the intermediate frequencies are planar.

[0212] As shown in FIGS. 15-17, the APT devices 1, 100, 200 may cooperate with an ultrasonic monitoring system generally designated by reference character 300. The ultrasonic monitoring system 300 may be powered by a power source (not shown) and includes a control system 310, an amplifier 312, and a pulse receiving system 314. The ultrasonic monitoring system 300 may be used to monitor and / or provide imaging of a target tissue before, during, and / or after an APT procedure, and in particular, the pulse receiving system 314 may include a transducer that receives pressure waves reflected from or generated by or within the target tissue, and the amplifier 312 generates an electrical signal corresponding to the received pressure waves. The control system 310 generates an output based on the electrical signal that may be used by a clinician to determine a treatment status and / or other parameters. Although the ultrasound monitoring system (300) is shown as a separate component from the APT devices (1), (100), (200), it should be appreciated that monitoring and APT delivery may be performed by a unitary system.

[0213] In some embodiments, an ultrasound monitoring system (300) is used to provide information about the location of the tissue being treated. One or more non-therapeutic ultrasound transmit and receive subsystems may be used to monitor the APT treatment and the effects of the treatment on the tissue.

[0214] In some embodiments, the data collected and used to plan radiation therapy is also used, at least in part, to plan the ultrasound procedure.

[0215] In some embodiments, the planning of the APT procedure or data collected for the APT procedure is used for planning a radiation therapy. In some embodiments, data collected for planning a radiation therapy is used for planning the APT procedure. In some embodiments, data collected during the APT procedure is used for planning a radiation therapy.

[0216] In some embodiments, ultrasound is applied at a lower frequency to treat specific locations identified in part by ultrasound imaging performed at a higher frequency.

[0217] A variety of ultrasound-based imaging and monitoring modalities may be used to monitor power deposition in tissue during APT procedures. In some embodiments, tissue temperature may be monitored by acoustic means

[79] .

[0218] In some embodiments, ultrasound elastography is used to monitor the treatment. In some embodiments, harmonic imaging is used to monitor the treatment. In some embodiments, thermal strain is measured. In some embodiments, the system is comprised of one or more ultrasound transmit and receive transducer subsystems that are used to measure tissue strain. The tissue strain information may be used to direct the therapeutic ultrasound beam to the desired tissue and, in some embodiments, prior to applying full treatment power to the therapeutic transducers. For example, in one embodiment, power is applied to one or more of the therapeutic transducers at 10-50% of the intended treatment power and the target tissue strain is measured using ultrasound feedback. The APT transducer may be physically or electronically repositioned or effectively oriented to the target tissue based on strain imaging. In some embodiments, full power is applied from one or more transducers for a time that is shorter than the time used for therapeutic effect during the period of strain measurement until desired targeting is confirmed.

[0219] In some embodiments, temperature checks are used to monitor treatment.

[0220] Each transducer of the APT systems (1), (100), (200) may be a single transducer or a series of multiple transducers. FIG. 18 is a perspective view of a transducer, generally designated by reference character (400), according to an exemplary embodiment of the present invention. The transducer (400) includes a series of transducer elements (402). Any number of the transducer elements (402) may be arranged in series along an azimuthal axis. The transducer elements (402) are supported on a backing block (404). Signal leads couple to electrodes of each transducer element (402) and transmit and receive circuitry, as is well known. The transducer elements (402) convert electrical signals provided by the transmit circuitry into pressure waves.

[0221] In some mid-frequency embodiments (about 300 kHz to about 3 MHz), two or more ultrasound transducers generate intersecting ultrasound beams within a treatment zone, referred to herein as the intersecting zone, with each beam generating between 10 and 500 W / cm. 2 Within the intersection zone, I spta In an embodiment, the two transducers generate intersecting ultrasound beams within the treatment zone, each beam having an intensity of 50-500 W / cm. 2 Within the intersection zone, I spta In an embodiment, three transducers generate intersecting ultrasound beams within the treatment zone, each beam having an intensity of 50-500 W / cm. 2 Within the intersection zone, I spta It has.

