Modified TCR and method for producing same

Abstract

The present invention aims to provide a modified T cell receptor (TCR) that does not induce antigen responsiveness and that allows the CD3 subunit to be retained in the cell membrane and function. The present invention relates to a modified TCR comprising a first polypeptide and a second polypeptide, wherein the first polypeptide is a polypeptide that comprises the constant region of human TCR α or a fragment of the constant region but does not contain the variable region of human TCR α, and the second polypeptide is a polypeptide that comprises the constant region of human TCR β or a fragment of the constant region but does not contain the variable region of human TCR β.

Description

[Technical field]

[0001] The present invention relates to a modified TCR and a method for producing the same. [Background technology]

[0002] T cells are one of the immune cells derived from hematopoietic stem cells. T cells express the α chain (TCRα) and β chain (TCRβ) of the T cell receptor (TCR) on the cell surface, and the TCRα and TCRβ form a heterodimer. TCRα and TCRβ are composed of variable and constant regions with sequence diversity, respectively, and specifically recognize major histocompatibility complex (MHC)-peptide complexes on target cells by the antigen recognition site formed by the variable region of the TCRα / TCRβ heterodimer. In addition, the antigen recognition site of the TCRα / TCRβ heterodimer recognizes whether the target cell is self or non-self, and is thought to be involved in non-self recognition responses (allo-reactions) in vivo.

[0003] In addition, the TCRα / TCRβ heterodimer forms a complex with the CD3 subunit (CD3ε, CD3δ, CD3γ, and CD3ζ). The TCRα / TCRβ heterodimer itself is specialized for recognizing and binding to antigens, and does not have the ability to transmit signals by itself. Instead, the intracellular region of the CD3 subunit is phosphorylated and activated by various adapter molecules, co-receptors, or enzyme molecules that are assembled in response to antigen recognition via TCR, and the signal of antigen stimulation is transmitted further downstream. This TCR / CD3 complex signal not only functions as a survival signal or an exclusion signal in the positive or negative selection that immature T cells undergo during the T cell differentiation process in the thymus, but also functions as an activation signal or a proliferation signal in T cells that have migrated to the periphery after maturation in the thymus.

[0004] T cells are broadly classified into helper T cells and cytotoxic T cells, and T cell therapy utilizing the antitumor effect of cytotoxic T cells has been developed. As a T cell therapy using autologous T cells, CAR-T therapy, which expresses chimeric antigen receptors (CAR) on T cells to treat tumors and infectious diseases, has been put into practical use and has already been approved as a cell medicine in Europe and the United States. In the future, a therapeutic method using allogeneic T cells will be required to reduce the burden on patients associated with T cell collection, improve the quality of T cells, and reduce manufacturing costs.

[0005] However, in the case of allogeneic T cell therapy, various TCRα / TCRβ heterodimers in allogeneic T cells induce strong alloreactions, which can cause tissue damage, i.e., the onset of graft-versus-host disease (GVHD). At present, in order to solve this problem, attempts are being made to reduce or eliminate alloreactions by knocking down or knocking out TCR genes (Non-Patent Documents 1 and 2).

[0006] In recent years, a method of inducing differentiation of T cells from induced pluripotent stem (iPS) cells established from allogeneic T cells has been proposed as a means of producing homogeneous and highly functional T cell preparations without relying on donors (Non-Patent Documents 3, 4, and 5).

[0007] Furthermore, in order to provide more versatile T cell preparations derived from allogeneic iPS cells, a method has been proposed in which an iPS cell bank established from blood cells (non-T cells) of a donor that has a homozygous human leukocyte antigen (HLA) haplotype, which is the human MHC, is utilized (Non-Patent Document 6).

[0008] To efficiently induce differentiation of T cells from non-T cell-derived iPS cells, it is believed to be important to rearrange functional TCR loci during differentiation and stimulate the TCR / CD3 complex formed thereby in vitro to promote proliferation and survival (Non-Patent Document 7). [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Okamoto S. et al, Cancer Res. 69: 9003-9011, 2009 [Non-Patent Document 2] Qasim W. et al, Sci Transl Med. 9, 2017 [Non-Patent Document 3] Nishimura T. et al, Cell Stem Cell. 12: 114-226, 2013 [Non-Patent Document 4] Vizcardo R. et al, Cell Stem Cell. 12: 31-36, 2013 [Non-Patent Document 5] Themeli M. et al, Nat. Biotechnol. 31: 928-33, 2013 [Non-Patent Document 6] Arata Kaneko, Modern Medicine 69: 724-733, 2014 [Non-Patent Document 7] Minagawa et al., Cell Stem Cell. 23: 1-9, 2018 Summary of the Invention [Problem to be solved by the invention]

[0010] However, when the TCR gene is knocked down or knocked out, the CD3 subunit is no longer retained on the cell membrane surface, and therefore proliferation and survival signals mediated by the TCR / CD3 complex cannot be received. This means that, for example, CD3 agonist antibodies used to expand donor-derived T cell preparations ex vivo will no longer work, posing a challenge in the efficient production and formulation of cellular medicines containing allogeneic T cells.

[0011] In the above-mentioned problem, in order to allow desired T cells to proliferate and survive at an appropriate time through CD3 signals, it is desirable that the TCRα / TCRβ complex is expressed on the cell surface. In addition, in order to prevent non-self recognition responses by allogeneic T cells, it is desirable that the TCRα / TCRβ complex does not recognize non-self antigens such as non-self HLA-peptide complexes.

[0012] Therefore, an object of the present invention is to provide a modified TCR that does not induce antigen responsiveness, retains the CD3 subunit on the cell membrane, and is capable of mediating CD3 signaling. [Means for solving the problem]

[0013] In order to achieve the above object, the present inventors designed TCRα deletion mutants and TCRβ deletion mutants in which the variable and constant regions of TCRα and TCRβ, respectively, were progressively deleted, and then introduced combinations of these deletion mutants into 293T cells that constitutively express the CD3 subunit and Jurkat cells in which the endogenous TCR had been knocked out, to examine whether CD3 subunit expression could be observed on the cell membrane surface.

[0014] As a result, it was revealed that a modified TCR comprising a polypeptide not containing the variable region of TCRα and comprising the constant region of TCRα or a fragment of said constant region, and a polypeptide not containing the variable region of TCRβ and comprising the constant region of TCRβ or a fragment of said constant region, can retain the CD3 subunit on the cell membrane, and induces T cell activation by stimulating the CD3 molecule presented on the cell surface by said modified TCR. In other words, it was found that by expressing said modified TCR in T cells in which endogenous TCR expression has been suppressed or eliminated, a stimulation response via the TCR / CD3 complex is possible without inducing antigen responsiveness, and the present invention has been completed.

[0015] That is, the present invention provides the following inventions. 1. A modified T cell receptor (TCR) comprising a first polypeptide and a second polypeptide, the first polypeptide is a polypeptide comprising a constant region of human T cell receptor alpha (TCRα) or a fragment of said constant region, and not comprising a variable region of human TCRα; The second polypeptide is a modified TCR, which is a polypeptide that includes the constant region of human T cell receptor β (TCRβ) or a fragment of the constant region, and does not include the variable region of human TCRβ. 2. The modified TCR according to 1 above, wherein the constant region of human TCR α or a fragment of said constant region is a polypeptide according to any one of (A1) to (A3) below. (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 1 to 11; (A3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11, in which one or several amino acids have been substituted, inserted, deleted and / or added. 3. The modified TCR according to 1 or 2 above, wherein the constant region of human TCR β or a fragment of said constant region is a polypeptide according to any one of (B1) to (B3) below. (B1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added. 4. The modified TCR described in any one of 1 to 3 above, wherein the constant region or a fragment of the constant region of human TCR α and the constant region or a fragment of the constant region of human TCR β are a polypeptide described in any one of (a1) to (a8) below. (a1) the human TCR β constant region or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the human TCR α constant region or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or 2; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; (a4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 19; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 19; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 19 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 or 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 10 or 11; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 or 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a5) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 21; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; (a6) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a7) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a8) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24 in which one or more amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or more amino acids have been substituted, inserted, deleted and / or added. 5. The modified TCR described in any one of 1 to 4 above, wherein the constant region or a fragment of the constant region of human TCR α and the constant region or a fragment of the constant region of human TCR β are a polypeptide described in any one of (b1) to (b7) below. (b1) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 2; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 21; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b5) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b6) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b7) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11. 6. The modified TCR according to any one of 1 to 5 above, wherein the constant region or a fragment of the constant region of human TCR α and the constant region or a fragment of the constant region of human TCR β are a polypeptide according to any one of (c1) to (c5) below. (c1) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c5) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11. 7. The modified TCR described in any one of 1 to 6 above, wherein the first polypeptide comprises at least one selected from the AB loop, the C strand, the DE loop and the F strand in the constant region of the human TCR α. 8. The modified TCR described in any one of 1 to 7 above, wherein the second polypeptide comprises at least one selected from Helix 3, CC loop, Helix 4 F strand and FG loop in the constant region of the human TCR β. 9. A modified TCR described in any one of 1 to 8, wherein the first polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCR α, and the second polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCR β. 10. A modified TCR comprising a first polypeptide and a second polypeptide, the first polypeptide is a polypeptide comprising a constant region of human TCR α or a fragment of said constant region, and not comprising a variable region of human TCR α; the second polypeptide is a polypeptide comprising a constant region of human TCR β or a fragment of the constant region, and not comprising a variable region of human TCR β; A modified TCR, in which the percentage of CD3 positive cells in pluripotent stem cells, hematopoietic stem / progenitor cells into which the modified TCR has been introduced, or T cells in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, is 1% or more. 11. The modified TCR described in any one of 1 to 10 above, wherein the percentage of CD3 positive cells in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively, into which the modified TCR has been introduced is at least twice as high as the percentage of CD3 positive cells in the corresponding cells in which the modified TCR has not been introduced. 12. The modified TCR described in any one of 1 to 11 above, wherein pluripotent stem cells or hematopoietic stem / progenitor cells into which the modified TCR has been introduced exhibit equal or greater T cell differentiation ability compared to corresponding cells into which a full-length TCR has been introduced. 13. The modified TCR according to any one of 1 to 12 above, wherein the alloreactivity of a non-T cell-derived pluripotent stem cell, hematopoietic stem / progenitor cell, or a T cell in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively, into which the modified TCR has been introduced, is reduced compared to the corresponding cell into which a full-length TCR has been introduced. 14. A modified TCR described in any one of 1 to 13 above, which is capable of retaining a CD3 subunit on the cell membrane. 15. A modified TCR according to claim 14, which is capable of transmitting a TCR / CD3 complex-associated signal into a cell. 16. The modified TCR described in 14 or 15 above, which is capable of transmitting a TCR / CD3 complex-associated signal into the cell via the CD3 subunit retained on the cell membrane. 17. The modified TCR described in 16 above, which activates T cells by transmitting a TCR / CD3 complex-associated signal into the cell via the CD3 subunit retained on the cell membrane. 18. The modified TCR according to any one of 1 to 17 above, for expression in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively. 19. The modified TCR according to 18 above, which is expressed in pluripotent stem cells or hematopoietic stem / progenitor cells and differentiated into T cells. 20. A modified TCR according to claim 18, for expressing in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out to produce T cells capable of responding to stimulation via the modified TCR / CD3 complex. 21. The modified TCR described in any one of 1 to 20, wherein the pluripotent stem cell is a pluripotent stem cell derived from a non-T cell or a pluripotent stem cell derived from a T cell in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out. 22. A cell expressing the modified TCR described in any one of 1 to 21 above. 23. The cell according to claim 22, wherein the cell expressing the modified TCR is a T cell. 24. A pharmaceutical composition comprising a cell expressing the modified TCR described in any one of 1 to 21 above. 25. A method for producing cells expressing a modified TCR, the modified TCR comprising a first polypeptide and a second polypeptide, the method comprising the steps of: (a) producing a cell expressing a modified TCR; (a) preparing cells; (b) preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of the constant region and not comprising a variable region of human TCR α, and an expression vector comprising a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of the constant region and not comprising a variable region of human TCR β; (c) transforming the cell prepared in step (a) with the expression vector prepared in step (b). 26. A method for producing cells expressing a modified TCR, the modified TCR comprising a first polypeptide and a second polypeptide, the method comprising the steps of: (a') to (c') of: (a') preparing cells; (b') preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of the constant region and not comprising a variable region of human TCR α, and a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of the constant region and not comprising a variable region of human TCR β; (c') transforming the cell prepared in step (a') with the expression vector prepared in step (b'). 27. The method for production described in 25 or 26 above, wherein the cells in step (a) or (a') are pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the TCRα and TCRβ genes have been knocked down or knocked out. 28. The production method described in any one of 25 to 27 above, wherein the cells expressing the modified TCR are T cells for immune cell therapy. 29. A method for producing T cells, comprising the step of expressing a modified TCR described in any one of 1 to 21 in a pluripotent stem cell or a hematopoietic stem / progenitor cell, thereby differentiating the cell into a T cell. 30. A method for producing T cells, comprising a step of expressing a modified TCR described in any one of 1 to 21 above in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCR α gene and endogenous TCR β gene have been knocked down or knocked out, respectively, and the resulting T cells are T cells capable of responding to stimulation via the modified TCR / CD3 complex. 31. A method of immune cell therapy comprising the steps of: expressing a modified TCR described in any one of 1 to 21 in a pluripotent stem cell and differentiating it into a T cell; and administering the obtained T cell to a subject. 32. A method of immune cell therapy comprising the steps of expressing a modified TCR described in any one of 1 to 21 above in T cells in which the endogenous TCR α gene and endogenous TCR β gene have been knocked down or knocked out, respectively, and administering the obtained T cells to a subject. 33. A method of immune cell therapy comprising the steps of expressing a modified TCR described in any one of 1 to 21 above in hematopoietic stem or progenitor cells to differentiate them into T cells, and administering the obtained T cells to a subject. 34. The modified TCR described in any one of 1 to 21 above, for use in immune cell therapy. 35. A pluripotent stem cell T cell for use in immune cell therapy, which is produced by expressing the modified TCR described in any one of 1 to 21 above in a pluripotent stem cell and differentiating it into a T cell. 36. T cells for use in immune cell therapy, in which the modified TCR described in any one of 1 to 21 above is expressed in T cells in which the endogenous TCR α gene and endogenous TCR β gene have been knocked down or knocked out, respectively. 37. T cells derived from hematopoietic stem / progenitor cells, for use in immune cell therapy, which are obtained by expressing the modified TCR described in any one of 1 to 21 above in hematopoietic stem / progenitor cells and differentiating them into T cells. 38. Use of a modified TCR described in any one of 1 to 21 above for the manufacture of a composition for immune cell therapy. 39. Use of T cells derived from pluripotent stem cells, which have been produced by expressing the modified TCR described in any one of 1 to 21 above in pluripotent stem cells and differentiating them into T cells, for the production of a composition for immune cell therapy. 40. Use of T cells in which the modified TCR described in any one of 1 to 21 above has been expressed in T cells in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively, for the production of a composition for immune cell therapy. 41. Use of T cells, which are obtained by expressing the modified TCR according to any one of 1 to 21 above in hematopoietic stem / progenitor cells and differentiating them into T cells, for the production of a composition for immune cell therapy. 42. A nucleic acid encoding the modified TCR according to any one of 1 to 21 above. 43. A vector comprising the nucleic acid according to 42. 44. A method for producing a pharmaceutical composition, using the nucleic acid according to 42 or the vector according to 43. 45. A pharmaceutical composition comprising the nucleic acid according to 42 or the vector according to 43. Effect of the Invention

