Chimeric antigens for treating viral infections

Abstract

The present invention provides chimeric antigens and their combination with antiviral agents to induce an immune response against chronic hepatitis B infection and break host resistance to the hepatitis B virus.

Description

[Technical field]

[0001] The present invention relates to the use of chimeric antigens to break host tolerance to HBV antigens by targeting and activating antigen presenting cells (APCs) to induce HBV-specific T cell and antibody responses. [Background technology]

[0002] Viral infections are a major public health problem. Human hepatitis B virus (HBV) is a member of a family of DNA viruses that primarily infect the liver (Gust, 1986). Other members of this family include Woodchuck hepatitis B virus (WHV, Summers et al., 1978), Duck hepatitis B virus (DHBV, Mason et al., 1980), and Heron hepatitis B virus (HHBV, Sprengel et al., 1988). Although these viruses share identical morphology and mechanisms of replication, they have different species specificities in infectivity (Marion, 1988).

[0003] HBV primarily infects hepatocytes, causing acute and chronic liver disease that induces cirrhosis and hepatocellular carcinoma. Infection occurs through blood and other body fluids. Approximately 90% of adults infected with HBV are cured, but the remaining 10% become chronic carriers of the virus, which are more likely to develop cirrhosis and hepatocellular carcinoma (Block, 2016). According to World Health Organization statistics, over 2 billion people are infected with HBV, of which 350 million are chronically infected with the virus (Beasley, 1988; Lau and Wright, 1993). Preventive vaccines based on HBV surface antigen (HbsAg) are highly effective in generating protective immunity against HBV infection. These vaccines have been developed from purified HBsAg in the plasma of chronic HBV carriers and produced through the use of recombinant DNA technology and synthetic peptides (see U.S. Patent Nos. 4,599,230 and 4,599,231). Although these are highly effective in preventing infection, they are by no means effective in eradicating chronic infections that have already formed.

[0004] Human hepatitis B virus (HBV) belongs to the family Hepadnaviridae (Mason et al., 1980). Other members of this family include duck hepatitis B virus (DHBV), woodchuck hepatitis virus (WHV), ground squirrel hepatitis B virus (GSHV), and heron hepatitis B virus (HHBV). Although these viruses show similar morphology and replication mechanisms, they have consequently different species specificities, infecting only closely related species. They have DNA genomes ranging in size from 3.0 to 3.2 Kb, with overlapping reading frames that code for several proteins. The HBV genome codes for several proteins. Among these, the large (S1 / S2 / S), medium (S2 / S), and small (S) surface antigens are involved in the binding of the virus to cellular receptors for uptake. The Core protein (Core) forms the capsid, which surrounds the partial double-stranded DNA genome. The Polymerase / Reverse Transcriptase (Pol) protein is a multifunctional enzyme required for viral replication. The X protein has many properties, including the activation of Src kinases (Ganem and Schneider, 2001). The present invention describes the use of a chimeric antigen fusion protein, HBV S1 fragment / S2 fragment / Core protein and a murine (xenotypic) Mab Fc fragment in combination with other HBV antiviral agents.

[0005] DHBV, another member of the Hepadnaviridae family, infects Peking ducks, resulting in chronic DHBV infection. The virus is species-specific and has been used as an animal model for addressing hepatitis B virus. DHBV has a DNA genome that encodes the surface antigens PreS and PreS / S, a core protein, and a polymerization / reverse transcriptase enzyme.

[0006] When a healthy host (human or animal) comes into contact with an antigen (such as a protein from a bacterium, virus, and / or parasite), the host normally mounts an immune response. This immune response may be a humoral and / or cellular response. In a humoral response, B cells form antibodies in response to an antigenic stimulus, which are secreted into the blood and / or lymph. The antibodies neutralize the antigen (e.g., a virus) by, among other things, binding the antigen to the antibody's surface, marking it for destruction by phagocytes and / or complement-mediated mechanisms. The cellular response is characterized by the ability to select and expand helper and cytotoxic T-lymphocytes to directly eliminate cells containing the antigen.

[0007] In many individuals, the immune response does not respond to specific antigens. When an antigen does not stimulate the production of specific antibodies and / or killer T cells, the immune system cannot prevent the resulting disease. As a result, an infectious agent (e.g., a virus) can form a chronic infection and the host's immune system can become tolerant to the antigens produced by the virus. The mechanism by which the virus escapes the immune system is still unknown. The best-known examples of chronic viral infections include hepatitis B, hepatitis C, human immunodeficiency virus (HIV), and herpes simplex virus (HSV).

[0008] When a viral infection becomes chronic, the virus escapes the host's immune system. Viral antigens are perceived as "self" and therefore are not captured by antigen-presenting cells, which process the antigens they encounter differently depending on the location of the antigen (Steinman et al., 1999). Exogenous antigens are processed inside the endosomes of antigen-presenting cells, and the peptide fragments generated during this process are complexed with major histocompatibility complex (MHC) class II and presented on the cell surface. When this complex is presented to CD4+ T cells, it stimulates CD4+ T helper cells. As a result, cytokines secreted by the helper cells stimulate B cells to produce antibodies in response to the exogenous antigen (humoral response). Immunization with antigens usually produces an antibody response through this endosomal antigen processing process.

[0009] Meanwhile, intracellular antigens are processed by the proteasome, and the resulting peptide fragments are presented on the surface of antigen-presenting cells as complexes with MHC Class I. Following binding of this complex to the co-receptor CD8 molecule, presentation of the antigen to CD8+ T cells elicits an immune response from cytotoxic T cells (CTLs) that kill the host cells carrying the antigen.

[0010] In patients with chronic viral infections, viral antigens are produced within host cells as the virus replicates vigorously. Secreted antigens circulate in the humoral circulatory system. For example, in chronic HBV carriers, virions and HBV surface antigens, as well as core antigens (e-antigens), can be observed in the blood. An effective therapeutic vaccine will elicit a CTL response against intracellular antigens or antigens delivered to the appropriate cellular compartment to activate MHC Class I processing.

[0011] Therapeutic vaccines that can trigger a CTL response can be processed through the proteasome pathway and presented through MHC Class I (Larsson et al., 2001). This can be accomplished by producing the antigen inside the host cell or delivering it to the appropriate cellular compartment to be processed and presented to induce a cellular response. Several approaches to deliver antigens inside the cell have been documented in the literature. Among others, viral vectors (Lorenz et al., 1999), the use of cells infected with cDNA (Donnelly et al., 1997), and expression of antigens through injection of cDNA vehicles (Lai and Bennett, 1998; U.S. Patent No. 5,589,466) have been reported. Several other approaches to treat chronic HBV infection have been incorporated in the literature (Liang et al., 2015; Block et al., 2015; Block et al., 2018).

[0012] Delivery vehicles capable of carrying antigens to cytosolic compartments for processing by the MHC Class I pathway have also been used. The use of adjuvants to achieve the same goal has also been detailed (Hilgers et al., 1999). Another approach is the use of biodegradable microspheres for cytoplasmic delivery of antigens (Newman et al., 2000). This was exemplified by the generation of a Th1 immune response against ovalbumin peptide (Newman et al., 2000; Newman et al., 1998). It has also been reported that most potent antigen presenting cells and dendritic cells take up PLGA nanospheres (Newman et al., 2002).

[0013] Blood monocyte-derived dendritic cells (DCs), thanks to their capacity as antigen-presenting cells, can be immunomodulators stimulating primary T cell responses (Steinman et al., 1999; Banchereau and Steinman, 1998). Their unique properties of capturing, processing, and presenting antigens, as well as stimulating naive T cells, have positioned DCs as a very important tool for the development of therapeutic vaccines (Laupeze et al., 1999). DC targeting of antigens is a crucial step in antigen presentation, and DCs have several receptors present for the Fc region of single antibodies, which have been used for such purposes (Regnault et al., 1999). Examples of this approach include the ovarian cancer Mab-B43.13 antibody, anti-prostate specific antigen (PSA) antibody, as well as anti-HBV antibody-antigen complexes (Wen et al., 1999). DCs carrying tumor-associated antigens have been used in cancer immunotherapy, where they have been shown to generate tumor-specific immune responses and antitumor activity (Campton et al., 2000; Fong and Engleman, 2000). Promising results were obtained in clinical trials using tumor antigen-pulsed DCs in vivo (Tarte and Klein, 1999). These studies suggest that it is efficient to use DCs to generate immune responses against cancer antigens.

[0014] In the last few years, active immunotherapy has been applied when treating cancer. The main content of this approach is the blockade of programmed cell death using Pd-1 and PD-L1, commonly known as “immune inhibitors”. Commercially available products include pembrolizumab (Merck) for the treatment of melanoma and non-small cell lung cancer. Similarly, nivolumab (Bristol-Myers Squibb) has been approved for the treatment of melanoma, squamous cell lung cancer, renal cell carcinoma, and Hodgkin lymphoma. A similar approach has been attempted and reported in the literature for the treatment of chronic HBV infection (Peng et al., 2008). In a mouse model for the treatment of chronic HBV infection, it was found that blocking Pd-1 restored some immune adverse functions (Tzeng, HT et al., 2012; Fisicaro et al., 2010).

[0015] Chimeric antigens (fusions of Fc antibody fragments with HBV antigens) have been shown to be effective in eliciting HBV antigen-specific T cell and B cell mediated immune responses in response to HBV, and breaking tolerance to HBV antigens in chronic disease states (George et. al., US patents, 8007805 B2, 8025873 B2, 8029803 B2, 8465745 B2, China patents 200480022747.1, India 225281, Japan 5200201, Korea 10-1327719, New Zealand 545048, Singapore 119567, Taiwan I364294, South Africa 2006-0804, Australia 2012200998, European Patent validated; Germany, France, UK 1664270; Ma et al., 2020, George et al., 2020). Summary of the Invention

[0016] In one aspect, the invention provides a method of treating a viral infection in a host by administering a chimeric antigen and a therapeutic agent that reduces viral levels in the host.