[0222] In some embodiments, the beams are substantially in phase with each other. In some embodiments, two ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has an intensity of 70-100 W / cm. 2 and the ultrasound is applied continuously for 1-5 seconds, with a spatial peak density of acoustic power in the intersection zone in the range of 50-70 W / cm. In some embodiments, three ultrasound beams emitted from separate ultrasound transducers are substantially the same frequency and in phase, intersect within the treatment zone, and each beam has a spatial peak density of acoustic power in the range of 50-70 W / cm. 2 with a spatial peak density of acoustic power in the intersection zone in the range of 0.1 to 0.5 s, and ultrasound is applied continuously for 1 to 5 s.

[0223] In some embodiments, the beams generated by the separate transducers or transducer elements each have a power output of approximately 300 W / cm in the treatment zone. 2 I spta Generate.

[0224] In some embodiments, the diameter of at least one transducer, and the ultrasound beam emitted from that transducer, is substantially larger than the treatment zone. The use of one or more such large transducers in combination with smaller transducers advantageously allows for less precise targeting of high power, large volume beams while achieving effective and faster treatment.

[0225] In some embodiments, where two or more beams intersect each other, a focused treatment zone is formed that is about 1 cm or more perpendicular to the direction of the transmitted energy and about 1 cm or more parallel to the transmitted direction.

[0226] In some embodiments, the acoustic pressure applied to the treatment zone from each transducer is between 0.1 and 10 MPa.

[0227] In some embodiments, the number of transducers providing the focused ultrasound treatment zone is between 1 and 1000.

[0228] In some embodiments, one or more center frequencies are utilized during treatment with center frequencies ranging from about 100 kHz to 20 MHz.

[0229] In some embodiments, ultrasound waves from a given transducer are applied continuously. In some embodiments, ultrasound waves emitted from a given transducer are applied in pulses that alternate between on and off time units, known as a duty cycle. Duty cycles can range from 1 on time unit to 9 off time units.

[0230] In some embodiments, the transducer transmits a single frequency sound or a multi-frequency chirp.

[0231] In some embodiments, the transducers are operated sequentially such that the total energy delivered to the target tissue during the entire course of application is greater than the total energy to the surrounding tissue.

[0232] In some embodiments, the frequency is swept during application to partially reduce zones of unnecessarily high density in zones near the transducer.

[0233] In some embodiments, the transducer comprising the treatment head is mechanically vibrated.

[0234] In some embodiments, the transducers are configured as a two-dimensional phased array, an annular array, and / or a three-dimensional phased array.

[0235] In some embodiments, one or more ultrasound transducers are incorporated into one or more endoscopic devices.

[0236] The APT treatment systems disclosed herein provide reduced thermal doses compared to heat delivery schemes common to hyperthermia and ablative thermal therapies. In some embodiments, the maximum temperature reached in the treatment zone is 45° C. during a treatment lasting about 2 seconds or less.

[0237] Considering the thermal mass, it is expected that the therapeutic effect is achieved through a thermal mechanism. Without wishing to be bound by theory, mechanical effects coupled with thermal effects may partially explain the observed effects of treatment using the disclosed devices, systems and methods.

[0238] In some embodiments, a couplant is used between the transducer and the patient's body to efficiently transmit ultrasound and, in some embodiments, to provide a desired distance between the transducer and the treatment zone. In some embodiments, the couplant is circulated to cool the transducer or the patient's body, or both, during treatment. Separate fluids may be used for the purposes of transmitting ultrasound, providing spacing, and cooling the patient and system components.

[0239] Without being bound by theory, APT treatment using the system described herein can promote interactions between cells and between cells and matrix proteins, between cancer cells and immune cells, and between immune cells, such as T cells and DCs.

[0240] In some embodiments, APT treatment may disrupt protein complexes, such as protein folding complexes.

[0241] For patients with diseases that benefit from treatment with multiple modalities, penetration throughout targeted treatment zones and lesions within these zones, relaxation of application of each modality and short periods of treatment is desired.