[0016] The modified TCR of the present invention comprises a first polypeptide and a second polypeptide, the first polypeptide comprising a constant region of human TCRα or a fragment of the constant region, and the second polypeptide comprising a constant region of human TCRβ or a fragment of the constant region, thereby enabling the CD3 subunit to be retained on the cell membrane. Furthermore, the modified TCR of the present invention has lost its antigen recognition ability, since the first polypeptide and the second polypeptide do not comprise the variable regions of TCRα and TCRβ, respectively. By expressing the modified TCR of the present invention in T cells in which endogenous TCR expression has been suppressed or eliminated, T cells capable of responding to stimulation via the modified TCR / CD3 complex can be produced without inducing antigen responsiveness. [Brief description of the drawings]

[0017] [Figure 1] FIG. 1 is a schematic diagram of full-length and modified TCR sequences. [Diagram 2]FIG. 2 shows the amino acid sequence information of ba1. [Diagram 3] FIG. 3 shows the amino acid sequence information of ba2 to ba9. [Figure 4] FIG. 4 shows the amino acid sequence information of ba10 to ba18. [Diagram 5] FIG. 5 shows flow cytometric analysis of CD3E expression when various ba vectors and mock vectors were introduced into 293T cells stably expressing CD3. [Figure 6] FIG. 6 is a graph showing the expression level of CD3E quantified by MFI when various ba vectors and mock vectors were introduced into 293T cells in which CD3 was stably expressed. [Figure 7] FIG. 7 shows flow cytometric analysis of CD3D expression when various ba vectors and mock vectors were introduced into 293T cells in which CD3 was stably expressed. [Figure 8] FIG. 8 is a graph showing the CD3D expression level quantified by MFI when various ba vectors and mock vectors were introduced into 293T cells in which CD3 was stably expressed. [Figure 9] FIG. 9 shows flow cytometric analysis of CD3E expression when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out. [Figure 10] FIG. 10 is a graph showing the expression level of CD3E quantified by MFI when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out. [Figure 11] FIG. 11 shows flow cytometric analysis of CD3D expression when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out. [Figure 12] FIG. 12 is a graph showing the expression level of CD3D quantified by MFI when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out. [Figure 13]FIG. 13 shows a diagram analyzing changes in responsiveness to OKT3 antibody stimulation due to knockout of endogenous TCR by flow cytometry using increased expression of CD69, an activated T cell marker, as an indicator. [Figure 14] FIG. 14 shows flow cytometric analysis of CD69 expression when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out, and the cells were stimulated with OKT3 antibody. [Figure 15] FIG. 15 is a graph showing the expression level of CD69 quantified by MFI when various ba vectors and mock vectors were introduced into Jurkat cells in which endogenous TCR was knocked out, and the cells were stimulated with OKT3 antibody. [Figure 16] 16 shows a partial N-terminal sequence of the amino acid sequence of the extracellular domain of modified TCRα and a schematic diagram of the structure of the amino acid sequence. The amino acid sequence with an * at the N-terminus shows a portion of the publicly known human TCRα amino acid sequence (Protein Data Bank ID: 3QJF; described in https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF). [Figure 17] 17 shows a partial N-terminal sequence of the amino acid sequence of the extracellular domain of modified TCR β and a schematic diagram of the structure of the amino acid sequence. The amino acid sequence with an * at the N-terminus shows a part of the publicly known human TCR β amino acid sequence (Protein Data Bank ID: 3QJF; described in https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF). [Figure 18] FIG. 18 shows the average CD3 positivity rate (n=3) in cells into which various modified TCR expression vectors were introduced. [Figure 19] Fig. 19(A) shows the results of expression analysis of CD3 and CD45 in FF-WJs524, and Fig. 19(B) shows the results of expression analysis of CD8β and CD8α in FF-WJs524. [Figure 20]Fig. 20(A) shows the results of culturing DLL4 and Retronectin for 21 days, and Fig. 20(B) shows the results of expression analysis of CD8β and CD8α. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] [Modified TCR] The modified TCR of the present invention is characterized in that it comprises a first polypeptide and a second polypeptide, wherein the first polypeptide is a polypeptide comprising the constant region of human TCR α or a fragment of the constant region, and not comprising the variable region of human TCR α, and the second polypeptide is a polypeptide comprising the constant region of human TCR β or a fragment of the constant region, and not comprising the variable region of human TCR β.

[0019] The TCRα locus is composed of a variable region (V region), a joining region (J region) and a constant region (C region). On the other hand, the TCRβ locus is composed of a V region, a diversity region (D region), a J region and a C region. The TCR locus undergoes genomic rearrangement during the differentiation process of T cells.

[0020] In TCRα, the V and J regions, and in TCRβ, the V, D and J regions, are linked in various combinations, and random base insertions or deletions occur at each junction, resulting in the formation of functional and highly diverse variable region exons.

[0021] Furthermore, during the gene transcription process, the variable region exons are linked to the C region exons by RNA splicing to form the full-length TCR gene mRNA. Subsequently, the TCR α chain polypeptide and the TCR β chain polypeptide translated as proteins form a heterodimer, and the TCR is displayed on the cell membrane surface.

[0022] The TCR α chain polypeptide and the TCR β chain polypeptide each have a variable region and a constant region, which are extracellular regions, a transmembrane region, and an intracellular region. Hereinafter, the constant region in the present invention refers to the C region sequence in a gene, and to the sequence excluding the variable domain (non-variable region) in a polypeptide.

[0023] It is known that there is one type of constant region gene for TCRα (TRAC gene) whereas there are two types of constant region genes for TCRβ (TRBC1 gene and TRBC2 gene). When the TCRβ locus is rearranged, either the TRBC1 or TRBC2 gene is selected. Based on sequence information extracted from IMGT (the international ImMunoGeneTics information system), the amino acid sequence of the TRBC1 gene and that of the TRBC2 gene differ by only five amino acids, and the C-terminus of TRBC2 has only two more amino acids than that of TRBC1. The sequence homology between the two genes is high, and no functional differences are known.

[0024] An example of the amino acid sequence of the constant region of human TCR α is the amino acid sequence shown in SEQ ID NO:1. Furthermore, the amino acid sequence of the constant region fragment of human TCR α may be any amino acid sequence as long as it is a partial sequence of the constant region of human TCR α, and examples thereof include the amino acid sequence shown in any one of SEQ ID NOs: 2 to 11. An embodiment of the human TCR α constant region or a fragment of said constant region in the present invention includes a polypeptide according to any one of (A1) to (A3) below. (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 1 to 11; (A3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11, in which one or several amino acids have been substituted, inserted, deleted and / or added.

[0025] An example of the amino acid sequence of the constant region of human TCR β is the amino acid sequence shown in SEQ ID NO:12. The amino acid sequence of the constant region fragment of human TCR β in the present invention may be any amino acid sequence as long as it is a partial sequence of the constant region of human TCR β, and examples thereof include the amino acid sequence shown in any one of SEQ ID NOs: 13 to 24. An embodiment of the constant region of human TCR β or a fragment of said constant region includes a polypeptide set forth in any one of (B1) to (B3) below. (B1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added.

[0026] The modified TCR of the present invention may have a length of the amino acid sequence of the constant region or the constant region fragment of human TCRα or the constant region fragment of human TCRβ in the above-mentioned embodiment changed as long as the effect of the present invention is achieved, and also includes those in which mutations due to single nucleotide polymorphisms (SNPs) derived from human TCR have been introduced. In addition, the modified TCR of the present invention also includes those in which known modifications for the purpose of improving the function of TCR (e.g., modifications described in Michael S. Kuhns et al., Immunity. 26: 357-369, 2007, Aswin Natarajan et al., Cell Reports.14: 2833-2845, 2016, or Schamel W. Wolfgang et al. Immunological Reviews. 291: 8-25, 2019) have been further performed as long as the effect of the present invention is achieved.

[0027] A polypeptide having an amino acid sequence in which one to several amino acids have been substituted, inserted, deleted, and / or added in the desired amino acid sequence can be produced by introducing site-specific mutations into DNA encoding a polypeptide comprising, for example, the amino acid sequence of SEQ ID NO: 1 to 24, using a method such as described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989; Current Protocols in Molecular Biology, John Wiley & Sons. 1987-1997; Nucleic Acids Research. 10, 6487, 1982; Proc. Natl. Acad. Sci. USA. 79, 6409, 1982; Gene, 34: 315, 1985; Nucleic Acids Research. 13: 4431, 1985, or Proc. Natl. Acad. Sci. USA. 82: 488, 1985).

[0028] The range of one to several amino acid substitutions, insertions, deletions, and / or additions in an amino acid sequence is not particularly limited, but for example, if 100 amino acids in an amino acid sequence are considered to be one unit, one unit means 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids, preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, and more preferably about 1, 2, 3, 4, or 5 amino acids.

[0029] An amino acid deletion means the absence or loss of an amino acid residue in a sequence, an amino acid substitution means that an amino acid residue in a sequence is replaced with another amino acid residue, and an amino acid insertion or addition means that a new amino acid residue is added before, after, or within the sequence.

[0030] Specific embodiments of the substitution of one or several amino acids include, for example, the substitution of one or several amino acids with other chemically similar amino acids. For example, a hydrophobic amino acid may be substituted with another hydrophobic amino acid, or a polar amino acid may be substituted with another polar amino acid having the same charge, etc. Such chemically similar amino acids are known in the art for each amino acid.

[0031] Specific examples of non-polar (hydrophobic) amino acids include alanine, valine, glycine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Polar (neutral) amino acids include serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Positively charged basic amino acids include arginine, histidine, and lysine. Negatively charged acidic amino acids include aspartic acid and glutamic acid.

[0032] In the amino acid sequence of a target protein, an amino acid sequence in which one to several amino acids have been substituted, inserted, deleted and / or added includes an amino acid sequence that has a certain level of sequence identity with the amino acid sequence of the target protein, for example, an amino acid sequence that has 60% or more, preferably 65% ​​or more, preferably 70% or more, preferably 75% or more, preferably 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more sequence identity with the amino acid sequence of the target protein.

[0033] As one embodiment of the modified TCR of the present invention, a modified TCR in which the constant region or a fragment of the constant region of human TCR α and the constant region or a fragment of the constant region of human TCR β are a polypeptide described in any one of (a1) to (a8) below is preferred. (a1) the human TCR β constant region or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the human TCR α constant region or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or 2; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; (a4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 19; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 19; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 19 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 or 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 10 or 11; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 or 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a5) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 21; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 7 to 11; (a6) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a7) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (a8) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24 in which one or more amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or more amino acids have been substituted, inserted, deleted and / or added.

[0034] Furthermore, among the modified TCRs which are the polypeptides of (a1) to (a8) above, a modified TCR which is a polypeptide according to any one of (b1) to (b7) below is preferred. (b1) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 2; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 21; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b5) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b6) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (b7) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11.

[0035] Furthermore, among the modified TCRs that are the polypeptides of (b1) to (b7) above, a modified TCR that is a polypeptide according to any one of (c1) to (c5) below is preferred. (c1) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c2) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c3) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c4) the constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23 in which one or several amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; (c5) The constant region of human TCR β or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11.