[0017] In some embodiments of the method of treatment, the chimeric antigen is an HBV S1 / S2 / Core chimeric antigen.

[0018] In some embodiments of the method of treatment, the therapeutic agent is an HBV antiviral agent. In some examples, the HBV antiviral agent may be a pharma- ceutically acceptable agent comprising any one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil, and lamivudine. In other examples, the HBV antiviral agent is an HBV antiviral RNAi agent that inhibits HBV replication. In yet another example, the method of treatment of claim 3 is a method of treatment in which the HBV antiviral agent is a core capsid assembly inhibitor. In yet another example, the method of treatment of claim 3 is a method of treatment in which the HBV antiviral agent is a Toll-like receptor (TLR) agonist.

[0019] In yet other embodiments of the method of treatment, the method further comprises administering to the host an immunomodulatory agent. In some examples, the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a. In other examples, the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor.

[0020] In yet another embodiment of the method of treatment, the host is a human.In another embodiment, the viral infection refers to an HBV infection.

[0021] In another aspect, the present invention provides a kit for treating a viral infection in a host comprising a chimeric antigen and a therapeutic agent that reduces viral levels in a host, and a package insert or label having instructions and other information for treating the viral infection in the host by administering the therapeutic chimeric antigen and therapeutic agent to the host.

[0022] In some embodiments of the kit, the cautionary information includes use and handling instructions for administering the chimeric agent and the therapeutic agent simultaneously, hi some examples, the cautionary information includes use and handling instructions for administering the chimeric agent and the therapeutic agent separately.

[0023] In some embodiments of the kit, the chimeric antigen is an HBV S1 / S2 / Core chimeric antigen. In other embodiments, the therapeutic agent is an HBV antiviral agent. In some examples, the HBV antiviral agent is a pharma- ceutically acceptable agent comprising any one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil, and lamivudine. In other examples, the HBV antiviral agent is an HBV antiviral RNAi agent that inhibits HBV replication. In other examples, the HBV antiviral agent is a core capsid assembly inhibitor. In yet other examples, the HBV antiviral agent is a Toll-like receptor (TLR) agonist.

[0024] In other embodiments, the kit further comprises an immunomodulatory agent. In some examples, the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a. In other examples, the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor.

[0025] In yet another aspect, the present invention provides for the use of chimeric antigens and therapeutic agents to reduce viral levels in a host in treating a viral infection in a host. In some embodiments, the chimeric antigen is an HBV S1 / S2 / Core chimeric antigen. In some embodiments, the therapeutic agent is an HBV antiviral agent. In some examples, the HBV antiviral agent is a pharma- ceutically acceptable agent comprising any one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil, and lamivudine. In other examples, the HBV antiviral agent is an HBV antiviral RNAi agent that inhibits HBV replication. In other examples, the HBV antiviral agent is a core capsid assembly inhibitor. In still other examples, the HBV antiviral agent is a Toll-like receptor (TLR) agonist.

[0026] In other embodiments, the use further includes an immunomodulatory agent. In some examples, the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a. In other examples, the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor. [Brief description of the drawings]

[0027] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Figure 1] Schematic diagram illustrating the structure of a dimeric chimeric antigen. The chimeric antigen includes HBV S1 and S2 fragments, a core antigen, and a mouse monoclonal antibody Fc fragment. (N-terminus) 6xHis-rTEV protease site-HBV S1 / S2 / Core [IRD] --- linker peptide-Part CH1-CH2-CH3-peptide [TBD] (C-terminus). [Diagram 2]Schematic representation illustrating the binary state of DHBV core chimeric antigen vaccine: (N-terminus) 6xHis-rTEV protease site-DHBV Core [IRD]-----Linker peptide-Part CH1-CH2-CH3-Peptide [TBD] (C-terminus). [Diagram 3] A chart showing the events that occur during recombination is shown. [Figure 4] Two graphs showing the binding of DHBV core chimeric antigen and TBD to duck PBMC, shown as % positive cells (left) and relative mean fluorescence intensity (right). [Diagram 5] 1 shows a graph illustrating the inhibition of binding of DHBV core chimeric antigen to duck PBMC by Fc fragments. [Figure 6] Photographs showing DHBV DNA from ducks infected with DHBV after hatching are shown. [Figure 7] Panels A and B show graphs depicting the levels of anti-DHBV core antibodies in the sera of chronically infected ducks immunized with PBS (7A) and core-TBD (7B), respectively. [Figure 8] A and B show photographs illustrating DHBV DNA in serum of chronically DHBV-infected ducks after 3TC (7A) and vaccine (7B) administration, respectively. [Figure 9] FIG. 1 shows a graph depicting mean SGPT (ALT) levels in chronically infected ducks. [Figure 10] FIG. 1 shows a graph depicting mean SGOT (AST) levels in chronically infected ducks. [Figure 11] 1 shows a schematic representation of the HBV core chimeric antigen vaccine in a dimerized form. [Figure 12]Panels A and B show graphs depicting the effect of the HBV chimeric vaccine on hepatic HBV DNA in the transgenic mice (genetically modified mice) using qPCR (Figure 12A) and Southern blot hybridization (Figure 12B). [Figure 13] A and B show graphs depicting the effect of the HBV core chimeric antigen vaccine on plasma ALT (FIG. 13A) and hepatic HBV RNA in the transgenic mice (FIG. 13B). [Figure 14] 1 shows a graph depicting the effect of the HBV core chimeric antigen vaccine on the change in whole body weight in the transgenic mice. [Figure 15] A to P show graphs showing the effects of the HBV core chimeric antigen vaccine on hepatic cytokines (IL-1α, IL-1β, IFN-γ, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, MCP-1, TNF-α, MIP-1, GM-CSF, and RANTES, respectively) in the HBV transgenic mice. [Figure 16] A to P show graphs showing the effects of the HBV core chimeric antigen vaccine on plasma cytokines (IL-1α, IL-1β, IFN-γ, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, MCP-1, TNF-α, MIP-1, GM-CSF, RANTES) in the HBV transgenic mice. [Figure 17] A to P are graphs showing the effects of the HBV core chimeric antigen vaccine on splenic cytokines (IL-1α, IL-1β, IFN-γ, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, MCP-1, TNF-α, MIP-1, GM-CSF, RANTES) in the HBV transgenic mice. [Figure 18]A-D are graphs showing the temporal expression of plasma IFN-Y in response to the HBV core chimeric antigen vaccine in the transgenic mice for all values ​​on days 1, 14, 35 and 56, respectively. [Figure 19] A graph showing the temporal expression of plasma IFN-Y in response to the HBV core chimeric antigen vaccine in the HBV transgenic mice, relative to the combined values ​​of all animals treated with the HBV core chimeric antigen vaccine. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] The present invention is based on the finding that said chimeric antigens can overcome the tolerance to HBV antigens in combination with anti-HBV viral agents and / or immunosuppressants, allowing HBV carriers to induce their own HBV-specific T and B cell responses, leading to the treatment of chronic HBV infection. In particular, said chimeric antigens are molecules that combine a viral antigen, such as hepatitis B core antigen, with a xenotypic fragment, such as murine immunoglobulin G Fc fragment.

[0029] In some aspects, the present invention describes the use of the chimeric antigen in combination with one or more antiviral agents to reduce the viral load in the host, and the use of stimulatory / suppressive immune agents to initiate an immune response to the chimeric antigen. In some embodiments, the chimeric antigen uses a xenotypic fragment mAb and DHBV core protein fusion, which can induce a broad immune response against chronic viral infections, such as a therapeutic vaccine.

[0030] Examples of antiviral agents include, but are not limited to, nucleotide / nucleotide-like RNAi, capsid assembly inhibitors, Toll-like receptor (TLR) agonists, interferons, immune checkpoint inhibitors and other agents that can directly or indirectly reduce viral infection.

[0031] Examples of immunomodulatory agents include, but are not limited to, immune checkpoint inhibitors (e.g., antibody blockade of PD-1, PDL-1, CTLA4) and other agents that directly or indirectly modulate the immune response in response to viral infection.

[0032] Presentation of HBV antigens to induce CTL responses for use as vaccine molecules in chronic HBV infection treatment was designed to target the vaccine with DCs. This would allow the HBV-associated antigens, which were perceived as "self" during chronic infection, to be perceived as "foreign", and the host's immune system would mount a CTL response to eliminate HBV-infected cells. At the same time, through cross-presentation, antibody responses against the circulating HBV antigens would bind to the antigens and eliminate them in the circulation. Thus, the present invention details the use of the chimeric antigens in combination with other antiviral agents to induce immune responses in patients with chronic HBV infection and treat the infection. A typical example of the chimeric antigen is shown in FIG. 1. Working Example

[0033] Example 1 Evaluation of chimeric DHBV antigens as immunotherapeutic modalities for treating chronic DHBV infection

[0034] 1. Introduction

[0035] 1.1 Animal models of HBV

[0036] Human HBV belongs to the Hepadnavirus family. Other members of this family include the Duck Hepatitis B Virus (DHBV, Mason et al., 1980), the Heron Hepatitis B Virus (HHBV, Sprengel et al., 1988), the Woodchuck Hepatitis Virus (WHV, Summers et al., 1978), and the Ground Squirrel Hepatitis B Virus (GSHV, Marion et al., 1980). Even though these viruses show similar genomic structure and replication mechanism characteristics, each virus has different species specificity and therefore infects only closely related species. Peking ducks (Anas platyrhynchos) infected with DHBV have been used as an animal model for the study of viral replication mechanism and analysis of antiviral agents (Schultz et al., 2004). These viruses have DNA genomes ranging in size from 3.0 to 3.2 Kb with overlapping reading frames encoding several proteins.

