Modulators of HSD17B13 Expression

Abstract

To provide methods, compounds, and the like that can be useful for treating, preventing, or ameliorating liver diseases such as nonalcoholic steatohepatitis (NASH), or for slowing the progression of liver diseases.SOLUTION: Disclosed are methods, compounds, and compositions useful for inhibiting HSD17B13 expression. Such compounds, compositions, and methods are useful for treating, preventing, or ameliorating diseases associated with HSD17B13.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application is filed with a sequence listing in electronic format. The sequence listing is provided in a file named BIOL0350WOSEQ_ST25.txt, created on December 13, 2019, and having a size of 640kb. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] The present embodiments provide methods, compounds, and compositions useful for inhibiting hydroxysteroid 17-beta dehydrogenase 13 (LOC345275; 17-beta hydroxysteroid dehydrogenase; HSD17B13; HSD17β13) expression, and in certain instances, for lowering the amount of HSD17B13 protein in a cell or animal, which may be useful for treating, preventing, or ameliorating diseases associated with HSD17B13. [Background technology]

[0003] Nonalcoholic fatty liver disease (NAFLD) encompasses a variety of liver diseases ranging from steatosis to nonalcoholic steatohepatitis (NASH) and cirrhosis. NAFLD is defined as the accumulation of fat in the liver of more than 5% by weight in the absence of significant alcohol consumption, steatogenic medication, or genetic disorders (Non-Patent Document 1).

[0004] Nonalcoholic steatohepatitis (NASH) is a type of NAFLD that shows signs of inflammation and liver damage. NASH is histologically defined by macrogranular steatosis, ballooning of hepatocytes, and lobular inflammatory infiltrates (Non-Patent Document 2). NASH is estimated to affect 2-3% of the general population. In the presence of other pathologies such as obesity or diabetes, the estimated prevalence increases to 7% and 62%, respectively (Non-Patent Document 3). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kotronen et al,Arterioscler Thromb.Vasc.Biol.2008,28:27-38 [Non-Patent Document 2] Sanyal,Hepatol.Res.2011.41:670-4) [Non-Patent Document 3] Hashimoto et al,J.Gastroenterol.2011.46(1):63-69 Summary of the Invention [Means for solving the problem]

[0006] Certain embodiments provided herein are compounds and methods for reducing the amount or activity of HSD17B13 mRNA, and in certain embodiments, for reducing the amount or activity of HSD17B13 protein in a cell or animal. In certain embodiments, the animal is suffering from a liver disease. In certain embodiments, the disease is NASH. In certain embodiments, the disease is alcoholic steatohepatitis (ASH). In certain embodiments, the disease is NAFLD. In certain embodiments, the disease is hepatic steatosis. In certain embodiments, the disease is cirrhosis. In certain embodiments, the disease is hepatocellular carcinoma. In certain embodiments, the disease is alcoholic liver disease. In certain embodiments, the disease is HCV hepatitis. In certain embodiments, the disease is chronic hepatitis. In certain embodiments, the disease is hereditary hemochromatosis. In certain embodiments, the disease is primary sclerosing cholangitis. Certain compounds provided herein relate to compounds and compositions that attenuate liver damage, fatty liver, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in animals.

[0007] Certain embodiments provided herein relate to potent and tolerable compounds and compositions useful for inhibiting HSD17B13 expression, which may be useful for treating, preventing, or ameliorating liver disease, or slowing the progression of liver disease. Certain embodiments provided herein relate to compounds and compositions that are more potent or have greater therapeutic value than published compounds. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments as claimed. As used herein, the use of the singular includes the plural unless otherwise stated. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is not limiting.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, papers, and reference sequence records in GenBank and NCBI, are expressly incorporated herein by reference in their entirety and in part as discussed herein.

[0010] It is understood that the sequence described in each SEQ ID NO in the examples listed herein is independent of any modification to the sugar moiety, internucleoside linkage, or nucleobase. Thus, the compound defined by the SEQ ID NO can independently include one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase. The compound described by the ION number represents a combination of nucleobase sequence, chemical modification, and motif.

[0011] definition Unless otherwise indicated, the following terms have the following meanings.

[0012] A 2'-deoxyfuranosyl sugar moiety or 2'-deoxyfuranosyl sugar means a furanosyl sugar moiety having two hydrogens at the 2'-position. The 2'-deoxyfuranosyl sugar moiety may be unmodified or modified, and may be substituted or unsubstituted at a position other than the 2'-position. A β-D-2'-deoxyribosyl sugar moiety in the context of an oligonucleotide is an unsubstituted unmodified 2'-deoxyfuranosyl found in naturally occurring deoxyribonucleic acid (DNA).

[0013] "2'-deoxynucleoside" means a nucleoside containing a 2'-H(H) furanosyl sugar moiety found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxynucleosides may contain modified nucleobases or may contain RNA nucleobases (uracil).

[0014] "2'-O-Methoxyethyl" (also referred to as 2'-MOE) refers to 2'-O(CH2)2-OCH3) in place of the 2'-OH group of the ribosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0015] "2'-MOE nucleoside" (also referred to as 2'-O-methoxyethyl nucleoside) means a nucleoside that includes a 2'-MOE modified sugar moiety.

[0016] "2'-substituted nucleoside" or "2-modified nucleoside" means a nucleoside that includes a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to a sugar moiety means a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0017] "3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3'-most nucleotide of a particular compound.

[0018] "5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5'-most nucleotide of a particular compound.

[0019] "5-methylcytosine" means a cytosine with a methyl group attached to the 5 position.

[0020] "About" means within ±10% of a value. For example, a statement that "a compound affected at least about 70% inhibition of HSD17B13" implies that HSD17B13 levels are inhibited within the range of 60%-80%.

[0021] "Administration" or "administering" refers to a route by which a compound or composition provided herein can be introduced into an individual to perform its intended function. One example of an administration route that can be used includes, but is not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0022] "Administered simultaneously" or "co-administration" means administration of two or more compounds in any manner in which the pharmacological effects of both are manifested in a patient. Co-administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not be manifested at the same time. The effects need only overlap for some time, not necessarily be coextensive. Co-administration or co-administration includes concurrent or sequential administration.

[0023] "Amelioration" refers to an improvement or alleviation of at least one indicator, sign, or symptom of the associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of an indicator may be determined by objective or subjective measures known to those of skill in the art.

[0024] "Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0025] "Antisense activity" refers to any detectable and / or measurable activity resulting from hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid, or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level for the target in the absence of the antisense compound.

[0026] "Antisense compound" refers to a compound that includes an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0027] "Antisense inhibition" means a reduction in the level of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid compared to the level of the target nucleic acid in the absence of the antisense compound.

[0028] An "antisense mechanism" is any mechanism involving hybridization of a compound with a target nucleic acid, where the outcome or effect of hybridization is either target degradation or target occupancy, with the concomitant stalling of, for example, the cellular machinery involved in transcription or splicing.

[0029] "Antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid, or a region or segment thereof. In certain embodiments, an antisense oligonucleotide is capable of specifically hybridizing to a target nucleic acid, or a region or segment thereof.

[0030] "Bicyclic nucleoside" or "BNA" refers to a nucleoside that includes a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0031] "Branched group" means an atomic group having at least three positions capable of forming covalent bonds to at least three groups. In certain embodiments, the branched group provides multiple reactive sites for linking a tethered ligand to an oligonucleotide via a conjugate linker and / or a cleavable moiety.

[0032] "Cell targeting moiety" means a conjugated group or a portion of a conjugated group that is capable of binding to a specific cell type.

[0033] "cEt" or "constrained ethyl" means a ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0034] "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0035] A "chemical modification" in a compound describes the substitution or change, via a chemical reaction, of any of the units in the compound relative to the original state of such unit. A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or a modified nucleobase. A "modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0036] A "chemically distinct region" refers to a region of a compound that is somewhat chemically different from another region of the same compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically different from a region having nucleotides without 2'-O-methoxyethyl modifications.

[0037] "Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions (each position having multiple subunits).

[0038] "Cleavable bond" means any chemical bond that can be split. In certain embodiments, the cleavable bond is selected from: amide, polyamide, ester, ether, one or both esters of a phosphodiester, phosphate ester, carbamate, disulfide, or peptide.

[0039] "Cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0040] "Complementary" with reference to oligonucleotides means that the nucleobase sequence of such oligonucleotide, or one or more regions thereof, matches the nucleobase sequence of another oligonucleotide or nucleic acid, or one or more regions thereof, when the two nucleobase sequences are aligned in reverse orientation. Nucleobase matches or complementary nucleobases as described herein, unless otherwise indicated, include the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C) and 5-methylcytosine (D). m Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside and may contain one or more nucleobase mismatches. In contrast, "fully complementary" or "100% complementary" with respect to an oligonucleotide means that the oligonucleotide has a nucleobase match at every nucleoside without any nucleobase mismatches.

[0041] "Conjugate group" means a group of atoms attached to an oligonucleotide. The conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0042] "Conjugate linker" means a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0043] "Conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0044] "Contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in the sequence.

[0045] "Designing" or "designed to" refers to the process of engineering a compound that will specifically hybridize with a selected nucleic acid molecule.

[0046] "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharma- ceutical necessary or desirable. For example, a diluent in a composition to be injected can be a liquid, such as a saline solution.

[0047] "Differentially modified" refers to chemical modifications or chemical substituents that differ from one another, including the absence of modification. Thus, for example, an MOE nucleoside and an unmodified DNA nucleoside are "differentially modified" even if the DNA nucleoside is unmodified. Similarly, DNA and RNA are "differentially modified" even if both are naturally occurring unmodified nucleosides. Nucleosides that are the same except for the inclusion of a different nucleobase are not differentially modified. For example, a nucleoside that includes a 2'-OMe modified sugar and an unmodified adenine nucleobase is not differentially modified compared to a nucleoside that includes a 2'-OMe modified sugar and an unmodified thymine nucleobase.

[0048] "Dose" refers to a specific amount of a compound or pharmaceutical agent provided in a single administration or within a specific period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose may require a volume that is not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reactions in individuals. In other embodiments, a compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. A dose may be given as the amount of pharmaceutical agent per hour, day, week, or month.

[0049] A "dosing regimen" is a combination of doses designed to achieve one or more desired effects.

[0050] "Double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds which are complementary to each other and form a duplex, wherein one of the two oligomeric compounds comprises an oligonucleotide.

[0051] "Effective amount" means an amount of a compound sufficient to achieve a desired physiological outcome in an individual in need of the compound. The effective amount may vary from individual to individual, depending on the health and condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, an evaluation of the individual's medical condition, and other relevant factors.

[0052] "Efficacy" means the ability to produce a desired effect.

[0053] "Expression" includes all functions by which a gene's coding information is converted into structures present and operative in a cell, including, but not limited to, the products of transcription and translation.

[0054] "Gapmer" means an oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage situated between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."

[0055] "HSD17B13" refers to any nucleic acid or protein of HSD17B13. "HSD17B13 nucleic acid" refers to any nucleic acid encoding HSD17B13. For example, in certain embodiments, HSD17B13 nucleic acid includes DNA sequences encoding HSD17B13, RNA sequences transcribed from DNA encoding HSD17B13 (including genomic DNA containing introns and exons), and mRNA sequences encoding HSD17B13. "HSD17B13 mRNA" refers to mRNA encoding HSD17B13 protein. Targets may be referred to in either uppercase or lowercase.

[0056] "HSD17B13 specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of HSD17B13 RNA and / or HSD17B13 protein at the molecular level. For example, HSD17B13 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents that can inhibit the expression of HSD17B13 RNA and / or HSD17B13 protein.

[0057] "Hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Without being limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0058] "Immediately adjacent" means that there are no intervening elements between elements of the same type that are immediately adjacent (eg, there are no intervening nucleobases between immediately adjacent nucleobases).

[0059] "Individual" means a human or non-human animal selected for treatment or therapy.

[0060] "Inhibiting expression or activity" refers to the reduction or disruption of expression or activity relative to expression of the activity in an untreated or control sample, and does not necessarily indicate the total elimination of expression or activity.

[0061] "Internucleoside linkage" means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. "Modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.

[0062] An "extension oligonucleotide" is an oligonucleotide disclosed herein, eg, one which has one or more additional nucleosides relative to a parent oligonucleotide.

[0063] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside bond.

[0064] "Linker-nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of the compound. The linker-nucleoside is not considered part of the oligonucleotide portion of the compound, even if it is contiguous with the oligonucleotide.

[0065] "Mismatch" or "non-complementary" refers to the nucleobase of the first oligonucleotide that is not complementary to the corresponding nucleobase of the second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, the nucleobases (including but not limited to universal nucleobases), inosine and hypoxanthine can hybridize with at least one nucleobase, but are still mismatched or non-complementary to the hybridized nucleobase. As another example, the nucleobase of the first oligonucleotide that cannot hybridize to the corresponding nucleobase of the second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatched nucleobase or a non-complementary nucleobase.

[0066] "Modulating" refers to changing or adjusting a characteristic in a cell, tissue, organ, or organism. For example, modulating HSD17B13 RNA can mean increasing or decreasing the level of HSD17B13 RNA and / or HSD17B13 protein in a cell, tissue, organ, or organism. A "modulator" brings about a change in a cell, tissue, organ, or organism. For example, an HSD17B13 compound can be a modulator that reduces the amount of HSD17B13 RNA and / or HSD17B13 protein in a cell, tissue, organ, or organism.

[0067] "MOE" means methoxyethyl.

[0068] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

[0069] "Motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0070] "Natural" or "naturally occurring" means something found in nature.

[0071] By "non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" is meant a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0072] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0073] "Nucleobase" refers to a heterocyclic moiety that can pair with a base of another nucleic acid. As used herein, "naturally occurring nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleobases" are naturally occurring nucleobases that have been chemically modified. "Universal bases" or "universal nucleobases" are nucleobases other than naturally occurring and modified nucleobases, and can pair with any nucleobase.

[0074] "Nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkages.

[0075] "Nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moieties are each independently unmodified or modified. "Modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0076] "Oligomeric compound" means a compound that includes a single oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group.

[0077] "Oligonucleotide" refers to a polymer of linked nucleosides, which may be modified or unmodified, independently of each other. Unless otherwise indicated, an oligonucleotide consists of 8 to 80 linked nucleosides. "Modified oligonucleotide" refers to an oligonucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. "Unmodified oligonucleotide" refers to an oligonucleotide that does not contain any sugar modification, nucleobase modification, or internucleoside modification.

[0078] "Parent oligonucleotide" refers to an oligonucleotide whose sequence is used as a basis for the design of more oligonucleotides of similar sequence but differing in length, motif, and / or chemical structure. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

[0079] "Parenteral administration" means administration via injection or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, or intracranial, such as intrathecal or intraventricular, administration.

[0080] "Pharmaceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to an individual. For example, a pharma- ceutically acceptable carrier can be a sterile aqueous solution such as PBS or water for injection.

[0081] "Pharmaceutically acceptable salts" refers to physiologically acceptable salts and pharma- ceutically acceptable salts of compounds such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the desired biological activity of the parent compound.

[0082] "Pharmaceutical agent" means a chemical compound that provides a therapeutic benefit when administered to an individual.

[0083] "Pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may include one or more compounds or salts thereof, and a sterile aqueous solution.

[0084] "Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.

[0085] "Phosphorus moiety" means a group of atoms that includes a phosphorus atom. In certain embodiments, the phosphorus moiety includes a mono-, di-, or triphosphate, or a phosphorothioate.

[0086] "Portion" refers to a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

[0087] "Prevent" refers to delaying or forestalling the onset, development, or progression of a disease, disorder, or symptom for a period ranging from a few minutes to an indefinite period.

[0088] "Prodrug" refers to a form of a compound that is metabolized to another form within the body or cells thereof when administered to an individual. In certain embodiments, the metabolized form is an active or more active form of the compound (e.g., a drug). Typically, the conversion of a prodrug within the body is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.

[0089] "Reduce" means to reduce to a smaller degree, size, amount, or number.

[0090] A "RefSeq number" is a unique combination of letters and numbers assigned to a sequence to indicate that the sequence is for a particular target transcript (e.g., a target gene). Such sequences and information about the target gene (collectively a gene record) can be found in gene sequence databases, including the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the Japan DNA Data Bank (the latter three forming the International Nucleotide Sequence Database Collaboration, or INSDC).

[0091] A "region" is defined as a portion of the target nucleic acid having at least one distinguishable structure, function, or characteristic.

[0092] "RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

[0093] A "segment" is defined as a smaller or subportion of a region within a nucleic acid.

[0094] "Side effects" refers to physiological disorders and / or symptoms resulting from treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and fatigue. For example, an increase in serum aminotransferase levels may indicate hepatotoxicity or hepatic function abnormalities. For example, an increase in bilirubin may indicate hepatotoxicity or hepatic function abnormalities.

[0095] "Single stranded" with reference to a compound means that the compound has only one oligonucleotide.

[0096] "Self-complementary" refers to an oligonucleotide that at least partially hybridizes to itself. A compound that consists of one oligonucleotide and where the oligonucleotide is self-complementary is a single-stranded compound. A single-stranded compound can bind to a complementary compound to form a duplex.

[0097] A "site" is defined as a unique nucleobase position within a target nucleic acid.

[0098] "Specifically hybridizable" refers to an oligonucleotide that has a degree of complementarity between the oligonucleotide and the target nucleic acid sufficient to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

[0099] "Specifically inhibit," with respect to a target nucleic acid, refers to reducing or inhibiting expression of the target nucleic acid while having a lesser effect, a minimal effect, or no effect on a non-target nucleic acid. Reduction does not necessarily indicate total elimination of expression of the target nucleic acid.

[0100] By "standard cellular assay" is meant the assay described in the Examples and relevant modifications thereof.

[0101] "Standard in vivo experiments" refers to procedures described in the Examples and reasonable modifications thereof.

[0102] "Stereoirregular chiral center" in the context of a population of molecules of the same molecular formula means a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereoirregular chiral center, the number of molecules that have the stereoirregular chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereoirregular chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered to be random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereoirregular chiral center is a stereoirregular phosphorothioate internucleoside linkage.

[0103] "Sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, an unmodified sugar moiety refers to a β-D-ribosyl moiety found in naturally occurring RNA or a β-D-2'-deoxyribosyl sugar moiety found in naturally occurring DNA. As used herein, a "modified sugar moiety" or "modified sugar" refers to a sugar surrogate or furanosyl sugar moiety other than β-D-ribosyl and β-D-2'-deoxyribosyl. A modified furanosyl sugar moiety may be modified or substituted at specific positions on the sugar moiety, substituted or unsubstituted, and may or may not have a stereoconfiguration other than β-D-ribosyl. Modified furanosyl sugar moieties include bicyclic and non-bicyclic sugars.