[0036] In the modified TCR of the present invention, the first polypeptide preferably comprises at least one selected from the AB loop, C strand, DE loop and F strand in the constant region of human TCR α.

[0037] In the constant region of human TCR α, the AB loop, C strand, DE loop and F strand are preferably contained in this order, but may be contained in a different order.

[0038] The AB loop has a structure consisting of, for example, the 14th to 20th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1. The C strand has a structure consisting of, for example, the 29th to 40th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1. The DE loop has a structure consisting of, for example, the 52nd to 57th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1. The F strand has a structure consisting of, for example, the 67th to 81st amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1.

[0039] In the modified TCR of the present invention, the second polypeptide preferably comprises at least one selected from Helix 3, CC loop, Helix 4 F strand and FG loop in the constant region of human TCR β.

[0040] In the human TCR β constant region, Helix 3, CC loop, Helix 4 F strand and FG loop are preferably contained in this order, but may be contained in a different order.

[0041] Helix3 has a structure consisting of, for example, the amino acid sequence of positions 20 to 26 in the amino acid sequence shown in SEQ ID NO: 12. CC loop has a structure consisting of, for example, the amino acid sequence of positions 49 to 54 in the amino acid sequence shown in SEQ ID NO: 12. Helix4 F strand has a structure consisting of, for example, the amino acid sequence of positions 88 to 93 in the amino acid sequence shown in SEQ ID NO: 12. FG loop has a structure consisting of, for example, the amino acid sequence of positions 105 to 113 in the amino acid sequence shown in SEQ ID NO: 12.

[0042] In the modified TCR of the present invention, it is preferable that the first polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of human TCR α, and the second polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of human TCR β.

[0043] The extracellular region in the constant region of human TCR α is, for example, a region consisting of the amino acid sequence of positions 1 to 117 in the amino acid sequence shown in SEQ ID NO: 1. The transmembrane region in the constant region of human TCR α is, for example, a region consisting of the amino acid sequence of positions 118 to 139 in the amino acid sequence shown in SEQ ID NO: 1. Preferred examples of embodiments that include at least a part of the extracellular region in the constant region of human TCR α include embodiments that include at least amino acids 82 to 117 in the region consisting of the amino acid sequence of positions 1 to 117 in the amino acid sequence shown in SEQ ID NO: 1. The intracellular region in the constant region of human TCR α is, for example, a region consisting of the amino acid sequence of positions 140 to 141 in the amino acid sequence shown in SEQ ID NO: 1.

[0044] The extracellular region in the constant region of human TCR β is, for example, a region consisting of the amino acid sequence of positions 1 to 146 in the amino acid sequence shown in SEQ ID NO: 12. The transmembrane region in the constant region of human TCR β is, for example, a region consisting of the amino acid sequence of positions 147 to 172 in the amino acid sequence shown in SEQ ID NO: 12. Preferred examples of embodiments that include at least a part of the extracellular region in the constant region of human TCR β include embodiments that include at least amino acids at positions 114 to 146 in the region consisting of the amino acid sequence of positions 1 to 146 in the amino acid sequence shown in SEQ ID NO: 12. The intracellular region in the constant region of human TCR β is, for example, a region consisting of the amino acid sequence of positions 173 to 179 in the amino acid sequence shown in SEQ ID NO: 12. Additionally, the polypeptides of the present invention also include polypeptides consisting of the amino acid sequence of the constant region of human TCR α or a fragment of said constant region, or the amino acid sequence of the constant region of human TCR β or a fragment of said constant region, which are disclosed in publicly known databases such as the Protein Data Bank (for example, Protein Data Bank ID: 3QJF; described at https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF).

[0045] In the constant region of wild-type TCRα or wild-type TCRβ, cysteine ​​residues contained in each amino acid sequence form disulfide bonds to bond the two chains. Similarly, the modified TCR of the present invention may have additional cysteine ​​residues in each of the first and second polypeptides so as to form disulfide bonds in the amino acid sequences of the constant region or the constant region fragment. In addition, the first and second polypeptides may be further modified so that additional disulfide bonds are formed within the chains and / or between the chains, which can improve the stability of the modified TCR.

[0046] By having the above-mentioned structure, the modified TCR of the present invention can associate with mammalian CD3 having three different chains (γ, δ, and ε) and CD3ζ chain, and retain the CD3 subunit on the cell membrane. The CD3 subunit plays an important role in signal transmission from TCR to the cell, and the modified TCR of the present invention transmits a TCR / CD3 complex-associated signal into the cell via the CD3 subunit retained on the cell membrane, activating the T cell.

[0047] The percentage of CD3 positive cells in pluripotent stem cells, hematopoietic stem / progenitor cells into which the modified TCR of the present invention has been introduced, or T cells in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, is preferably 1% or more, 3% or more, 5% or more, 10% or more, or 15% or more, more preferably 20% or more, even more preferably 40% or more, particularly preferably 60% or more, particularly preferably 75% or more, and most preferably 80% or more. When the percentage of CD3 positive cells is at least 1%, a sufficient stimulatory response can be obtained via the modified TCR / CD3 complex. The percentage of CD3 positive cells can be evaluated by examining the percentage of CD3D positive cells or CD3E positive cells using flow cytometry, as described later in the Examples.

[0048] From the viewpoint of obtaining a sufficient stimulatory response via the modified TCR / CD3 complex, the percentage of CD3-positive cells in pluripotent stem cells, hematopoietic stem / progenitor cells into which the modified TCR of the present invention has been introduced, or T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out, respectively, is preferably at least twice, more preferably at least five times, even more preferably at least ten times, and particularly preferably at least 20 times, the percentage of CD3-positive cells in the corresponding cells.

[0049] Pluripotent stem cells or hematopoietic stem / progenitor cells into which a modified TCR of the present invention has been introduced preferably exhibit T cell differentiation potency equal to or greater than that of the corresponding cells into which a full-length TCR (wild-type TCR) has been introduced. T cell differentiation potency can be evaluated by the method described below for determining whether T cells maintain an undifferentiated state.

[0050] The antigen recognition site formed by the variable region of the TCRα / TCRβ heterodimer is believed to recognize whether a target cell is self or non-self. The modified TCR of the present invention does not contain the variable regions of TCRα and TCRβ in the first and second polypeptides, respectively, and has lost antigen recognition ability, resulting in reduced or lost / absent alloreactivity.

[0051] The modified TCR of the present invention may also contain a signal peptide at the N-terminus.

[0052] The modified TCR of the present invention can be preferably used for applications such as expressing it in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out, respectively; expressing it in pluripotent stem cells or hematopoietic stem / progenitor cells to differentiate them into T cells; and expressing it in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out, respectively, to produce T cells capable of responding to stimulation via the modified TCR / CD3 complex.

[0053] [Cells expressing modified TCR and production method thereof] In the present invention, the method for introducing a modified TCR into a cell to produce a cell expressing a modified TCR is not particularly limited, and any known method can be used as appropriate, such as a method for introducing the modified TCR into a cell in the form of a polynucleotide encoding the modified TCR or a method for introducing the modified TCR into a cell in the form of a protein.

[0054] One embodiment of the production method for introducing a modified TCR into cells in the form of a polynucleotide includes a method comprising the following steps (a) to (c) or steps (a') to (c').

[0055] (a) preparing cells; (b) preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of the constant region and not comprising a variable region of human TCR α, and an expression vector comprising a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of the constant region and not comprising a variable region of human TCR β; (c) transforming the cell prepared in step (a) with the expression vector prepared in step (b).

[0056] (a') preparing cells; (b') preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of the constant region and not comprising a variable region of human TCR α, and a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of the constant region and not comprising a variable region of human TCR β; (c') transforming the cell prepared in step (a') with the expression vector prepared in step (b').

[0057] The type of polynucleotide is not particularly limited and can be selected depending on the method for gene introduction, and may be either DNA or RNA.

[0058] Examples of polynucleotides encoding the constant region of human TCR α or a fragment of the constant region include the polynucleotides described in (i) to (v) below. (i) a polynucleotide consisting of a nucleotide sequence shown in any one of SEQ ID NOs: 25 to 35; (ii) a polynucleotide having 90% or more sequence identity to any one of the nucleotide sequences shown in SEQ ID NOs: 25 to 35; (iii) a polynucleotide consisting of a nucleotide sequence shown in any one of SEQ ID NOs: 25 to 35 or a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence; (iv) a polynucleotide encoding a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (v) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 1 to 11.

[0059] Examples of polynucleotides encoding the constant region of human TCR β or a fragment of the constant region include the polynucleotides described in (vi) to (x) below. (vi) a polynucleotide consisting of a nucleotide sequence shown in any one of SEQ ID NOs: 36 to 48; (vii) a polynucleotide having 90% or more sequence identity to any one of the nucleotide sequences shown in SEQ ID NOs: 36 to 48; (viii) a polynucleotide consisting of a nucleotide sequence shown in any one of SEQ ID NOs: 36 to 48 or a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to said sequence; (ix) a polynucleotide encoding a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 12 to 24; (x) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 12 to 24.

[0060] Examples of base sequences that hybridize under stringent conditions include base sequences of hybridizable polynucleotides obtained by colony hybridization, plaque hybridization, Southern blot hybridization, DNA microarray, or the like using a polynucleotide containing the target base sequence as a probe.

[0061] Specifically, examples of the base sequence of DNA that can be identified include those that can be identified by performing a hybridization method (described, for example, in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989, Current Protocols in Molecular Biology, John Wiley & Sons, 1987-1997, or DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University, 1995) at 65°C in the presence of 0.7 to 1.0 mol / L sodium chloride using a DNA sequence derived from a hybridized colony or plaque, or a filter or slide glass onto which a PCR product or oligo DNA having the DNA sequence has been immobilized, and then washing the filter or slide glass at 65°C using a 0.1 to 2-fold concentration SSC solution (the composition of a 1-fold concentration SSC solution is 150 mmol / L sodium chloride and 15 mmol / L sodium citrate).

[0062] Examples of polynucleotides containing a base sequence that hybridizes under stringent conditions include DNAs having a certain level of sequence identity with the base sequence of a polynucleotide having the base sequence of a target gene used as a probe. For example, DNAs having at least 60% homology with the target base sequence, preferably 80% homology, and more preferably 95% homology. In addition, for example, if 100 bases in a base sequence are taken as one unit, DNAs containing a base sequence having one to several, preferably 1 to 40, preferably 1 to 35, preferably 1 to 30, preferably 1 to 25, preferably 1 to 20, more preferably 1 to 15, still more preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and even more preferably 1, 2, 3, 4, or 5 base substitutions, insertions, deletions, and / or additions, etc., in the base sequence of the target gene per unit.

[0063] A base deletion means that a base is missing or lost in a sequence, a base substitution means that a base in a sequence is replaced with a different base, and a base insertion or addition means that a new base is added, such as by insertion.

[0064] Genetic polymorphisms are often found in the nucleotide sequences of genes encoding proteins in eukaryotes. The nucleotide sequences of genes used in the present invention also include nucleotide sequences of genes in which small-scale mutations have occurred due to such polymorphisms.

[0065] In the present invention, sequence identity means the identity between two sequences, and refers to the presence of exactly the same nucleotide or amino acid at the same position in two nucleotide or protein sequences compared by aligning the two sequences with each other. Thus, when two proteins show 90% identity, this means that 90% of all amino acid residues contained in the proteins at corresponding positions are exactly the same.

[0066] In the present invention, unless otherwise specified, the numerical value of sequence identity may be a numerical value calculated using a sequence identity search program known to those skilled in the art. For base sequences, the numerical value may be a numerical value calculated using default parameters in BLAST (e.g., J. Mol. Biol., 215, 403, 1990), and for amino acid sequences, the numerical value may be a numerical value calculated using default parameters in BLAST2 (e.g., Nucleic Acids Res., 25, 3389, 1997; Genome Res., 7, 649, 1997; or http: / / www.ncbi.nlm.nih.gov / Education / BLASTinfo / information3.html) or Pairwise Sequence Alignment based on the Needleman-Wunsch algorithm.

[0067] Default parameters include, for example, G (Cost to open gap) is 5 for nucleotide sequences and 11 for amino acid sequences, -E (Cost to extend gap) is 2 for nucleotide sequences and 1 for amino acid sequences, -q (Penalty for nucleotide mismatch) is -3, -r (reward for nucleotide match) is 1, -e (expect value) is 10, -W (wordsize) is 11 residues for nucleotide sequences and 3 residues for amino acid sequences, -y[Dropoff(X)for blast extensions in bits] is 20 for blastn and 7 for programs other than blastn, -X (X dropoff value for gapped alignment in bits) is 15, and -Z (final X dropoff value for gapped alignment in bits) is 50 for blastn and 25 for programs other than blastn (see, for example, http: / / www.ncbi.nlm.nih.gov / blast / htmL / blastcgihelp.html).

[0068] The gene can be introduced by appropriately utilizing a method commonly used in the art, and the method is not particularly limited. For example, the gene of the present invention can be introduced by incorporating it into a viral vector such as a retrovirus, lentivirus, or adenovirus, and infecting the cells to be introduced. It can also be introduced by incorporating it into a vector such as a non-viral vector such as a plasmid, a bacterial vector, or an episomal vector, and incorporating it into the cells to be introduced by a transfection method, an electroporation method, a liposome method, a calcium phosphate coprecipitation method, a DEAE dextran method, a microinjection method, or the like. In addition, the gene of the present invention can be inserted into any genomic DNA site of a cell, and the gene can be freely introduced using genome editing techniques such as transcription activator-like effector nucleases (TALEN) or clustered regulatory interspaced short palindromic repeat (CRISPR) / Cas9, or transposon methods, etc. Furthermore, the gene of the present invention can be expressed by introducing it into a cell using an artificial chromosome vector, etc.