[0037] The HBV genome encodes several proteins, including the large (S1 / S2 / S), medium (S2 / S), and small (S) surface antigens, which mediate the binding of the virus to cellular receptors for uptake. The core protein (Core) forms the capsid, which encloses the partial double-stranded DNA genome. The Polymerase / Reverse Transcriptase (Pol) protein is a multifunctional enzyme required for viral replication. The X protein has many properties (Ganem, 2001, Bouchard and Schneider, 2004), including the activation of Src kinases (Klein and Schneider, 1997).

[0038] The DHBV genome encodes the surface antigen PreS / S, core protein, and polymerization / reverse transcriptase. It is known that an X-like protein is produced in cultured cells, even though DHBV does not contain an open reading frame for the X protein (Chang et al., 2001). However, it remains to be determined whether this gene product has functional significance in DHBV-infected ducks (Meier et al., 2003). Even though HBV and DHBV show similarities, the viruses differ from each other in several aspects. DHBV does not cause disease in the host. It has been suggested that DHBV may lack the X gene product, and that it is this lack of protein that causes hepatocellular carcinomas to fail to develop. Elements essential for DHBV infection, such as the glycoprotein carboxypeptidase D, are not observed in HBV (Schultz et al., 2004).

[0039] 1.2 DHBV, an animal model of HBV infection

[0040] Since the discovery of DHBV (Mason et al., 1980), the duck animal model has been widely used to study hepadnavirus replication mechanisms and characterization of antiviral drugs (Schultz et al., 2004). Despite limited knowledge about the duck immune system, this animal model has been used to address the immune response to DHBV infection (Jilbert and Kotlarski, 2000).

[0041] Similar to human HBV infection, DHBV infection in ducks can be acute or chronic. Infected ducks transmit the virus to their eggs as they lay through the bloodstream. Congenital DHBV infection occurs as a result of viral replication in the yolk sac and developing liver of the embryo (Urban et al., 1985, Jilbert et al., 1998). Ducks congenitally infected with DHBV remain chronically infected for life, but with minimal hepatic histological changes and no biochemical evidence of liver damage (Marion et al., 1984).

[0042] Chronic DHBV infection can also be induced in newly hatched ducklings by injection with serum from infected ducks (Marion et al., 1984, Jilbert et al., 1996). The outcome of infection appears to depend on the age of the duckling, with the most susceptible to infection occurring in newly hatched ducklings and the infection becoming less susceptible with age (Jilbert et al., 1998). DHBV infection in older adult ducks is transient and results in the production of antibodies and immunity that neutralize the viral response against reinfection (Jilbert et al., 1998). The type of immune response that leads to infection in newborns and the cause of infection absence in older birds remains unclear. It has been shown that the relative maturity of the immune system defines the outcome of infection. The more developed the immune system, the greater the chance of viral treatment and resistant immunity (Zinkernagel, 1996, Vickery and Cossart, 1996).

[0043] Congenitally and chronically DHBV-infected ducks and primary hepatocytes derived from them have been used extensively to assay antiviral compounds and to study mechanisms of viral replication (Offensperger et al., 1993, 1996; Hafkemeyer et al., 1996).

[0044] 1.3 Ducks as an animal model for the study of protective and therapeutic immune systems

[0045] The duck animal model has also been used to evaluate preventive and therapeutic immune responses to DHBV (Rollier et al., 1999). A DNA-based vaccine has been shown to have both protective and therapeutic effects (Rollier et al., 2000a & b). Studies using antiviral compounds such as adefovir and a DHBV L protein DNA-based vaccine have shown that a combination of antiviral drugs and immunotherapy may be more effective in treating chronic HBV infection than either method alone (LeGuerhier et al., 2003).

[0046] 1.4 Normal immune response to HBV infection

[0047] It is a commonly held belief that to achieve elimination of intracellular pathogens such as HBV, the infected cells must be destroyed by MHC Class I-restricted CD8+ CTLs (Chisari and Ferrari, 1995). During HBV infection, CTL responses induce hepatocyte inflammation and viral clearance (Bertoletti and Maini, 2000; Rehermann, 2000). The role of proinflammatory cytokines such as IFN-γ in clearing HBV without clearing infected cells has also been documented (Guidotti et al., 1999; Bertoletti et al., 1997). This effect is clearly seen in chimpanzees acutely infected with HBV (Guidotti et al., 1999). In the HBV transgenic mice, induction of hepatic IFN-γ and TNF-α can noncytopathically prevent the viral replication and gene expression (Guidotti et al., 1996). The antiviral effect of inflammatory cytokines has been demonstrated in the HBV transgenic mice superinfected with LCMV. This process is believed to be mediated by TNF-α and IFN-α / β produced by the LCMV-infected hepatic macrophages (Guidotti et al., 1996a). This result emphasizes the importance of the immune response required to clear chronic HBV infection.

[0048] 1.5 Immune response of ducks to DHBV infection

[0049] In the duck animal model, studies on the immune response of DHBV infection have been very limited due to the lack of understanding of the duck immune system and the lack of suitable reagents (Schultz et al., 2004). Recently, several duck cytokines have been identified. Among them, duck IFN-γ has been shown to suppress the replication of DHBV in vivo and in vitro (Heuss et al., 1998, Schultz et al., 1999). Very limited information is available for other duck cytokines, but several studies have reported on IFN-γ (Schultz and Chisari, 1999) and IL-2 (Schultz et al., 2004). Despite the difficulty in using immunological tools to evaluate the immune response occurring in the duck animal model, in the present invention, we have attempted to use this model to study the effect of the chimeric antigen vaccine.

[0050] 1.6 Design of DHBV core chimeric antigen vaccine

[0051] Chimeric antigen vaccine technology represents a breakthrough in the development and design of unique antiviral therapeutic vaccines. The chimeric antigen vaccine is a new class of recombinant "chimeric antigen" that contains a selected antigen and a specific region of a xenogeneic antibody produced as a fusion protein. Both functional designs of the molecule are tailored to target viral antigens to the appropriate antigen-presenting cells to break tolerance to the viral antigen, and to induce humoral and, most preferably, cellular immune responses to clear the viral infection. The chimeric antigen vaccine monomeric fusion protein is shown diagrammatically in FIG. 2.

[0052] As can be seen from Figure 2, the vaccine has two domains: an immune response domain (IRD) containing a recombinant antigen and a target-binding domain (TBD) containing a fragment portion of a xenogeneic antibody. More specifically, the chimeric antigen comprises a DHBV core antigen fused to a xenogeneic Fc fragment (murine).

[0053] The design of the molecule informs several unique properties. The unique chimeric design prefers to form a structure similar to that of an antibody to facilitate uptake via specific receptors, resulting in proper antigen presentation. This generates a broad immune response in both cellular (Class I) and humoral (Class II) immunity. This is processed through the proteasome pathway and peptides presented in complex with MHC Class I, resulting in a CTL response. The chimeric antigen vaccine may also be processed through the endosomal pathway presented by MHC Class II, generating a humoral response. The TBD mediates the binding of the chimeric antigen vaccine to specific APC receptors, such as Fc-gamma receptors. Binding to immature DCs most often results in Class I presentation. The heterologous nature of the TBD makes the molecule even more immunogenic. Furthermore, linker peptides of various lengths, unrelated to the native protein, are integrated at the N- and C-termini of the antigen and the antibody fragment of the chimeric antigen vaccine, which helps the molecule to be perceived as "foreign" by the host immune system of the chronic DHBV carrier.

[0054] Expression of the recombinant proteins in insect cells presents different glycosylation characteristics than in mammalian cells, adding another dimension to the immunogenic properties of the proteins. The mannose / pauci mannose glycosylation incorporated in insect cells also allows APCs to target mannose receptors for uptake. The chimeric antigen vaccines can be taken up by APCs through specific Fcγ receptors I, II and III (CD64, CD32, CD16), mannose receptor (CD206), other C-type lectin receptors and phagocytosis (Geijtenbeek et al., 2004). Uptake via these receptors, followed by processing through the endosomal and proteasomal pathways and presentation to two classes of MHC, can trigger a broad immune response that can eliminate virus-infected cells and clear circulating antigens.

[0055] The generation of CTL responses is important in clearing virus-infected cells. In antibody-based therapy, the concentration of administered antibodies must be adjusted for each patient for optimal complexation with circulating self-antigens. In the chimeric antigen vaccine technology, this variable is avoided because the Ag / Ab stoichiometry is maintained within the vaccine molecule. An added advantage is that the DHBV chimeric antigen vaccine does not have to rely on circulating antigens for presentation.

[0056] 2. Generation of DHBV core chimeric antigen vaccine

[0057] 2.1 Replication and Expression

[0058] This section describes the methodology used for cloning the DHBV core chimeric antigen vaccine, DHBV core and the TBD components using the "Bac to bac" cloning system. This section describes the standardization of expression of proteins in High Five™ insect cells.