[0242] Various other aspects of APT treatment devices and APT treatment modalities according to exemplary embodiments of the present invention will now be described:

[0243] <Positioning device> In some embodiments, the transducer applicator is designed to be portable by a clinician or caregiver. In some embodiments, the applicator is mounted on a mechanical positioning device, such as the positioning device (500) illustrated in FIG. 19. The positioning device (500) can be manually operated or robotically controlled. In this embodiment, the positioning device (500) is an arcuate rail along which the transducer travels; specifically, the transducer may be mounted on a cable-driven carriage that in turn rides on the rail. The rail itself may be rotatable so that the transducer may be positioned in three dimensions. The positioning device (500) may be large enough to allow the patient to fit under the transducer and within its target range. Although FIG. 19 shows only one transducer positioned on the rail, it should be appreciated that more than one transducer may be placed on the rail and / or other rails may be provided that support one or more other transducers. In some embodiments, a Stewart platform, sometimes called a hexapod, may be used in the positioning device. Computer programming may be used to set treatment parameters and operate the positioning device.

[0244] Equipment and patient cooling In some embodiments, the treatment system includes a patient cooling mechanism for cooling skin exposed to the ultrasound or other energy.

[0245] <Cited documents> 1. Rabinovich, G.A., Gabrilovich, D., and Sotomayor, E.M. 2007. Immunosuppressive strategies that are mediated by tumor cells. Annu Rev Immunol 25:267-296. 2. Dougan, M., and Dranoff, G. 2009. Immune therapy for cancer. Annu Rev Immunol 27:83-117. 3. Uyttenhove, C., Pilotte, L., Theate, I., Stroobant, V., Colau, D., Parmentier, N., Boon, T., and Van den Eynde, B.J. 2003. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat Med 9:1269-1274. 4. Thomas, D.A., and Massague, J. 2005. TGF-beta directly targets cytotoxic T cell functions during tumor evasion of immune surveillance. Cancer Cell 8:369-380. 5. Gerlini, G., Tun-Kyi, A., Dudli, C., Burg, G., Pimpinelli, N., and Nestle, F.O. 2004. Metastatic melanoma secreted IL-10 down-regulates CD1 molecules on dendritic cells in metastatic tumor lesions. Am J Pathol 165:1853-1863. 6. Turk, M.J., Guevara-Patino, J.A., Rizzuto, G.A., Engelhorn, M.E., Sakaguchi, S., and Houghton, A.N. 2004. Concomitant tumor immunity to a poorly immunogenic melanoma is prevented by regulatory T cells. J Exp Med 200:771-782. 7. Huang, B., Pan, P.Y., Li, Q., Sato, A.I., Levy, D.E., Bromberg, J., Divino, C.M., and Chen, S.H. 2006. Gr-1+CD115+ immature myeloid suppressor cells mediate the development of tumor-induced T regulatory cells and T-cell anergy in tumor-bearing host. Cancer Res 66:1123-1131. 8. Sica, A., and Bronte, V. 2007. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest 117:1155-1166. 9. Curiel, T.J., Coukos, G., Zou, L., Alvarez, X., Cheng, P., Mottram, P., Evdemon-Hogan, M., Conejo-Garcia, J.R., Zhang, L., Burow, M., et al. 2004. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med 10:942-949. 10. van Elsas, A., Hurwitz, A.A., and Allison, J.P. 1999. Combination immunotherapy of B16 melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and granulocyte / macrophage colony-stimulating factor (GM-CSF)-producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J Exp Med 190:355-366. 11. Phan, G.Q., Yang, J.C., Sherry, R.M., Hwu, P., Topalian, S.L., Schwartzentruber, D.J., Restifo, N.P., Haworth, L.R., Seipp, C.A., Freezer, L.J., et al. 2003. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte-associated antigen 4 blockade in patients with metastatic melanoma. Proc Natl Acad Sci USA 100:8372-8377. 12. Dong, H., Strome, S.E., Salomao, D.R., Tamura, H., Hirano, F., Flies, D.B., Roche, P.C., Lu, J., Zhu, G., Tamada, K., et al. 2002. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 8:793-800. 13. Rubinstein, N., Alvarez, M., Zwirner, N.W., Toscano, M.A., Ilarregui, J.M., Bravo, A., Mordoh, J., Fainboim, L., Podhajcer, O.L., and Rabinovich, G.A. 2004. Targeted inhibition of galectin-1 gene expression in tumor cells results in heightened T cell-mediated rejection; A potential mechanism of tumor-immune privilege. Cancer Cell 5:241-251. 14. Troy, A.J., Summers, K.L., Davidson, P.J., Atkinson, C.H., and Hart, D.N. 1998. Minimal recruitment and activation of dendritic cells within renal cell carcinoma. Clin Cancer Res 4:585-593. 15. Staveley-O'Carroll, K., Sotomayor, E., Montgomery, J., Borrello, I., Hwang, L., Fein, S., Pardoll, D., and Levitsky, H. 1998. Induction of antigen-specific T cell anergy: An early event in the course of tumor progression. Proc Natl Acad Sci U S A 95:1178-1183. 16. Willimsky, G., and Blankenstein, T. 2005. Sporadic immunogenic tumours avoid destruction by inducing T-cell tolerance. Nature 437:141-146. 17. Overwijk, W.W., Theoret, M.R., Finkelstein, S.E., Surman, D.R., de Jong, L.A., Vyth-Dreese, F.A., Dellemijn, T.A., Antony, P.A., Spiess, P.J., Palmer, D.C., et al. 2003. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J Exp Med 198:569-580. 18. Cuenca, A., Cheng, F., Wang, H., Brayer, J., Horna, P., Gu, L., Bien, H., Borrello, I.M., Levitsky, H.I., and Sotomayor, E.M. 2003. Extra-lymphatic solid tumor growth is not immunologically ignored and results in early induction of antigen-specific T-cell anergy: dominant role of cross-tolerance to tumor antigens. Cancer Res 63:9007-9015. 19. Zheng, Y., Zha, Y., Driessens, G., Locke, F., and Gajewski, T.F. 2012. Transcriptional regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. J Exp Med 209:2157-2163. 31. Zhang, H.G., Mehta, K., Cohen, P., and Guha, C. 2008. Hyperthermia on immune regulation: a temperature's story. Cancer Lett 271:191-204. 32. Basu, S., and Srivastava, P.K. 1999. Calreticulin, a peptide-binding chaperone of the endoplasmic reticulum, elicits tumor- and peptide-specific immunity. J Exp Med 189:797-802. 33. Castelli, C., Ciupitu, A.M., Rini, F., Rivoltini, L., Mazzocchi, A., Kiessling, R., and Parmiani, G. 2001. Human heat shock protein 70 peptide complexes specifically activate antimelanoma T cells. Cancer Res 61:222-227. 34. Haug, M., Dannecker, L., Schepp, C.P., Kwok, W.W., Wernet, D., Buckner, J.H., Kalbacher, H., Dannecker, G.E., and Holzer, U. 2005. The heat shock protein Hsp70 enhances antigen-specific proliferation of human CD4+ memory T cells. Eur J Immunol 35:3163-3172. 35. Pawaria, S., and Binder, R.J. 2011. CD91-dependent programming of T-helper cell responses following heat shock protein immunization. Nat Commun 2:521. 36. Gajewski, T.F., Woo, S.R., Zha, Y., Spaapen, R., Zheng, Y., Corrales, L., and Spranger, S. 2013. Cancer immunotherapy strategies based on overcoming barriers within the tumor microenvironment. Curr Opin Immunol 25:268-276. 37. Driessens, G., Kline, J., and Gajewski, T.F. 2009. Costimulatory and coinhibitory receptors in anti-tumor immunity. Immunol Rev 229:126-144. 38. Leach, D.R., Krummel, M.F., and Allison, J.P. 1996. Enhancement of antitumor immunity by CTLA-4 blockade. Science 271:1734-1736. 39. Munn, D.H., and Mellor, A.L. 2007. Indoleamine 2,3-dioxygenase and tumor-induced tolerance. J Clin Invest 117:1147-1154. 40. Green, D.R., Ferguson, T., Zitvogel, L., and Kroemer, G. 2009. Immunogenic and tolerogenic cell death. Nat Rev Immunol 9:353-363. 