[0069] When multiple genes, such as a gene encoding the constant region or a fragment of the constant region of human TCR α and a gene encoding the constant region or a fragment of the constant region of human TCR β, are introduced, each gene can be placed under the control of an independent promoter and inserted into the same vector or into separate vectors. Alternatively, each gene can be linked via an intervening sequence to form a single expression cassette using a single promoter.

[0070] Examples of the intervening sequence include, but are not limited to, an internal ribosome entry site (IRES) sequence or a 2A peptide sequence (described in Szymczak et al., Expert Opin. Biol. Ther., 2005, 5: 627-638). The 2A peptide is a virus-derived peptide sequence of about 20 amino acid residues, and when multiple genes are linked by the 2A peptide, the glycine and proline at the C-terminus of the 2A peptide are not linked by the ribosomal skip mechanism during the translation process, resulting in the expression of each polypeptide in a split form.

[0071] One embodiment of the production method for introducing the modified TCR into cells in the form of a protein includes a method in which the modified TCR is synthesized from the above-mentioned polynucleotide using a protein synthesis system and then incorporated into cells to express the modified TCR on the cell surface. Methods for introducing a protein into a target cell include, for example, a method using a protein introduction reagent, a method using a protein introduction domain (PTD) fusion protein, electroporation, microinjection, or the method described in Shimono K, et al., Protein Sci. 18(10): 2160-71, 2009.

[0072] [Cells into which modified TCR is introduced] Cells into which modified TCRs can be introduced include, for example, pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCR α gene and endogenous TCR β gene have been knocked down or knocked out.

[0073] In the present invention, pluripotent stem cells are stem cells that have pluripotency and can be differentiated into many cells present in a living body, and also have proliferation ability, and include at least any cell that can be differentiated / induced into the T cells used in the present invention. Pluripotent stem cells are preferably derived from mammals, and more preferably from humans. In the present invention, the term "origin" refers to the source of acquisition. For example, pluripotent stem cells derived from a mammal refer to pluripotent stem cells obtained from a mammal.

[0074] Pluripotent stem cells include, but are not limited to, for example, embryonic stem (ES) cells, cloned embryo-derived embryonic stem (ntES) cells obtained by nuclear transfer, spermatogonial stem cells (GS cells), embryonic germ cells (EG cells), induced pluripotent stem (iPS) cells, pluripotent stem cells derived from cultured fibroblasts or umbilical cord blood, or pluripotent stem cells derived from bone marrow stem cells (Muse cells), etc. In the present invention, preferred pluripotent stem cells are iPS cells, more preferably human iPS cells, from the viewpoint that they can be obtained without destroying embryos or eggs in the production process.

[0075] The pluripotent stem cells of the present invention are preferably pluripotent stem cells that do not have endogenous TCRα and TCRβ genes, and more preferably non-T cell-derived pluripotent stem cells or T cell-derived pluripotent stem cells in which the endogenous TCRα and TCRβ genes have been knocked down or knocked out, such as induced pluripotent stem cells (T-iPS cells) derived from T cells in which the endogenous TCRα and TCRβ genes have been knocked down or knocked out.

[0076] Methods for producing iPS cells are known in the art, and iPS cells can be produced by introducing reprogramming factors into any somatic cells. Examples of reprogramming factors include genes or gene products such as Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, or Glis1. These reprogramming factors may be used alone or in combination.

[0077] Combinations of reprogramming factors include those described in International Publication No. 2007 / 069666, International Publication No. 2008 / 118820, International Publication No. 2009 / 007852, International Publication No. 2009 / 032194, International Publication No. 2009 / 058413, International Publication No. 2009 / 057831, International Publication No. 2009 / 075119, International Publication No. 2009 / 07 9007, WO 2009 / 091659, WO 2009 / 101084, WO 2009 / 101407, WO 2009 / 102983, WO 2009 / 114949, WO 2009 / 117439, WO 2009 / 126250, WO 2009 / 126251, WO WO 2009 / 126655, WO 2009 / 157593, WO 2010 / 009015, WO 2010 / 033906, WO 2010 / 033920, WO 2010 / 042800, WO 2010 / 050626, WO 2010 / 056831, WO 2010 / 0689 55, International Publication No. 2010 / 098419, International Publication No. 2010 / 102267, International Publication No. 2010 / 111409, International Publication No. 2010 / 111422, International Publication No. 2010 / 115050, International Publication No. 2010 / 124290, International Publication No. 2010 / 147395, International Publication No. 2010 / 147612, Huangfu D, et al., Nat. Biotechnol., 26: 795-797, 2008, Shi Y, et al., Cell Stem Cell, 2: 525-528, 2008, Eminli S, et al., Stem Cells. 26: 2467-2474, 2008, Huangfu D, et al., Nat. Biotechnol. 26: 1269-1275, 2008, Shi Y, et al., Cell Stem Cell, 3, 568-574, 2008, Zhao Y, et al., Cell Stem Cell, 3: 475-479, 2008, Marson A, Cell Stem Cell, 3, 132-135, 2008, Feng B, et al. al., Nat. Cell Biol.11:197-203, 2009, RL Judson et al., Nat. Biotechnol., 27: 459-461, 2009, Lyssiotis CA, et al., Proc Natl Acad Sci US A. 106: 8912-8917, 2009, Kim JB, et al., Nature. 461:649-643, 2009, Ichida JK, et al., Cell Stem Cell. 5: 491-503, 2009, Heng JC, et al., Cell Stem Cell. 6:167-74, 2010, Han J, et al., Nature. 463: 1096-100, 2010, Mali P, et al. al., Stem Cells. 28: 713-720, 2010 or Maekawa M, et al., Nature. 474:225-9, 2011.

[0078] The somatic cells used to produce iPS cells are not particularly limited, but examples include fetal (calf) somatic cells, neonatal (calf) somatic cells, mature healthy or diseased somatic cells, primary culture cells, passaged cells, and established cell lines.

[0079] Examples of the somatic cells include (1) tissue stem cells (e.g., somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, or dental pulp stem cells, (2) tissue progenitor cells such as hematopoietic progenitor cells, or (3) differentiated cells such as blood cells (e.g., peripheral blood cells, umbilical cord blood cells, etc.), bone marrow cells, lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts (e.g., skin cells, etc.), hair cells, liver cells, gastric mucosa cells, intestinal cells, spleen cells, pancreatic cells (e.g., exocrine pancreatic cells, etc.), brain cells, lung cells, kidney cells, and adipocytes. As the somatic cells, somatic cells other than T cells (non-T cells) are preferable, but T cells may also be used.

[0080] The T cells as the somatic cells are not particularly limited, but are preferably T cells that express CD3 and at least one of CD4 and CD8 molecules.

[0081] Examples of such T cells include helper T cells, cytotoxic T cells, regulatory T cells, naive T cells, stem cell memory T cells (TSCM), central memory T cells (TCM), effector memory T cells, and terminal effector T cells.

[0082] Helper T cells are CD4 positive cells, and are further classified into Th1 cells, Th2 cells, Th17 cells, and the like depending on the cytokines they express (for example, as described in J Allergy Clin. Immunol., 135(3): 626-635, 2012).

[0083] Examples of Th1 cells include cells that express IFN-γ, IL-2, TNF-α, etc. Examples of Th2 cells include cells that express IL-4, IL-5, IL-6, IL-10, IL-13, etc. Examples of Th17 cells include cells that express IL-17, IL-6, etc.

[0084] Cytotoxic T cells are CD8 positive cells, and like helper T cells, are further classified into Tc1 cells, Tc2 cells, etc. depending on the cytokines they express.

[0085] Examples of Tc1 cells include cells that express IFN-γ, IL-2, TNF-α, etc. Examples of Tc2 cells include cells that express IL-4, IL-5, IL-6, IL-10, IL-13, etc.

[0086] Preferred examples of regulatory T cells include CD4(+)CD25(+)FoxP3(+) cells.

[0087] Preferred examples of naive T cells include CD4(+)CD45RA(+)CD62L(+)CCR7(+) cells, CD8(+)CD45RA(+)CD62L(+)CCR7(+) cells, CD4(+)CCR7(+)CD45RA(+)CD95(-)CD45RO(-) cells, and CD8(+)CCR7(+)CD45RA(+)CD95(-)CD45RO(-) cells.

[0088] Preferred examples of stem cell memory T cells include CD4(+)CD45RA(+)CD62L(+)CCR7(+)CD95(+) cells, CD8(+)CD45RA(+)CD62L(+)CCR7(+)CD95(+) cells, CD4(+)CCR7(+)CD45RA(+)CD95(+)CD45RO(+) cells, and CD8(+)CCR7(+)CD45RA(+)CD95(+)CD45RO(+) cells.

[0089] Preferred examples of central memory T cells include CD4(+)CD45RA(-)CD62L(+)CCR7(+)CD95(+) cells, CD8(+)CD45RA(-)CD62L(+)CCR7(+)CD95(+) cells, CD4(+)CCR7(+)CD45RA(-)CD45RO(+) cells, and CD8(+)CCR7(+)CD45RA(-)CD45RO(+) cells.

[0090] Preferred examples of effector memory T cells include CD4(+)CCR7(-)CD45RA(-)CD45RO(+) cells or CD8(+)CCR7(-)CD45RA(-)CD45RO(+) cells.

[0091] Preferred examples of terminal effector T cells include CD4(+)CD45RA(+)CD62L(-) cells and CD8(+)CD45RA(+)CD62L(-) cells.

[0092] The T cells as somatic cells are preferably undifferentiated T cells. Examples of undifferentiated T cells include, in order of increasing degree of undifferentiation, naive T cells, stem cell memory T cells, and central memory T cells. Among these, naive T cells and stem cell memory T cells are particularly preferred from the viewpoint of maintaining the undifferentiated state of cells and improving proliferation or biological persistence.

[0093] Highly undifferentiated T cells exhibit a high immune cell therapy effect. The T cells as somatic cells are preferably T cells for immune cell therapy.

[0094] Methods for determining whether T cells maintain an undifferentiated state include a method for determining by detecting the expression of an undifferentiated marker and / or non-detection of the expression of a differentiated marker, a method for determining by detecting the expression of various other markers (genes or proteins), or a method for observing the morphological characteristics of the cells. For example, CCR7 is used as an undifferentiated marker for peripheral blood (for example, as described in Nature Reviews Immunology, 18: 363-373, 2018).

[0095] When T cells are used as the somatic cells, T cells in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out are preferred.

[0096] The endogenous TCR α gene and endogenous TCR β gene refer to the TCR α gene and TCR β gene possessed by the T cell to be knocked down or knocked out, the TCR α gene and TCR β gene derived from the T cell to be knocked down or knocked out, and the TCR α gene and TCR β gene derived from the same type of T cell as the T cell to be knocked down or knocked out. Knocking down a gene refers to reducing the transcription amount or inhibiting the translation of a specific gene. Knocking out a gene refers to disrupting the base sequence of a specific gene to inhibit gene expression.

[0097] As a method for producing T cells in which the endogenous TCRα gene and the endogenous TCRβ gene of the present invention are knocked down or knocked down, respectively, known methods such as a method of suppressing gene expression by introducing small interfering RNA (siRNA) against the genes into cells (described in Non-Patent Document 1) can be used. As a method for producing T cells in which the endogenous TCRα gene and the endogenous TCRβ gene are knocked down or knocked out, respectively, known methods such as a method of causing a frameshift in the gene region using genome editing techniques such as TALEN or CRISPR / Cas9 to disrupt the coding sequence of the gene (Non-Patent Document 2) can be used.

[0098] In the present invention, the origin of somatic cells is not particularly limited, but is preferably a mammal, more preferably a human. When human-derived T cells of the present invention are used for transfusion, it is preferable that the somatic cells that are the source of iPS cells are isolated from the subject to be transfused, from the viewpoint of facilitating compatibility of the human leukocyte antigen (HLA) type with that of the transfused patient.

[0099] Existing cell lines may be used as iPS cells. For example, human iPS cell lines include 253G1 strain (RIKEN Cell Bank No. HPS0002), 201B7 strain (RIKEN Cell Bank No. HPS0063), 409B2 strain (RIKEN Cell Bank No. HPS0076), 454E2 strain (RIKEN Cell Bank No. HPS0077), HiPS-RIKEN-1A strain (RIKEN Cell Bank No. HPS0003), HiPS-RIKEN-2A strain (RIKEN Cell Bank No. HPS0009), HiPS-RIKEN-12A strain (RIKEN Cell Bank No. HPS0029), and Nips-B2 strain (RIKEN Cell Bank No. HPS0223).

[0100] Cells into which the modified TCR of the present invention is introduced include hematopoietic stem / progenitor cells. Hematopoietic stem / progenitor cells can be collected from bone marrow, umbilical cord blood, mobilized peripheral blood, etc. These cells can be derived from the patient himself / herself or from healthy individuals such as related or unrelated donors.