[0059] 2.2 pFastBacHTa TBD, parent plasmid construction

[0060] The mouse IgG1 DNA sequence encoding the amino acids of the CH1-Hinge-CH2-CH3 region was derived from mRNA isolated from a lympho-hybrid cell line (2C12) that produces mAb in response to HBsAg. Total mRNA was isolated using TRizol reagent (Thermo Fisher Scientific), and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Thermo Fisher Scientific). The PCR primers contained a linker sequence encoding a linker peptide -SRPQGGGS- with a unique Not I at the 5' end and a unique Hind III at the 3' end. The resulting cDNA contains (5' Not I)-linker sequence-CH1(VDKKI)-CH2-CH3-linker sequence-(3' Hind III). After digestion with the enzymes, the fragment was ligated into pFastBacHTa donor vector plasmid (Thermo Fisher Scientific) using the same restriction enzyme sites. The 5' primer used for PCR amplification was (sense) 5' TGTCATTCTGCGGCCG CAAGGCGGCGGATCCGTGGACAAGAAAATTGTGCCCAGG, and the 3' primer was (antisense) 5' ACGAATCAAGCTTTGCAGCCC AGGAGAGTGGGAGAG, which contained the Not I and Hind III sites, respectively.

[0061] The amplified DNA was digested with Not I and Hind III, the fragment was agarose gel purified and ligated into the pFastBacHTa vector plasmid, digested with the same restriction enzymes to generate the donor plasmid pFastBacHTa-TBD. This plasmid was used to generate E. coli DH10Bac to generate the recombinant baculovirus plasmid (described below). The accuracy of the DNA sequence and ORFs was confirmed by standard sequencing methods.

[0062] 2.3 pFastBacHTa DHBV core antigen and DHBV core-TBD fusion protein expression vector

[0063] DNA encoding the DHBV core antigen was generated in the plasmid pRSET B DHBV using the PCR methodology. The primers used were: Sense 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC, which contains the unique restriction enzyme site Nco I, and 3' antisense 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG, which contains the unique restriction enzyme site Not I. The amplified DNA was digested with Nco I / Not I and ligated with pFastBacHTa expression vector digested with the same two enzymes. This generated the expression vector pFastBacHTa DHBV core. This plasmid was used for transposition into DH10Bac to generate the recombinant baculovirus plasmid (using the baculovirus genome as a vector). The recombinant baculovirus plasmid was used to transfect Sf9 insect cells. The resulting baculovirus carried the gene for the DHBV core antigen and was used to express the protein DHBV core protein. The generation of pFastBacHTa DHBV Core-TBD plasmid was achieved through a similar protocol. The PCR amplified DNA was digested with Nco I / Not I, and the purified DNA fragment was ligated with the plasmid pFastBacHTa-TBD while digested with the respective enzymes. This generated the expression vector pFastBacHTa DHBV Core-TBD. This plasmid was used to generate a recombinant baculovirus that expressed the protein chimeric antigen DHBV Core-TBD.

[0064] 2.4 Transformation of E. coli DH5α

[0065] The ligated plasmid was used to transform E. coli Dh5α, the plasmid was isolated using standard protocols, the sequence and open reading frame were confirmed by sequencing, and the plasmid was used to transform E. coli DH10Bac to generate the recombinant baculovirus plasmid.

[0066] 2.5 Dislocations

[0067] The generation of the recombinant baculovirus plasmid is based on the "Bac-to-bac" cloning system (Thermo Fisher Scientific) using the bacterial transposable element Tn7 and site-specific transposition. This is accomplished in the E. coli strain DH10Bac. The DH10Bac cells contain the baculovirus plasmid. The baculovirus plasmid confers kanamycin resistance and a helper plasmid encoding a gene transposase, conferring resistance to tetracycline. The gene of interest is cloned into the donor plasmid pFastBacHTa, which has mini-Tn7 elements located next to the cloning sites. The plasmid is used to transform the E. coli strain DH10Bac. It contains a baculovirus shuttle plasmid (baculovirus plasmid) that contains the attachment site for Tn7 in the LacZα gene. Transposition interrupts the LacZα gene so that only recombination can generate a white population and can be easily selected. The advantage of using transposition in E. coli is that a single population contains only the recombinant baculovirus plasmid. The recombinant baculovirus plasmid is isolated using standard plasmid isolation protocols and used to transduce Sf9 insect cells to generate baculovirus expressing the recombinant protein. The sequence of events involved in recombination is shown in Figure 3.

[0068] The donor plasmids pFastBacHTa-TBD, pFastBacHTa DHBV Core, and pFastBacHTa DHBV Core-TBD were used to site-specifically transpose the cloned genes into baculovirus shuttle vectors (baculovirus plasmids). The recombinant pFastBacHTa plasmid and the gene of interest (TBD, DHBV Core & Core-TBD) were used to transform the DH10Bac cells for transposition to generate the recombinant baculovirus plasmids.

[0069] A 100 μL aliquot of the DH10Bac cells eliciting the antibody response was thawed on ice, the pFastBacHTa-based plasmid was added, and the mixture was incubated on ice for 30 minutes. The mixture was heat shocked at 42° C. for 45 seconds, then chilled on ice for 2 minutes. The mixture was then added to 900 μL of LB medium and incubated at 37° C. for 4 hours. The transformed cells were serially diluted to 10-1 and 10-2 in LB. 100 μL of each dilution was placed in an LB plate containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline, 100 μg / mL X-gal, and 40 μg / mL IPTG, and incubated at 37° C. for at least 36 hours.

[0070] The pFastBacHTa harbors gentamicin resistance, and the X-gal and IPTG were used to differentiate the white (recombinant baculovirus plasmid) from the blue (non-recombinant baculovirus plasmid) populations. The white populations were selected and inoculated into 2 mL of LB containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, and 10 μg / mL tetracycline and incubated overnight at 37° C. with mixing. A sterile loop was used to extract a small sample of the overnight culture, which was then smeared onto a fresh plate of LB broth containing 50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline, 100 μg / mL X-gal, and 40 μg / mL IPTG and incubated at 37° C. for at least 36 hours to confirm the white phenotype.

[0071] The recombinant baculovirus plasmids were isolated by standard protocols (Sambrook & Russell, 2001) and used for transfection after DNA samples were dissolved in 40 μL TE (10 mM Tris-HCL pH 8, 1 mM EDTA).

[0072] 2.6 Transduction and production of recombinant baculovirus

[0073] To produce the recombinant baculovirus, each of the baculovirus plasmids was transfected into Sf9 insect cells. Sf9 cells (9x105) were seeded into each well of a 6-well cell culture dish (35 mm well) in a 2 mL Sf 900II (Thermo Fisher Scientific) and allowed to attach for at least 1 hour at 27°C. Transfection was performed using Cellfectin reagent (Thermo Fisher Scientific) according to the protocol provided by the Sf9 cell supplier. Following transfection, cells were cultured at 27°C for 72 hours. The medium containing the baculovirus was collected and then stored in the dark at 4°C.

[0074] The efficiency of transfection was confirmed by checking the production of the baculovirus DNA. The isolated baculovirus DNA was subjected to PCR to check the inserted target gene. The expression of intracellular heterologous protein was confirmed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot using the 6xHis tag monoclonal antibody (Clontech) as a probe.

[0075] 2.7 Amplification of recombinant baculoviruses

[0076] Once the baculovirus production and protein expression have been confirmed, the virus production is amplified to produce a dense population of the baculovirus carrying the gene of interest. Amplifying the baculovirus at least two-fold is standard practice and this standard practice was followed in all protocols described herein. After the second round of amplification, the dense population of the baculovirus produced was quantified using a plaque assay according to the protocol described by the kit manufacturer (Thermo Fisher Scientifics). The most suitable dense population of the virus for infecting Sf9 insect cells and the optimal time point for the production of the desired protein were also established. Two protocols for expression in monolayer and suspension culture of Sf9 cells were also established.

[0077] 2.8 Expression of Recombinant Proteins

[0078] The recombinant baculoviruses were cultured at a standardized MOI using the High Five TMIt was used to infect insect cells. In suspension culture, cells were seeded at a density of 3x105 cells / mL and grown at 27.5°C with mixing at 138 rpm until the cell density reached 2-3x106 cells / mL. The recombinant baculovirus was added to the cells. For the expression of the DHBV protein, the MOI was 1-2 pfu / cell, and for TBD, 10 pfu / cell was used. The cultivation was continued for 48 hours at 27.5°C. The cells were extracted by centrifugation at 2500 rpm for 10 minutes at 4°C and used for purification of the recombinant protein. Unused portions of the cells were frozen in liquid nitrogen and stored at -70°C.

[0079] 2.9 Protein purification

[0080] The purification of the 6xHis tagged proteins is based on Ni-chelation affinity chromatography under denaturing conditions, followed by ion exchange chromatography. The protocols used for the purification of the different proteins are described in the next section.

[0081] 2.10 Dissolution and Solubilization

[0082] Cell pellets from 250 mL cultures were resuspended in approximately 30 mL of cold lysis buffer (6 M Guanidine HCl, 100 mM NaH2PO4, 10 mM Tris HCl, 10 mM Imidazole, pH 8.00). After freezing on ice for 10 min, the suspension cultures were sonicated (Sonicator 3000, Misonics Inc., 5 pulses / min at 60-65 watts with 5 min cooling in between). The lysate was further solubilized by stirring for 2 h at RT. Unsolubilized material was removed by centrifugation in a Beckman Avanti J25 centrifuge at 15,000 rpm for 30 min at 4° C. in a JA 25.50 rotor.

[0083] 2.11 Ni-NTA purification

[0084] A BioRad Econo column (1.5x12cm) was filled to capacity with 2.5ml (PV) of Ni-NTA Super Flow Microorganisms (Qiagen) and equilibrated with 20ml of lysis buffer. The swept solution was poured into the Ni-NTA Super Flow column to bind the target protein.