41. Lee, P.P., Yee, C., Savage, P.A., Fong, L., Brockstedt, D., Weber, J.S., Johnson, D., Swetter, S., Thompson, J., Greenberg, P.D., et al. 1999. Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients. Nat Med 5:677-685. 42. Valdor, R., and Macian, F. 2013. Induction and stability of the anergic phenotype in T cells. Semin Immunol 25:313-320. 43. Macian, F., Garcia-Cozar, F., Im, S.H., Horton, H.F., Byrne, M.C., and Rao, A. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109:719-731. 44. Safford, M., Collins, S., Lutz, M.A., Allen, A., Huang, C.T., Kowalski, J., Blackford, A., Horton, M.R., Drake, C., Schwartz, R.H., et al. 2005. Egr-2 and Egr-3 are negative regulators of T cell activation. Nat Immunol 6:472-480. 45. Soto-Nieves, N., Puga, I., Abe, B.T., Bandyopadhyay, S., Baine, I., Rao, A., and Macian, F. 2009. Transcriptional complexes formed by NFAT dimers regulate the induction of T cell tolerance. J Exp Med 206:867-876. 46. Enk, A.H., Jonuleit, H., Saloga, J., and Knop, J. 1997. Dendritic cells as mediators of tumor-induced tolerance in metastatic melanoma. Int J Cancer 73:309-316. 47. Marangoni, F., Murooka, T.T., Manzo, T., Kim, E.Y., Carrizosa, E., Elpek, N.M., and Mempel, T.R. 2013. The transcription factor NFAT exhibits signal memory during serial T cell interactions with antigen-presenting cells. Immunity 38:237-249. 48. Srivastava, P. 2002. Interaction of heat shock proteins with peptides and antigen presenting cells: chaperoning of the innate and adaptive immune responses. Annu Rev Immunol 20:395-425. 49. Udono, H., and Srivastava, P.K. 1993. Heat shock protein 70-associated peptides elicit specific cancer immunity. J Exp Med 178:1391-1396. 50. Udono, H., and Srivastava, P.K. 1994. Comparison of tumor-specific immunogenicities of stress-induced proteins gp96, hsp90, and hsp70. J Imunol 152:5398-5403. 51. Ullrich, S.J., Robinson, E.A., Law, L.W., Willingham, M., and Appella, E. 1986. A mouse tumor-specific transplantation antigen is a heat shock-related protein. Proc Natl Acad Sci U S A 83:3121-3125. 52. Somersan, S., Larsson, M., Fonteneau, J.F., Basu, S., Srivastava, P., and Bhardwaj, N. 2001. Primary tumor tissue lysates are enriched in heat shock proteins and induce the maturation of human dendritic cells. J Immunol 167:4844-4852. 53. Liu, B., DeFilippo, A.M., and Li, Z. 2002. Overcoming Immune Tolerance to Cancer by Heat Shock Protein Vaccines. Mol Cancer Ther 1:1147-1151. 54. Chen, X., Tao, Q., Yu, H., Zhang, L., and Cao, X. 2002. Tumor cell membrane-bound heat shock protein 70 elicits antitumor immunity. Immunol Lett 84:81-87. 55. Vega, V.L., Rodriguez-Silva, M., Frey, T., Gehrmann, M., Diaz, J.C., Steinem, C., Multhoff, G., Arispe, N., and De Maio, A. 2008. Hsp70 translocates into the plasma membrane after stress and is released into the extracellular environment in a membrane-associated form that activates macrophages. J Immunol 180:4299-4307. 56. Basu, S., Binder, R.J., Suto, R., Anderson, K.M., and Srivastava, P.K. 2000. Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-kappa B pathway. Int immunol 12:1539-1546. 57. Obeid, M., Panaretakis, T., Tesniere, A., Joza, N., Tufi, R., Apetoh, L., Ghiringhelli, F., Zitvogel, L., and Kroemer, G. 2007. Leveraging the immune system during chemotherapy: moving calreticulin to the cell surface converts apoptotic death from "silent" to immunogenic. Cancer Res 67:7941-7944.58. Hu, Z., Yang, X.Y., Liu, Y., Morse, M.A., Lyerly, H.K., Clay, T.M., and Zhong, P. 2005. Release of endogenous danger signals from HIFU-treated tumor cells and their stimulatory effects on APCs. Biochem Biophys Res Comm 335:124-131. 59. Hu, Z., Yang, X.Y., Liu, Y., Sankin, G.N., Pua, E.C., Morse, M.A., Lyerly, H.K., Clay, T.M., and Zhong, P. 2007. Investigation of HIFU-induced anti-tumor immunity in a murine tumor model. J Transl Med 5:34-34. 