[0101] Furthermore, cells into which the modified TCR of the present invention is introduced also include T cells in which the endogenous TCR α gene and endogenous TCR β gene have been knocked down or knocked out.

[0102] The T cells, the endogenous TCR α gene and the endogenous TCR β gene, the gene knockdown and the gene knockout, and the method for producing T cells in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked down, respectively, are the same as those described above.

[0103] The cell into which the modified TCR of the present invention is introduced may be a cell into which a chimeric antigen receptor (CAR) has been introduced in advance. Here, CAR means a fusion protein containing an extracellular domain that binds to an antigen and an intracellular domain derived from a polypeptide different from the extracellular domain. Examples of CAR include fusion proteins in which an antigen recognition site of an antibody for a specific antigen [e.g., a light chain (L chain) of a variable region and a heavy chain (H chain) of a variable region, etc.] is bound to an intracellular domain of a T cell receptor such as CD3, and an intracellular domain of a costimulatory molecule such as CD28 or 4-1BB (for example, as described in JP Patent Publication No. 2015-509716).

[0104] The antigen recognition site of the CAR can be selected according to the antigen of interest, thereby making it possible to produce T cells specific to the antigen of interest. For example, when CD19 is used as an antigen, the antigen recognition site of an anti-CD19 antibody can be cloned and bound to the intracellular domain of a CD3 molecule to produce a CAR (see, for example, Cancer Res., 66: 10995-11004, 2006). In addition, the strength or duration of activation can be controlled by selecting the type or number of co-stimulatory molecules to be bound (see, for example, Mol Ther., 17: 1453-1464, 2009).

[0105] By introducing a CAR, it is possible to confer specificity for a target antigen to cells into which the modified TCR of the present invention has been introduced. In addition, by introducing a CAR, it is possible to directly recognize antigen molecules, and it is possible to induce a strong immune response even against tumors with reduced expression of HLA class I genes.

[0106] [Differentiation of T cells from pluripotent stem cells or primary hematopoietic stem / progenitor cells transfected with modified TCR] In the present invention, the method for differentiating T cells from pluripotent stem cells into which a modified TCR has been introduced can be carried out using known methods.Specific examples of the method include the method described in International Publication No. 2016 / 076415 for producing CD8 positive cells and the method described in International Publication No. 2017 / 221975 for producing CD4CD8 positive T cells.

[0107] The method for differentiating T cells from primary hematopoietic stem / progenitor cells can be the same as or similar to the method for differentiating T cells from pluripotent stem cells described above (e.g., Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro; Blood, 105(4): 1431-1439, 2005).

[0108] [Therapeutic agents, pharmaceutical compositions, and immune cell therapy methods] The modified TCR of the present invention, the cell expressing the modified TCR, the nucleic acid encoding the first and second polypeptides constituting the modified TCR, or the expression vector containing the nucleic acid can each be used as a therapeutic agent. The therapeutic agent may be used alone or in combination with other drugs and treatment methods that can be used in the treatment of cancer, autoimmune disease, heart disease, etc.

[0109] Examples of other drugs and treatment methods that can be used include, but are not limited to, molecular targeted drugs, chemotherapy, radiofrequency ablation therapy, surgical therapy, hepatic artery (chemo)embolization therapy, radiation therapy, heavy particle therapy, radioisotope therapy, hepatic arterial injection chemotherapy, peptide vaccine therapy, and other immune cell therapy. The therapeutic agent of the present invention and the other drugs described above may be administered simultaneously or separately, and may be administered by the same administration route or different administration routes.

[0110] The above-mentioned therapeutic agent can also be in the form of a pharmaceutical composition or a composition for immune cell therapy, either alone or in combination with other active ingredients. Ingredients that can be contained in the pharmaceutical composition include, in addition to the therapeutic agent of the present invention and other active ingredients, pharma- ceutical acceptable carriers, buffers, or stabilizers that are usually mixed in the art depending on the administration form. Carriers include, but are not limited to, physiological saline, phosphate buffered saline, glucose solution, or buffered saline. Salts, sugars, sugar alcohols, and the like can also be used as additives. The therapeutic agent and pharmaceutical composition of the present invention are intended to be administered in liquid form due to the nature of the present invention, and therefore need to be in a form that can maintain the stability of the active ingredient.

[0111] The therapeutic agent and pharmaceutical composition of the present invention can be administered locally or systemically, and the administration form is not particularly limited, but can be, for example, intravenous administration. It may also be administered by injection or infusion into the affected area or near the affected area. The dosage and frequency of administration of the therapeutic agent or pharmaceutical composition of the present invention vary depending on the patient's weight, sex, age, severity of the disease, etc., and are not particularly limited.

[0112] Examples of the immune cell therapy method of the present invention include a method comprising the steps of expressing the modified TCR of the present invention in pluripotent stem cells derived from non-T cells and differentiating them into T cells, and administering the obtained cells to a subject; a method comprising the steps of expressing the modified TCR of the present invention in pluripotent stem cells derived from T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out, respectively, and differentiating them into T cells, and administering the obtained cells to a subject; a method comprising the steps of expressing the modified TCR of the present invention in hematopoietic stem / progenitor cells and differentiating them into T cells, and administering the obtained T cells to a subject; a method comprising the steps of expressing the modified TCR of the present invention in T cells in which the endogenous TCRα gene and endogenous TCRβ gene have been knocked down or knocked out, respectively, and administering the obtained cells to a subject. The T cells to be administered may be the obtained T cells as they are, or may be administered in the form of the above-mentioned formulated pharmaceutical composition.

[0113] The present invention will be described in detail below based on examples, but the embodiment of the present invention is not limited to these examples. EXAMPLES

[0114] [Example 1] The ability of the modified TCR to retain CD3 subunit molecules in 293T cells was analyzed.

[0115] First, a full-length TCR expression vector was constructed. The full-length TCRα chain and full-length TCRβ chain genes were derived from the T cell-derived iPS cell line TKT3v1-7 (provided by the University of Tokyo, described in Nishimura et al., Cell Stem Cell.12: 774-786, 2013), which was established by introducing Yamanaka factors into T cells. The full-length base sequence of TCRα used in the examples is shown in SEQ ID NO: 25, and the full-length base sequence of TCRβ is shown in SEQ ID NO: 36. RNA was extracted from T cells obtained by differentiation from the TkT3v1-7 line, and 5' RACE cDNA and 3' RACE cDNA of the TCRα and TCRβ genes were obtained using SMARTer RACE 5' / 3' Kit (Takara Bio). Full-length cDNA sequence information was obtained by Sanger sequencing of the cDNA product.

[0116] The TCR expression vector was constructed by cloning the TCR β chain gene and the TCR α chain gene linked in this order with the SGSG linker-T2A peptide sequence upstream of the IRES of the pEF1α-IRES-hKO1 (humanized codon type Kusabira Orange) vector (hereafter referred to as mock vector) using the In-Fusion HD Cloning Kit (Clontech). This full-length TCR expression vector was named the ba1 vector.

[0117] Next, a modified TCR expression vector lacking the variable region deletion was constructed. The constant region sequences of the TCRα and TCRβ sequences were linked in-frame directly downstream of the sequences encoding the signal peptides of the TCRα and TCRβ sequences to form a variable region deleted TCR gene. This was cloned into a mock vector in the same manner as the ba1 vector to construct an expression vector (ba2 vector).

[0118] Furthermore, a modified TCR expression vector was constructed in which the constant region sequences were deleted stepwise in addition to the variable regions of the TCRα and TCRβ sequences. Based on known literature (Kuhns et al., Immunity.26: 357-369, 2007; Natarajan et al., Cell Rep. 14: 2833-2845, 2016), four regions, AB loop, C strand, DE loop, and F strand, were extracted from the TCRα constant region, and four regions, Helix3, CC loop, Helix4 F strand, and FG loop, were extracted from the TCRβ constant region. Multiple patterns of modified TCR sequences were designed in which constant region sequences in which bases were deleted stepwise from the 5' end to eliminate each amino acid region were connected in-frame immediately below the sequence coding for the signal peptide of the TCRα and TCRβ sequences, and the sequences were cloned into mock vectors to construct expression vectors (ba3 to ba18 vectors).

[0119] A schematic diagram of the above full-length and modified TCR sequences is shown in Figure 1, the amino acid sequence information of ba1 (sequence number 49) is shown in Figure 2, the amino acid sequence information of ba2 to ba9 (sequence numbers 50 to 57) is shown in Figure 3, and the amino acid sequence information of ba10 to ba18 (sequence numbers 58 to 66) is shown in Figure 4.

[0120] CD3 expression vectors for expression in 293T cells were constructed based on the known cDNA sequence information of each CD3 subunit (CD3E: NM_000733.3; CD3G: NM_000073.2; CD3D: NM_000732.4; CD247 (CD3Z): NM_198053.2). These CD3 subunit sequences and the EGFP gene were linked with the GSG linker-T2A peptide sequence (CD3E-T2A-CD3G-T2A-CD3D-T2A-CD3Z-T2A-EGFP) and cloned into the pEF1α expression vector.

[0121] 293T cells stably expressing CD3 were established. 293T cells were obtained from DSMZ (#ACC635). 293T medium [containing Dulbecco's Modified Eagle Medium (Nacalai Tesque), 10% FBS (Access Cell Culture), 10μg / mL gentamicin sulfate (Nacalai Tesque)] was used for maintenance culture of 293T cells. 293T cells were passaged by washing once with PBS (Nacalai Tesque) and detaching the cells with Trypsin / EDTA solution (Sigma). 293T cells were transfected with CD3 expression vector using Lipofectamine 2000 (ThermoFisher), and the EGFP-positive fraction was purified using a cell sorter SH800 (SONY) and the cells were expanded and cultured repeatedly to establish a CD3-EGFP stable expressing line.

[0122] We verified whether CD3E and CD3D molecules were retained on the cell surface by introducing the above-mentioned various ba vectors into the CD3-EGFP stable expression line. Various ba vectors and mock vectors were transfected into the CD3-EGFP stable expression line using Lipofectamine 2000, and the cells were harvested two days later. The harvested cells were washed with FACS buffer [containing PBS (Nacalai Tesque), 2% FBS (Access Cell Culture), and 1 mM EDTA (Invitrogen)]. PE / Cy7-labeled anti-human CD3E antibody (clone: ​​UCHT1) (BioLegend) was added to stain CD3E, and APC-labeled anti-human CD3D antibody (clone: ​​7D6) (Invitrogen) was added to stain CD3D, and the cells were left to stand at 4°C for 30 minutes in the dark. After washing the cells with FACS buffer, DAPI (Dojindo Laboratories) was added to stain dead cells. FACS analysis was performed using a cell sorter SH800.

[0123] The expression pattern of CD3E in the EGFP-positive, hKO1-positive, DAPI-negative fraction is shown in FIG. 5, and the numerical data based on MFI (Mean Fluorescence Intensity) is shown in FIG. 6. CD3E expression was observed in cells transfected with full-length TCR (ba1). CD3E expression was also confirmed on the cell surface when modified TCRs ba2 to ba18 were transfected, but the expression level varied depending on the type of modified TCR.

[0124] The expression pattern of CD3D is shown in Figure 7, and the numerical data by MFI is shown in Figure 8. Expression of CD3D was observed in cells transfected with full-length TCR (ba1). As in the case of CD3E, expression of CD3D on the cell surface was confirmed by transfection with modified TCRs ba2 to ba18, but the expression level varied depending on the type of modified TCR.

[0125] From the above, artificial TCR / CD3 reconstitution experiments in 293T cells have made it possible to screen for modified TCRs that can efficiently retain CD3 subunit expression on the cell surface. As a result of the verification of ba1 to ba18, it was revealed that the expression levels of CD3E and CD3D on the cell surface changed depending on the deletion pattern of the TCR gene. Specifically, ba2, ba3, ba7, ba8, ba9, ba10, ba17 and ba18 had the same level of CD3E and CD3D retention ability as ba1.

[0126] [Example 2] The ability of the modified TCR to retain CD3 subunit molecules was analyzed in Jurkat cells.

[0127] To analyze the CD3 subunit retention ability of the modified TCR under more physiological conditions, Jurkat cells (#ACC282) (DSMZ), a T cell line, were used. Jurkat cells were maintained in Jurkat medium [RPMI1640 (Nacalai Tesque), 10% FBS (Access Cell Culture), 10 μg / mL gentamicin sulfate (Nacalai Tesque)]. Subculture was performed by taking an appropriate amount of Jurkat cells and suspending them in fresh Jurkat medium.

[0128] Jurkat cells, a cell line of the T cell lineage, have endogenous TCR genes in which the TCRα and TCRβ genes have already been rearranged. Therefore, when a modified TCR gene is introduced into wild-type Jurkat cells (hereinafter referred to as WT strain), a chimeric TCR molecule may be formed between the endogenous TCR gene and the modified TCR, and the CD3 subunit retention ability of the modified TCR cannot be accurately determined. Therefore, we attempted to double knock out the endogenous TCRα and TCRβ genes in Jurkat cells by genome editing.

[0129] Genome editing was performed targeting the gene encoding the TCR α chain constant region (TRAC gene) and the gene encoding the TCR β chain constant region (TRBC gene), and knockout was performed by frameshift. For genome editing, a method was used in which a complex of Cas9 protein and guide RNA was directly introduced into cells using the Alt-R CRISPR-Cas9 System (IDT). The target sequences (NGG upstream 20mer) were extracted from publicly known literature; TRAC: gagaatcaaaatcggtgaat (SEQ ID NO: 67) (described in Osborn et al., Mol Ther, 2017); TRBC (common to TRBC1 and TRBC2): caaacacagcgacctcgggt (SEQ ID NO: 68) (described in Legut et al., Blood. 131(3): 311-322, 2018).