[0085] The column was washed with lysis buffer (approximately 30 column volumes) until the A280 stabilized. The column was further washed with approximately 30 column volumes of wash buffer (8 M urea in 100 mM NaH2PO4, 10 mM Tris, 20 mM imidazole, pH 8.0) until the A280 was less than 0.1. Proteins bound to Ni-NTA were eluted with elution buffer (8 M urea in 100 mM NaH2PO4, 10 mM Tris, 250 mM imidazole, pH 8.0) and fractions were collected per ml. The protein fractions with absorbance A280 higher than 0.05 (Ultrospec 4000 Spectrophotometer, Pharmacia Biotech) were collected using an Amicon Ultra centrifugal filter device (Millipore Amicon Ultra-15, 30,000 MWCO) to a final volume of 4-5 mL. To remove imidazole, samples were applied to a Sephadex G 25 (1.5x30 cm) column pre-equilibrated with 8 M urea containing 20 mM NaH2PO4 pH 7.4. The bound proteins were eluted from the column with the same buffer and the fractions containing the protein of interest were collected and used for ion exchange chromatography.

[0086] 2.12 Ion exchange chromatography using CM-Sepharose (DHBV core chimeric antigen vaccine and DHBV Core)

[0087] This procedure was used for the second stage purification for the DHBV core chimeric antigen vaccine and the DHBV core protein. A CM Sepharose (Pharmacia) column (1.5x15cm) was filled and equilibrated with 20mM sodium phosphate, 8M urea, pH 7.4. The protein purified by Ni-NTA affinity chromatography was applied to the column. The flow rate used for binding and subsequent elution was 1ml / min. The column was washed with the same buffer until the A280 was stable and close to baseline. The CM-Sepharose bound protein was eluted with an increasing linear gradient curve of sodium chloride (0-0.6M). The fractions containing the protein of interest were collected and the A280 was adjusted to 0.3 for the DHBV core chimeric antigen vaccine and 0.2 for DHBV Core. Samples were dialyzed against triplicate of the above buffer into 1 L of 20 mM sodium phosphate and 300 mM sodium chloride, pH 7.4.

[0088] 3. Immunological characterization of DHBV chimeric antigen vaccine

[0089] The next section describes the methodology used for isolation of the duck PBMCs and evaluation of the binding of the DHBV chimeric antigen vaccine to the duck PBMCs.

[0090] 3.1 Isolation and culture of duck PBMCs

[0091] The duck PBMCs were isolated from whole blood by Ficoll density gradient separation. Cells were then cultured overnight in 100 mm culture dishes with Iscove's modified Dulbecco's medium (I-DMEM) at 37° C. with 10% FBS. Non-adherent cells were removed by extensively washing the dishes with I-DMEM / 10% FBS. Adherent cells were mechanically removed from the dishes, washed with Dulbecco's PBS with 0.1% BSA, and used for evaluation of binding of the chimeric antigen vaccine.

[0092] 3.2 Binding of chimeric antigen vaccine to duck PBMCs

[0093] Adherent PBMCs were plated at 2x105 cells / well in wells of a 96-well plate. Cells were then incubated for 1 hour at 4°C in the presence or absence of DHBV core chimeric antigen vaccine, core, or TBD. In some cases, cells were pre-incubated with 3mM purified mouse IgG Fc fragment for 20 minutes at 4°C before adding antigen. After incubation with antigen, cells were washed and incubated with anti-mouse IgG-biotin Ab or anti-DHBV-Core-biotin Ab for 20 minutes. Cells were then incubated with Streptavidin-Cy-Chrome for 20 minutes, washed, and again incubated in suspension with 2% paraformaldehyde in DPBS. At least 20,000 binding events were generated using a FACSCalibur (BD Biosciences) and analyzed using CELLQuest software.

[0094] 3.3 FACS acquisition and analysis

[0095] Positive cell profiles were acquired using a FACSCalibur (BD BioSciences) with Cellquest acquisition and analysis software (BD). Viable cells, as determined by FSC and SCC distribution profiles, were gated and ≥10,000 binding events were acquired. To determine the percentage of positive cells, gates were set based on cells that received a negative control (synonymous control or cells labeled with F(ab′)2 goat anti-mouse Alexa-488 alone).

[0096] The percentage of specific positive cells was calculated as follows: (% positive cells in experimental sample - % positive cells in control group) x 100 100-% control positive cells

[0097] Relative mean fluorescent intensities (MFI) were determined as follows: MFI of experimental samples-MFI of control samples.

[0098] 3.4 Experimental animals and procedures

[0099] A group of ducks chronically infected with DHBV after hatching was used to evaluate the efficacy of the DHBV core chimeric antigen vaccine. The following section describes the procedures used for animal selection and experimentation.

[0100] 3.4.1 Generation and analysis of ducks chronically infected with DHBV

[0101] To generate ducks chronically infected with DHBV after hatching, ducklings from an uninfected flock were inoculated (iv) with 100–200 μL of DHBV-positive serum (>100 pg DHBV DNA / 10 μL, i.v. test). Birds 1–3 days after hatching and at 3 weeks were tested for DHBV infection by serum i.v. test, and animals showing positive virosis were selected for study. Animals showing positive results in the first DHBV DNA i.v. test, animals with DHBV virosis <10 pg / 10 μL at 3 weeks, or animals with other obvious health problems were excluded from the study.

[0102] 3.4.2 Confirmation of serum DHBV DNA by DNA infusion testing

[0103] 10 μL of serum was applied to a Hybond-N+ nylon membrane (Amersham Biosciences UK Limited) with alkaline denaturation and UV cross-linking. The membrane was hybridized in 7% SDS / 6xSSC at 65°C for 16 hours after a 2-hour hybridization preparation step. A DHBV probe was made on a monomeric copy of the DHBV DNA in the plasmid pAltD2-8 using a Random Primer Kit (Thermo Fisher Scientific). The membrane was washed twice for 15 minutes in 0.1% SDS / 2xSSC and again for 215 minutes in 0.1% SDS / 0.2xSSC. Signals were quantified based on comparison with a plasmid standard of known concentration applied to the same membrane.

[0104] 3.4.3 Antibody levels in duck serum

[0105] The levels of antibodies in the duck sera were measured by ELISA method. ELISA dishes were coated with either recombinant DHBV core antigen or DHBV PreS antigen (1 μg / mL, 100 μL / well) overnight at 4°C. The dishes were washed with washing buffer and then blocked with 2% BSA / PBS at RT for 1 h. All samples were diluted in 100 μL of 2% BSA / PBS (1:50) per well, incubated at 37°C for 1 h, washed, and then incubated with goat anti-duck IgG-HRP (1:4000) at 37°C for 1 h. The culture dishes were washed with the washing buffer, and the chromogen ABTS (KPL, MD, USA: 2,2'-azino-di-(3-ethylbenzthiazoline-6-sulfonic acid) was added to each well (100 μL / well), and the culture dishes were incubated for 10 min at RT. The developed color was measured at 405 nm.

[0106] 4. Vaccine Protocol

[0107] 4.1 Efficacy of DHBV core-TBD (chimeric antigen vaccine) on ducks with chronic DHBV infection

[0108] A group of ducks infected with DHBV after hatching were used for the experiment. The experimental group received the DHBV core-TBD chimeric antigen vaccine (20 μg, 150 αl buffer) subcutaneously once a week for the first 5 weeks, followed by 40 μg, 300 μl buffer once every 4 weeks until the end of the experiment. The control group received the same regimen and injection of the same amount of buffer (20 mM NaH2PO4, 300 mM NaCl, pH 7.4) as the other groups. The ducks were 3-4 weeks old when vaccination began. The experimental period was 33 weeks.

[0109] 4.2 Efficacy of treatment with lamivudine and DHBV core chimeric antigen vaccine on DHBV-infected ducks

[0110] Ducks infected with DHBV (3-4 weeks old) were treated with 3TC (lamivudine) intramuscularly (20 mg / kg / day, twice daily) for 16 days before vaccination began and continued for 10 weeks. Starting at the 12th week of the study, lamivudine vaccination was increased to 40 mg / kg / day in the same volume of the buffer and continued for 4 weeks, achieving complete viral suppression as monitored by DHBV DNA infusion assay.

[0111] The first group received the DHBV core chimeric antigen vaccine (40 μg, 300 μL buffer) subcutaneously once every 2 weeks, with the first injection being given 2 weeks after starting lamivudine treatment. The second group received the DHBV core (20 μg, 300 μL buffer) subcutaneously once every 2 weeks, with the first injection being given 2 weeks after starting lamivudine treatment. The third group received buffer (20 mM NaH2PO4 pH 7.4, 300 mM NaCl). The total study period was 24 weeks.

[0112] 4.3 Collection of tissue samples

[0113] Blood (0.1-0.2 ml) from ducks to be infected with DHBV after hatching was collected before infection and then (1 ml) at the first and third week of infection for evaluation of DHBV virosis and once every two weeks thereafter. Upon completion of the study, liver and spleen samples were frozen in liquid nitrogen. For histological and toxicological evaluation, tissues from the following organs were preserved in formaldehyde: liver, spleen, lungs, kidneys, heart, pancreas, duodenum, skin and muscle from inoculated and non-inoculated sites.

[0114] 4.4 Result evaluation

[0115] The outcome of the study was assessed through measurement of the serum DHBV DNA levels by drop testing (Section 3.4.2) and the antibody responses (Section 3.4.3). Serum SGPT (ALT) and other enzymes in the duck serum were measured using automated tests. Testing was performed through a contract with the CVPLD Veterinary Pathology Laboratory in Edmonton. Histology, pathology, and H+E staining of all tissues, and immunohistochemistry were performed at a contract laboratory (Histobest, Edmonton) using antibodies against DHBV Core and PreS proteins.