60. Boussiotis, V.A., Barber, D.L., Nakarai, T., Freeman, G.J., Gribben, J.G., Bernstein, G.M., D'Andrea, A.D., Ritz, J., and Nadler, L.M. 1994. Prevention of T cell anergy by signaling through the gamma c chain of the IL-2 receptor. Science 266:1039-1042. 61. Dure, M., and Macian, F. 2009. IL-2 signaling prevents T cell anergy by inhibiting the expression of anergy-inducing genes. Mol Immunol 46:999-1006. 62. Gao, B., Kong, Q., Kemp, K., Zhao, Y.S., and Fang, D. 2012. Analysis of sirtuin 1 expression reveals a molecular explanation of IL-2-mediated reversal of T-cell tolerance. Proc Natl Acad Sci U S A 109:899-904. 63. Gramaglia, I., Weinberg, A.D., Lemon, M., and Croft, M. 1998. Ox-40 ligand: a potent costimulatory molecule for sustaining primary CD4 T cell responses. J Immunol 161:6510-6517. 64. Lathrop, S.K., Huddleston, C.A., Dullforce, P.A., Montfort, M.J., Weinberg, A.D., and Parker, D.C. 2004. A signal through OX40 (CD134) allows anergic, autoreactive T cells to acquire effector cell functions. J Immunol 172:6735-6743. 65. Murata, S., Ladle, B.H., Kim, P.S., Lutz, E.R., Wolpoe, M.E., Ivie, S.E., Smith, H.M., Armstrong, T.D., Emens, L.A., Jaffee, E.M., et al. 2006. OX40 costimulation synergizes with GM-CSF whole-cell vaccination to overcome established CD8+ T cell tolerance to an endogenous tumor antigen. J Immunol 176:974-983. 66. Tsushima, F., Yao, S., Shin, T., Flies, A., Flies, S., Xu, H., Tamada, K., Pardoll, D.M., and Chen, L. 2007. Interaction between B7-H1 and PD-1 determines initiation and reversal of T-cell anergy. Blood 110:180-185. 67. Wilcox, R.A., Tamada, K., Flies, D.B., Zhu, G., Chapoval, A.I., Blazar, B.R., Kast, W.M., and Chen, L. 2004. Ligation of CD137 receptor prevents and reverses established anergy of CD8+ cytolytic T lymphocytes in vivo. Blood 103:177-184. 68. Zhang, L., Chen, X., Liu, X., Kline, D.E., Teague, R.M., Gajewski, T.F., and Kline, J. 2013. CD40 ligation reverses T cell tolerance in acute myeloid leukemia. J Clin Invest 123:1999-2010. 69. Anelli T, Alessio M, Mezghrani A, Simmen T, Talamo F, Bachi A and Sitia R. ERp44, a novel endoplasmic reticulum folding assistant of the thioredoxin family. EMBO J. 2002; 21(4):835-844. 70.Jessop CE, Chakravarthi S, Garbi N, Hammerling GJ, Lovell S and Bulleid NJ. ERp57 is essential or efficient folding of glycoproteins sharing common structural domains. EMBO J. 2007; 26(1):28-40. 71.Ron D and Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol. 2007; 8(7):519-529. 72.White E. Deconvoluting the context-dependent role for autophagy in cancer. Nat Rev Cancer. 2012; 12(6):401-410. 73. Kon M, Kiffin R, Koga H, Chapochnick J, Macian F, Varticovski L and Cuervo AM. Chaperone-mediated autophagy is required for tumor growth. Sci Transl Med. 2011; 3(109):109ra117. 74.Haar G, Shaw A, Pye S, Ward B, Bottomley F, Nolan R and Coady AM. Guidance on reporting ultrasound exposure conditions for bio-effects studies. Ultrasound Med Biol. 2011; 37(2):177-183. 75.Duck FA. (1990). Physical properties of tissue: a comprehensive reference book: Academic Press). 76.Partanen A, Tillander M, Yarmolenko PS, Wood BJ, Dreher MR and Kohler MO. Reduction of peak acoustic pressure and shaping of heated region by use of multifoci sonications in MR-guided high-intensity focused ultrasound mediated mild hyperthermia. Med Phys. 2013; 40(1):013301. 77.Back SH, Schroder M, Lee K, Zhang K and Kaufman RJ. ER stress signaling by regulated splicing: IRE1 / HAC1 / XBP1. Methods. 2005; 35(4):395-416. 78.Lewis and Olbricht, Review of Scientific Instruments 80, 114704 (2009). 79.Pouch et al. Ultrasound Med 2010; 29:1595-1606. 80.Sahu et al. Scientic Reports 2014 『t(Dec 3)t』;4:7303. doi: 10.1038 / srep07303.