[0130] After forming the Cas9 / guide RNA complex according to the manufacturer's instructions, the Cas9 / guide RNA complex was introduced into Jurkat cells by electroporation using 4D-Nucleofector (Lonza) and SE Cell Line 4D-Nucleofector X Kit L (Lonza) (introduction program: CL-120).

[0131] First, Cas9 / guide RNA complex was introduced into the WT strain for TRAC gene knockout. After expansion and culture, the cells were stained with APC-labeled anti-human TCRα / β antibody (clone: ​​IP26) (BioLegend) and PE / Cy7-labeled anti-human CD3E antibody (clone: ​​UCHT1) (BioLegend), and the appearance of a TCR-negative CD3E-negative fraction was observed. This fraction was purified using a cell sorter and expanded and cultured, and then Cas9 / guide RNA complex was introduced for TRBC gene knockout. After expansion and culture, a vector expressing only the full-length TCRα chain was transiently introduced into the cells, and stained with APC-labeled anti-human TCRα / β antibody and PE / Cy7-labeled anti-human CD3E antibody, and the appearance of a TCR-negative CD3E-negative fraction was observed. This fraction was considered to be a fraction in which the TCRβ gene was successfully knocked out, and was purified using a cell sorter and expanded and cultured.

[0132] Finally, we transiently transfected these cells with a vector expressing only the full-length TCRα chain or a vector expressing only the full-length TCRβ chain, and stained them with APC-labeled anti-human TCRα / β antibody and PE / Cy7-labeled anti-human CD3E antibody. In both cases, we found that the TCR-negative CD3E-negative fraction was present at a purity of about 99%. Based on the above, we established a double knockout strain of the TCRα gene and the TCRβ gene (hereinafter referred to as the dKO strain).

[0133] We verified whether CD3E and CD3D molecules were retained on the cell surface by introducing various ba vectors into the dKO strain. Various ba vectors and mock vectors were introduced by electroporation in the same manner as above, and the cells were harvested two days later. The harvested cells were washed with FACS buffer. PE / Cy7-labeled anti-human CD3E antibody was added to stain CD3E, and APC-labeled anti-human CD3D antibody was added to stain CD3D, and the cells were left to stand at 4°C for 30 minutes in the dark. After washing the cells with FACS buffer, DAPI was added to stain dead cells. FACS analysis was performed using a cell sorter SH800.

[0134] The expression pattern of CD3E in the DAPI-negative fraction is shown in Figure 9, and the numerical data by MFI is shown in Figure 10. CD3E expression was observed in cells transfected with full-length TCR (ba1). CD3E expression was also confirmed on the cell surface when modified TCRs ba2 to ba18 were transfected, but the expression level varied depending on the type of modified TCR.

[0135] The expression pattern of CD3D is shown in Figure 11, and the numerical data by MFI is shown in Figure 12. Expression of CD3D was observed in cells transfected with full-length TCR (ba1). As in the case of CD3E, expression of CD3D on the cell surface was confirmed by transfection with modified TCRs ba2 to ba18, but the expression level varied depending on the type of modified TCR.

[0136] From the above, we demonstrated that by using a dKO strain of Jurkat cells that has the properties of T cells, it is possible to screen for modified TCRs that can efficiently maintain CD3 subunit expression on the cell surface. As a result of verifying ba1 to ba18, it was found that the expression levels of CD3E and CD3D on the cell surface vary depending on the deletion pattern of the TCR gene. As a result of verifying ba1 to ba18, it was found that, for example, ba7, ba8, and ba9 supported cell surface expression of CD3E and CD3D at relatively high levels even in Jurkat cells, although not as high as ba1.

[0137] [Example 3] We analyzed the signaling ability of the modified TCR using a dKO strain of Jurkat cells.

[0138] In Examples 1 and 2, it was shown that there is a variation in the ability to support the expression of CD3 subunits on the cell surface for each of the designed modified TCRs. Next, signal transmission to T cells via the CD3 molecule presented on the cell surface by the modified TCR was examined.

[0139] CD69 is a representative cell surface marker of activated T cells, the expression of which is induced early when T cells respond to TCR / CD3 complex stimulation (described in Ziegler et al., Stem Cells. 12(5): 456-65, 1994). It is also known that CD69 expression is enhanced in Jurkat cells in response to stimulation with CD3 / CD28 antibody-bound beads (described in Tomkowicz et al., PLoS One, 2015). Therefore, if CD69 expression is enhanced by CD3 stimulation when CD3 molecules are retained on the cell surface by the modified TCR, it can be shown that the modified TCR is functionally useful in T cell signaling.

[0140] We examined whether stimulation of WT and dKO Jurkat cells with OKT3, an anti-CD3E agonist antibody, would enhance CD69 expression. 100 μL of Ultra-LEAF Purified anti-human CD3 Antibody (clone: ​​OKT3) (BioLegend) diluted to 10 μg / mL with PBS (Nacalai Tesque) was added to a 96-well plate for adherent cells and incubated overnight at 37°C.

[0141] The supernatant was removed, and the plate (hereinafter referred to as solidified OKT3 plate) was washed twice with PBS. The WT or dKO strain was seeded on the plate and further cultured overnight at 37°C. The cells were collected and washed with FACS buffer. Alexa Fluor 647-labeled anti-human CD69 antibody (clone: ​​FN50) (BioLegend) was added to the cells and allowed to stand at 4°C for 30 minutes in the dark. After washing the cells with FACS buffer, DAPI was added to stain dead cells. FACS analysis was performed using a cell sorter SH800. The results are shown in Figure 13.

[0142] As shown in Figure 13, OKT3 stimulation increased CD69 expression in the WT strain, whereas no enhancement of CD69 expression was observed in the dKO strain, indicating that the dKO strain, in which CD3 expression was lost due to TCR double knockout, also lost responsiveness to CD3 stimulation.

[0143] Next, it was verified whether the introduction of modified TCR into the dKO strain would result in enhanced CD69 expression via OKT3 stimulation. As in Example 2, various ba vectors and mock vectors were introduced into the dKO strain by electroporation, and the cells were collected the next day and seeded on a solidified OKT3 plate. The cells were collected the next day, and CD69 expression analysis was performed using the same procedure as above. The expression pattern of CD69 in the DAPI-negative fraction is shown in FIG. 14, and the numerical data by MFI is shown in FIG. 15.

[0144] As shown in Figures 14 and 15, CD69 expression was observed in cells transfected with full-length TCR (ba1). When the modified TCRs ba2 to ba18 were transfected, CD69 expression was confirmed on the cell surface, but the expression level varied depending on the type of modified TCR.

[0145] From the above, it was revealed that the modified TCR not only retains CD3 molecules on the cell membrane surface, but also transmits TCR / CD3 complex signals into the cell by stimulating the CD3 molecules presented on the cell surface with agonistic antibodies, etc.

[0146] [Example 4] The CD3E positivity rate by CD1-18 in the CD3-EGFP stable expressing line was reanalyzed based on the FACS analysis results of the CD3E protein obtained in Example 1. FlowJo was used as the analysis software. The average value (N=2) is shown in Table 1.

[0147] [Table 1]

[0148] [Example 5] Using 293T cells forced to express CD3, the localization of the CD3 protein on the cell surface by modified TCRα and modified TCRβ was evaluated. Here, from the results of Example 1 and Example 2, 293T cells in which the CD3 subunit is constitutively expressed (CD3-forced expression 293T cells) had higher sensitivity than Jurkat cells in which the endogenous TCR was knocked out, and therefore, in Example 5, analysis was performed using CD3-forced expression 293T cells.

[0149] First, the sequences of modified TCRα and TCRβ were designed. The amino acids of TCRα and TCRβ that have been reported to interact with CD3 protein were confirmed with reference to known literature (Michael S. Kuhns et al., Immunity. 26: 357-369, 2007; Aswin Natarajan et al., Cell Reports.14: 2833-2845, 2016).

[0150] The crystal structures of the TCRα and TCRβ proteins were confirmed using PyMOL, an open source molecular graphic tool. The crystal structures of the TCRα and TCRβ proteins were referenced to publicly available information (Protein Data Bank ID: 3QJF).

[0151] Partial N-terminal sequences of the amino acid sequences of the extracellular domains of the modified TCR α and modified TCR β proteins are shown in Figures 16 and 17, respectively. The amino acid sequences of the modified TCR α and its fragments are shown in Tables 2 and 8, and the amino acid sequences of the modified TCR β and its fragments are shown in Tables 3 and 9, respectively.

[0152] [Table 2]

[0153] [Table 3]

[0154] The amino acid sequences of TCRα and TCRβ of ba2 to ba18 are selected from the modified TCRα and fragments thereof and the modified TCRβ and fragments thereof shown in Tables 2 and 8, and Tables 3 and 9, respectively. Table 4 shows the correspondence between each of the amino acid sequences of the modified TCRα and fragments thereof and the modified TCRβ and fragments thereof shown in Tables 2 and 8, and Tables 3 and 9, and each of the amino acid sequences of TCRα and TCRβ in ba2 to ba18.

[0155] [Table 4]

[0156] Plasmid vectors expressing the designed modified TCRα and modified TCRβ were constructed. Using ba2 as a template, αCR and βCR were amplified by adding Kpn1 to the 5' end and Xho1 to the 3' end by PCR. pcDNA3.1(+) Mammalian Expression vector (Thermo Fisher Scientific) was cleaved with Kpn1 and Xho1, and the amplified DNA was cloned. Next, using αCR and βCR as templates, α1 to 10 and β1 to 12 were produced by inverse PCR. The primers used for inverse PCR are shown in Table 5. PCR was performed using PrimeSTAR GXL Polymerase, and the DNA sequence was confirmed by sequence analysis of the obtained plasmid DNA. The base sequences of DNA encoding modified TCRα are shown in Tables 6, 10, and 11, and the base sequences of DNA encoding modified TCRβ are shown in Tables 7, 12, and 13, respectively.

[0157] [Table 5]

[0158] [Table 6]

[0159] [Table 7]

[0160] [Table 8]

[0161] [Table 9]

[0162] [Table 10]

[0163] [Table 11]

[0164] [Table 12]

[0165] [Table 13]

[0166] We verified whether the CD3 molecule was retained on the cell surface by introducing a modified TCR expression vector into a CD3-EGFP stable expression line. Various modified TCRα vectors and various modified TCRβ vectors were combined and co-transfected with the transfection marker pEF1α-IRES-hKO1 (the mock vector in Example 1) into the CD3-EGFP stable expression line using Lipofectamine 2000 (Invitrogen).

[0167] Empty pcDNA3.1(+) vector and pEF1α-IRES-hKO1 were cotransfected as a control. After 2 days, the cells were collected and washed with FACS buffer [containing PBS (Nacalai Tesque), 2% FBS (Access Cell Culture), and 1 mM EDTA (Invitrogen)].

[0168] To stain CD3, APC-labeled anti-human CD3 antibody (clone:UCHT1) (BioLegend) was added to the cells and left to stand in the dark at 4°C for 30 minutes. After washing the cells with FACS buffer, propidium iodide was added to stain dead cells. FACS analysis was performed using a BD LSR Fortessa. The CD3 positivity rate in EGFP(+)KO(+) cells was analyzed using FlowJo9. The average value of N=3 is shown in Figure 18.

[0169] From the results shown in FIG. 18, the following findings (1) to (13) were obtained. (1) All modified TCRs that combined βCR and each modified TCRα showed high CD3 recruiting activity of over 80%. (2) The modified TCRs consisting of β1 and each modified TCRα showed 7.42-43.1% CD3 recruiting activity. In particular, when combined with modified TCRα consisting of αCR and α1, they showed sufficiently high CD3 recruiting activity of more than 20%. (3) Modified TCRs consisting of β2 and each modified TCRα showed 13.3-71% CD3 recruiting activity. In particular, when combined with modified TCRα other than α3, they showed sufficiently high CD3 recruiting activity of more than 20%. (4) The modified TCRs consisting of β3 and each modified TCRα showed CD3 recruiting activity of 1.12-6.63%. (5) The modified TCRs consisting of β4 and each modified TCRα showed CD3 recruiting activity of 1.02-8.97%. (6) The modified TCRs consisting of β5 and each modified TCRα showed CD3 recruiting activity of 0.99-8.97%. (7) The modified TCRs consisting of β6 and each modified TCRα showed CD3 recruiting activity of 0.94-10.1%. (8) The modified TCRs consisting of β7 and each modified TCRα showed 3.58-30.1% CD3 recruiting activity. In particular, when combined with α9-10, they showed a sufficiently high CD3 recruiting activity of over 20%. (9) Modified TCRs consisting of β8 and each modified TCRα showed CD3 recruiting activity of 1.81-18.1%. (10) The modified TCRs consisting of β9 and each modified TCRα showed 5.28-69.2% CD3 recruiting activity. In particular, when combined with α8-10, they showed a sufficiently high CD3 recruiting activity of over 20%. (11) Modified TCRs consisting of β10 and each modified TCRα showed 9.23-85.1% CD3 recruiting activity. In particular, when combined with α3-10, it showed a sufficiently high CD3 recruiting activity of more than 20%. (12) The modified TCRs consisting of β11 and each modified TCRα showed 12.3-81.7% CD3 recruiting activity. In particular, when combined with α3-10, they showed a sufficiently high CD3 recruiting activity of over 20%. (13) Modified TCRs consisting of β12 and each modified TCRα showed 11.5-80.6% CD3 recruiting activity. In particular, when combined with α3-10, it showed a sufficiently high CD3 recruiting activity of more than 20%.