[0116] 5. Results

[0117] 5.1 Antigen-binding receptors in duck PBMCs

[0118] In mammalian systems, there are several ways that antigens can enter antigen-presenting cells, especially DCs (dendritic cells). Among them, receptor-mediated uptake is the most important. CD64 or FcγRI is a high affinity receptor that serves as an effective uptake mechanism for IgG-complexed antigens. After uptake, antigens can be processed and presented through Class I and Class II pathways. CD32 or FcγRII is a low affinity receptor that provides effective uptake of IgG-complexed antigens. Antigens can be processed and presented through Class I and Class II pathways. CD16 or FcγRIII is a low affinity receptor for IgG, a receptor whose antigen processing and presentation details are not well characterized. CD206 is a high affinity receptor for high mannose-containing antigens, and processing is mainly through Class II pathway. In addition to the receptor-mediated mechanism of antigen uptake, the other major pathways of antigen uptake are macrophages and microcytosis. The mechanism of antigen absorption in birds, especially in ducks, has not been well characterized (Schultz et al., 2004). Although there are very important differences between normal mammalian and avian immune systems, some similarities have been suggested (Sharma, 1997). The crystal structure of the Fcγ receptor identifies the binding site of Fc fragments in a variety of other species, and the duck receptor appears to have a highly similar recognition site (Sondermann et al., 2001). Based on this observation, the applicant performed several studies to evaluate the binding of the DHBV chimeric antigen vaccine to the duck PBMCs.

[0119] 5.2 Binding of DHBV chimeric antigen vaccine to duck PBMCs: Analysis by flow cytometry

[0120] Applicants investigated the ability of the DHBV chimeric antigen vaccine to bind to adherent PBMCs from the ducks. PBMCs were isolated from duck blood by Ficoll density gradient separation and cultured in I-DMEM / 10% FBS at 37° C. for 20 hours.

[0121] The culture dishes were washed to remove non-adherent cells, and the adherent cells were removed by mechanical separation and used for binding studies. Cells were incubated with the chimeric antigen vaccine (antigen) in PBS / 0.1% BSA for 1 hour at 4°C. The binding of the TBD region was recognized by goat anti-mouse IgG biotin and SA-Cy, and the core region was recognized by anti-duck core biotin mAb and goat anti-mouse Fab IgG FITC Ab. Data were obtained by flow cytometry to determine the % positive binding cells and the relative MFI (mean fluorescence intensity). The results are shown in Figure 4. Figure 4 shows that the fusion protein can bind to the duck PBMC. This binding was inhibited by the Fc fragment, suggesting that the Fc-specific receptors of the duck cells are involved in the binding of the chimeric antigen vaccine (Figure 5).

[0122] 5.3 Evaluation of the efficacy of chimeric antigen vaccines in chronically DHBV-infected ducks

[0123] A study was conducted in ducks infected with DHBV after hatching (chronic infection). The DHBV core chimeric antigen vaccine was tested in ducks infected after hatching (chronic infection) with and without prior treatment with lamivudine. The following section presents the results of this study.

[0124] 5.4 Evaluation of the efficacy of DHBV core chimeric antigen vaccine in chronically DHBV-infected ducks

[0125] Ducks chronically infected with DHBV were treated with the DHBV core-TBD chimeric antigen vaccine or with the same amount of the DHBV core protein as described above. Control groups were inoculated with the buffer used for injections.

[0126] 5.4.1 A significant reduction in viral disease was observed in ducks treated with the core chimeric antigen vaccine

[0127] Blood samples were collected from chronically DHBV-infected ducks at different time points during treatment, and DHBV DNA levels were measured by DNA instillation. In ducks infected with DHBV after hatching, a reduction in DHBV DNA sera was observed 18 weeks after vaccination with the core chimeric antigen vaccine, but the effect was less clear at later time points (Figure 6). In addition, there was a reduction in virosis in some ducks in the control group. It is unclear whether this effect is due to a temporary reduction in the virus.

[0128] 5.4.2 Anti-Core antibody levels in chronically DHBV-infected ducks increased after vaccination

[0129] As described above, anti-Core antibody levels were measured through serum collected from the ducks at different time points during treatment. The results for the chronically infected group, shown in Figure 7B, indicate that antibody levels were increased when compared to the control group in Figure 7A.

[0130] 6. Fusion therapy: evaluation of the efficacy of a core chimeric antigen vaccine in chronically DHBV-infected ducks pretreated with lamivudine (3TC)

[0131] It has been postulated that one of the mechanisms by which HBV induces host resistance is by producing large amounts of virus and viral proteins to saturate the host's immune system. By inference, the reduction in virosis and the resulting concentration of viral antigens should be useful in generating an immune response during therapeutic vaccination.

[0132] This possibility was tested in post-hatch DHBV-infected ducks pre-treated with 3TC as described above, and the results of this experiment are presented in the next section.

[0133] 6.1 He received 3TC treatment with DHBV core chimeric antigen vaccine. Ducks chronically infected with DHBV to throw Given effect

[0134] As mentioned above, ducks are After prior treatment with 3TC, Immunization with the DHBV core chimeric antigen vaccine I started to do DHBV virulence in the duck serum, as determined by DHBV DNA instillation assay, is shown in Figure 8B, in comparison to the control group, shown in Figure 8A. The results indicate that in some animals the onset of virulence re-expansion is delayed.

[0135] 6.2 Intrahepatic inflammatory enzymes in vaccinated ducks did not show any significant changes as a result of vaccination.

[0136] The DHBV core chimeric antigen vaccine did not induce a significant increase in inflammatory enzymes in the 3TC pre-treated and post-hatch infected duck group. The results of this experiment are shown in Figures 9 and 10. The following liver enzymes were assayed in serum samples from the duck group and used in this study: SGOT (AST), SGPT (ALT), sorbitol dehydratase-AO, alkaline phosphatase, and gamma glutamyl transferase (GT). The results of ALT and AST measurements in three ducks, one in each control group, are shown in Figures 9 and 10, respectively. Although there were no notable changes in the experimental group compared to the control group, there were significant variations in values ​​in all animals. There were no vaccine-related deaths in this group of ducks.

[0137] 7. Summary of Results

[0138] In chronically DHBV-infected ducks, the DHBV core chimeric antigen vaccine reduced virulence up to 18 weeks compared to controls, but this effect was not sustained in the long term, possibly due to a lack of memory T cells in birds. Co-treatment with 3TC and the core chimeric antigen vaccine delayed the time of virus re-expansion after 3TC administration was discontinued compared to controls. Chronically infected ducks showed increased antibody levels to the DHBV core chimeric antigen vaccine. There were no notable adverse reactions to the vaccine, and no morbidity or mortality was associated with administration of the chimeric antigen vaccine.

[0139] Example 2. Evaluation of HBV core chimeric antigen vaccine as an immunotherapy for the treatment of chronic infection (Study conducted by NIH USA, Expt. No. NHA-77, October 2007)

[0140] 1. Design of HBV core chimeric antigen vaccine

[0141] The HBV core chimeric antigen vaccine monomer fusion protein is shown diagrammatically as follows: (N-term) 6xHis-rTEV protease site-HBV core protein-----[IRD]------Linker peptide-Part CH1-CH2-CH3-Peptide(C-term)[TBD], see FIG. 11.

[0142] 2. Transgenic Mouse Model for Treatment of Chronic HBV Infection

[0143] HBV transgenic mice are experimental models developed to study HBV infection, viral replication, and various therapeutic approaches, including immunotherapy. The immune response to the HBV core chimeric antigen alone and in combination with an HBV antiviral drug, adefovir pivoxil (ADV), was examined.

[0144] 2.1 Materials and methods

[0145] animal:

[0146] Identical male and female HBV transgenic mice were used (22.2 ± 2.8 g). Mice were originally obtained from Frank Chisari (Scripps Research Institute, La Jolla, California) (Guidotti et al., 1995) and were then housed in the AAALAC (American Association for the Accreditation of Laboratory Animal Care)-accredited Laboratory Animal Research Center (LARC) at Utah State University in a Biosafety Level 3 (Bl-3) area. Animals were derived from founder 1.3.32. Hepatic HBV DNA was obtained and assayed via liver biopsy prior to the experiment and subsequently randomized into experimental groups. The study was approved by the Utah State University Animal Care and Use Committee and had an expiration date of June 8, 2008. The study was conducted at the AAALAC-accredited Laboratory Animal Research Center at Utah State University. US government (National Institutes of Health (NIH)) approval was updated on February 27, 2002 (Confirmation No. A3801-01) in accordance with the NIH Guide for the Care and Use of Laboratory Animals (revised in 1996).

[0147] Mice were not allowed to be weaned before 3 weeks or eat solid food and had to have persistently high liver HBV DNA titers. The use of such mice avoids the introduction of animals expressing liver HBV DNA at the limits of the assay. Applicants therefore utilized mice that were not weaned early and these mice were biopsied to obtain liver HBV DNA levels prior to the experiment.

[0148] Compound:

[0149] The HBV core chimeric antigen vaccine was prepared according to the instructions given above. The liquid form of the vaccine was diluted with buffer (final dialysis buffer) to the levels mentioned above and stored at 2-8°C for the duration of the experiment.

[0150] Adefovir pivoxil (ADV) was obtained from Gilead Sciences (Foster City, California) by Utah State University (USU). Permission was granted to use the ADV as a positive control. The ADV was prepared in citric acid (0.05M, pH 2.0), which was used to improve the solubility of the ADV in liquid suspension. The ADV was administered by oral gavage in a volume of 0.1 mL.