[0104] "Sugar surrogate" means a modified sugar moiety that does not contain a furanosyl or tetrahydrofuranyl ring (not a "furanosyl sugar moiety") and that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group, within an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or nucleic acids.

[0105] "Synergism" or "synergize" refers to the effect of a combination that is greater than the additive effect of each component alone at the same dose.

[0106] "Target gene" refers to a gene that encodes a target.

[0107] "Targeting" refers to the specific hybridization of a compound to a target nucleic acid so as to induce a desired effect.

[0108] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid that can be targeted by the compounds described herein.

[0109] "Target region" means a portion of a target nucleic acid to which one or more compounds are targeted.

[0110] "Target segment" means a sequence of nucleotides of a target nucleic acid to which a compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0111] "Terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0112] "Therapeutically effective amount" means an amount of a compound, pharmaceutical agent, or composition that confers a therapeutic benefit to an individual.

[0113] "Treating" refers to administering a compound or pharmaceutical composition to an animal to effect an alteration or amelioration of a disease, disorder, or condition in the animal.

[0114] Specific Embodiments Certain embodiments provide methods, compounds, and compositions for inhibiting HSD17B13 expression.

[0115] Certain embodiments provide compounds that target HSD17B13 nucleic acids. In certain embodiments, the HSD17B13 nucleic acid has the sequence shown in RefSeq or GENBANK Accession No. NM_178135.4 (incorporated by reference and disclosed herein as SEQ ID NO: 1), the complement of GENBANK Accession No. NC_000004.12 (incorporated by reference and disclosed herein as SEQ ID NO: 2) truncated from nucleotides 87301001-87326000, the sequence set forth as SEQ ID NO: 3, or GENBANK Accession No. NM_001136230.2 (incorporated by reference and disclosed herein as SEQ ID NO: 4). In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0116] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases of any of 8 to 2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 10 to 30 linked nucleosides.

[0117] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of 8 to 2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 10 to 30 linked nucleosides.

[0118] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 10-80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of 8-2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 10-30 linked nucleosides.

[0119] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of 8 to 2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 11 to 30 linked nucleosides.

[0120] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 consecutive nucleobases of any of 8 to 2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 12 to 30 linked nucleosides.

[0121] Certain embodiments provide compounds comprising modified oligonucleotides consisting of 16-80 linked nucleosides and having a nucleobase sequence comprising any one of 8-2896 nucleobase sequences. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds are single-stranded. In certain embodiments, the compounds are double-stranded. In certain embodiments, the modified oligonucleotides consist of 16-30 linked nucleosides.

[0122] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of 8 to 2896 nucleobase sequences. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0123] Certain embodiments include modified oligonucleotides consisting of 12 to 30 linked nucleosides and selected from the group consisting of nucleobases 3095 to 3369, 3371 to 7564, 7565 to 7672, 7673 to 8777, 8778 to 8909, 8910 to 10401, 10402 to 10508, 10509 to 12040, 12041 to 12178, 12179 to 15641, Compounds are provided having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portions complementary to equal length portions within 15642-15758, 15759-20692, or 20693-22212, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides.

[0124] In certain embodiments, the compound is a compound selected from the group consisting of nucleobases 1 to 46, 58 to 142, 1 to 142, 74 to 89, 154 to 197, 154 to 234, 200 to 232, 218 to 234, 240 to 345, 254 to 269, 354 to 746, 354 to 830, 5 19~534, 565~580, 603~628, 693~716, 734~750, 734~830, 749~828, 835~862, 835~957, 966~1044, 1017~1043, 1054~1106, 1055~1070, 1075~1169, 1074~1132, 1136~1169, 1175~1218, 1180~121 7, 1250-1292, 1251-1279, 1296-1146, 1296-1448, 1308-1448, 1461-1481, 1461-1519, 1461-1647, 1461-1646, 1483-1535, 1538-1646, 1544-1561, 1597-1645, 1654-1685, 1654-1817, 1702-1 and modified oligonucleotides having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions complementary to equal length portions within 817, 1705-1741, 1748-2211, 2174-2219, 2240-2272, 2244-2272, 2349-2370, 2350-2371, or 2378-2394.

[0125] In certain embodiments, the compound is a compound selected from the group consisting of nucleobases 1 to 46, 58 to 142, 1 to 142, 74 to 89, 154 to 197, 154 to 234, 200 to 232, 218 to 234, 240 to 345, 254 to 269, 354 to 746, 354 to 830, 5 19~534, 565~580, 603~628, 693~716, 734~750, 734~830, 749~828, 835~862, 835~957, 966~1044, 1017~1043, 1054~1106, 1055~1070, 1075~1169, 1074~1132, 1136~1169, 1175~1218, 1180~121 7, 1250-1292, 1251-1279, 1296-1146, 1296-1448, 1308-1448, 1461-1481, 1461-1519, 1461-1647, 1461-1646, 1483-1535, 1538-1646, 1544-1561, 1597-1645, 1654-1685, 1654-1817, 1702-1 and modified oligonucleotides having at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions complementary to equal length portions within 817, 1705-1741, 1748-2211, 2174-2219, 2240-2272, 2244-2272, 2349-2370, 2350-2371, or 2378-2394.

[0126] In certain embodiments, the compound is selected from the group consisting of nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3568-3634, 3671-3736, 3676-3717, 3721-3799, 3732-3740, 3741-3742, 3742-3744, 3741-3746, 3741-3746, 3741-3742, 3741-374 ... 741~3771, 3750~3770, 3782~3799, 3834~3849, 3834~4154, 3877~3897, 3902~3917, 3933~3967, 3933~3979, 3988~4005, 3988~4017, 4068~4091, 4103~4 118, 4123~4155, 4133~4155, 4220~4240, 4220~4264, 4249~4264, 4222~4240, 4296~4311, 4360~4378, 4389~4427, 4389~4431, 4405~4449, 4476~4496, 4 517~4588, 4517~4552, 4537~4552, 4572~4588, 4640~4678, 4640~4879, 4641~4667, 4862~4879, 4991~5006, 4991~5305, 5029~5098, 5046~5098, 5104~ 5120, 5121~5141, 5125~5141, 5156~5256, 5158~5217, 5223~5242, 5267~5319, 5268~5319, 5395~5950, 5646~5695, 5655~5858, 5712~5752, 5712~5777, 5758~5777, 5782~5797, 5782~5862, 5804~5862, 5870~5910, 5871~6005, 5870~5910, 5870~5911, 5916~6007, 5935~5950, 5974~6007, 6029~6048, 6029~ 6055, 6035~6164, 6084~6099, 6084~6104, 6134~6164, 6170~6248, 6170~6275, 6170~6277, 6191~6218, 6221~6243, 6246~6275, 6284~6350, 6284~6352,6298~6372、6357~6372、6388~6406、6422~6493、6422~6497、6426~6621、6567~6758、6567~6582、6597~6653、6626~6653、6710~6779、6784~6811、6785~6800、6795~6811、6913~6930、6914~6929、6914~6930、6915~6930、7101~7138、7101~7441、7125~7145、7426~7441、7473~7494、7473~7498、7481~7498、7526~7543、7550~7565、7550~7634、7563~7699、7643~7676、7680~7698、7680~7699、7708~7723、7751~7819、7768~7796、7828~7866、7834~7969、7938~7968、7938~7969、7973~7994、8017~8032、8039~8186、8039~8065、8040~8065、8121~8156、8125~8151、8164~8185、8164~8186、8205~8297、8205~8220、8236~8252、8236~8271、8256~8294、8279~8297、8487~8502、8487~8627、8529~8579、8587~8628、8636~8732、8643~8910、8744~8762、8786~8910、8939~9027、8939~8996、9000~9027、9057~9096、9080~9230、9110~9173、9188~9240、9256~9275、9312~9365、9372~9401、9373~9394、9410~9446、9410~9491、9476~9555、9497~9555、9588~9678、9588~9681、9712~9737、9712~9742、9751~9811、9751~10040、9887~9902、9908~10017、10025~10040、10058~10079、10112~10160、10124~10160、10138~10160、10180~10227、10180~10233、10258~10279、10292~10310、10293~10310、10335~10375、10335~10538、10380~10538、10554~10569、10584~10599、10728~10745、10831~10870、10930~10946、10931~10946、10970~10993、10971~11015、1100~11015、11030~11045、11073~11094、11074~11094、11115~11132、11117~11132、11155~11171、11210~11228、11210~11276、11235~11276、11290~11323、11308~11323、11384~11407、11385~11443、11428~11443、11468~11529、11542~11605、11621~11636、11621~11638、11621~11668、11652~11668、11742~11808、11742~11811、11853~11881、11853~11909、11892~11912、11924~11940、11925~12226、11953~12027、12038~12226、12238~12270、12337~12531、12337~12368、12410~12448、12465~12531、12598~12642、12598~12742、12647~12742、12758~12832、12761~12832、12862~12904、13548~13627、13551~13654、13638~13674、13688~13798、13704~13798、13813~13932、13949~14064、13951~13969、13975~14064、14077~14107、14089~14107、14126~14147、14165~14221、14166~14221、14243~14298、14243~14299、14315~14336、14316~14336、14362~14414、14432~14454、14461~14514、14465~14514、14541~14815、14541~14636、14724~14746、1400~14815、14905~14951、14916~14951、15019~15039、15022~15039、15170~15185、15200~15232、15211~15268、15244~15268、15279~15295、15279~15399、15312~15343、15350~15399、15405~15460、15492~15526、15570~15586、15633~15808、15641~15657、15643~15711、15716~15765、15771~15802、16116~16144、16116~16149、16189~16206、16189~16342、16218~16240、16254~16310、16327~16352、16377~16397、16377~16400、16407~16439、16407~16440、16461~16476、16533~16548、16755~16770、16895~16920、16905~16920、16956~16984、16956~17092、17014~17034、17135~17159、17041~17062、17077~17092、17135~17159、17227~17254、17672~17795、17675~17872、17802~17817、17857~17872、17909~17945、17909~17971、17953~17971、17954~17971、17984~18061、17985~18048、18075~18117、18087~18115、18138~18160、18176~18193、18505~18555、18506~18536、18585~18600、18658~18712、18662~18762、18720~18763、18798~18864、18871~18888、18901~18940、18925~18940、18958~18983、18958~19013、19388~19460、19467~19513、19474~19505、19531~19626、19533~19626、19649~19717、19649~19726、19731~19801、19731~19842、19815~19875、19860~19951、19887~19951、19970~19985、19970~20054、19999~20024、20037~20061、20087~20102、20109~20153、20087~20207、20172~20212、20356~20438, 20248~20437, 20248~20264, 20470~20508, 20481~20507, 20571~20623, 20571~20644, 20685~20700, 20706~21032, 20706~20772, 20781~2085 9, 20869-20984, 20990-21033, 21065-21102, 21065-21263, 21092-21632, 21276-21500, 21517-21632, 21989-22034, 22059-22087, or 22164-22209.

[0127] In certain embodiments, the compound is selected from the group consisting of nucleobases 3095-3454, 3095-3140, 3152-3236, 3168-3183, 3248-3328, 3312-3328, 3334-3390, 3348-3390, 3401-3420, 3429-3451, 3429-3454, 3474-3719, 3474-3644, 3478-3494, 3505-3531, 3544-3559, 3568-3634, 3671-3736, 3676-3717, 3721-3799, 3732-3740, 3741-3742, 3742-3744, 3741-3746, 3741-3746, 3741-3742, 3741-374 ... 741~3771, 3750~3770, 3782~3799, 3834~3849, 3834~4154, 3877~3897, 3902~3917, 3933~3967, 3933~3979, 3988~4005, 3988~4017, 4068~4091, 4103~4 118, 4123~4155, 4133~4155, 4220~4240, 4220~4264, 4249~4264, 4222~4240, 4296~4311, 4360~4378, 4389~4427, 4389~4431, 4405~4449, 4476~4496, 4 517~4588, 4517~4552, 4537~4552, 4572~4588, 4640~4678, 4640~4879, 4641~4667, 4862~4879, 4991~5006, 4991~5305, 5029~5098, 5046~5098, 5104~ 5120, 5121~5141, 5125~5141, 5156~5256, 5158~5217, 5223~5242, 5267~5319, 5268~5319, 5395~5950, 5646~5695, 5655~5858, 5712~5752, 5712~5777, 5758~5777, 5782~5797, 5782~5862, 5804~5862, 5870~5910, 5871~6005, 5870~5910, 5870~5911, 5916~6007, 5935~5950, 5974~6007, 6029~6048, 6029~ 6055, 6035~6164, 6084~6099, 6084~6104, 6134~6164, 6170~6248, 6170~6275, 6170~6277, 6191~6218, 6221~6243, 6246~6275, 6284~6350, 6284~6352,6298~6372、6357~6372、6388~6406、6422~6493、6422~6497、6426~6621、6567~6758、6567~6582、6597~6653、6626~6653、6710~6779、6784~6811、6785~6800、6795~6811、6913~6930、6914~6929、6914~6930、6915~6930、7101~7138、7101~7441、7125~7145、7426~7441、7473~7494、7473~7498、7481~7498、7526~7543、7550~7565、7550~7634、7563~7699、7643~7676、7680~7698、7680~7699、7708~7723、7751~7819、7768~7796、7828~7866、7834~7969、7938~7968、7938~7969、7973~7994、8017~8032、8039~8186、8039~8065、8040~8065、8121~8156、8125~8151、8164~8185、8164~8186、8205~8297、8205~8220、8236~8252、8236~8271、8256~8294、8279~8297、8487~8502、8487~8627、8529~8579、8587~8628、8636~8732、8643~8910、8744~8762、8786~8910、8939~9027、8939~8996、9000~9027、9057~9096、9080~9230、9110~9173、9188~9240、9256~9275、9312~9365、9372~9401、9373~9394、9410~9446、9410~9491、9476~9555、9497~9555、9588~9678、9588~9681、9712~9737、9712~9742、9751~9811、9751~10040、9887~9902、9908~10017、10025~10040、10058~10079、10112~10160、10124~10160、10138~10160、10180~10227、10180~10233、10258~10279、10292~10310、10293~10310、10335~10375、10335~10538、10380~10538、10554~10569、10584~10599、10728~10745、10831~10870、10930~10946、10931~10946、10970~10993、10971~11015、1100~11015、11030~11045、11073~11094、11074~11094、11115~11132、11117~11132、11155~11171、11210~11228、11210~11276、11235~11276、11290~11323、11308~11323、11384~11407、11385~11443、11428~11443、11468~11529、11542~11605、11621~11636、11621~11638、11621~11668、11652~11668、11742~11808、11742~11811、11853~11881、11853~11909、11892~11912、11924~11940、11925~12226、11953~12027、12038~12226、12238~12270、12337~12531、12337~12368、12410~12448、12465~12531、12598~12642、12598~12742、12647~12742、12758~12832、12761~12832、12862~12904、13548~13627、13551~13654、13638~13674、13688~13798、13704~13798、13813~13932、13949~14064、13951~13969、13975~14064、14077~14107、14089~14107、14126~14147、14165~14221、14166~14221、14243~14298、14243~14299、14315~14336、14316~14336、14362~14414、14432~14454、14461~14514、14465~14514、14541~14815、14541~14636、14724~14746、1400~14815、14905~14951、14916~14951、15019~15039、15022~15039、15170~15185、15200~15232、15211~15268、15244~15268、15279~15295、15279~15399、15312~15343、15350~15399、15405~15460、15492~15526、15570~15586、15633~15808、15641~15657、15643~15711、15716~15765、15771~15802、16116~16144、16116~16149、16189~16206、16189~16342、16218~16240、16254~16310、16327~16352、16377~16397、16377~16400、16407~16439、16407~16440、16461~16476、16533~16548、16755~16770、16895~16920、16905~16920、16956~16984、16956~17092、17014~17034、17135~17159、17041~17062、17077~17092、17135~17159、17227~17254、17672~17795、17675~17872、17802~17817、17857~17872、17909~17945、17909~17971、17953~17971、17954~17971、17984~18061、17985~18048、18075~18117、18087~18115、18138~18160、18176~18193、18505~18555、18506~18536、18585~18600、18658~18712、18662~18762、18720~18763、18798~18864、18871~18888、18901~18940、18925~18940、18958~18983、18958~19013、19388~19460、19467~19513、19474~19505、19531~19626、19533~19626、19649~19717、19649~19726、19731~19801、19731~19842、19815~19875、19860~19951、19887~19951、19970~19985、19970~20054、19999~20024、20037~20061、20087~20102、20109~20153、20087~20207、20172~20212、20356~20438, 20248~20437, 20248~20264, 20470~20508, 20481~20507, 20571~20623, 20571~20644, 20685~20700, 20706~21032, 20706~20772, 20781~20859, 20869~20984, 20990~21033, The modified oligonucleotide has at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions complementary to equal length portions within 21065-21102, 21065-21263, 21092-21632, 21276-21500, 21517-21632, 21989-22034, 22059-22087, or 22164-22209. In certain embodiments, the compound is an antisense compound, an oligomeric compound, or an oligonucleotide. In certain embodiments, the modified oligonucleotide consists of 10-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides.

[0128] In certain embodiments, the compound has a nucleobase sequence complementary to nucleobases 1323-1338, 1600-1615, 1627-1642, or 1782-1797 of an HSD17B13 nucleic acid having the nucleobase sequence of SEQ ID NO:1.

[0129] In certain embodiments, the compound has a nucleobase sequence that includes a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases that are complementary within an equal length portion of nucleobases 1323-1338, 1600-1615, 1627-1642, or 1782-1797 of an HSD17B13 nucleic acid having the nucleobase sequence of SEQ ID NO:1. In certain embodiments, the compound is an antisense compound, an oligomeric compound, or an oligonucleotide. In certain embodiments, the modified oligonucleotide consists of 10-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides.

[0130] In certain embodiments, the compound has a nucleobase sequence complementary to nucleobases 3439-3454, 3552-3567, 3754-3769, 3963-3978, 4406-4421, 4123-4138, 4139-4154, 4991-5006, 5045-5060, 5662-5677, 6476-6491, 6478-6493, 17992-18007, 21138-21153, 21415-21430, 21442-21457, or 21597-21612 of an HSD17B13 nucleic acid having the nucleobase sequence of SEQ ID NO:2.