Claims

1. 1. An ultrasound stimulation therapy system, comprising: A control system; The control system is coupled to the one or more ultrasonic beams, and the frequency waveform of the one or more ultrasonic beams is adjusted to a value between 1 and 1000 W / cm at the treatment zone. ２ The spatial peak time-averaged acoustic power intensity (I ｓｐｔａ at least two transducers configured to generate one or more ultrasound beams having a Including, the at least two transducers generate one or more ultrasonic frequencies in the range of 0.01 to 10 MHz; the at least two transducers are configured to generate ultrasound waves such that a waist of a beam profile at −3 dB is at least 5 mm in the treatment zone; The ultrasonic beam includes a columnar ultrasonic beam, The system is for use in combination with a chaperone inhibitor to treat a tumor in a subject.

2. The chaperone inhibitor comprises a heat shock protein (HSP) 90 inhibitor.

2. The system described in 1.

3. The system of claim 2, wherein the HSP90 inhibitor comprises 17-allylamino-17-demethoxy-geldanamycin (17AAG).

4. The system of claim 2, wherein the HSP90 inhibitor comprises 17-dimethylamino-ethylamino-17-demethoxygeldanamycin (17DMAG).

5. The system of claim 2 , wherein the HSP90 inhibitor comprises geldanamycin.

6. The system of claim 1 , wherein the ultrasound beam in the treatment zone has a frequency from 0.01 to 10 MHz.

7. The system of claim 1 , wherein the at least two transducers are configured to generate ultrasound beams having different frequencies.

8. 7. The system of claim 6, wherein one of the ultrasound beams has a frequency between 300 kHz and 3 MHz and another of the ultrasound beams has a frequency between 30 kHz and 300 kHz.

9. The ultrasound beam has a power of 10 to 300 W / cm at the treatment zone. ２ The spatial peak time-averaged acoustic power intensity (I ｓｐｔａ 10. The system of claim 1, further comprising:

10. The system of claim 1 , wherein the ultrasound beam is applied to the treatment zone for a period of 0.5 to 5 seconds.

11. The system of claim 1 , wherein the ultrasound beam is non-ablative.

12. The system of claim 1 , wherein the ultrasound beam does not induce cavitation in the treatment zone.

13. The system of claim 1 , wherein the ultrasound beam is applied at least once to multiple masses within the tumor over a period of less than one hour.

14. 2. The system of claim 1, wherein the tumor comprises a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testis, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid, skin, head and neck, glioma, or soft tissue sarcoma.

15. The system of claim 14 , wherein the tumor comprises a breast, skin, soft tissue sarcoma, liver, brain, or bone tumor.

16. The system of claim 15 , wherein the tumor comprises a prostate, skin, or lung tumor.

Images