[0151] Liver HBV DNA potency assay:

[0152] Liver tissue was homogenized in lysis buffer immediately after necropsy. Tissue (approximately 0.1 g) was ground with a tight fitting pestle in a microcentrifuge tube containing lysis buffer (1 mM EDTA, 10 mM Tris, 10 mM NaCl, 0.5% SDS, protease K). After incubation at room temperature for 5-10 min, the tubes were frozen in liquid nitrogen for storage. For DNA extraction, samples were incubated at 55°C for 2-4 h. The samples were homogenized in Phaselock 1000 with 150 μL water and 350-500 μL phenol. TMThe pellet was poured into a gel tube. After shaking at 12,000 rpm for 15 min and centrifugation, the contents were poured into a second tube containing 350-500 μL of chloroform. After centrifugation, the DNA was precipitated with 50 μL 5 M sodium chloride and 650 μL of isopropanol and washed with 70% ethanol. The dried pellet was spread evenly in 500 μL TE buffer containing 1 μL Rnase and incubated overnight at 55°C with occasional shaking. The DNA solution, with the indicated amount, usually containing 40 μg, was digested with Hind III enzyme during a 3-h incubation period at 37°C (New England Biological Laboratories, Beverly, Massachusetts). It was found that Hind III does not cleave within the HBV transgene sequence. The digested DNA was separated by electromigration using agarose gels buffered with 1% TAE at 80 V for 3-4 h. The DNA was then transferred to a BioDyne™ B positively charged nylon membrane by the alkaline transfer method. The following modifications were observed when using the alkaline transfer method: 1) the gel was soaked in 0.4 M sodium hydroxide for 15-30 min. 2) the nylon membrane was soaked in water and then in 0.4 M sodium hydroxide for 5 min. The sponge used for transfer was also soaked thoroughly in 0.4 M sodium hydroxide. The treated gel was placed on top of the sponge absorbent paper (welled side down). Transfer took place for 3 hours, after which the gel was discarded and the nylon membrane was washed in 0.2 M Tris (pH 7.6), 2xSSC, and 0.1% SDS solution. The membrane was baked at 80°C for more than 30 min and fixed by UV ultraviolet light using a UV Stratalinker™ 1800 (Stratagene, La Jolla, CA). Before hybridization, the filters were washed twice for 30 min with neutralizing solution 0.1x SSC and 0.1% SDS.Hybridization with an HBV genomic probe (digested with Hae III) labeled with [32P]CTP cloned into the pBluscript plasmid (gift of Dr. Luca Guidotti, Scripps Research Institute, La Jolla, CA) was developed overnight at 60°C in 10% PEG-8000, 0.05 M NaPO4, 0.21 mg / ml salmon sperm DNA, and 7% SDS.

[0153] The radioactive signal was measured using a phosphorescence imaging method (Optiquant). Images of the UV filter were taken overnight using Cyclone TM The exposed screen was exposed through a storage phosphor screen (PerkinElmer Multisensitivity Medium, type MSPPN7001723). TM The cells were transferred to drums and read using a 600 dpi setting. The ratio of viral DNA binding to transgene binding was used to determine the concentration of viral DNA per host DNA. This calculation is based on the presence of 1.3 transgene cells per host cell in the transgenic mouse species (personal communication with Dr. F. Chisari). The transgene was used as an internal index to calculate pg of HBV DNA per μg of homotypic cell host DNA.

[0154] Liver HBcAg potency assay:

[0155] For Hepatitis B core antigen (HBcAg) testing, liver biopsies were first embedded in paraffin. The paraffin was then removed from the sections by treating with xylene twice for 5 min. Tissues were fixed by treating with 95% ethanol twice for 3 min. Sections were treated with deionized water for 3 min, exposed to 3% hydrogen peroxide for 5 min, and exposed to biotin block (#X0590, Dako Corporation) for 5 min. Primary antibody, rabbit anti-HBcAg (1:100 dilution) (#B0586, Dako Corporation), goat anti-rabbit secondary antibody (#k684 Dako, LSAB peroxidase kit), streptavidin peroxidase (#K684 Dako, LSAB peroxidase kit), and substrate chromogen solution (3-amino-9-ethylcarbazole (AEC)) were added for periods of 30 min, 30 min, 10 min, and 10 min, respectively. Sections were counterstained with Mayer's hematoxylin before mounting.

[0156] Three different parameters were obtained from each tissue section. The first two measurements were based on the observation that cells surrounding the central veins of the liver stain more intensely than in other areas of the liver (personal observation) and that drugs administered intraperitoneally approach venous luminal cells more quickly. The first two parameters were obtained by counting the number of cells surrounding the central veins. The total number of cells, the number of cells with stained nuclei, and the number of cells with stained cytoplasm surrounding the central veins were calculated. The number of cells with stained nuclei or the number of cells with stained cytoplasm was divided by the total number of cells. Three central vein areas were calculated for each slide sample. For the third parameter, the number of cells with stained nuclei in areas that were not central vein areas was counted. One-quarter of the total area was counted. The three areas were counted as the number of cells per liver section. The identity of the samples was blinded to the person reading the slides.

[0157] Serum HBeAg:

[0158] Total blood samples were obtained at necropsy by cardiac puncture. Total blood was then transferred to glass bottles containing heparin and centrifuged for collection of serum components. 10 μL of the serum was then diluted with 90 μL of negative control serum to give a dilution ratio of 1:10 for each sample. Samples along with serial dilutions of positive control and calibrator diluent were run in an HBeAg-specific ELISA (International Immuno Diagnostics, Foster City, CA) according to the manufacturer's instructions. Using a unit known as the calibrator PEI unit, PEI units were formed for serial dilutions of positive serum. A graph was generated and extrapolation was used to assign a high confidence level PEI unit value (R2 value 0.9816) to each sample (R2 value 0.9816). The ELISA product's acceptance criteria were also used.

[0159] Serum HBsAg:

[0160] The same serum samples collected and prepared for the HBeAg ELISA were used for the HBsAg ELISA. 15 μL of serum was diluted in the same manner and run in an HBsAg-specific ELISA (International Immuno Diagnostics, Foster City, CA) according to the manufacturer's instructions. Both the product's limit table (with blank correction) and the manufacturer's limit formula (without blank correction) were then analyzed.

[0161] Cytokine Array-Plasma:

[0162] The same serum samples collected and prepared for HBeAg and HBsAg ELISA were also used for serum cytokine assays. 5 μL of serum was diluted with 120 μL of sample dilution buffer, which gave a dilution ratio of 1:25 for each sample. 30 μL of the prepared sample was run on a Q-Plex™ Mouse Cytokine Array (Quansys Biosciences, Logan, Utah) according to the manufacturer's instructions. The fully developed cytokine dish was then captured as a tif image on a Fuji LAS-3000 Luminescence Image Analyzer (Fuji Life Sciences, Stamford, Connecticut) and analyzed with Quansys Array Software™, version 1.3.

[0163] Cytokine Array-Liver and Spleen:

[0164] Liver and spleen tissues (approximately 35 mg each) were collected during necropsy and rapidly homogenized in sterile PBS containing 0.1% Np-40. The homogenized samples were then frozen in liquid nitrogen until assays were performed. Immediately prior to assays, samples were rapidly thawed to remove solid clumps and centrifuged at 3000 rpm for 20 min. The supernatants were then diluted 1:5 in sample dilution buffer and run on a Q-Plex™ Mouse Cytokine Array (Quansys Biosciences, Logan, Utah) according to the manufacturer's instructions. The fully developed cytokine dishes were then captured as tif images on a Fuji LAS-3000 Luminescence Image Analyzer (Fuji Life Sciences, Stamford, Connecticut) and analyzed by Quansys Array Software™, version 1.3.

[0165] Plasmid interferon-gamma potency assay:

[0166] An IFN-γ ELISA kit (BDOpt EIA ELISA Set Mouse IFN-g Kit, cat.# 551866) was used to assay plasma collected on days 1, 14, 35 and 56 after the first vaccination.

[0167] Plasma Chemistry Panel:

[0168] Specifically, a VetScan® chemistry, electrolyte and T4 analyzer designed for veterinary medicine was used in the BL-2 laboratory to process samples into a "Comprehensive Diagnostic Profile." The "Comprehensive Diagnostic Profile" includes ALT, BUN, creatinine, total bilirubin, albumin, alkaline phosphatase, globulin, glucose, Na+, K+, phosphorus, and total protein. The protocol for the machine was also followed.

[0169] Liver HBV RNA:

[0170] Real-time RT-PCR was used to assay HBV-specific RNA in liver biopsy tissue. Total RNA from the tissue was purified using Trizol TMThe HBV3 probe / primer pair was used as a control because there were no notable differences between the two pairs. Duplex polymerase chain reaction was performed with a mouse GAPDH primer / probe internal control. The primers and probe were forward GCATCTTGGGCTACACTGAGG, reverse GAAGGTGGAAGAGTGGGAGTTG, and probe [5HEX]-ACCAGGTTGTCTCCTGCGACTTCAACAG-[BHQ1a5HEX]. One-Step FullVelocity™ QRT-PCR Master Mix (Stratagene, La Jolla, CA) was used for RT, amplification of HBV RNA, and mouse GAPDH, and primers and probe were set to a final concentration of 0.1 μM. Two microliters of total cellular RNA was extracted from infected and control tissues. Samples were run in a DNA Engine Opticon 2 (MJ Research Inc, Waltham, MA). The 25 μL reaction consisted of 12.5 μL FullVelocity™ QPCR Master Mix, 0.375 μL diluted Reference Dye (1:500), 0.25 μL Stratascript™ RT / RNase Blocking Enzyme Mix, and 0.5 μL FullVelocity™ Enzyme. The reaction contained 0.25 μL of the two HBV-primers, 0.25 μL of the two GAPDH-primers, and 0.25 μL of the two probes, all at 10 μM stock concentration.Reverse transcription of cellular RNA was performed at 50°C for 30 min, and PCR was performed at 95°C for 1 cycle for 2 min, followed by 40 cycles at 95°C for 10 s, and 60°C for 30 s. Potency assays were performed with 10 dilutions of liver RNA extracted from the HBV transgenic mice to obtain a standard curve. The Y-axis shows the volume of one of the 10 dilutions, and the X-axis shows the C value. The R2 value was used to measure the quality of the curve and was always above 0.098. The average C(t) value was obtained for each sample replicate. The average C(t) value of each sample was used to obtain the log relative RNA value using the formula for the fit line of the standard curve.