[0131] In certain embodiments, the compound is selected from the group consisting of nucleobases 3439-3454, 3552-3567, 3754-3769, 3963-3978, 4406-4421, 4123-4138, 4139-4154, 4991-5006, 5045-5060, 5662-5677, 647-648, 651-652-653-654, 661-662-663-664-67, 671-671-672-673-674-675-676-677-678-679-681-682-683-684-685-686-687-688-689-690-700-700-701 ... The modified oligonucleotide has a nucleobase sequence that includes a portion of at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobases that are complementary to an equal length portion within the range of 6-6491, 6478-6493, 17992-18007, 21138-21153, 21415-21430, 21442-21457, or 21597-21612. In certain embodiments, the compound is an antisense compound, an oligomeric compound, or an oligonucleotide. In certain embodiments, the modified oligonucleotide consists of 10-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides.

[0132] In certain embodiments, any of the foregoing modified oligonucleotides have at least one modified internucleoside linkage, at least one modified sugar, and / or at least one modified nucleobase.

[0133] In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.

[0134] In certain embodiments, at least one internucleoside linkage of a modified oligonucleotide comprises a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

[0135] In certain embodiments, at least one nucleobase of any of the foregoing modified oligonucleotides comprises a modified nucleobase, eg, 5-methylcytosine.

[0136] In certain embodiments, any of the foregoing modified oligonucleotides comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides having A gap segment is located between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising a sequence listed in any one of SEQ ID NOs: 8-2896. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length and has a nucleobase sequence comprising a nucleobase sequence listed in any one of SEQ ID NOs: 8-2896. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length and has a nucleobase sequence comprising a nucleobase sequence listed in any one of SEQ ID NOs: 8-2896.

[0137] In certain embodiments, the compound comprises, or consists of, a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising a nucleobase sequence listed in any one of 8 to 2896, wherein the modified oligonucleotide is: a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides having A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0138] In certain embodiments, the compound comprises, or consists of, between 12 and 30 modified oligonucleotide linked nucleobases long having a nucleobase sequence comprising a sequence set forth in any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, and 1595, wherein the modified oligonucleotide is: a gap segment consisting of 10 linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides having A gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt sugar, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0139] In certain embodiments, the compound comprises or consists of a modified oligonucleotide linked nucleobases long of 12 to 30 having a nucleobase sequence comprising a sequence recited in any one of SEQ ID NOs:819, wherein the modified oligonucleotide is: a gap segment consisting of nine linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides having The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of the 5' wing segment comprises a cEt sugar; the sugar residue of a nucleoside of the 3' wing segment is 5'-cEt-cEt-cEt-MOE-3'; each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0140] In certain embodiments, the compound comprises or consists of a modified oligonucleotide linked nucleobases long of 12 to 30 having a nucleobase sequence comprising a sequence recited in any one of SEQ ID NOs: 1595, wherein the modified oligonucleotide is: a gap segment consisting of 10 linked nucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides having The gap segment is located between the 5' wing segment and the 3' wing segment, the gap segment consisting of 5'-one deoxy, one 2'-O-methyl nucleoside, and eight deoxynucleosides-3', each nucleoside of each wing segment comprises a cEt sugar; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0141] In any of the foregoing embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding HSD17B13.

[0142] In any of the foregoing embodiments, the compound may be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0143] In any of the foregoing embodiments, the compound may consist of 8-80, 10-30, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

[0144] In certain embodiments, the compound comprises a modified oligonucleotide as described herein and a conjugate group. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises at least one N-acetylgalactosamine (GalNAc), at least two N-acetylgalactosamine (GalNAc), or at least three N-acetylgalactosamine (GalNAc).

[0145] In certain embodiments, the compounds or compositions provided herein include a pharma- ceutically acceptable salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

[0146] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 286), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0147] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 286).

[0148] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 817), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0149] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 817).

[0150] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 983), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0151] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 983).

[0152] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1215), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0153] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1215).

[0154] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 747), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0155] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 747).

[0156] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 43), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0157] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 43).

[0158] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 355), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0159] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 355).

[0160] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1602), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0161] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (According to sequence number 1602).

[0162] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 201), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0163] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (Sequence number 201).

[0164] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 734), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0165] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 734).

[0166] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1249), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0167] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1249).

[0168] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 513), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0169] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO:513).

[0170] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1449), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0171] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1449).

[0172] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1448), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0173] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1448).

[0174] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1595), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0175] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (Sequence number 1595).

[0176] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 819), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0177] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 819).

[0178] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 1595), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0179] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (Sequence number 1595).

[0180] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (SEQ ID NO: 208), or a salt thereof. In certain embodiments, the compound is a sodium salt. In certain embodiments, the compound is a potassium salt.

[0181] In certain embodiments, the compounds provided herein have the following chemical structure: [ka] (Sequence number 208).

[0182] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and cationic (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each in equilibrium. Thus, an oligonucleotide in solution exists in equilibrium in an ensemble of forms at all of its multiple positions. The term "oligonucleotide" is intended to include all such forms. Drawn structures necessarily represent a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, structures showing the free acid of a compound followed by the term "or a salt thereof" explicitly include all forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain instances, one or more specific cations are identified.

[0183] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH. In certain embodiments, the compounds or compositions described herein are used in in vitro IC 50 is active by at least one of less than 2 μM, less than 1.5 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, less than 0.5 μM, less than 0.4 μM, less than 0.3 μM, less than 0.2 μM, less than 0.1 μM, less than 0.05 μM, less than 0.04 μM, less than 0.03 μM, less than 0.02 μM, or less than 0.01 μM.

[0184] In certain embodiments, the compounds or compositions described herein are well tolerated as demonstrated by at least one of an increase in alanine transaminase (ALT) or aspartate transaminase (AST) levels of 4-fold or less, 3-fold or less, or 2-fold or less compared to control animals, or an increase in liver, spleen, or kidney weight of 30% or less, 20% or less, 15% or less, 12% or less, 10% or less, 5% or less, or 2% or less compared to control animals. In certain embodiments, the compounds or compositions described herein are well tolerated as demonstrated by no increase in ALT or AST compared to control animals. In certain embodiments, the compounds or compositions described herein are well tolerated as demonstrated by no increase in liver, spleen, or kidney weight compared to control animals.

[0185] Certain embodiments provide compositions comprising any of the compounds of the above-mentioned embodiments, or any pharma- ceutically acceptable salts thereof, and at least one pharma- ceutically acceptable carrier or diluent. In certain embodiments, the compositions have a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In certain embodiments, the compositions having any of the above-mentioned viscosities comprise the compounds provided herein at a concentration of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL, or about 300 mg / mL. In certain embodiments, the composition having any of the aforementioned viscosities and / or compound concentrations is at room temperature or at a temperature of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

[0186] Numbered non-limiting embodiments include:

[0187] Embodiment 1: Certain embodiments provide compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any of the nucleobase sequences in SEQ ID NOs: 8 to 2896. Certain embodiments provide compounds comprising modified oligonucleotides consisting of 12 to 30 linked nucleosides, the modified oligonucleotides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive nucleobases of any of the nucleobase sequences in SEQ ID NOs: 8 to 2896.

[0188] Embodiment 2: Certain embodiments provide compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8 to 2896. Certain embodiments provide compounds comprising modified oligonucleotides consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8 to 2896.

[0189] Embodiment 3: Certain embodiments provide compounds comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs:8-2896.

[0190] Embodiment 4: Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, or consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is selected from the group consisting of nucleobases 3095 to 3454, 3095 to 3140, 3152 to 3236, 3168 to 3183, 3248 to 3328, 3312 to 3328, 3334 to 3390, 3348 to 3390, 3401 to 3420, 3429 to 3451, 3429 to 3454, 3474 to 3719, 3474 to 3644, 3478 to 3494, 3505 to 3531, 3544~3559, 3568~3634, 3671~3736, 3676~3717, 3721~3799, 3741~3771, 3750~3770, 3782~3799, 3834~3849, 3834~4154, 3877~3897, 3902~3917, 3933~ 3967, 3933~3979, 3988~4005, 3988~4017, 4068~4091, 4103~4118, 4123~4155, 4133~4155, 4220~4240, 4220~4264, 4249~4264, 4222~4240, 4296~4311, 4360~4378, 4389~4427, 4389~4431, 4405~4449, 4476~4496, 4517~4588, 4517~4552, 4537~4552, 4572~4588, 4640~4678, 4640~4879, 4641~4667, 4862~ 4879, 4991~5006, 4991~5305, 5029~5098, 5046~5098, 5104~5120, 5121~5141, 5125~5141, 5156~5256, 5158~5217, 5223~5242, 5267~5319, 5268~5319, 5395~5950, 5646~5695, 5655~5858, 5712~5752, 5712~5777, 5758~5777, 5782~5797, 5782~5862, 5804~5862, 5870~5910, 5871~6005, 5870~5910, 5870~ 5911, 5916~6007, 5935~5950, 5974~6007, 6029~6048, 6029~6055, 6035~6164, 6084~6099, 6084~6104, 6134~6164, 6170~6248, 6170~6275, 6170~6277,6191~6218、6221~6243、6246~6275、6284~6350、6284~6352、6298~6372、6357~6372、6388~6406、6422~6493、6422~6497、6426~6621、6567~6758、6567~6582、6597~6653、6626~6653、6710~6779、6784~6811、6785~6800、6795~6811、6913~6930、6914~6929、6914~6930、6915~6930、7101~7138、7101~7441、7125~7145、7426~7441、7473~7494、7473~7498、7481~7498、7526~7543、7550~7565、7550~7634、7563~7699、7643~7676、7680~7698、7680~7699、7708~7723、7751~7819、7768~7796、7828~7866、7834~7969、7938~7968、7938~7969、7973~7994、8017~8032、8039~8186、8039~8065、8040~8065、8121~8156、8125~8151、8164~8185、8164~8186、8205~8297、8205~8220、8236~8252、8236~8271、8256~8294、8279~8297、8487~8502、8487~8627、8529~8579、8587~8628、8636~8732、8643~8910、8744~8762、8786~8910、8939~9027、8939~8996、9000~9027、9057~9096、9080~9230、9110~9173、9188~9240、9256~9275、9312~9365、9372~9401、9373~9394、9410~9446、9410~9491、9476~9555、9497~9555、9588~9678、9588~9681、9712~9737、9712~9742、9751~9811、9751~10040、9887~9902、9908~10017、10025~10040、10058~10079、10112~10160、10124~10160、10138~10160、10180~10227、10180~10233、10258~10279、10292~10310、10293~10310、10335~10375、10335~10538、10380~10538、10554~10569、10584~10599、10728~10745、10831~10870、10930~10946、10931~10946、10970~10993、10971~11015、1100~11015、11030~11045、11073~11094、11074~11094、11115~11132、11117~11132、11155~11171、11210~11228、11210~11276、11235~11276、11290~11323、11308~11323、11384~11407、11385~11443、11428~11443、11468~11529、11542~11605、11621~11636、11621~11638、11621~11668、11652~11668、11742~11808、11742~11811、11853~11881、11853~11909、11892~11912、11924~11940、11925~12226、11953~12027、12038~12226、12238~12270、12337~12531、12337~12368、12410~12448、12465~12531、12598~12642、12598~12742、12647~12742、12758~12832、12761~12832、12862~12904、13548~13627、13551~13654、13638~13674、13688~13798、13704~13798、13813~13932、13949~14064、13951~13969、13975~14064、14077~14107、14089~14107、14126~14147、14165~14221、14166~14221、14243~14298、14243~14299、14315~14336、14316~14336、14362~14414、14432~14454、14461~14514、14465~14514、14541~14815、14541~14636、14724~14746、1400~14815、14905~14951、14916~14951、15019~15039、15022~15039、15170~15185、15200~15232、15211~15268、15244~15268、15279~15295、15279~15399、15312~15343、15350~15399、15405~15460、15492~15526、15570~15586、15633~15808、15641~15657、15643~15711、15716~15765、15771~15802、16116~16144、16116~16149、16189~16206、16189~16342、16218~16240、16254~16310、16327~16352、16377~16397、16377~16400、16407~16439、16407~16440、16461~16476、16533~16548、16755~16770、16895~16920、16905~16920、16956~16984、16956~17092、17014~17034、17135~17159、17041~17062、17077~17092、17135~17159、17227~17254、17672~17795、17675~17872、17802~17817、17857~17872、17909~17945、17909~17971、17953~17971、17954~17971、17984~18061、17985~18048、18075~18117、18087~18115、18138~18160、18176~18193、18505~18555、18506~18536、18585~18600、18658~18712、18662~18762、18720~18763、18798~18864、18871~18888、18901~18940、18925~18940、18958~18983、18958~19013、19388~19460、19467~19513、19474~19505、19531~19626、19533~19626、19649~19717、19649~19726、19731~19801、19731~19842、19815~19875、19860~19951、19887~19951、19970~19985、19970~20054、19999~20024、20037~20061、20087~20102, 20109~20153, 20087~20207, 20172~20212, 20356~20438, 20248~20437, 20248~20264, 20470~20508, 20481~20507, 20571~20623, 20571~20644, 20685~20700, 20706~21032, 20706~20772, 20781~20859, 20869~20984, 20990~21033, 2 The modified oligonucleotide has a nucleobase sequence that includes a portion of at least 8 consecutive nucleobases that is complementary to an equal length portion of 1065-21102, 21065-21263, 21092-21632, 21276-21500, 21517-21632, 21989-22034, 22059-22087, or 22164-22209, and the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2.

[0191] Embodiment 5: Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, the modified oligonucleotide being selected from the group consisting of nucleobases 3095 to 3454, 3095 to 3140, 3152 to 3236, 3168 to 3183, 3248 to 3328, 3312 to 3328, 3334 to 3390, 3348 to 3390, 3401 to 3420, 3429 to 3451, 3429 to 3454, 3474 to 3719, 3474 to 3644, 3478 to 3494, 3505 to 3531, 3544 to 3559, 3568 to 3634, 3570 to 3572, 3574 to 3576, 3578 to 3578, 3578 to 3579, 3580 to 3582, 3584 to 3586, 3588 to 3588, 3590 to 3690, 3691 to 3692, 3693 to 3694, 3695 to 3696, 3701 to 3701 ... 671~3736, 3676~3717, 3721~3799, 3741~3771, 3750~3770, 3782~3799, 3834~3849, 3834~4154, 3877~3897, 3902~3917, 3933~3967, 3933~3979, 3988~4 005, 3988~4017, 4068~4091, 4103~4118, 4123~4155, 4133~4155, 4220~4240, 4220~4264, 4249~4264, 4222~4240, 4296~4311, 4360~4378, 4389~4427, 4 389~4431, 4405~4449, 4476~4496, 4517~4588, 4517~4552, 4537~4552, 4572~4588, 4640~4678, 4640~4879, 4641~4667, 4862~4879, 4991~5006, 4991~ 5305, 5029~5098, 5046~5098, 5104~5120, 5121~5141, 5125~5141, 5156~5256, 5158~5217, 5223~5242, 5267~5319, 5268~5319, 5395~5950, 5646~5695, 5655~5858, 5712~5752, 5712~5777, 5758~5777, 5782~5797, 5782~5862, 5804~5862, 5870~5910, 5871~6005, 5870~5910, 5870~5911, 5916~6007, 5935~ 5950, 5974~6007, 6029~6048, 6029~6055, 6035~6164, 6084~6099, 6084~6104, 6134~6164, 6170~6248, 6170~6275, 6170~6277, 6191~6218, 6221~6243,6246~6275、6284~6350、6284~6352、6298~6372、6357~6372、6388~6406、6422~6493、6422~6497、6426~6621、6567~6758、6567~6582、6597~6653、6626~6653、6710~6779、6784~6811、6785~6800、6795~6811、6913~6930、6914~6929、6914~6930、6915~6930、7101~7138、7101~7441、7125~7145、7426~7441、7473~7494、7473~7498、7481~7498、7526~7543、7550~7565、7550~7634、7563~7699、7643~7676、7680~7698、7680~7699、7708~7723、7751~7819、7768~7796、7828~7866、7834~7969、7938~7968、7938~7969、7973~7994、8017~8032、8039~8186、8039~8065、8040~8065、8121~8156、8125~8151、8164~8185、8164~8186、8205~8297、8205~8220、8236~8252、8236~8271、8256~8294、8279~8297、8487~8502、8487~8627、8529~8579、8587~8628、8636~8732、8643~8910、8744~8762、8786~8910、8939~9027、8939~8996、9000~9027、9057~9096、9080~9230、9110~9173、9188~9240、9256~9275、9312~9365、9372~9401、9373~9394、9410~9446、9410~9491、9476~9555、9497~9555、9588~9678、9588~9681、9712~9737、9712~9742、9751~9811、9751~10040、9887~9902、9908~10017、10025~10040、10058~10079、10112~10160、10124~10160、10138~10160、10180~10227、10180~10233、10258~10279、10292~10310、10293~10310、10335~10375、10335~10538、10380~10538、10554~10569、10584~10599、10728~10745、10831~10870、10930~10946、10931~10946、10970~10993、10971~11015、1100~11015、11030~11045、11073~11094、11074~11094、11115~11132、11117~11132、11155~11171、11210~11228、11210~11276、11235~11276、11290~11323、11308~11323、11384~11407、11385~11443、11428~11443、11468~11529、11542~11605、11621~11636、11621~11638、11621~11668、11652~11668、11742~11808、11742~11811、11853~11881、11853~11909、11892~11912、11924~11940、11925~12226、11953~12027、12038~12226、12238~12270、12337~12531、12337~12368、12410~12448、12465~12531、12598~12642、12598~12742、12647~12742、12758~12832、12761~12832、12862~12904、13548~13627、13551~13654、13638~13674、13688~13798、13704~13798、13813~13932、13949~14064、13951~13969、13975~14064、14077~14107、14089~14107、14126~14147、14165~14221、14166~14221、14243~14298、14243~14299、14315~14336、14316~14336、14362~14414、14432~14454、14461~14514、14465~14514、14541~14815、14541~14636、14724~14746、1400~14815、14905~14951、14916~14951、15019~15039、15022~15039、15170~15185、15200~15232、15211~15268、15244~15268、15279~15295、15279~15399、15312~15343、15350~15399、15405~15460、15492~15526、15570~15586、15633~15808、15641~15657、15643~15711、15716~15765、15771~15802、16116~16144、16116~16149、16189~16206、16189~16342、16218~16240、16254~16310、16327~16352、16377~16397、16377~16400、16407~16439、16407~16440、16461~16476、16533~16548、16755~16770、16895~16920、16905~16920、16956~16984、16956~17092、17014~17034、17135~17159、17041~17062、17077~17092、17135~17159、17227~17254、17672~17795、17675~17872、17802~17817、17857~17872、17909~17945、17909~17971、17953~17971、17954~17971、17984~18061、17985~18048、18075~18117、18087~18115、18138~18160、18176~18193、18505~18555、18506~18536、18585~18600、18658~18712、18662~18762、18720~18763、18798~18864、18871~18888、18901~18940、18925~18940、18958~18983、18958~19013、19388~19460、19467~19513、19474~19505、19531~19626、19533~19626、19649~19717、19649~19726、19731~19801、19731~19842、19815~19875、19860~19951、19887~19951、19970~19985、19970~20054、19999~20024、20037~20061、20087~20102、20109~20153, 20087~20207, 20172~20212, 20356~20438, 20248~20437, 20248~20264, 20470~20508, 20481~20507, 20571~20623, 20571~20644, 20685~20700, 20706~21032, 20706~20772, 20781~20859, 20869~20984, 2099 The modified oligonucleotide has a nucleic acid base sequence complementary to a nucleic acid base sequence within the range of 0 to 21033, 21065 to 21102, 21065 to 21263, 21092 to 21632, 21276 to 21500, 21517 to 21632, 21989 to 22034, 22059 to 22087, or 22164 to 22209, and the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2.