[0170] These results demonstrated that most of the combinations of modified TCRα and modified TCRβ induced recruitment of CD3 protein to the cell surface, and that the expression level of CD3 on the cell surface varied depending on the TCR gene deletion pattern.

[0171] [Example 6] Retroviral vectors of ba1, ba2, ba4 and ba9, which are modified TCRs, were constructed. The inserts were excised using EcoRI and NotI located upstream of the IRES of the ba1 vector, ba2 vector, ba4 vector and ba9 vector (pEF1α-IRES-hKO1) constructed in Example 1, and subcloned into pMY-IRES-EGFP (hereinafter referred to as pMY-IG, Cell Biolabs, Inc.) cleaved with EcoRI and NotI. To produce retroviruses, ba1-pMY-IG, ba2-pMY-IG, ba4-pMY-IG, ba9-pMY-IG and Empty-pMY-IG were transfected into GP2-293 packaging cells (Takara Bio) together with the VSV-G vector (Takara Bio) using Lipofectamine 2000. Two days later, the cell supernatant containing the retrovirus was collected, and concentrated retroviruses were prepared using a Retro-X Concentrator (Takara Bio).

[0172] [Example 7] We verified the ability of the modified TCRs ba1 and ba2 to induce T cells from iPS cells. First, hematopoietic progenitor cells (HPCs) for gene transfer of ba1 and ba2 were induced from iPS cell lines (FF-WJs524, FF-WJs527) that were confirmed to be derived from umbilical cord blood and not derived from T cells. For the maintenance of feeder-free iPS cells, StemFit AK02N medium (Ajinomoto) was used.

[0173] iPS cells were detached from the iMatrix-511-coated culture surface using a detachment agent [1× TrypLE Select (Thermo Fisher Scientific) diluted 1 / 2 with PBS, 0.5 mol / l EDTA solution (pH 8, Nacalai tesque) was added, and the final concentration was 0.5× TrypLE Select, 0.75 mM EDTA], and then passaged and cultured in a medium containing StemFit AK02N and 10 μM Y-27632 (37°C, 5% CO 2 The next day, the medium was replaced with StemFit AK02N. This procedure was repeated once a week to maintain the iPS cells.

[0174] Next, HPCs were produced by inducing differentiation of iPS cells using the Embryoid Body formation method. Feeder-free iPS cells were detached with 0.5× TrypLE Select and 0.75 mM EDTA, and then plated at 2–3×10 5 Cells were seeded at 1000 cells / well.

[0175] The cells were cultured under hypoxic conditions (5% O) in Stemfit AK02N medium supplemented with 10 μM Y-27632 (Nacalai tesque) and 10 μM CHIR99021 (Tocris Bioscience). 2) (Day 0). The next day, the cells were cultured in StemPro34 (Thermo Fisher Scientific) medium (EB medium) supplemented with 1x Insurin, Transferrin, Selenium Solution (Thermo Fisher Scientific), 1x Glutamax (Thermo Fisher Scientific), 0.2x PSG, 45 mM monothioglycerol (Wako), and 50 μg / ml PAA (Wako), and then cultured with 50 ng / ml BMP-4 (Miltenyi Biotec), 50 ng / ml VEGF-165A (Wako), and 50 ng / ml bFGF (Wako) (Day 1, 5% O 2 ).

[0176] The next day, 6 μM SB431542 (Wako) was added and cultured (Day 2, 5% O 2 After 2 days, the cells were cultured in EB medium supplemented with 50 ng / ml VEGF-165A, 50 ng / ml bFGF, and 50 ng / ml SCF (Day 4, 5% O 2 After 2 days, the cells were cultured in EB medium supplemented with 50ng / ml VEGF-165A, 50ng / ml bFGF, 50ng / ml SCF, 30ng / ml TPO (Wako), and 10ng / ml FLT3L (Wako) (Day 6). The medium was changed every 2-3 days, and the cells were incubated in 5% CO until Day 13. 2 The cells were then harvested and frozen in a Tc protector.

[0177] The resulting HPCs were transduced with modified TCR ba1 and ba2, and then differentiated into CD3(+)CD45(+) T cells. In detail, to transduce the retrovirus, frozen HPCs were thawed and cultured in EB medium supplemented with 50ng / ml VEGF-165A, 50ng / ml bFGF, 50ng / ml SCF, 30ng / ml TPO (Wako), and 10ng / ml FLT3L (Wako) (Day-2).

[0178] The next day, 2–4 × 10 cells were thawed on a 48-well plate coated with Retronectin (100 μg / ml, Takara Bio). 4 Then, modified TCRba1, ba2 or Empty retrovirus was added, and the cells were cultured in EB medium supplemented with 50ng / ml VEGF-165A, 50ng / ml bFGF, 50ng / ml SCF, 30ng / ml TPO (Wako), and 10ng / ml FLT3L (Wako) (Day-1).

[0179] The next day, the cells were seeded again onto 48-well plates coated with DLL4 (5 μg / ml, R&D systems) and Retronectin (5 μg / ml, Takara Bio) and cultured in alpha-MEM medium supplemented with 50 ng / ml SCF (Wako), 50 ng / ml IL-7 (Wako), 50 ng / ml Flt3L (Wako), 100 ng / ml TPO (Wako), 30 μM SDF-1α (Wako), 15 μM SB203580 (Tocris Bioscience), 55 μM 2-mercaptoethanol (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG (Day 0).

[0180] Every week, new plates coated with DLL4 and Retronectin were prepared and the cells were reseeded. The medium was changed every 2 to 3 days. The cells were cultured until Day 21. The differentiated cells (Day 21) were co-stained with CD3-BV510 (BioLegend) and CD45-APC-Cy7 (BioLegend). After washing, the cells were resuspended in FACS buffer containing propidium iodide (PI). Analysis was performed using a BD LSRFortessa cytometer (BD Bioscience). The positive rates of CD3 and CD45 in the PI(-)GFP(+) cell population were analyzed using FlowJo9.

[0181] As a representative example of the results of expression analysis of CD3 and CD45, the results of FF-WJs524 are shown in Figure 19(A). As shown in Figure 19(A), CD3 expression was not observed in Empty-transfected cells, whereas CD3 expression was observed in ba1 and ba2-transfected cells (ba1: 99.8%, ba2: 50.4%). Expression of the CD45 leukocyte marker was observed in all of Empty, ba1, and ba2.

[0182] Next, CD8β(+)CD8α(+) were induced to mature T cells. In detail, the above-mentioned CD3(+)CD45(+) T cells were cultured in a 48-well plate at 1–10x10 4 Cells were seeded at 1000 x 1000 cells / well and cultured in alpha-MEM medium supplemented with 500 ng / ml Anti-CD3 antibody OKT3 (eBioscience), 10 nM Dexamethasone (Dexate R, Fuji Pharma), 10 ng / ml IL-7 (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG (Day 0). After 3 days, the medium was replaced with 10 ng / ml IL-7 (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG, and cultured (Day 3). After 7 days, cells were counted by trypan blue staining (Day 10).

[0183] Over the 10 days from day 0 to day 10, cell proliferation was 0.38-fold and 0.165-fold in the empty control (results for FF-WJs524 and FF-WJs527, respectively; same below), while in the ba1-introduced cells it was 5.13-fold and 2.21-fold, and in the ba2 it was 1.55-fold and 4.25-fold.

[0184] Only the cells transfected with modified TCR ba1 and ba2 were analyzed for the expression of mature T cell markers CD8β and CD8α. Specifically, they were co-stained with CD3-BV510, CD45-APC-Cy7, CD4-BV421 (BioLegend), CD8beta-PE-Cy7 (eBioscience), and CD8α-APC (BioLegend). After washing, the cells were resuspended in FACS buffer containing propidium iodide. Analysis was performed using a BD LSRFortessa cytometer (BD Bioscience). The positive rates of CD8β and CD8α in the PI(-)GFP(+)CD3(+)CD45(+)CD4(-) cell population were analyzed using FlowJo9.

[0185] As a representative example of the expression analysis results of CD8β and CD8α, the results for FF-WJs524 are shown in Figure 19(B). Both ba1 and ba2-introduced cells expressed CD8β and CD8α (Ba1: 100%, Ba2: 99.5%).

[0186] These results indicate that ba2, a modified TCR consisting of TCRα / TCRβ without variable domains, is useful for inducing mature T cells from totipotent stem cells, as is ba1 consisting of the full-length TCRα / TCRβ. In particular, mature T cells could be induced by introducing ba1 and ba2 using the CD3 antibody OKT3, which indicates that the modified TCR not only has the effect of retaining CD3 molecules on the cell membrane surface, but also has the effect of transmitting TCR / CD3 complex signals into the cell by stimulating the CD3 molecules presented on the cell surface with agonist antibodies, etc.

[0187] [Example 8] The T cell induction ability was evaluated using ba4, a modified TCR with a part of the TCRβ constant domain truncated, and ba9, a modified TCR with a part of the TCRα constant domain truncated. After gene transfer of ba4 and ba9 into HPCs of the iPS cell line FF-WJs524, differentiation induction and analysis were performed in the same manner as in Example 7. The results of 21 days of culture on DLL4 and Retronectin are shown in Figure 20(A).

[0188] As shown in Figure 20(A), no CD3 expression was observed in the Empty-transfected cells (0.94%), whereas CD3 expression was observed in the ba4- and ba9-transfected cells (ba4: 38.3%, ba9: 99.5%). Expression of the CD45 leukocyte marker was observed in all of the Empty, ba4, and ba9 transfected cells.

[0189] Next, the cells were induced to differentiate into CD8β(+)CD8α(+) mature T cells. The results of the expression analysis of CD8β and CD8α are shown in Figure 20(B). As shown in Figure 20(B), both ba4 and ba9 transfected cells expressed CD8β and CD8α (ba4: 100%, ba2: 99.7%).

[0190] From the above results, it was shown that, like ba1 and ba2, modified TCRs lacking a part of the constant domain are also useful for inducing differentiation of pluripotent stem cells or totipotent stem cells into mature T cells. Furthermore, ba4 showed the lowest CD3 positivity rate in the reanalysis results of Example 1 (Example 4), and the lowest level of CD3 positivity rate in Additional Example 2. However, in this Example, ba4 was able to induce differentiation of mature T cells. This shows that modified TCRs that can recruit even a small amount of CD3 to the cell surface are useful for inducing differentiation of mature T cells. Furthermore, it was suggested that modified TCRs with various modifications added to the TCRα and TCRβ constant domains, not limited to the modified TCRs shown in the present invention, have CD3 recruiting activity.

[0191] From the above, it was revealed that the modified TCR not only has the effect of simply retaining CD3 molecules on the surface of the cell membrane, but also has the effect of transmitting TCR / CD3 complex signals into the cell by stimulating the CD3 molecules presented on the cell surface with agonist antibodies, etc. [Industrial Applicability]

[0192] To efficiently induce T cell differentiation from pluripotent stem cells or hematopoietic stem / progenitor cells, it is believed that it is important that functional TCR locus rearrangement occurs at the appropriate timing during differentiation and that the resulting TCR / CD3 complex is stimulated in vitro to promote proliferation and survival. However, in pluripotent stem cells in which the TCR locus is not rearranged, functional TCR is not expected to be efficiently generated during differentiation, which significantly reduces the efficiency of T cell production. Even if the TCR locus is rearranged, the antigen specificity of the resulting TCR molecule is random, so there are issues regarding the homogeneity of the cell preparation as well as the safety of the product, which may cause unpredictable alloreactions after transplantation into patients.

[0193] The modified TCR according to the present invention can retain the CD3 subunit on the cell membrane. Therefore, in the differentiation of T cells from pluripotent stem cells, if the modified TCR is expressed in the original pluripotent stem cells or in the precursor cells in the process of differentiation, signals necessary for T cell maturation and proliferation can be freely transmitted at any timing by stimulation via the modified TCR / CD3 complex, and as a result, differentiation induction into T cells is promoted. Similarly, even after differentiation into T cells, it is also possible to appropriately expand T cells by stimulating the modified TCR / CD3 complex. In addition, since the modified TCR according to the present invention has lost its antigen recognition ability, it is considered that there is an extremely low possibility of alloreaction occurring after transplantation of a cell preparation. Therefore, by using the modified TCR according to the present invention, it is possible to efficiently induce differentiation of homogeneous T cells from pluripotent stem cells.

[0194] Furthermore, since the size of the gene encoding the modified TCR according to the present invention is compact compared to the full-length TCR gene, it is believed that it can be used in any format for gene introduction, such as gene introduction via an expression vector or viral vector, episomal vector or transposon vector, or gene insertion into a desired genomic region using genome editing technology, modification of the TCR locus itself, or even gene loading into an artificial chromosome vector.

[0195] Although the present invention has been described in detail using specific embodiments, it is apparent to those skilled in the art that various modifications and variations are possible without departing from the spirit and scope of the present invention. This application is based on a Japanese patent application (Patent Application No. 2018-242733) filed on December 26, 2018, and is incorporated by reference in its entirety.