[0171] Statistical analysis:

[0172] One-way analysis of variance was performed using the Newman-Keuls multiple comparison test with Prism 4 (Graph Pad Software, Inc.).

[0173] 2.2 Experimental design

[0174] The experimental design is shown in Table 1. The HBV transgenic mice with measurable HBV DNA expression in liver biopsies prior to the experiment were randomly selected between groups. In this case, one of seven treatment groups, as shown below, received subcutaneous (intradermal) treatment on days 0, 21, and 42. Heparinized plasma was collected on days 14, 35, and 56, two weeks after each vaccination. On day 56, mice were euthanized prior to collection of liver and final plasma. Plasma was titrated with IFN-γ (shipped to supplier) and ALT (plasma HBV antigen if sufficient amounts remained). Livers were collected for HBV DNA and cytokine arrays. Three liver tissues were frozen for backup. [Table 1]

[0175] 2.3 Results

[0176] The HBV core chimeric antigen vaccine alone failed to significantly affect hepatic HBV DNA as measured by real-time PCR (Figure 12A) or Southern blot hybridization (Figure 12B). As expected, AD V 5 mg / kg / day reduced hepatic HBV DNA. The HBV liver RNA was not significantly altered by the vaccine (FIG. 13B). These results suggest that the resistance of transgenic mice was not broken by the vaccine.

[0177] Plasma ALT was increased in both transgenic and non-transgenic mice treated with higher doses of HBV core vaccine (2.5-5.0 μg / mouse), whereas it was not increased in animals treated with carrier buffer, indicating that the vaccine alone caused the release of ALT from blood cells (FIG. 13A). However, the vaccine did not cause any toxicity in terms of changes in total body weight (FIG. 14).

[0178] Quansys TMAccording to the array, the HBV core vaccine, which contains IFN-γ, did not noticeably affect the cytokine arrays on the day of necropsy for liver (Figures 15A-15P), plasma (Figures 16A-16P), and spleen (Figures 17A-17P) tissues. Since IFN-γ can be an indicator of virus-specific cytotoxic T cells (CTL), the applicants collected plasma two weeks after each vaccination and performed potency assays using a mouse IFN-γ specific ELISA kit. For example, plasma was collected on days 14, 35, and 56, with day 1 serving as the control baseline (Figures 18A-18D). The baseline (wavy line) was calculated by three standard deviations of the mean so that samples above the baseline could be considered positive for IFN-γ. Samples from four mice collected before administration of the vaccine (day 1) were above the baseline (Figure 18A). This is likely due to erroneous antigens in the environment and not due to HBV-specific CTL responses. The same number of plasma samples, four and three, taken on days 14 (FIG. 18B) and 35 (FIG. 18C), respectively, were also above the baseline, which was due to erroneously elevated CTL responses. However, nine samples on day 56 (FIG. 18D) were above the baseline, and six of the samples had higher IFN-γ values ​​than the other samples at the earliest time points. FIG. 19 shows the combined values ​​for the number of mice treated with HBV core vaccine. Even though the groups were not statistically different, the day 56 sample had a notably higher IFN-γ value, suggesting that the vaccine, administered a total of three times at two-week intervals, may have broken resistance to HBV in the transgenic mice.

[0179] 2.4 Summary

[0180] Three doses of subcutaneous vaccination given 2 weeks apart could abolish resistance to HBV in some transgenic mice, as confirmed by an increase in plasma IFN-γ. [Prior art documents] [Non-patent literature]

[0181]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Direct Environment 7

Outdoor Track 8

Outdoor Tools9

Outdoor Tools 10

Outdoor Content11

Outdoor Tools 12

Outdoor Content13

Outdoor Tools 14

Outdoor Tools 15

Outdoor Tools 16

Outdoor Track 17

Outdoor Tools 18

Outdoor Tools 19

Outdoor Tools20

Direct Environment21

Outdoor Tools22

Optional Trademark23

Optional Trademark24

Direct Entries 25

Direct Entries 26

Non-Patent Document 27

Non-Patent Document 28

Non-Patent Document 29

Direct Entries 35

Direct Entries 36

Direct Entries 37

Direct Entries 38

Direct Entries 39

Outdoor Track 40

Optional Trademark41

Outdoor Tools 42

Non-Patent Document 43

Non-Patent Document 44

Non-Patent Document 45

Non-Patent Document 46

Non-Patent Document 47

Non-Patent Document 48

Non-Patent Document 49

Non-Patent Document 50

Non-Patent Document 51

Non-Patent Document 52

Direct Entries53

Direct Entries 54

Direct Entries 55

Direct Entries 56

Non-licensed Document 57

Non-licensed Document 58

Non-licensed Document 59

Non-licensed Document 60

Direct Entries 61

Direct Environment 62

Direct Entries 63

Direct Entries 64

Non-Patent Document 65

Non-Patent Document 66

Non-Patent Document 67

Claims

1. 1. A composition for treating HBV infection in a host comprising an HBV Core-heterotype Fc fragment chimeric antigen and a therapeutic agent that reduces HBV levels in a host, the therapeutic agent is an HBV (human hepatitis B virus) antiviral agent, the host is a human; The therapeutic agent and the HBV Core-heterotype Fc fragment chimeric antigen are administered three times at intervals of once every two weeks, such as on days 0, 21, and 42 of the treatment, the dosage of the HBV Core-heterotype Fc fragment chimeric antigen is 0.498 mg / human, and the dosage of the therapeutic agent is 0.0705 mg / kg-0.0767 mg / kg; A composition, wherein the HBV antiviral agent comprises one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil and lamivudine.

2. The composition of claim 1 , wherein the HBV antiviral agent further comprises an HBV antiviral RNAi agent that inhibits HBV replication.

3. 10. The composition of claim 1, wherein the HBV antiviral agent further comprises a core capsid assembly inhibitor.

4. 10. The composition of claim 1, wherein the HBV antiviral agent further comprises a Toll-like receptor (TLR) agonist.

5. The composition of claim 1 , further comprising an immunomodulatory agent.

6. 6. The composition of claim 5, wherein the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a.

7. 6. The composition of claim 5, wherein the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor.

8. an HBV Core-heterotypic Fc fragment chimeric antigen and a therapeutic agent for reducing HBV levels in a host; and a package insert or label having information such as precautions for treating HBV infection in a host by administering the HBV Core-heterotype Fc fragment chimeric antigen and the therapeutic agent to the host, the therapeutic agent is an HBV (human hepatitis B virus) antiviral agent, the host is a human; The information on precautions, etc. includes precautions for use and handling that the therapeutic agent and the HBV Core-heterotype Fc fragment chimeric antigen are administered three times at intervals of once every two weeks, such as on days 0, 21, and 42 of the treatment, that the dose of the HBV Core-heterotype Fc fragment chimeric antigen is 0.498 mg / human, and that the dose of the therapeutic agent is 0.0705 mg / kg-0.0767 mg / kg, The therapeutic agent and the HBV Core-heterotype Fc fragment chimeric antigen are administered in accordance with the precautions and other information. The kit, wherein the HBV antiviral agent comprises one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil, and lamivudine.

9. The kit of claim 8 , wherein the HBV antiviral agent further comprises an HBV antiviral RNAi agent that inhibits HBV replication.

10. The kit of claim 8, wherein the HBV antiviral agent further comprises a core capsid assembly inhibitor.

11. The kit of claim 8, wherein the HBV antiviral agent further comprises a Toll-like receptor (TLR) agonist.

12. The kit of claim 8, further comprising an immunomodulatory agent.

13. The kit of claim 12, wherein the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a.

14. The kit of claim 12, wherein the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor.

15. 1. Use of an HBV Core-heterotype Fc fragment chimeric antigen and a therapeutic agent for reducing HBV levels in a host in the manufacture of a composition for treating HBV infection in a host, comprising: the therapeutic agent is an HBV (human hepatitis B virus) antiviral agent, the host is a human; The therapeutic agent and the HBV Core-heterotype Fc fragment chimeric antigen are administered three times at intervals of once every two weeks, such as on days 0, 21, and 42 of the treatment, the dosage of the HBV Core-heterotype Fc fragment chimeric antigen is 0.498 mg / human, and the dosage of the therapeutic agent is 0.0705 mg / kg-0.0767 mg / kg; The HBV antiviral agent comprises one or more compounds selected from the group consisting of tenofovir, tenofovir disoproxil fumarate, tenofovir alafenamide, entecavir, telbivudine, adefovir dipivoxil and lamivudine.

16. The use of claim 15, wherein the HBV antiviral agent further comprises an HBV antiviral RNAi agent that inhibits HBV replication.

17. 16. The use of claim 15, wherein the HBV antiviral agent further comprises a core capsid assembly inhibitor.

18. 16. The use of claim 15, wherein the HBV antiviral agent further comprises a Toll-like receptor (TLR) agonist.

19. 16. The use of claim 15 further comprising an immunomodulatory agent.

20. 20. The use according to claim 19, wherein the immunomodulatory agent is an interferon, such as pegylated interferon alpha-2a.

21. 20. The use according to claim 19, wherein the immunomodulatory agent is an immune checkpoint inhibitor, such as a PD1 / PDL1 inhibitor.

Images