[0192] Embodiment 6: Certain embodiments provide compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides, the modified oligonucleotides being selected from nucleobases 1 to 46, 58 to 142, 1 to 142, 74 to 89, 154 to 197, 154 to 234, 200 to 232, 218 to 234, 240 to 345, 254 to 269, 354 to 746, 354 to 830, 519 to 520, 530 to 540, 550 to 560, 570 to 580, 590 to 600, 600 to 700, 700 to 800, 800 to 900, 900 to 1000, 1000 to 1100, 1100 to 1200, 1200 to 1300, 1300 to 1400, 1400 to 1500, 1500 to 1600, 1600 to 1700, 1700 to 1800, 1800 to 1900, 1900 to 2000, 2000 to 2100, 2100 to 2200, 2200 to 2300, 2300 to 2400, 2400 to 2500, 2500 to 2600, 2600 to 2700, 2700 to 2800, 2800 to 2900, 3000 to 3100, 3100 to 3200, 3200 to 3300, 3 534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828, 835-862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1074-1132, 1136-1169, 1175-1218, 1180-1217, 1250-1292, 125 1~1279, 1296~1146, 1296~1448, 1308~1448, 1461~1481, 1461~1519, 1461~1647, 1461~1646, 1483~1535, 1538~1646, 1544~1561, 1597~1645, 1654~1685, 1654~1817, 1702~1817, 1705~1741, 1748~2211, 217 and the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39,

[0193] Embodiment 7: Certain embodiments provide compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides, the modified oligonucleotides being selected from nucleobases 1 to 46, 58 to 142, 1 to 142, 74 to 89, 154 to 197, 154 to 234, 200 to 232, 218 to 234, 240 to 345, 254 to 269, 354 to 746, 354 to 89, 400 to 420, 400 to 440, 450 to 460, 450 to 480, 450 to 500, 500 to 520, 500 to 540, 500 to 560, 500 to 580, 500 to 590, 600 to 610, 600 to 710, 600 to 720, 700 to 820, 700 to 830, 700 to 840, 700 to 850, 850 to 900, 900 to 910, 900 to 920, 900 to 930, 900 to 940, 900 to 950, 900 to 960, 900 to 970, 900 to 980, 900 to 990, 900 to 1000, 1000 to 1020, 1000 to 1040, 1000 to 1050, 1000 to 1060, 1000 to 1070, 1000 to 1080, 1000 830, 519-534, 565-580, 603-628, 693-716, 734-750, 734-830, 749-828, 835-862, 835-957, 966-1044, 1017-1043, 1054-1106, 1055-1070, 1075-1169, 1074-1132, 1136-1169, 1175-1218, 1180-12 17, 1250-1292, 1251-1279, 1296-1146, 1296-1448, 1308-1448, 1461-1481, 1461-1519, 1461-1647, 1461-1646, 1483-1535, 1538-1646, 1544-1561, 1597-1645, 1654-1685, 1654-1817, 1702-1817 , 1705-1741, 1748-2211, 2174-2219, 2240-2272, 2244-2272, 2349-2370, 2350-2371, or 2378-2394, and the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:1.

[0194] Embodiment 8: Certain embodiments provide compounds comprising modified oligonucleotides consisting of 12 to 30 linked nucleosides, the modified oligonucleotides being selected from nucleobases 3439 to 3454, 3552 to 3567, 3754 to 3769, 3963 to 3978, 4406 to 4421, 4123 to 4138, 4139 to 4154, 4991 to 5006, 5045 to 5060, 5662 to 5677, 6476 to 6491, 6478 to 6493, 17992 to 18007, 21138 to 21138 ... and the nucleobase sequence of the modified oligonucleotide comprises a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases that is 100% complementary to an equal length portion of SEQ ID NO: 1153, 21415-21430, 21442-21457, or 21597-21612, and the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2.

[0195] Embodiment 9: Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595, and 819.

[0196] Embodiment 10: Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595, and 819.

[0197] Embodiment 11: Certain embodiments provide compounds of embodiments 1-6, The oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2 over the entire length of the oligonucleotide.

[0198] Embodiment 12: Certain embodiments provide a compound of any one of the previous embodiments, wherein the modified oligonucleotide comprises at least one modification selected from at least one modified internucleoside linkage, at least one modified nucleoside comprising a modified sugar moiety, and at least one modified nucleoside comprising a modified nucleobase.

[0199] Embodiment 13: Certain embodiments provide a compound of embodiment 12, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0200] Embodiment 14: Certain embodiments provide a compound of embodiment 12 or 13, wherein at least one nucleoside of the modified oligonucleotide is a 2'-substituted nucleoside or a bicyclic nucleoside.

[0201] Embodiment 15: Certain embodiments provide a compound of embodiment 14, wherein the bicyclic sugar moiety of the bicyclic nucleoside is selected from the group consisting of: 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); and 4'-CH(CH3)-O-2' (cEt).

[0202] Embodiment 16: Certain embodiments provide a compound of any one of embodiments 12-15, wherein the modified nucleoside is a 2'-O-methoxyethyl nucleoside.

[0203] Embodiment 17: Certain embodiments provide the compound of any one of embodiments 12-16, wherein the modified nucleobase is 5-methylcytosine.

[0204] Embodiment 18: Certain embodiments provide a compound of any one of embodiments 1 to 17, wherein the modified oligonucleotide comprises: a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides having the gap segment is immediately adjacent to and positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0205] Embodiment 19: Certain embodiments provide a compound of any one of claims 1-18, wherein the modified sugar moiety of each nucleoside of each wing segment is selected from 2'-O-Me, 2'-MOE, and cEt sugar moieties.

[0206] Embodiment 20: Certain embodiments provide a compound of any one of claims 1 to 19, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides Including, A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a cEt nucleoside; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0207] Embodiment 21: Certain embodiments provide a compound of any one of claims 1 to 20, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides Including, A gap segment is positioned between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a cEt nucleoside, at least one internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0208] Embodiment 22: Certain embodiments provide a compound of any of the previous embodiments, wherein the modified oligonucleotide comprises: a gap segment consisting of nine linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of the 5' wing segment comprises a cEt nucleoside; the sugar moiety of a nucleoside of the 3' wing segment is 5'-cEt-cEt-cEt-MOE-3'; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0209] Embodiment 23: Certain embodiments provide a compound of any of the previous embodiments, wherein the modified oligonucleotide comprises: a gap segment consisting of nine linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside of the 5' wing segment comprises a cEt nucleoside; each sugar moiety of a nucleoside of the 3' wing segment is selected from a cEt and a 2'-MOE sugar moiety; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0210] Embodiment 24: Certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked nucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, the gap segment consisting of one deoxy, one 2'-O-methyl nucleoside, and eight deoxynucleosides 5' to 3', each nucleoside of each wing segment comprises a cEt nucleoside; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0211] Embodiment 25:Embodiment 24:Certain embodiments provide a compound of any one of the preceding embodiments, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked nucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, and the nucleosides of the gap segment are selected from deoxynucleosides, cEt nucleosides, and 2'-MOE nucleosides, each nucleoside of each wing segment comprises a cEt nucleoside; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0212] Embodiment 26: Certain embodiments provide the compound of any one of embodiments 1 to 25, wherein the compound is single-stranded.

[0213] Embodiment 27: Certain embodiments provide the compound of any one of embodiments 1 to 25, wherein the modified oligonucleotide hybridizes to a second oligonucleotide to form a double-stranded antisense compound.

[0214] Embodiment 28: Certain embodiments provide a compound of any one of embodiments 1 to 27, wherein at least one of the nucleotides of the modified oligonucleotide is a ribonucleotide.

[0215] Embodiment 29: Certain embodiments provide a compound of any one of embodiments 1 to 27, wherein at least one of the nucleotides of the modified oligonucleotide is a deoxyribonucleotide.

[0216] Embodiment 30: Certain embodiments provide a compound of any one of embodiments 1 to 23, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

[0217] Embodiment 31: Certain embodiments provide the compound of any one of embodiments 1 to 30, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

[0218] Embodiment 32: Certain embodiments provide the compound of any one of embodiments 1 to 30, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

[0219] Embodiment 33: Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence selected from any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595, and 819, wherein the modified oligonucleotide is: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides Including, A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0220] Embodiment 34: Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, the modified oligonucleotide having a nucleobase sequence selected from any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, and 1595, the modified oligonucleotide comprising: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of three linked nucleosides Including, The gap segment is positioned between the 5' wing segment and the 3' wing segment, the 5' wing segment and the 3' wing segment comprise cEt sugars, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0221] Embodiment 35: Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of SEQ ID NO:819, wherein the modified oligonucleotide is: a gap segment consisting of nine linked 2'-deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of the 5' wing segment comprises a cEt sugar; the sugar residue of a nucleoside of the 3' wing segment is 5'-cEt-cEt-cEt-MOE-3'; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0222] Embodiment 36: Certain embodiments provide a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of SEQ ID NO: 1595, wherein the modified oligonucleotide is: a gap segment consisting of 10 linked nucleosides; a 5' wing segment consisting of three linked nucleosides; and A 3' wing segment consisting of four linked nucleosides Including, The gap segment is located between the 5' wing segment and the 3' wing segment, the gap segment consisting of one deoxy, one 2'-O-methyl nucleoside, and eight deoxynucleosides 5' to 3', each nucleoside of each wing segment contains a cEt sugar; each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.

[0223] Embodiment 37: Certain embodiments provide a compound of any of the previous embodiments, comprising a conjugate group.

[0224] Embodiment 38: Certain embodiments provide the compound of embodiment 37, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0225] Embodiment 39: Certain embodiments provide a compound of embodiment 37 or embodiment 38, wherein the conjugate group comprises a conjugate linker consisting of a single bond.

[0226] Embodiment 40: Certain embodiments provide the compound of any one of embodiments 37-39, wherein the conjugate group comprises a cleavable linker.

[0227] Embodiment 41: Certain embodiments provide the compound of any one of embodiments 37-40, wherein the conjugate group comprises a conjugate linker comprising 1 to 3 linker-nucleosides.

[0228] Embodiment 42: Certain embodiments provide the compound of any one of embodiments 37-41, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

[0229] Embodiment 42: Certain embodiments provide the compound of any one of embodiments 37 to 41, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

[0230] Embodiment 43: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0231] Embodiment 44: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0232] Embodiment 45: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0233] Embodiment 46: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0234] Embodiment 47: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0235] Embodiment 48: Certain embodiments provide a compound having the following chemical structure or a salt thereof: [ka]

[0236] Embodiment 49: Certain embodiments provide a compound having the following chemical structure: [ka]

[0237] Embodiment 50: Certain embodiments provide a compound having the following chemical structure: [ka]

[0238] Embodiment 51: Certain embodiments provide a compound having the following chemical structure: [ka]

[0239] Embodiment 52: Certain embodiments provide a compound having the following chemical structure: [ka]

[0240] Embodiment 53: Certain embodiments provide a compound having the following chemical structure: [ka]

[0241] Embodiment 54: Certain embodiments provide a compound having the following chemical structure: [ka]

[0242] Embodiment 55: Certain embodiments provide a compound having the following chemical structure: [ka]

[0243] Embodiment 56: Certain embodiments provide a compound having the following chemical structure: [ka]

[0244] Embodiment 57: Certain embodiments provide a compound having the following chemical structure: [ka]

[0245] Embodiment 58: Certain embodiments provide a compound having the following chemical structure: [ka]

[0246] Embodiment 59: Certain embodiments provide a compound having the following chemical structure: [ka]

[0247] Embodiment 60: Certain embodiments provide a compound having the following chemical structure: [ka]

[0248] Embodiment 61: Certain embodiments provide a compound of any one of embodiments 43-60, wherein the compound is a sodium salt.

[0249] Embodiment 62: Certain embodiments provide a compound of any one of embodiments 43-60, wherein the compound is a potassium salt.

[0250] Embodiment 63: Certain embodiments provide a chirally enriched population of the compound of any one of embodiments 1 to 62, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0251] Embodiment 64: Certain embodiments provide the chiral enriched population of embodiment 63, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Sp) configuration.

[0252] Embodiment 65: Certain embodiments provide a chiral enriched population of embodiment 63 or embodiment 64, wherein the population is enriched for compounds having modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0253] Embodiment 66: Certain embodiments provide a chiral enriched population of claim 63, wherein the population is enriched for compounds having modified oligonucleotides with a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0254] Embodiment 67: Certain embodiments provide the chiral enriched population of embodiment 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage.

[0255] Embodiment 68: Certain embodiments provide the chiral enriched population of embodiment 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0256] Embodiment 69: Certain embodiments provide a chiral enriched population of embodiment 63 or 66, wherein the population is enriched for oligomeric compounds having modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in an Sp-Sp-Rp configuration in the 5' to 3' direction.

[0257] Embodiment 70: Certain embodiments provide a population of compounds having the modified oligonucleotides of any of embodiment 69, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereoirregular.

[0258] Embodiment 71: Certain embodiments provide a composition comprising a compound of any one of embodiments 1 to 70 and a pharma- ceutically acceptable carrier.

[0259] Embodiment 72: Certain embodiments provide a composition comprising a compound of any of the previous embodiments for use in therapy.

[0260] Embodiment 73: Certain embodiments provide a method of treating, preventing, or ameliorating a disease associated with HSD17B13 in an individual, comprising administering to the individual a compound complementary to HSD17B13, thereby treating, preventing, or ameliorating the disease.

[0261] Embodiment 74: Certain embodiments provide a method of administering a compound of embodiments 1-70 or a composition of embodiment 71 or embodiment 72 to an individual.

[0262] Embodiment 75: Certain embodiments provide the method of embodiment 73 or 74, wherein the individual suffers from liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

[0263] Embodiment 76: Certain embodiments provide the method of embodiment 73 or embodiment 74, wherein the compound is an antisense compound.

[0264] Embodiment 77: Certain embodiments provide the method of any of embodiments 73-76, wherein administering the compound ameliorates liver damage, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in the individual.

[0265] Embodiment 78: Certain embodiments provide a method of inhibiting expression of HSD17B13 in a cell, comprising inhibiting expression of HSD17B13 in the cell by contacting the cell with a compound comprising a modified oligonucleotide complementary to HSD17B13.

[0266] Embodiment 79: Certain embodiments provide the method of embodiment 78, wherein the cell is in the liver of the individual.

[0267] Embodiment 80: Certain embodiments provide the method of embodiment 79, wherein the individual has or is at risk of having liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

[0268] Embodiment 81: Certain embodiments provide a method of ameliorating, alleviating, or inhibiting liver damage, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in an individual, comprising administering to the individual a compound comprising a modified oligonucleotide complementary to HSD17B13, thereby alleviating or inhibiting liver damage, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in an individual.

[0269] Embodiment 82: Certain embodiments provide the method of embodiment 81, wherein the individual has or is at risk of having liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

[0270] Embodiment 83: Certain embodiments provide the method of any one of embodiments 78 to 82, wherein the compound is an antisense compound.

[0271] Embodiment 84: Certain embodiments provide the method of any one of embodiments 78 to 83, wherein the compound is any one of the compounds of embodiments 1 to 70, or the composition of embodiment 71 or embodiment 72.

[0272] Embodiment 85: Certain embodiments provide the method of embodiment 83 or embodiment 84, wherein the compound or composition is administered parenterally.

[0273] Embodiment 86: Certain embodiments provide for the use of a compound comprising a modified oligonucleotide complementary to HSD17B13 for treating, preventing, or ameliorating a disease associated with HSD17B13.

[0274] Embodiment 87: Certain embodiments provide the use of embodiment 86, wherein the disease is liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

[0275] Embodiment 88: Certain embodiments provide the use of embodiment 86 or 87, wherein the compound is an antisense compound.

[0276] Embodiment 89: Certain embodiments provide the use of any one of embodiments 86 to 88, wherein the compound is any one of the compounds of embodiments 1 to 70, or the composition of embodiment 71 or embodiment 72.

[0277] Embodiment 90: Certain embodiments provide for the use of a compound comprising a modified oligonucleotide complementary to HSD17B13 in the manufacture of a medicament for treating, preventing, or ameliorating a disease associated with HSD17B13.

[0278] Embodiment 91: Certain embodiments provide the use of embodiment 90, wherein the disease is liver disease, NAFLD, NASH, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.

[0279] Embodiment 92: Certain embodiments provide the use of embodiment 90 or 91, wherein the compound is an antisense compound.

[0280] Embodiment 93: Certain embodiments provide the use of any one of embodiments 90 to 92, wherein the compound is any one of the compounds of embodiments 1 to 70, or the composition of embodiment 71 or embodiment 72.

[0281] Specific Indications Certain embodiments provided herein relate to a method of inhibiting HSD17B13 expression, which may be useful for treating, preventing, or ameliorating diseases associated with HSD17B13 in an individual by administering a compound that targets HSD17B13. In certain embodiments, the compound may be an HSD17B13-specific inhibitor. In certain embodiments, the compound may be an antisense compound, an oligomeric compound, or an oligonucleotide that targets HSD17B13.

[0282] Examples of diseases associated with HSD17B13 that can be treated, prevented, and / or ameliorated by the methods provided herein include liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.Certain compounds provided herein relate to compounds and compositions that alleviate liver damage, steatosis, liver fibrosis, hepatitis, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or liver fat accumulation in animals.