Claims

1. 1. A modified T cell receptor (TCR) comprising a first polypeptide and a second polypeptide, the first polypeptide is a polypeptide comprising a constant region of human T cell receptor alpha (TCRα) and not comprising a variable region of human TCRα; the second polypeptide is a polypeptide that includes a constant region of a human T cell receptor β (TCRβ) and does not include a variable region of a human TCRβ; The modified TCR has lost the antigen recognition ability derived from the variable regions of human TCRα and human TCRβ. Modified TCR.

2. The modified TCR of claim 1, excluding one in which an antigen recognition site formed by a region other than the variable region of the human TCR α and the variable region of the human TCR β is bound to at least one of the constant region of the human TCR α and the constant region of the human TCR β.

3. A modified T cell receptor (TCR) comprising a first polypeptide and a second polypeptide, the first polypeptide is a polypeptide comprising a constant region of human T cell receptor alpha (TCRα) or a fragment of said constant region, and not comprising a variable region of human TCRα; the second polypeptide is a polypeptide comprising a constant region of human T cell receptor β (TCRβ) or a fragment of said constant region, and not comprising a variable region of human TCRβ; The modified TCR has lost the antigen recognition ability derived from the variable regions of human TCRα and human TCRβ, The constant region of human TCRα or a fragment thereof is a polypeptide according to any one of (A1) to (A3) below: (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1 to 11; (A3) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; A modified TCR, wherein the constant region of human TCRβ or a fragment of the constant region is a polypeptide described in any one of (B1) to (B3) below. (B1) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added.

4. A modified TCR as described in claim 3, excluding one in which an antigen recognition site formed by something other than the variable region of the human TCRα and the variable region of the human TCRβ is bound to at least one of the constant region or a fragment of the constant region of the human TCRα and the constant region or a fragment of the constant region of the human TCRβ.

5. The modified TCR according to claim 3 or 4, wherein the constant region of human TCR α or a fragment of the constant region thereof and the constant region of human TCR β or a fragment of the constant region thereof are a polypeptide according to any one of (a1) to (a8) below. (a1) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (a2) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 13, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or 2; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or 2; (a3) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 5 to 11; (a4) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 19; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 19; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 19, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 or 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 10 or 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 10 or 11; (a5) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:21; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO:21, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs:7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs:7 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs:7 to 11; (a6) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 22, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; (a7) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 23, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; (a8) The constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24 in which one or more amino acids have been substituted, inserted, deleted and / or added, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11; or a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 to 11 in which one or more amino acids have been substituted, inserted, deleted and / or added.

6. The modified TCR according to any one of claims 3 to 5, wherein the constant region of human TCR α or a fragment of the constant region thereof and the constant region of human TCR β or a fragment of the constant region thereof are a polypeptide according to any one of (b1) to (b7) below. (b1) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (b2) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 13; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 13; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 13, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 2; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 2; (b3) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 and 10; (b4) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 21; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; (b5) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 22, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; (b6) the constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 23, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 and 7 to 11; (b7) The constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 4 and 6 to 11.

7. The modified TCR according to any one of claims 3 to 6, wherein the constant region of human TCR α or a fragment of the constant region thereof and the constant region of human TCR β or a fragment of the constant region thereof are a polypeptide according to any one of (c1) to (c5) below. (c1) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 12; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (c2) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 14; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 1; (c3) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 22; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 22, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; (c4) the constant region of human TCRβ or a fragment of said constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 23; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 23; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 23, and the constant region of human TCRα or a fragment of said constant region is a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; (c5) The constant region of human TCRβ or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 24; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCRα or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11; or a polypeptide consisting of an amino acid sequence in which one or several amino acids have been substituted, inserted, deleted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 8 to 11.

8. The modified TCR according to any one of claims 1 to 7, wherein the first polypeptide comprises at least one selected from an AB loop, a C strand, a DE loop, and an F strand in the constant region of the human TCRα.

9. The modified TCR according to any one of claims 1 to 8, wherein the second polypeptide comprises at least one selected from Helix 3, CC loop, Helix 4 F strand and FG loop in the constant region of the human TCRβ.

10. The modified TCR according to any one of claims 1 to 9, wherein the first polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCR alpha, and the second polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCR beta.

11. A modified TCR comprising a first polypeptide and a second polypeptide, the first polypeptide is a polypeptide comprising a constant region of human TCRα or a fragment of said constant region, and not comprising a variable region of human TCRα; the second polypeptide is a polypeptide comprising a constant region of human TCRβ or a fragment of said constant region, and not comprising a variable region of human TCRβ; The modified TCR has lost the antigen recognition ability derived from the variable regions of human TCRα and human TCRβ, A modified TCR, wherein the percentage of CD3 positive cells in a pluripotent stem cell, a hematopoietic stem / progenitor cell, or a T cell in which an endogenous TCRα gene and an endogenous TCRβ gene have been knocked down or knocked out, respectively, into which the modified TCR has been introduced, is 1% or more; The constant region of human TCRα or a fragment thereof is a polypeptide according to any one of (A1) to (A3) below: (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1 to 11; (A3) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; A modified TCR, wherein the constant region of human TCRβ or a fragment of the constant region is a polypeptide described in any one of (B1) to (B3) below. (B1) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added.

12. The modified TCR according to claim 11, excluding one in which an antigen recognition site formed by a component other than the variable region of the human TCR α and the variable region of the human TCR β is bound to at least one of the constant region or a fragment of the constant region of the human TCR α and the constant region or a fragment of the constant region of the human TCR β.

13. The modified TCR according to any one of claims 1 to 12, wherein the percentage of CD3-positive cells in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, into which the modified TCR has been introduced is at least twice as high as the percentage of CD3-positive cells in corresponding cells into which the modified TCR has not been introduced.

14. The modified TCR according to any one of claims 1 to 13, wherein a pluripotent stem cell or a hematopoietic stem / progenitor cell into which the modified TCR has been introduced exhibits equal or greater T cell differentiation ability compared to a corresponding cell into which a full-length TCR has been introduced.

15. The modified TCR according to any one of claims 1 to 14, wherein the alloreactivity of a non-T cell-derived pluripotent stem cell, a hematopoietic stem / progenitor cell, or a T cell in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, into which the modified TCR has been introduced, is reduced compared to a corresponding cell into which a full-length TCR has been introduced.

16. The modified TCR according to any one of claims 1 to 15, which is capable of retaining a CD3 subunit on a cell membrane.

17. The modified TCR of claim 16, capable of transmitting a TCR / CD3 complex-associated signal into a cell.

18. The modified TCR of claim 16 or 17, which is capable of transmitting a TCR / CD3 complex-associated signal into a cell via the CD3 subunit retained on the cell membrane.

19. The modified TCR of claim 18, which activates a T cell by transmitting a TCR / CD3 complex-associated signal intracellularly via the CD3 subunit retained on the cell membrane.

20. The modified TCR according to any one of claims 1 to 19, for expression in a pluripotent stem cell, a hematopoietic stem / progenitor cell, or a T cell in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively.

21. The modified TCR according to claim 20, which is expressed in pluripotent stem cells or hematopoietic stem / progenitor cells to differentiate them into T cells.

22. The modified TCR described in claim 20 is expressed in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCR alpha gene and endogenous TCR beta gene have been knocked down or knocked out, to produce T cells capable of responding to stimulation via the modified TCR / CD3 complex.

23. The modified TCR according to any one of claims 11 to 15 and 20 to 22, wherein the pluripotent stem cell is a pluripotent stem cell derived from a non-T cell, or a pluripotent stem cell derived from a T cell in which an endogenous TCRα gene and an endogenous TCRβ gene have been knocked down or knocked out.

24. A cell expressing a modified TCR according to any one of claims 1 to 23.

25. The cell of claim 24, wherein the cell expressing the modified TCR is a T cell.

26. A pharmaceutical composition comprising a cell expressing the modified TCR according to any one of claims 1 to 23.

27. A method for producing a cell expressing a modified TCR, the modified TCR comprising a first polypeptide and a second polypeptide, and in which the antigen recognition ability derived from the variable regions of human TCRα and human TCRβ has been eliminated, the method comprising the steps of: (a) preparing cells; (b) preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of said constant region and not comprising a variable region of human TCR α, and an expression vector comprising a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of said constant region and not comprising a variable region of human TCR β; (c) transforming the cell prepared in step (a) with the expression vector prepared in step (b); The constant region of human TCRα or a fragment thereof is a polypeptide according to any one of (A1) to (A3) below: (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1 to 11; (A3) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; A method for producing the constant region of human TCR β or a fragment of said constant region, wherein the constant region or a fragment of said constant region is a polypeptide according to any one of (B1) to (B3) below: (B1) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added.

28. The manufacturing method described in claim 27, wherein the modified TCR excludes those in which an antigen recognition site formed by something other than the variable region of the human TCR α and the variable region of the human TCR β is bound to at least one of the constant region or a fragment of the constant region of the human TCR α and the constant region or a fragment of the constant region of the human TCR β.

29. A method for producing a cell expressing a modified TCR, the modified TCR comprising a first polypeptide and a second polypeptide, and in which the antigen recognition ability derived from the variable regions of human TCRα and human TCRβ has been eliminated, the method comprising the following steps (a′) to (c′): (a') preparing cells; (b') preparing an expression vector comprising a polynucleotide encoding a first polypeptide comprising a constant region of human TCR α or a fragment of said constant region and not comprising a variable region of human TCR α, and a polynucleotide encoding a second polypeptide comprising a constant region of human TCR β or a fragment of said constant region and not comprising a variable region of human TCR β; (c') transforming the cell prepared in step (a') with the expression vector prepared in step (b'); The constant region of human TCRα or a fragment thereof is a polypeptide according to any one of (A1) to (A3) below: (A1) a polypeptide consisting of an amino acid sequence shown in any one of SEQ ID NOs: 1 to 11; (A2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1 to 11; (A3) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 1 to 11 in which one or several amino acids have been substituted, inserted, deleted and / or added; A method for producing the constant region of human TCR β or a fragment of said constant region, wherein the constant region or a fragment of said constant region is a polypeptide according to any one of (B1) to (B3) below: (B1) a polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24; (B2) a polypeptide consisting of an amino acid sequence having 90% or more sequence identity to any one of the amino acid sequences shown in SEQ ID NOs: 12 to 24; (B3) A polypeptide consisting of an amino acid sequence represented by any one of SEQ ID NOs: 12 to 24, in which one or several amino acids have been substituted, inserted, deleted and / or added.

30. The manufacturing method described in claim 29, wherein the modified TCR excludes those in which an antigen recognition site formed by something other than the variable region of the human TCR α and the variable region of the human TCR β is bound to at least one of the constant region or a fragment of the constant region of the human TCR α and the constant region or a fragment of the constant region of the human TCR β.

31. The method according to any one of claims 27 to 30, wherein the cells in step (a) or (a') are pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which TCRα and TCRβ genes have been knocked down or knocked out.

32. The method according to any one of claims 27 to 31, wherein the cells expressing the modified TCR are T cells for immune cell therapy.

33. A method for producing T cells, comprising a step of expressing the modified TCR according to any one of claims 1 to 23 in a pluripotent stem cell or a hematopoietic stem / progenitor cell, and differentiating the cell into a T cell.

34. A method for producing T cells, comprising a step of expressing the modified TCR according to any one of claims 1 to 23 in pluripotent stem cells, hematopoietic stem / progenitor cells, or T cells in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, and the resulting T cells are T cells capable of responding to stimulation via the modified TCR / CD3 complex.

35. The modified TCR according to any one of claims 1 to 23 for use in immune cell therapy.

36. A T cell derived from a pluripotent stem cell, which is produced by expressing the modified TCR according to any one of claims 1 to 23 in a pluripotent stem cell and differentiating the stem cell into a T cell, for use in immune cell therapy.

37. A T cell for use in immune cell therapy, comprising a modified TCR according to any one of claims 1 to 23, the modified TCR being expressed in a T cell in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively.

38. A T cell derived from a hematopoietic stem / progenitor cell, which is differentiated into a T cell by expressing the modified TCR according to any one of claims 1 to 23 in the hematopoietic stem / progenitor cell for use in immune cell therapy.

39. Use of the modified TCR according to any one of claims 1 to 23 for the manufacture of a composition for immune cell therapy.

40. Use of T cells derived from pluripotent stem cells, which have been caused to express the modified TCR according to any one of claims 1 to 23 and differentiated into T cells, for the manufacture of a composition for immune cell therapy.

41. Use of T cells in which the modified TCR according to any one of claims 1 to 23 has been expressed in T cells in which the endogenous TCRα gene and the endogenous TCRβ gene have been knocked down or knocked out, respectively, for the production of a composition for immune cell therapy.

42. Use of a T cell, which is obtained by expressing the modified TCR according to any one of claims 1 to 23 in a hematopoietic stem / progenitor cell and differentiating it into a T cell, for the production of a composition for immune cell therapy.

43. A nucleic acid encoding a modified TCR according to any one of claims 1 to 23.

44. A vector comprising the nucleic acid of claim 43.

45. A method for producing a pharmaceutical composition using the nucleic acid of claim 43 or the vector of claim 44.

46. 45. A pharmaceutical composition comprising the nucleic acid of claim 43 or the vector of claim 44.

Images