[0283] In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with HSD17B13 in an individual comprises administering to the individual a compound comprising an HSD17B13 specific inhibitor to treat, prevent, or ameliorate the disease. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a disease associated with HSD17B13. In certain embodiments, the disease is a liver disease. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeted to HSD17B13. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of 16 to 80 linked nucleosides and comprising a nucleobase sequence consisting of any one of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of the nucleobase sequences of SEQ ID NOs: 8-2896. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, administering the compound ameliorates, preserves, or prevents liver damage, fatty liver, liver fibrosis, liver cirrhosis, elevated transaminases, or liver fat accumulation in the animal.

[0284] In certain embodiments, the method of treating, preventing, or ameliorating liver damage, steatosis, liver fibrosis, liver cirrhosis, elevated transaminases, or liver fat accumulation in an animal comprises administering to an individual a compound comprising an HSD17B13 specific inhibitor, thereby treating, preventing, or ameliorating liver damage, steatosis, liver fibrosis, liver cirrhosis, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeting HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B13. In certain embodiments, the compound comprises a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and comprising a nucleobase sequence consisting of any one of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of the nucleobase sequences of SEQ ID NOs: 8-2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, administering the compound ameliorates, preserves, or prevents liver damage, fatty liver, liver fibrosis, cirrhosis, elevated transaminases, or hepatic fat accumulation. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a disease associated with HSD17B13.

[0285] In certain embodiments, the method of inhibiting HSD17B13 expression in an individual suffering from or at risk of suffering from a disease associated with HSD17B13 comprises inhibiting HSD17B13 expression in the individual by administering a compound comprising an HSD17B13 specific inhibitor to the individual. In certain embodiments, administering the compound inhibits HSD17B13 expression in the liver. In certain embodiments, the disease is a liver disease. In certain embodiments, the individual suffers from or is at risk of suffering from liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the individual suffers from or is at risk of suffering from liver damage, steatosis, liver fibrosis, liver cirrhosis, elevated transaminases, or liver fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeted to HSD17B13. In certain embodiments, the compound has a nucleobase sequence consisting of 8-80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16-80 linked nucleosides and comprising a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, administering the compound ameliorates, preserves, or prevents liver damage, fatty liver, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation.

[0286] In certain embodiments, the method of inhibiting expression of HSD17B13 in a cell comprises inhibiting expression of HSD17B13 in the cell by contacting the cell with a compound comprising an HSD17B13 specific inhibitor. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of an individual suffering from or at risk of suffering from liver damage, fatty liver, liver fibrosis, cirrhosis, elevated transaminases, or hepatic fat accumulation. In certain embodiments, the compound comprises an antisense compound targeted to HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeted to HSD17B13. In certain embodiments, the compound has a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of SEQ ID NOs: 8 to 2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0287] In certain embodiments, the method of alleviating or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation in an individual suffering from or at risk of suffering from a disease associated with HSD17B13 comprises administering to the individual a compound comprising an HSD17B13 specific inhibitor, thereby alleviating or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or liver fat accumulation in the individual. In certain embodiments, the individual suffers from or at risk of suffering from liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeted to HSD17B13. In certain embodiments, the compound has a nucleobase sequence consisting of 8-80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16-80 linked nucleosides and comprising a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual. In certain embodiments, the individual is identified as suffering from or at risk of suffering from a disease associated with HSD17B13.

[0288] Certain embodiments are directed to compounds comprising HSD17B13 specific inhibitors for use in treating diseases associated with HSD17B13. In certain embodiments, the disease is liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B13. In certain embodiments, the compound has a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16-80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of SEQ ID NOs: 8-2896. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or an oligomeric compound. In certain embodiments, the compound is administered parenterally to the individual.

[0289] Certain embodiments are directed to compounds comprising HSD17B13 specific inhibitors for use in ameliorating or inhibiting liver damage, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or hepatic fat accumulation in individuals suffering from or at risk of suffering from liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compounds comprise antisense compounds targeting HSD17B13. In certain embodiments, the compounds comprise oligonucleotides targeting HSD17B13. In certain embodiments, the compounds have a nucleobase sequence consisting of 8-80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8-2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of any one of SEQ ID NOs: 8 to 2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0290] Certain embodiments are directed to the use of a compound comprising an HSD17B13 specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with HSD17B13. Certain embodiments are directed to the use of a compound comprising an HSD17B13 specific inhibitor for the preparation of a medicament for treating a disease associated with HSD17B13. In certain embodiments, the disease is a liver disease. In certain embodiments, the disease is a liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B13. In certain embodiments, the compound has a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and comprising a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0291] Particular embodiments are directed to the use of a compound comprising an HSD17B13 specific inhibitor for the manufacture or preparation of a medicament for alleviating or inhibiting liver damage, steatosis, liver fibrosis, liver cirrhosis, elevated transaminases, or liver fat accumulation in an individual suffering from or at risk of suffering from a disease associated with HSD17B13.In particular embodiments, the disease is liver disease, NAFLD, NASH, alcoholic steatohepatitis (ASH), alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis.Particular embodiments are directed to the use of a compound comprising an HSD17B13 specific inhibitor for the preparation of a medicament for the treatment of a disease associated with HSD17B13. In certain embodiments, the disease is liver disease, NAFLD, NASH, alcoholic liver disease, non-alcoholic liver disease, alcoholic cirrhosis, non-alcoholic cirrhosis, steatohepatitis, hepatic steatosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In certain embodiments, the compound comprises an antisense compound targeting HSD17B13. In certain embodiments, the compound comprises an oligonucleotide targeting HSD17B13. In certain embodiments, the compound comprises a nucleobase sequence consisting of 8 to 80 linked nucleosides and comprising at least 8 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and comprising a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In certain embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence consisting of any of the nucleobase sequences of SEQ ID NOs: 8 to 2896. In any of the foregoing embodiments, the compound may be single-stranded or double-stranded. In any of the foregoing embodiments, the compound may be an antisense compound or an oligomeric compound.

[0292] In any of the aforementioned methods or uses, the compound may target HSD17B13. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example, a modified oligonucleotide consisting of 8-80 linked nucleosides, 10-30 linked nucleosides, 12-30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences listed in SEQ ID NOs: 1-4. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-O-methoxyethyl modified sugar, and the modified nucleobase is 5-methylcytosine. In certain embodiments, a modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, where the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.

[0293] In any of the foregoing embodiments, the modified oligonucleotide consists of 12-30, 15-30, 15-25, 15-24, 16-24, 17-24, 18-24, 19-24, 20-24, 19-22, 20-22, 16-20, or 16 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences listed in SEQ ID NOs: 1-4.

[0294] In any of the foregoing methods or uses, the compound comprises, or consists of, a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 8 to 2896, wherein the modified oligonucleotide is: a gap segment consisting of linked 2'-deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and A 3' wing segment consisting of linked nucleosides having A gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

[0295] In any of the above-mentioned methods or uses, the compound may be administered parenterally.For example, in certain embodiments, the compound may be administered via injection or infusion.Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal administration or intraventricular administration.

[0296] Specific Compounds In certain embodiments, the compounds described herein may be antisense compounds. In certain embodiments, the antisense compounds comprise or consist of oligomeric compounds. In certain embodiments, the oligomeric compounds comprise modified oligonucleotides. In certain embodiments, the modified oligonucleotides have a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid.

[0297] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides, hi certain embodiments, the modified oligonucleotides have a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid.

[0298] In certain embodiments, the compound or antisense compound is single-stranded. Such single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

[0299] In certain embodiments, the compound is double-stranded. Such double-stranded compounds include a first modified oligonucleotide having a region complementary to a target nucleic acid, and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, a thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, the compound includes a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both of the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide is 16-30 linked nucleosides in length and the second modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleobases of any of SEQ ID NOs: 8-2035.

[0300] In certain embodiments, the antisense compound is double-stranded.Such double-stranded antisense compounds include a first oligomeric compound with a region complementary to the target nucleic acid, and a second oligomeric compound with a region complementary to the first oligomeric compound.The first oligomeric compound of such double-stranded antisense compounds typically comprises or consists of a modified oligonucleotide, and optionally a conjugate group.The oligonucleotide of the second oligomeric compound of such double-stranded antisense compounds may be modified or unmodified.Either or both of the oligomeric compounds of the double-stranded antisense compounds may comprise a conjugate group.The oligomeric compound of the double-stranded antisense compounds may comprise non-complementary overlapping nucleosides.

[0301] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNA-targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

[0302] In certain embodiments, the compounds described herein have a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of a target segment of a targeted nucleic acid.

[0303] In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 12-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 12-22. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 14-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 14-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 15-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 15-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 16-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 16-20. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 17-30. In certain embodiments, the compounds described herein include oligonucleotides with a linkage subunit length of 17-20. In certain embodiments, the compounds described herein include oligonucleotides with a length of 18-30 linked subunits. In certain embodiments, the compounds described herein include oligonucleotides with a length of 18-20 linked subunits. In certain embodiments, the compounds described herein include oligonucleotides with a length of 20-30 linked subunits. In other words, such oligonucleotides are 12-30 linked subunits, 14-30 linked subunits, 14-20 subunits, 15-30 subunits, 15-20 subunits, 16-30 subunits, 16-20 subunits, 17-30 subunits, 17-20 subunits, 18-30 subunits, 18-20 subunits, or 20-30 subunits long, respectively.In certain embodiments, the compounds described herein comprise oligonucleotides with a linkage subunit length of 14. In certain embodiments, the compounds described herein comprise oligonucleotides with a linkage subunit length of 16. In certain embodiments, the a compounds described herein comprise oligonucleotides with a linkage subunit length of 17. In certain embodiments, the compounds described herein comprise oligonucleotides with a linkage subunit length of 18. In certain embodiments, the compounds described herein comprise oligonucleotides with a linkage subunit length of 19. In certain embodiments, the compounds described herein comprise oligonucleotides with a linkage subunit length of 20. In other embodiments, the compounds described herein include oligonucleotides of 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30 linked subunits. In certain such embodiments, the compounds described herein include oligonucleotides of linked subunit length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, or a range defined by any two of the above values. In some embodiments, the linking subunit is a nucleotide, a nucleoside, or a nucleobase.

[0304] In certain embodiments, the compound may further comprise additional features or elements attached to the oligonucleotide, such as a conjugate group. In certain embodiments, such a compound is an antisense compound. In certain embodiments, such a compound is an oligomeric compound. In embodiments where the conjugate group comprises a nucleoside (i.e., the nucleoside that attaches the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

[0305] In certain embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation) or alternatively from the 3' end (3' truncation). A shortened or truncated compound targeting HSD17B13 nucleic acid may have two subunits deleted from the 5' end of the compound or alternatively from the 3' end. Alternatively, the deleted nucleosides may be distributed throughout the compound.

[0306] When a single additional subunit is present in the extended compound, the additional subunit may be located at the 5'-end or 3'-end of the compound. When two or more additional subunits are present, the additional subunits may be adjacent to each other, for example, two subunits may be added to the 5'-end of the compound (5'-addition) or alternatively to the 3'-end of the compound (3'-addition). Alternatively, the additional subunits may be dispersed throughout the compound.

[0307] It is possible to extend or shorten the length of a compound, such as an oligonucleotide, and / or introduce mismatch bases without losing activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992,89:7305-7309; Gautschi et al. J. Natl. Cancer Inst. March 2001,93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998,16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry, and motifs can result in large differences in one or more of many properties required for clinical development (Seth et al. J. Med. Chem. 2009,52,10; Egli et al. J. Am. Chem. Soc. 2011,133,16642).

[0308] In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also referred to as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function at least in part through the RISC pathway to degrade and / or sequester target nucleic acids (hence including microRNA / microRNA mimic compounds). The term siRNA as used herein is meant to be equivalent to other terms used to describe nucleic acid molecules that can mediate sequence-specific RNAi, such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotides, short interfering nucleic acids, short interfering modified oligonucleotides, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), etc. The term "RNAi" as used herein is also meant to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translation inhibition, or epigenetics.

[0309] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeting HSD17B13 described herein. In certain embodiments, the compounds may be double-stranded. In certain embodiments, the compounds comprise a first strand comprising at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions of any one of SEQ ID NOs: 8-2035, and a second strand. In certain embodiments, the compounds comprise a first strand comprising a nucleobase sequence of any one of SEQ ID NOs: 8-2035, and a second strand. In certain embodiments, the compounds comprise a first strand comprising a ribonucleotide having uracil (U) instead of thymine (T) in any one of SEQ ID NOs: 8-2035. In certain embodiments, the compounds comprise (i) a first strand comprising a nucleobase sequence complementary to a site on HSD17B13 targeted by any one of SEQ ID NOs: 8-2035, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position of the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the strand of the dsRNA compound. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides other than the naturally occurring phosphodiester bond. Examples of such bonds include phosphoramide bonds, phosphorothioate bonds, and phosphorodithioate bonds. The compound may be a chemically modified nucleic acid molecule as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compounds contain one or two cap chains, for example as disclosed by WO 00 / 63364, filed April 19, 2000.

[0310] In certain embodiments, the first strand of the compound is an siRNA guide strand, and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first strand or the second strand of the compound may comprise a conjugate group.

[0311] In certain embodiments, the compounds described herein may comprise any of the oligonucleotide sequences targeted to HSD17B13 described herein. In certain embodiments, the compounds are single stranded. In certain embodiments, such compounds are single stranded RNAi (ssRNAi) compounds. In certain embodiments, the compounds comprise at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions of any one of SEQ ID NOs: 8-2035. In certain embodiments, the compounds comprise a nucleobase sequence of any one of SEQ ID NOs: 8-2035. In certain embodiments, the compounds comprise a ribonucleotide in which uracil (U) is substituted for thymine (T) in any one of SEQ ID NOs: 8-2035. In certain embodiments, the compounds comprise a nucleobase sequence complementary to a site on HSD17B13 targeted by any one of SEQ ID NOs: 8-2035. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (e.g., a fluorine group; 2'-F) or an alkoxy group (e.g., a methoxy group; 2'-OMe). In certain embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases along the chain of the compound. In certain embodiments, the compound comprises one or more bonds between adjacent nucleotides other than the naturally occurring phosphodiester bond. Examples of such bonds include phosphoramide, phosphorothioate, and phosphorodithioate bonds. The compound may be a chemically modified nucleic acid molecule as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compounds contain cap chains as disclosed, for example, by WO 00 / 63364, filed April 19, 2000. In certain embodiments, the compounds consist of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.In certain embodiments, the compound may include a conjugate group.

[0312] Specific mechanisms In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. In certain embodiments, the compounds described herein can hybridize to a target nucleic acid to provide at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or hybridize to one or more non-target nucleic acids to provide significant undesired antisense activity.

[0313] In certain antisense activities, the hybridization of the compounds described herein to the target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently "DNA-like" to induce RNase H activity. Furthermore, in certain embodiments, one or more non-DNA-like nucleosides are tolerated within the gap of the gapmer.

[0314] In certain antisense activity, the compound or part of the compound described herein is loaded into RNA-induced silencing complex (RISC), which finally leads to the cleavage of target nucleic acid.For example, certain compounds described herein lead to the cleavage of target nucleic acid by Argonaute.The compound loaded into RISC is an RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0315] In certain embodiments, hybridization of the compounds described herein to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain such embodiments, hybridization of the compounds to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain such embodiments, hybridization of the compounds to the target nucleic acid results in inhibition of binding interactions between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compounds to the target nucleic acid results in alteration of translation of the target nucleic acid.

[0316] Antisense activity can be observed directly or indirectly, in certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0317] Target Nucleic Acids, Target Regions, and Nucleotide Sequences In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mRNA and pre-mRNA comprising introns, exons, and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0318] Nucleotide sequences encoding HSD17B13 include, but are not limited to, RefSeq or GENBANK Accession No. NM_178135.4 (incorporated by reference and disclosed herein as SEQ ID NO:1), the complement of GENBANK Accession No. NC_000004.12 truncated from nucleotides 87301001-87326000 (incorporated by reference and disclosed herein as SEQ ID NO:2), the sequence set forth as SEQ ID NO:3, or GENBANK Accession No. NM_001136230.2 (incorporated by reference and disclosed herein as SEQ ID NO:4).

[0319] Hybridization In some embodiments, hybridization occurs between the compounds disclosed herein and HSD17B13 nucleic acids. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[0320] Hybridization can occur under a variety of conditions, which are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0321] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein can specifically hybridize to HSD17B13 nucleic acid.

[0322] Complementarity An oligonucleotide is said to be complementary to another nucleic acid if the nucleobase sequence of the oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposite orientations. Nucleobase matches or complementary nucleobases described herein are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside and may contain one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary if the oligonucleotide has a nucleobase match at every nucleoside without any nucleobase mismatches.

[0323] In certain embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleobases between the compounds and HSD17B13 nucleic acids can be tolerated only if the compounds remain capable of specifically hybridizing to the target nucleic acid. Furthermore, the compounds can hybridize across one or more segments of HSD17B13 nucleic acids such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).

[0324] In certain embodiments, the compounds provided herein or specified portions thereof are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an HSD17B13 nucleic acid, target region, target segment, or specified portion thereof, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an HSD17B13 nucleic acid, target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein or specified portions thereof are complementary to an HSD17B13 nucleic acid, target region, target segment, or specified portion thereof, between 70% and 75%, between 75% and 80%, between 80% and 85%, between 85% and 90%, between 90% and 95%, between 95% and 100%, or any value between these ranges. The percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

[0325] For example, a compound that specifically hybridizes with 18 of the 20 nucleobases of the compound being complementary to the target region will exhibit 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases, and need not be contiguous to each other or to complementary nucleobases. Thus, a compound 18 nucleobases long with four non-complementary nucleobases flanking two regions that are completely complementary to the target nucleic acid will have an overall complementarity of 77.8% with the target nucleic acid. The percent complementarity of a compound with a region of a target nucleic acid can be routinely determined using BLAST (basic local alignment search tool) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656), which are known in the art. Percent homology, sequence identity, or complementarity can be determined, for example, using the default settings of the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0326] In certain embodiments, the compounds described herein or specific portions thereof are fully complementary (i.e., 100% complementary) to the target nucleic acid or specific portions thereof. For example, the compounds can be fully complementary to the HSD17B13 nucleic acid, or a target region, target segment, or target sequence thereof. As used herein, "fully complementary" means that each nucleobase of the compound is complementary to the corresponding nucleobase of the target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, as long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. "Fully complementary" can also be used in reference to a specific portion of a first nucleic acid and / or a second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be "fully complementary" to a target sequence that is 400 nucleobases long. A 20 nucleobase portion of a 30 nucleobase compound is fully complementary to a target sequence if the target sequence has a corresponding 20 nucleobase portion, where each nucleobase is complementary to the 20 nucleobase portion of the compound.At the same time, the entire 30 nucleobase compound may or may not be fully complementary to a target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0327] In certain embodiments, the compounds described herein contain one or more mismatched nucleobases with respect to the target nucleic acid. In certain such embodiments, the antisense activity with respect to the target is reduced by such mismatches, but the activity with respect to the non-target is reduced more. Thus, in certain such embodiments, the selectivity of the compound is improved. In certain such embodiments, the mismatches are particularly located in oligonucleotides that have a gapmer motif. In certain such embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain such embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain such embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain such embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3' end of the wing region. In certain such embodiments, the mismatches are located at positions 2, 3, or 4 from the 5' end of the wing region. In certain such embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 3 ... embodiments, the mismatches are located at positions 1, 2, 3, or 1 from the 3' end of the wing region. In certain embodiments, the mismatches are located at positions 2, 3, or 1 from the 3' end of the wing region. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatch is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0328] The location of the non-complementary nucleobase may be at the 5'-end or 3'-end of the compound. Alternatively, one or more non-complementary nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobases are located within the wing segment of a gapmer oligonucleotide.

[0329] In certain embodiments, the compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, or that are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobases to a target nucleic acid, e.g., an HSD17B13 nucleic acid, or a specified portion thereof.

[0330] In certain embodiments, the compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobases to a target nucleic acid, e.g., an HSD17B13 nucleic acid, or a specified portion thereof.

[0331] In certain embodiments, the compounds described herein also include compounds that are complementary to a portion of a target nucleic acid. As used herein, a "portion" refers to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, a compound is complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 9 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 10 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 12 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 13 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 14 nucleobase portion of a target segment. In certain embodiments, a compound is complementary to at least an 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

[0332] identity The compounds provided herein may be defined as percent identical to a compound represented by a specific nucleotide sequence, SEQ ID NO:, or ION number designated, or a portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. The compounds used herein are identical to the sequences disclosed herein if they have the same nucleic acid base pairing ability. For example, an RNA containing uracil instead of thymidine in the disclosed DNA sequence would be considered identical to the DNA sequence, since both uracil and thymidine pair with adenine. Shortened and extended versions of the compounds described herein, as well as compounds with non-identical bases to the compounds provided herein, are also contemplated. The non-identical bases may be adjacent to each other or distributed throughout the compound. The percent identity of a compound is calculated according to the number of bases that are identical in base pairing to the sequence to be compared.

[0333] In certain embodiments, the compounds described herein or portions thereof are 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs disclosed herein, or portions thereof. In certain embodiments, the compounds described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a compound or portion thereof represented by a particular nucleotide sequence, SEQ ID NO:, or specific ION number, or any percentage between such values, and the compounds include oligonucleotides having one or more mismatched nucleobases. In certain such embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In certain such embodiments, the mismatches are at positions 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0334] In certain embodiments, the compounds described herein comprise or consist of antisense compounds.In certain embodiments, a portion of antisense compounds is compared with an equal length portion of target nucleic acid.In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared with an equal length portion of target nucleic acid.

[0335] In certain embodiments, the compound described herein comprises or consists of an oligonucleotide.In certain embodiments, a portion of the oligonucleotide is compared with an equal length portion of the target nucleic acid.In certain embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases is compared with an equal length portion of the target nucleic acid.

[0336] Specific modified compounds In certain embodiments, the compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA (i.e., contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage).

[0337] A. Modified Nucleosides A modified nucleoside contains a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0338] 1. Modified sugar moiety In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic sugar moiety or a tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such a sugar surrogate may contain one or more substitutions that correspond to other types of substitutions in the modified sugar moiety.

[0339] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents (including but not limited to, substituents at the 2', 4', and / or 5' positions). In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched chains. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is selected from halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), or OCH2C(=O)-N(Rm)(Rn), where Rm and Rn are each independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl, as well as the 2'-substituents described in U.S. Pat. Nos. 6,531,584 to Cook et al.; 5,859,221 to Cook et al.; and 6,005,087 to Cook et al. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from the following: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for linear non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars include multiple non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., U.S. Patent Application Publication No. 2013 / 0203836.

[0340] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where Rm and Rn are each independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl.

[0341] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0342] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety that includes a linear 2'-substituent selected from the following: F, OCH3, and OCH2CH2OCH3.

[0343] Nucleosides that include modified sugar moieties, e.g., non-bicyclic modified sugar moieties, are referred to by the position of substitution on the sugar moiety of the nucleoside. For example, a nucleoside that includes a 2'-substituted sugar moiety or a 2-modified sugar moiety is referred to as a 2'-substituted nucleoside or a 2-modified nucleoside.

[0344] Certain modified sugar moieties include a bridging sugar substituent that forms a second ring to result in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4'-2' bridged sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH 2OCH3)-O-2' ("constrained MOE" or "cMOE") and their analogs (see, e.g., U.S. Pat. No. 7,399,845 to Seth et al., U.S. Pat. No. 7,569,686 to Bhat et al., U.S. Pat. No. 7,741,457 to Swayze et al., and U.S. Pat. No. 8,022,193 to Swayze et al.), 4'-C(CH3)(CH3)-O-2' and their analogs (see, e.g., U.S. Pat. No. 8,278,283 to Seth et al. ), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,425 to Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Pat. No. 7,696,345 to Allerson et al. and U.S. Pat. No. 8,124,745 to Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4' -CH2-C(=CH2)-2' and analogs thereof (see, e.g., U.S. Pat. No. 8,278,426 to Seth et al.), 4'C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (R, Ra, and Rb are each independently H, a protecting group, or C1-C12 alkyl (see, e.g., U.S. Pat. No. 7,427,672 to Imanishi et al.)).

[0345] In certain embodiments, such 4'-2' bridges independently comprise from 1 to 4 linking groups independently selected from the following: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-; During the ceremony: x is 0, 1, or 2; n is 1, 2, 3, or 4; Ra and Rb each independently represent H, a protecting group, hydroxyl, C1 to C12 alkyl, substituted C1 to C12 alkyl, C2 to C12 alkenyl, substituted C2 to C12 alkenyl, C2 to C12 alkynyl, substituted C2 to C12 alkynyl, C5 to C20 aryl, substituted C5 to C20 aryl, a heterocyclic group, a substituted heterocyclic group, a heteroaryl, a substituted heteroaryl, a C5 to C7 alicyclic group, a substituted C5 to C7 alicyclic group, a halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, C N, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); J1 and J2 are each independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group).

[0346] Additional bicyclic sugar moieties are known in the art, see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al. al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. No. 7,053,207 to Wengel et al., U.S. Pat. No. 6,268,490 to Imanishi et al., U.S. Pat. No. 6,770,748 to Imanishi et al., U.S. Pat. No. 6,770,748 to Imanishi et al., U.S. Pat. No. 6,268,490 ...268,490 to Imanishi et al., U.S. Pat. No. 6,770,748 to IRE44,779; U.S. Patent No. 6,794,499 to Wengel et al., U.S. Patent No. 6,670,461 to Wengel et al., U.S. Patent No. 7,034,133 to Wengel et al., U.S. Patent No. 8,080,644 to Wengel et al., U.S. Patent No. 8,034,909 to Wengel et al., U.S. Patent No. 8,153,365 to Wengel et al., U.S. Patent No. 7,572,582 to Wengel et al., and U.S. Patent No. 6,525,191 to Ramasamy et al., WO 2004 / 106356 to Torsten et al., WO 1999 / 014226 to Wengel et al., WO 2007 / 134181 to Seth et al.; No. 7,547,684 to Seth et al.; U.S. Patent No. 7,666,854 to Seth et al.; U.S. Patent No. 8,088,746 to Seth et al.; U.S. Patent No. 7,750,131 to Seth et al.; U.S. Patent No. 8,030,467 to Seth et al.; U.S. Patent No. 8,268,980 to Seth et al.; U.S. Patent No. 8,546,556 to Seth et al.; U.S. Patent No. 8,530,640 to Seth et al.; U.S. Patent No. 9,012,421 to Migawa et al.; U.S. Patent No. 8,501,805 to Seth et al.; U.S. Patent Application Publication No. 2008 / 0039618 to Allerson et al.; and U.S. Patent Application Publication No. 2015 / 0191727 to Migawa et al..

[0347] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, a general description of a bicyclic nucleoside includes both isomeric configurations. When a position of a specific bicyclic nucleoside (e.g., LNA or cEt) is specified in an exemplary embodiment herein, the position is in the β-D configuration unless otherwise specified.

[0348] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0349] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4' sulfur atom, as well as substitutions at the 2' position (see, e.g., U.S. Pat. Nos. 7,875,733 to Bhat et al. and 7,939,677 to Bhat et al.) and / or the 5' position.

[0350] In certain embodiments, the sugar surrogate comprises a ring with more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and the formula: [ka] wherein, for each modified THP nucleoside, independently: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that attaches the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that attaches the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C 1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and R1 and R2 are each independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and J1, J2, and J3 are each independently H or C1-C6 alkyl.

[0351] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0352] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used herein, the term "morpholino" refers to the following structure: [ka] "sugar substitute" means a sugar substitute having the formula:

[0353] In certain embodiments, morpholinos may be modified, for example, by adding various substituents to or varying from the preceding morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0354] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in U.S. Patent Application Publication No. 2013 / 130378 to Manoharan et al.

[0355] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0356] In certain embodiments, the modified oligonucleotide comprises a 2'-OMe modified nucleoside in the gap of a cEt gapmer. In certain embodiments, the 2'-OMe modified nucleoside is at position 2 or position 3 of the gap. In certain embodiments, the 2'-OMe modified nucleoside is at position 2 of the gap. In certain embodiments, the modified oligonucleotide has the sugar motif kkkdmddddddddkkk, where each k represents a cEt nucleoside, each d represents a 2'-β-D-deoxyribosyl nucleoside, and each m represents a nucleoside that includes a 2'-OMe sugar moiety (a "2'-OMe nucleoside").

[0357] In certain embodiments, the modified oligonucleotide has the formula ABC, where A is the 5'-region, B is the central region, and C is the 3'-region. In certain embodiments, A and C each consist of 1-5 linked nucleosides and B consists of 7-11 linked nucleosides. In certain embodiments, A and C consist of 3 linked cEt nucleosides. In certain embodiments, the second nucleoside of the central region comprises a 2'-OMe modified sugar moiety, and each remaining central region nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0358] In certain embodiments, the modified oligonucleotide comprises a neutral phosphonate linkage at one or more positions. In certain embodiments, the modified oligonucleotide comprises a methoxypropyl phosphonate linkage at one or more positions. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one methoxypropyl phosphonate linkage in the gap. In certain embodiments, the methoxypropyl phosphonate linkage is between the second and third nucleosides in the gap. In certain embodiments, the methoxypropyl phosphonate linkage is between the third and fourth nucleosides in the gap.

[0359] 2. Modified Nucleobases The modification or substitution of nucleobase (or base) is structurally distinguishable from naturally occurring nucleobase or synthetic unmodified nucleobase, but functionally interchangeable with naturally occurring nucleobase or synthetic unmodified nucleobase. Both natural and modified nucleobases can participate in hydrogen bonding. Such nucleobase modification can impart nuclease stability, binding affinity, or some other beneficial biological property to antisense compounds.

[0360] In certain embodiments, the compound described herein comprises modified oligonucleotide.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobase, which are referred to as abasic nucleoside.

[0361] In certain embodiments, the modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and others. 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808 to Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0362] Publications which teach the preparation of the above specific modified nucleobases, as well as other modified nucleobases, include, but are not limited to, U.S. Patent Application Publication No. 2003 / 0158403 to Manoharan et al., U.S. Patent Application Publication No. 2003 / 0175906 to Manoharan et al.; U.S. Patent No. 4,845,205 to Dinh et al.; U.S. Patent No. 5,130,302 to Spielvogel et al.; U.S. Patent No. 5,134,066 to Rogers et al.; U.S. Patent No. 5,172,326 to Bischofberger et al. No. 5,273 to Urdea et al.; U.S. Pat. No. 5,367,066 to Urdea et al.; U.S. Pat. No. 5,432,272 to Benner et al.; U.S. Pat. No. 5,434,257 to Matteucci et al.; U.S. Pat. No. 5,457,187 to Gmeiner et al.; U.S. Pat. No. 5,459,255 to Cook et al.; U.S. Pat. No. 5,484,908 to Froehler et al.; U.S. Pat. No. 5,502,177 to Matteucci et al.; U.S. Pat. No. 5,525,711 to Hawkins et al.; U.S. Patent No. 5,552,540 to Haralambidis et al.; U.S. Patent No. 5,587,469 to Cook et al.; U.S. Patent No. 5,594,121 to Froehler et al.; U.S. Patent No. 5,596,091 to Switzer et al.; U.S. Patent No. 5,614,617 to Cook et al.; U.S. Patent No. 5,645,985 to Froehler et al.; U.S. Patent No. 5,681,941 to Cook et al.; U.S. Patent No. 5,811,534 to Cook et al.; U.S. Patent No. 5,7 No. 5,948,903 to Cook et al.; U.S. Pat. No. 5,587,470 to Cook et al.; U.S. Pat. No. 5,457,191 to Cook et al.; U.S. Pat. No. 5,763,588 to Matteucci et al.; U.S. Pat. No. 5,830,653 to Froehler et al.; U.S. Pat. No. 5,808,027 to Cook et al.; U.S. Pat. No. 6,166,199 to Cook et al.; and U.S. Pat. No. 6,005,096 to Matteucci et al.

[0363] In certain embodiments, the compound that targets HSD17B13 nucleic acid comprises one or more modified nucleobases.In certain embodiments, the modified nucleobase is 5-methylcytosine.In certain embodiments, each cytosine is 5-methylcytosine.

[0364] Modified internucleotide linkages The naturally occurring internucleoside bond of RNA and DNA is a 3'-5' phosphodiester bond. In certain embodiments, the compounds described herein that have one or more modified, i.e., non-naturally occurring, internucleoside bonds are often selected over compounds that have naturally occurring internucleoside bonds. This is due to desirable properties, such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0365] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereoirregular internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereoirregular. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as will be appreciated by those skilled in the art, each phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages of independently selected specific stereochemical configurations. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555.In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereoirregular or may be of a specific stereochemical configuration.

[0366] In certain embodiments, the compound that targets HSD17B13 nucleic acid comprises one or more modified internucleoside linkages.In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages.In certain embodiments, each internucleoside linkage of antisense compound is phosphorothioate internucleoside linkage.

[0367] In certain embodiments, the compounds described herein comprise oligonucleotides.The oligonucleotides with modified internucleoside linkages include the internucleoside linkages that hold phosphorus atoms and the internucleoside linkages that do not have phosphorus atoms.Exemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate.The methods of preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0368] In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside bond.Two main classes of internucleoside linkages are defined by the presence or absence of phosphorus atom.Exemplary phosphorus-containing internucleoside bond includes, but is not limited to, phosphate (also called unmodified bond or naturally occurring bond) containing phosphodiester bond ("P=O"), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to the naturally occurring phosphate linkage, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as racemic mixtures or as separate enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0369] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 moieties.

[0370] In certain embodiments, the oligonucleotide comprises modified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, the internucleoside linkages are arranged in a gap motif. In such embodiments, the internucleoside linkages in each of the two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the wings are phosphodiester linkages and the internucleoside linkages in the gap are phosphorothioate linkages. Because the nucleoside motifs are independently selected, such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif, and if they have a gapped nucleoside motif, the wing length and gap length may or may not be the same.

[0371] In certain embodiments, the oligonucleotide comprises a region having an alternating internucleoside linkage motif. In certain embodiments, the oligonucleotide comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate.

[0372] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

[0373] In certain embodiments, the oligonucleotide comprises one or more methylphosphonate linkages. In certain embodiments, the oligonucleotide having a gapmer nucleoside motif comprises a linkage motif that comprises all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is present in the central gap of the oligonucleotide having a gapmer nucleoside motif.

[0374] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be reduced or the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be reduced and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while maintaining nuclease resistance.

[0375] 3. Specific motifs In certain embodiments, the compounds described herein include oligonucleotides. Oligonucleotides can have motifs, such as patterns of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugars. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differentially modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motifs, nucleobase motifs, and / or internucleoside linkage motifs (nucleobase motifs as used herein describe the modification of nucleobases independent of the sequence of nucleobases).

[0376] A specific glyco motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0377] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif that includes two exterior regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides in which at least a portion of the sugar moieties of the nucleosides of each wing differ from at least a portion of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides that have a sugar moiety that is different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0378] In certain embodiments, the gapmer wing comprises 1-5 nucleosides. In certain embodiments, the gapmer wing comprises 2-5 nucleosides. In certain embodiments, the gapmer wing comprises 3-5 nucleosides. In certain embodiments, the nucleosides of the gapmer are all modified nucleosides.

[0379] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, the gapmer gap comprises 7-10 nucleosides. In certain embodiments, the gapmer gap comprises 8-10 nucleosides. In certain embodiments, the gapmer gap comprises 10 nucleosides. In certain embodiments, each nucleoside of the gapmer gap is an unmodified 2'-deoxynucleoside.

[0380] In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing side of each wing / gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

[0381] In certain embodiments, a modified oligonucleotide has a fully modified sugar motif, where each nucleoside of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside of the region contains a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region contains the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each uniformly modified nucleoside contains the same 2'-modification.

[0382] B specific nucleobase motif In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.

[0383] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0384] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is present in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propynepyrimidine.

[0385] C specific internucleoside linkage motifs In certain embodiments, the compounds described herein comprise oligonucleotides. In certain embodiments, the oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, essentially each internucleoside linkage group is a phosphate internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is independently selected from phosphorothioate and phosphate internucleoside linkages. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages within the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereoirregular. In certain embodiments, all of the phosphorothioate linkages in the wing are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.

[0386] 4. Specific Modified Oligonucleotides In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification, motif, and total length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such gapmer oligonucleotides may include one or more modified nucleobases independent of the gapmer pattern of sugar modification. Furthermore, in certain instances, oligonucleotides are described by total length or range, and by the length or length range of two or more regions (e.g., regions of nucleosides having specific sugar modifications). In such a situation, it may be possible to select the numbers for each range that result in an oligonucleotide whose total length falls outside the specified range. In such a situation, both elements must be met. For example, in a particular embodiment, a modified oligonucleotide comprises 15-20 linked nucleosides and has a sugar motif comprised of three regions A, B, and C, where region A comprises 2-6 linked nucleosides having a particular sugar motif, region B comprises 6-10 linked nucleosides having a particular sugar motif, and region C comprises 2-6 linked nucleosides having a particular sugar motif. Such an embodiment does not include modified oligonucleotides in which A and C each comprise 6 linked nucleosides and B comprises 10 linked nucleosides (even though those numbers of nucleosides are allowed within the requirements for A, B, and C) because the total length of such an oligonucleotide would be 22, which exceeds the upper limit (20) for the total length of a modified oligonucleotide.In this specification, if the description of an oligonucleotide is silent about one or more parameters, such parameters are not limited.Thus, a modified oligonucleotide that is described only as having a gapmer sugar motif and not further described can have any length, internucleoside linkage motif, and nucleobase motif.Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0387] Specific conjugate compounds In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0388] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleobase sequence that is complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to pre-mRNA. In certain embodiments, the oligonucleotide is complementary to the sense transcript.

[0389] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0390] In certain embodiments, oligonucleotide is covalently bound to one or more conjugate groups.In certain embodiments, conjugate group modifies one or more properties of attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.In certain embodiments, conjugate group gives new properties to attached oligonucleotide, such as fluorophore or reporter group, which allows detection of oligonucleotide. Certain conjugate groups and moieties have been described previously, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538), Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc cluster (e.g., WO 2014 / 179620).

[0391] I. Conjugated Moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0392] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterials, or antibiotics.

[0393] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain compounds, the conjugate moiety is attached to the oligonucleotide via a more complex conjugate linker that includes one or more conjugate linker moieties that are subunits that form the conjugate linker. In certain embodiments, the conjugate linker includes a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

[0394] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0395] In certain embodiments, the conjugate linker (including the conjugate linkers described above) is a bifunctional linking moiety, known in the art to be useful, for example, for attaching a conjugate group to a parent compound, such as an oligonucleotide provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles that react with nucleophilic groups, and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0396] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 alkynyl, a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0397] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desired that the linker-nucleoside be cleaved from the compound after reaching the target tissue. Thus, the linker-nucleosides are typically attached to each other and to the remainder of the compound via cleavable bonds, hi certain embodiments, such cleavable bonds are phosphodiester bonds.

[0398] In the present specification, the linker-nucleosides are not considered to be part of the oligonucleotide. Thus, in embodiments where a compound comprises an oligonucleotide consisting of a specific number or range and / or a specific percentage of complementarity to a reference nucleic acid, and the compound also comprises a conjugate group comprising a conjugate linker that comprises linker-nucleosides, those linker-nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide with the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, a compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker-nucleoside.

[0399] In certain embodiments, it is desired that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, compounds containing certain conjugate moieties are better taken up by certain cell types, but it is desired that the conjugate group is cleaved to release the unconjugated or parent oligonucleotide once the compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0400] In certain embodiments, the cleavable bond is selected from: amide, ester, ether, one or both esters of a phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0401] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is attached to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and is covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate bond or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0402] 3. Specific Cell-Targeting Conjugate Moieties In certain embodiments, the conjugate group comprises a cell targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula: [ka] have (In the formula, n is 1 to about 3, when n is 1, m is 0, and when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0).

[0403] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0404] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branched group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to a branched group.

[0405] In certain embodiments, the cell targeting moiety comprises a branched chain group comprising one or more groups selected from an alkyl group, an amino group, an oxo group, an amide group, a disulfide group, a polyethylene glycol group, an ether group, a thioether group, and a hydroxylamino group. In certain embodiments, the branched chain group comprises a branched chain aliphatic group comprising a group selected from an alkyl group, an amino group, an oxo group, an amide group, a disulfide group, a polyethylene glycol group, an ether group, a thioether group, and a hydroxylamino group. In certain such embodiments, the branched chain aliphatic group comprises a group selected from an alkyl group, an amino group, an oxo group, an amide group, and an ether group. In certain such embodiments, the branched chain aliphatic group comprises a group selected from an alkyl group, an amino group, and an ether group. In certain such embodiments, the branched chain aliphatic group comprises a group selected from an alkyl group and an ether group. In certain such embodiments, the branched chain group comprises a monocyclic or polycyclic ring system.

[0406] In certain embodiments, each tether of the cell targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a straight chain aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or a neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms long. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms long. In certain embodiments, each tether comprises a chain length of about 10 atoms.

[0407] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has affinity for at least one type of receptor on the surface of a mammalian hepatocyte. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucoseamine, and fucose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the cell targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell targeting moiety comprises two GalNAc ligands. In certain embodiments, the cell targeting moiety comprises one GalNAc ligand.

[0408] In certain embodiments, each ligand of the cell targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, for example, Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting", Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor", J.Med. Chem. 2004, 47, 5798-5808). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, the amino sugar can be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-sulfo-D-glucosamine, and N-glycolyl-α-neuraminic acid. For example, the thio sugar can be selected from 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

[0409] In certain embodiments, the conjugate group has the formula: [ka] The cell targeting moiety comprises the following structure:

[0410] In certain embodiments, the conjugate group has the formula: [ka] The cell targeting moiety comprises the following structure:

[0411] In certain embodiments, the conjugate group has the formula: [ka] The cell targeting moiety comprises the following structure:

[0412] In certain embodiments, the conjugate group has the formula: [ka] The cell targeting moiety comprises the following structure:

[0413] In certain embodiments, the conjugate group has the formula: [ka] The cell targeting moiety comprises the following structure:

[0414] In certain embodiments, the compound comprises a conjugate group described herein as "LICA-1." LICA-1 has the formula: [ka] has.

[0415] In certain embodiments, the compounds described herein include LICA-1 and the cleavable moiety in the conjugate linker has the formula: [ka] have where Oligo is an oligonucleotide.

[0416] Representative U.S. patents, U.S. patent applications, international patent applications, and other publications that teach the preparation of compounds containing the particular conjugate groups of interest above, as well as conjugate groups, tethers, conjugate linkers, branched groups, ligands, cleavable moieties, and other modifications, include, but are not limited to, U.S. Pat. No. 5,994,517, U.S. Pat. No. 6,300,319, U.S. Pat. No. 6,660,720, U.S. Pat. No. 6,420,625, U.S. Pat. No. 6,520,635, U.S. Pat. No. 6,520,635, U.S. Pat. No. 6,520,625, U.S. Pat. No. 6,420,635, U.S. Pat. No. 6,5 ... ,906,182, U.S. Pat. No. 7,262,177, U.S. Pat. No. 7,491,805, U.S. Pat. No. 8,106,022, U.S. Pat. No. 7,723,509, U.S. Patent Application Publication No. 2006 / 0148740, U.S. Patent Application Publication No. 2011 / 0123520, International Publication No. 2013 / 033230, and International Publication No. 2012 / 037254, Biessen et al., J.Med.Chem.1995,38,1846-1852, Lee et al.,Bioorganic & Medicinal Chemistry 2011,19,2494-2500, Rensen et al.,J.Biol.Chem.2001,276,37577-37584, Rensen et al. al., J. Med. Chem. 2004, 47, 5798-5808, Sliedregt et al., J. Med. Chem. 1999, 42, 609-618, and Valentijn et al., Tetrahedron, 1997, 53, 759-770.

[0417] In certain embodiments, the modified oligonucleotide comprises a gapmer or a fully modified sugar motif and a conjugate group that comprises at least 1, 2, or 3 GalNAc ligands. In certain embodiments, the compound comprises a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al. al., Tetrahedron,1997,53,759-770;Kim et al.,Tetrahedron Lett,1997,38,3487-3490;Lee et al.,Bioconjug Chem,1997,8,762-765;Kato et al.,Glycobiol,2001,11,821-829;Rensen et al. al.,J Biol Chem,2001,276,37577-37584;Lee et al.,Methods Enzymol,2003,362,38-43;Westerlind et al.,Glycoconj J,2004,21,227-241;Lee et al.,Bioorg Med Chem Lett,2006,16(19),5132-5135;Maierhofer et al.,Bioorg Med Chem,2007,15,7661-7676;Khorev et al.,Bioorg Med Chem,2008,16,5216-5231;Lee et al.,Bioorg Med Chem,2011,19,2494-2500;Kornilova et al.,Analyt Biochem,2012,425,43-46;Pujol et al.,Angew Chemie Int Ed Engl,2012,51,7445-7448;Biessen et al.,J Med Chem,1995,38,1846-1852;Sliedregt et al.,J Med Chem,1999,42,609-618;Rensen et al.,J Med Chem,2004,47,5798-5808;Rensen et al.,Arterioscler Thromb Vasc Biol,2006,26,169-175;van Rossenberg et al.,Gene Ther,2004,11,457-464;Sato et al.,J Am Chem Soc,2004,126,14013-14022;Lee et al., J Org. Chem,2012,77,7564-7571;Biessen et al.,FASEB J,2000,14,1784-1792;Rajur et al.,Bioconjug Chem,1997,8,935-940;Duff et al.,Methods Enzymol,2000,313,297-321;Maier et al. al.,Bioconjug Chem,2003,14,18-29;Jayaprakash et al.,Org Lett,2010,12,5410-5413;Manoharan,Antisense Nucleic Acid Drug Dev,2002,12,103-128;Merwin et al.,Bioconjug Chem,1994,5,612-620;Tomiya et al. al.,Bioorg Med Chem,2013,21,5275-5281;WO 1998 / 013381;WO 2011 / 038356;WO 1997 / 046098;WO 2008 / 098788;WO 2004 / 101619;WO 2012 / 037254;WO 2011 / 120053;WO 2011 / 100131;WO 2011 / 163121;WO 2012 / 177947;WO 2013 / 033230;WO 2013 / 075035;WO 2012 / 083185;WO 2012 / 083046;WO 2009 / 082607;WO 2009 / 134487;WO 2010 / 144740;WO 2010 / 148013;WO 1997 / 020563;WO 2010 / 088537;WO 200 WO 2010 / 129709;WO 2012 / 068187;WO 2009 / 126933;WO 2004 / 024757;WO 2010 / 054406;WO 2012 / 089352;WO 2012 / 089602;WO 2013 / 166121;WO 2013 / 165816;U.S. Patent No. 4,751,219 Fine print; U.S. Patent No. 8,552,163; U.S. Patent No. 6,908,903; U.S. Patent No. 7,262,177; U.S. Patent No. 5,994,517; U.S. Patent No. 6,300,319; U.S. Patent No. 8,106,022; U.S. Patent No. 7,491,805; U.S. Patent No. 7,491,805; U.S. Patent No. 7,582,744; U.S. Patent No. 8,137,695; U.S. Patent No. 6,383,812; U.S. Patent No. 6,525,031; U.S. Patent No. 6,660,720 documents;U.S. Patent No. 7,723,509;U.S. Patent No. 8,541,548;U.S. Patent No. 8,344,125;U.S. Patent No. 8,313,772;U.S. Patent No. 8,349,308;U.S. Patent No. 8,450,467;U.S. Patent No. 8,501,930;U.S. Patent No. 8,158,601;U.S. Patent No. 7,262,177;U.S. Patent No. 6,906,182;U.S. Patent No. 6,620,916;U.S. Patent No. 8,435,491;U.S. Patent No. 8,404,862;U.S. Patent Application Publication No. 7,851,615; U.S. Patent Application Publication No. 2011 / 0097264; U.S. Patent Application Publication No. 2011 / 0097265; U.S. Patent Application Publication No. 2013 / 0004427; U.S. Patent Application Publication No. 2005 / 0164235; U.S. Patent Application Publication No. 2006 / 0148740; U.S. Patent Application Publication No. 2008 / 0281044; U.S. Patent Application Publication No. 2010 / 0240730; U.S. Patent Application Publication No. US Patent Publication No. 2003 / 0119724; US Patent Publication No. 2006 / 0183886; US Patent Publication No. 2008 / 0206869; US Patent Publication No. 2011 / 0269814; US Patent Publication No. 2009 / 0286973; US Patent Publication No. 2011 / 0207799; US Patent Publication No. 2012 / 0136042; US Patent Publication No. 2012 / 0165393; US Patent Publication No. 2008 / 0281041; U.S. Publication No. 2009 / 0203135; U.S. Publication No. 2012 / 0035115; U.S. Publication No. 2012 / 0095075; U.S. Publication No. 2012 / 0101148; U.S. Publication No. 2012 / 0128760; U.S. Publication No. 2012 / 0157509; U.S. Publication No. 2012 / 0230938; U.S. Pat. US Patent Publication No. 2013 / 0109817; US Patent Publication No. 2013 / 0121954; US Patent Publication No. 2013 / 0178512; US Patent Publication No. 2013 / 0236968; US Patent Publication No. 2011 / 0123520; US Patent Publication No. 2003 / 0077829; US Patent Publication No. 2008 / 0108801; and US Patent Publication No. 2009 / 0203132.;

[0418] In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0419] Compositions and methods for formulating pharmaceutical compositions The compounds described herein can be mixed with pharma- ceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and method for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0420] Certain embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable diluent or carrier that is pharma- ceutically acceptable. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such pharmaceutical compositions consist of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of a compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0421] The compounds described herein that target HSD17B13 nucleic acid can be utilized in pharmaceutical compositions by combining the compounds with a suitable pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharma-ceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, the method described herein is used in a pharmaceutical composition that includes a compound that targets HSD17B13 nucleic acid and a pharma-ceutically acceptable diluent. In certain embodiments, the pharma-ceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0422] Pharmaceutical compositions comprising the compounds provided herein include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to an animal, including humans. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of modified oligonucleotides. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of the compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0423] Prodrugs may include the incorporation of additional nucleosides at one or both ends of the compound, which are cleaved by endogenous nucleases within the body to form the active compound.

[0424] In certain embodiments, the compound or composition further comprises a pharma- ceutically acceptable carrier or diluent. EXAMPLES

[0425] The following example describes a screening process to identify compounds that target HSD17B13.

[0426] Non-limiting disclosure and incorporation by reference The sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, although in practice these sequences may be modified by any combination of chemical modifications. Those of skill in the art will readily recognize that designations such as "RNA" or "DNA" to describe modified oligonucleotides are, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH for the natural 2'-H in DNA) or an RNA with a modified base (thymine (methylated uracil) for the natural uracil in RNA).

[0427] Thus, the nucleic acid sequences provided herein, including but not limited to those contained in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those nucleic acids having modified nucleobases. As a further example, and without limitation, an oligonucleotide having the nucleobase sequence "ATCGATCG" encompasses any oligonucleotide having such a nucleobase sequence, whether modified or unmodified, and includes but is not limited to such compounds that contain RNA bases, for example those having the sequence "AUCGAUCG", some DNA bases and some RNA bases, such as "AUCGATCG", as well as other modified nucleobases, such as "AT m CGAUCG" m C represents a cytosine base containing a methyl group at the 5-position.

[0428] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), as α or β for sugar anomers, etc., or as (D) or (L) for amino acids, etc. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compounds shown. Compounds provided herein that are depicted or described with no defined stereochemistry include all possible isomers, including stereoirregular and optically pure forms thereof. Similarly, all tautomeric forms of the compounds provided herein are included unless otherwise indicated. Unless otherwise indicated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.

[0429] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein that contain hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, the following: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36 Examples include S.

[0430] While certain compounds, compositions, and methods described herein have been described with properties in accordance with certain embodiments, the following examples serve only to illustrate, and are not intended to limit, the compounds described herein. Each reference cited in this application is incorporated herein by reference in its entirety.

[0431] Example 1: Antisense inhibition of human HSD17B13 by cEt gapmers in HepaRG cells Modified oligonucleotides complementary to HSD17B13 nucleic acid were synthesized and tested in vitro for their effect on HSD17B13 RNA levels. Modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each separate experiment are shown in the following table.

[0432] All modified oligonucleotides were 3-10-3 cEt gapmers (i.e., a central gap segment of 10 2'-deoxynucleosides flanked by wing segments containing three cEt modified nucleosides). Internucleoside linkages throughout each modified oligonucleotide were phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each modified oligonucleotide were 5-methylcytosines.

[0433] "START SITE" indicates the 5'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. "STOP SITE" indicates the 3'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotide is complementary to human HSD17B13 mRNA (designated herein as SEQ ID NO: 1) (GENBANK Accession No. NM_178135.4), or to human HSD17B13 genomic sequence (designated herein as SEQ ID NO: 2) (complement of GENBANK Accession No. NC_000004.12, truncated from nucleotides 87301001-87326000), or to both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to a particular target sequence.

[0434] HepaRG cells cultured at a density of 20,000 cells per well were transfected with 1,000 nM of modified oligonucleotides using electroporation. After a treatment period of about 24 hours, RNA was isolated from the cells and HSD17B13 RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human primer probe set RTS43553 (forward sequence AGACTACAGAAGTTTCTTCCTGAAC, designated herein as SEQ ID NO:5; reverse sequence CATCTCTGGCTGGAGCTTATTT, designated herein as SEQ ID NO:6; probe sequence TTTGAAGCAGTGGTTGGCCACAAA, designated herein as SEQ ID NO:7). HSD17B13 RNA levels were normalized to total RNA content measured by RIBOGREEN®. Results are shown as the percent inhibition of HSD17B13 relative to untreated control cells. As used herein, a value of "0" indicates that treatment with modified oligonucleotides did not inhibit HSD17B13 mRNA levels. An asterisk (*) indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer-probe set, so the associated data is not reliable. In such cases, further runs with alternative primer-probe sets must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

[0435] [Table 1]

[0436] [Table 2]

[0437] [Table 3]

[0438]

Table 4

[0439]

Table 5

[0440]

Table 6

[0441]

Table 7

[0442]

Table 8

[0443]

Table 9

[0444]

Table 10

[0445]

Table 11

[0446]

Table 12

[0447]

Table 13

[0448]

Table 14

[0449]

Table 15

[0450]

Table 16

[0451]

Table 17

[0452]

Table 18

[0453]

Table 19

[0454]

Table 20

[0455]

Table 21

[0456]

Table 22

[0457]

Table 23

[0458]

Table 24

[0459]

Table 25

[0460]

Table 26

[0461]

Table 27

[0462]

Table 28

[0463]

Table 29

[0464]

Table 30

[0465]

Table 31

[0466]

Table 32

[0467]

Table 33

[0468]

Table 34

[0469]

Table 35

[0470]

Table 36

[0471]

Table 37

[0472]

Table 38

[0473]

Table 39

[0474]

Table 40

[0475]

Table 41

[0476]

Table 42

[0477]

Table 43

[0478]

Table 44

[0479]

Table 45

[0480]

Table 46

[0481]

Table 47

[0482]

Table 48

[0483]

Table 49

[0484]

Table 50

[0485]

Table 51

[0486]

Table 52

[0487]

Table 53

[0488]

Table 54

[0489]

Table 55

[0490]

Table 56

[0491]

Table 57

[0492]

Table 58

[0493]

Table 59

[0494]

Table 60

[0495]

Table 61

[0496]

Table 62

[0497]

Table 63

[0498]

Table 64

[0499]

Table 65

[0500]

Table 66

[0501] [Table 67]

[0502] Example 2: Dose-dependent inhibition of human HSD17B13 by cEt gapmers in HepaRG cells Specific modified oligonucleotides described in previous studies that showed significant in vitro inhibition of HSD17B13 RNA were selected and tested at various doses in HepaRG cells.

[0503] Modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are shown in a separate table below. HepaRG cells cultured at a density of 30,000 cells per well were transfected with modified oligonucleotides diluted to various concentrations as specified in the table below using electroporation. After a treatment period of about 24 hours, HSD17B13 RNA levels were measured as described above using human HSD17B13 primer-probe set RTS43553. HSD17B13 RNA levels were normalized to total RNA measured by RIBOGREEN®. The results are shown in the table below as the percentage inhibition of HSD17B13 relative to untreated control cells.

[0504] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below.

[0505] [Table 68]

[0506] [Table 69]

[0507] Example 3: Antisense inhibition of human HSD17B13 by cEt gapmers in HepaRG cells Additional modified oligonucleotides complementary to HSD17B13 nucleic acid were synthesized and tested in vitro for their effect on HSD17B13 RNA levels. Modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are shown in separate tables below.

[0508] HepaRG cells cultured at a density of 30,000 cells per well were transfected with 1,000 nM modified oligonucleotides using electroporation. After a treatment period of about 24 hours, RNA was isolated from the cells and HSD17B13 RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human primer probe set RTS43553. HSD17B13 RNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are shown as percent inhibition of HSD17B13 relative to untreated control cells. As used herein, a value of "0" indicates that treatment with modified oligonucleotides did not inhibit HSD17B13 mRNA levels. An asterisk (*) indicates that the modified oligonucleotides are complementary to the target transcript within the amplicon region of the primer probe set, so the associated data is not reliable. In such cases, additional runs using alternative primer probe sets must be performed to accurately evaluate the potency and efficacy of such modified oligonucleotides.

[0509] The modified oligonucleotides described in the table below were 3-10-3 cEt gapmers. The internucleoside linkages throughout each modified oligonucleotide were phosphorothioate (P=S) linkages. All cytosine residues throughout each modified oligonucleotide were 5-methylcytosine.

[0510] "START SITE" indicates the 5'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. "STOP SITE" indicates the 3'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotide is complementary to human HSD17B13 mRNA (designated herein as SEQ ID NO: 1) (GENBANK Accession No. NM_178135.4), or to human HSD17B13 genomic sequence (designated herein as SEQ ID NO: 2) (complement of GENBANK Accession No. NC_000004.12, truncated from nucleotides 87301001-87326000), or to both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to a particular target sequence.

[0511] [Table 70]

[0512] [Table 71]

[0513] [Table 72]

[0514] [Table 73]

[0515] [Table 74]

[0516] [Table 75]

[0517] [Table 76]

[0518]

Table 77

[0519]

Table 78

[0520]

Table 79

[0521]

Table 80

[0522]

Table 81

[0523]

Table 82

[0524]

Table 83

[0525]

Table 84

[0526]

Table 85

[0527]

Table 86

[0528] [Table 87]

[0529] [Table 88]

[0530] [Table 89]

[0531] Modified oligonucleotides complementary to HSD17B13 nucleic acids with other chemical modifications were synthesized and tested in vitro for their effects on HSD17B13 RNA levels, as described above. The Chemical Designation column in the table below specifies the chemistry of each modified oligonucleotide; subscript "d" represents a 2'-β-D-deoxyribosyl sugar moiety, subscript "e" represents a 2'-MOE sugar moiety, subscript "y" represents a 2'-O-methyl sugar moiety, subscript "k" represents a cEt modified sugar moiety, subscript "s" represents a phosphorothioate internucleoside linkage, and superscript "m" before a cytosine residue represents a 5-methylcytosine.

[0532] [Table 90]

[0533] [Table 91]

[0534] [Table 92]

[0535] [Table 93]

[0536]

Table 94

[0537]

Table 95

[0538]

Table 96

[0539]

Table 97

[0540]

Table 98

[0541]

Table 99

[0542]

Table 100

[0543]

Table 101

[0544]

Table 102

[0545]

Table 103

[0546]

Table 104

[0547]

Table 105

[0548]

Table 106

[0549]

Table 107

[0550]

Table 108

[0551]

Table 109

[0552]

Table 110

[0553]

Table 111

[0554]

Table 112

[0555]

Table 113

[0556]

Table 114

[0557]

Table 115

[0558]

Table 116

[0559]

Table 117

[0560]

Table 118

[0561]

Table 119

[0562]

Table 120

[0563]

Table 121

[0564]

Table 122

[0565]

Table 123

[0566]

Table 124

[0567]

Table 125

[0568]

Table 126

[0569]

Table 127

[0570]

Table 128

[0571]

Table 129

[0572]

Table 130

[0573]

Table 131

[0574]

Table 132

[0575]

Table 133

[0576]

Table 134

[0577] [Table 135]

[0578] [Table 136]

[0579] [Table 137]

[0580] [Table 138]

[0581] [Table 139]

[0582] [Table 140]

[0583] Example 4: Design of modified oligonucleotides of human HSD17B13 and their antisense inhibition in HepRG cells Modified oligonucleotides complementary to HSD17B13 nucleic acids were synthesized and tested in vitro for their effect on HSD17B13 RNA levels. The chemistry of each modified oligonucleotide is specified; subscript "d" represents a 2'-β-D-deoxyribosyl sugar moiety, subscript "e" represents a 2'-MOE sugar moiety, subscript "y" represents a 2'-O-methyl sugar moiety, subscript "k" represents a cEt modified sugar moiety, subscript "s" represents a phosphorothioate internucleoside linkage, and superscript "m" before a cytosine residue represents a 5-methylcytosine. "Start site" indicates the 5'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. "Stop site" indicates the 3'-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides are complementary to human HSD17B13 mRNA (designated herein as SEQ ID NO:1) (GENBANK Accession No. NM_178135.4), or to the human HSD17B13 genomic sequence (designated herein as SEQ ID NO:2) (complement of GENBANK Accession No. NC_000004.12, truncated from nucleotides 87301001-87326000), or to both. "N / A" indicates that the modified oligonucleotide is not complementary with 100% complementarity to a particular target sequence.

[0584] Modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are shown in separate tables below. HepaRG cells cultured at a density of 30,000 cells per well were transfected with 1,000 nM modified oligonucleotides using electroporation. After a treatment period of about 24 hours, RNA was isolated from the cells and HSD17B13 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS43553 was used to measure RNA levels. HSD17B13 RNA levels were adjusted according to total RNA content measured by RIBOGREEN®. Results are shown as the percent inhibition of HSD17B13 relative to untreated control cells. As used herein, a value of "0" indicates that treatment with modified oligonucleotides did not inhibit HSD17B13 mRNA levels.

[0585] [Table 141]

[0586] [Table 142]

[0587] [Table 143]

[0588] [Table 144]

[0589] [Table 145]

[0590] [Table 146]

[0591]

Table 147

[0592]

Table 148

[0593]

Table 149

[0594]

Table 150

[0595]

Table 151

[0596]

Table 152

[0597]

Table 153

[0598]

Table 154

[0599]

Table 155

[0600]

Table 156

[0601] Example 5: Dose-dependent inhibition of human HSD17B13 by modified oligonucleotides in HepaRG cells Specific modified oligonucleotides described in previous studies that showed significant in vitro inhibition of HSD17B13 RNA were selected and tested at various doses in HepaRG cells.

[0602] Modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are shown in a separate table below. HepaRG cells cultured at a density of 30,000-35,000 cells per well were transfected with modified oligonucleotides diluted to various concentrations specified in the table below using electroporation. After a treatment period of about 24 hours, HSD17B13 RNA levels were measured as described above using human HSD17B13 primer-probe set RTS43553. HSD17B13 RNA levels were normalized to total RNA content measured by human GAPDH. The results are shown in the table below as the percentage inhibition of HSD17B13 relative to untreated control cells. Data shown as "ND" (not available) means that data for treatment with the compound is not available.

[0603] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below.

[0604] [Table 157]

[0605] [Table 158]

[0606] [Table 159]

[0607]

Table 160

[0608]

Table 161

[0609]

Table 162

[0610]

Table 163

[0611]

Table 164

[0612]

Table 165

[0613]

Table 166

[0614]

Table 167

[0615]

Table 168

[0616]

Table 169

[0617]

Table 170

[0618]

Table 171

[0619]

Table 172

[0620]

Table 173

[0621]

Table 174

[0622]

Table 175

[0623]

Table 176

[0624]

Table 177

[0625]

Table 178

[0626]

Table 179

[0627]

Table 180

[0628] Example 6: Design of human HSD17B13 modified oligonucleotides The specific modified oligonucleotides described above were further modified with a LICA-1 moiety by conjugation at the 5'-end. The resulting compounds and their non-conjugated counterparts are listed in the table below. The compounds are identical in sequence and oligonucleotide chemistry to the "parent compounds" described above.

[0629] [Table 181]

[0630] Example 7: Dose-dependent ex vivo inhibition of human HSD17B13 in transgenic mouse hepatocytes The conjugated modified oligonucleotides described above were tested for inhibition of HSD17B13 RNA at various doses in primary mouse hepatocytes extracted from transgenic mice.

[0631] A transgenic mouse model was developed in-house using a fosmid containing the human HSD17B13 gene (NCBI Clone DB ID: ABC8-43206400A10). The clone was digested at Not1 restriction sites (two different sites) to generate a fragment containing 19,118 bp of the human HSD17B13 gene (including 12,175 bp of the upstream region and 7,553 bp of the downstream region). The gene fragment was introduced into fertilized eggs from C57 / BL / 6NTac strain mice by pronuclear injection to generate huHSD 17469 and 17470 founders. Transgenic mice derived from founder 17469 were used in the experiments described herein. Human HSD17B13 RNA expression is found in the liver of this model. Mice were sacrificed and hepatocytes were collected and used in experiments to test conjugated modified oligonucleotides.

[0632] The conjugated modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are shown in a separate table below. Primary mouse transgenic hepatocytes described above were plated at a density of 20,000 cells per well and treated by free uptake with the conjugated modified oligonucleotides diluted to various concentrations specified in the table below. After overnight incubation, HSD17B13 RNA levels were measured using human HSD17B13 primer-probe set RTS43553 as described earlier herein. HSD17B13 RNA levels were normalized to total GAPDH content. The results are shown in the table below as the percentage inhibition of HSD17B13 relative to untreated control cells. The half-maximal inhibitory concentration (IC) of each modified oligonucleotide was determined. 50 ) was calculated using linear regression on a log / linear plot of the data in Excel and is also shown in the table below.

[0633] [Table 182]

[0634] [Table 183]

[0635] [Table 184]

[0636] Example 8: Tolerance of modified oligonucleotides complementary to HSD17B13 in CD-1 mice CD-1 mice are a versatile mouse model frequently used for safety and efficacy testing. In this study, CD-1 mice were treated with conjugate-modified oligonucleotides selected from the previously described studies and evaluated for changes in the levels of various plasma chemical markers.

[0637] treatment Groups of 6-8 week old male CD-1 mice were injected subcutaneously with 25 mg / kg of the conjugate modified oligonucleotide once a week for 6 weeks (for a total of 7 treatments). One group of male CD-1 mice was injected with PBS. Mice were euthanized 48 hours after the final dose.

[0638] Research 1 Plasma Chemistry Markers To evaluate the effect of conjugate modified oligonucleotide on liver function, blood urea nitrogen (BUN), albumin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatinine (CREA) plasma levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY).The results are shown in the following table.

[0639] [Table 185]

[0640] Body and organ weights The weights of CD-1 mice were measured on days 1 and 44. The average weights per group are shown in the table below. The weights of the liver, kidneys, and spleen were measured at the end of the study and are shown in the table below.

[0641] [Table 186]

[0642] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements and platelet (PLT) counts, and the results are shown in the table below.

[0643] [Table 187]

[0644] Research 2 Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), albumin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatinine (CREA) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are shown in the table below.

[0645] [Table 188]

[0646] Body and organ weights The weights of CD-1 mice were measured on days 1 and 42. The average weights per group are shown in the table below. The weights of the liver, kidneys, and spleen were measured at the end of the study and are shown in the table below.

[0647] [Table 189]

[0648] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements, platelet (PLT) counts, neutrophil (NEU) counts, reticulocyte (RET) counts, and lymphocyte (LYM) counts. The results are shown in the table below.

[0649] [Table 190]

[0650] Research 3 Plasma Chemistry Markers To assess the effect of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), albumin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), and creatinine (CREA) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are shown in the table below.

[0651] [Table 191]

[0652] Body and organ weights The weights of CD-1 mice were measured on days 1 and 39. The average weights per group are shown in the table below. The weights of the liver, kidneys, and spleen were measured at the end of the study and are shown in the table below.

[0653] [Table 192]

[0654] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements, platelet (PLT) counts, neutrophil (NEU) counts, reticulocyte (RET) counts, and lymphocyte (LYM) counts. The results are shown in the table below.

[0655] [Table 193]

[0656] Example 9: Tolerance of modified oligonucleotides targeting human HSD17B13 in Sprague-Dawley rats The Sprague-Dawley rat is a versatile model used to evaluate safety and efficacy. In this study, rats were treated with Ionis-conjugated modified oligonucleotides from the studies described in the previous examples and evaluated for changes in the levels of various plasma chemistry markers.

[0657] treatment Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow ad libitum. Groups of four Sprague-Dawley rats each were subcutaneously injected with 25 mg / kg of conjugated modified oligonucleotide every week (total of 7 doses) for 6 weeks. 72 hours after the last dose, rats were euthanized and organs, urine, and plasma were collected for further analysis.

[0658] Research 1 Plasma Chemistry Markers To evaluate the effect of the conjugate modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured. The results are shown in the table below, expressed in IU / L. Plasma levels of creatinine (CREA), albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer. The results are also shown in the table below.

[0659] [Table 194]

[0660] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements and platelet (PLT) counts, and the results are shown in the table below.

[0661] [Table 195]

[0662] renal function To evaluate the effect of conjugated modified oligonucleotides on renal function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratios (P / C ratios) are shown in the table below.

[0663] [Table 196]

[0664] Body and organ weights The weights of the Sprague-Dawley rats were measured on days 1 and 40. The average weights per group are shown in the table below. The weights of the liver, heart, spleen, and kidneys were measured at the end of the study and are shown in the table below.

[0665] [Table 197]

[0666] Research 2 Plasma Chemistry Markers To evaluate the effect of the conjugate modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured. The results are shown in the table below, expressed in IU / L. Plasma levels of creatinine (CREA), albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer. The results are also shown in the table below.

[0667] [Table 198]

[0668] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements, platelet (PLT) counts, neutrophil (NEU) counts, reticulocyte (RET) counts, and lymphocyte (LYM) counts. The results are shown in the table below.

[0669] [Table 199]

[0670] renal function To assess the effect of Ionis oligonucleotides on renal function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratios (P / C ratios) are shown in the table below.

[0671] [Table 200]

[0672] Body and organ weights The weights of the Sprague-Dawley rats were measured on days 1 and 44. The average weights per group are shown in the table below. The weights of the liver, heart, spleen, and kidneys were measured at the end of the study and are shown in the table below.

[0673] [Table 201]

[0674] Research 3 Plasma Chemistry Markers To evaluate the effect of the conjugate modified oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured. The results are shown in the table below, expressed in IU / L. Plasma levels of creatinine (CREA), albumin, total bilirubin (TBIL), and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer. The results are also shown in the table below.

[0675] [Table 202]

[0676] Hematology Assays Blood from the groups of mice at week 6 was sent to IDEXX BioResearch for hematocrit (HCT) measurements, platelet (PLT) counts, neutrophil (NEU) counts, reticulocyte (RET) counts, and lymphocyte (LYM) counts. The results are shown in the table below.

[0677] [Table 203]

[0678] renal function To assess the effect of Ionis oligonucleotides on renal function, urinary levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratios (P / C ratios) are shown in the table below.

[0679] [Table 204]

[0680] Body and organ weights The weights of the Sprague-Dawley rats were measured on days 1 and 42. The average weights per group are shown in the table below. The weights of the liver, heart, spleen, and kidneys were measured at the end of the study and are shown in the table below.

[0681] [Table 205]

[0682] Example 10: Viscosity measurements of modified oligonucleotides targeting human HSD17B13 The viscosity of selected conjugate-modified oligonucleotides from the studies described above was measured.

[0683] Conjugate-modified oligonucleotides (in the range of 32-38 mg) were placed into separate glass vials; approximately 100 μL of water was added to each vial and the conjugate-modified oligonucleotides were dissolved in solution by heating the vials to 55° C. 75 μL portions of the pre-heated samples were pipetted into a microviscometer (PAC Cambridge Viscosity Viscometer). The temperature of the microviscometer was set to 25° C. to measure the viscosity of the samples. A 75 μL portion of each sample was then combined with the remainder of the original sample and then diluted for a UV reading at 260 nM (Cary UV instrument). The data are shown in the table below. Compounds with a viscosity of less than 40 cP in this assay are generally suitable for therapeutic use.

[0684] [Table 206]

Claims

1. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, The modified oligonucleotide has a nucleobase sequence selected from any one of SEQ ID NOs: 286, 817, 983, 1215, 747, 43, 355, 1602, 201, 734, 1249, 208, 513, 1449, 1448, 1595, and 819, wherein the modified oligonucleotide is: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; a 3' wing segment consisting of linked nucleosides; Including, The compound, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar.

2. The compound of claim 1 comprising a conjugate group.

3. The compound of claim 2, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

4. The compound of claim 2, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

5. The compound of claim 2 , wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

6. The compound of claim 1 which is a sodium salt.

7. The compound of claim 1 which is a potassium salt.

8. 10. A pharmaceutical composition comprising a compound of claim 1 and a pharma- ceutically acceptable diluent.

9. 9. The pharmaceutical composition of claim 8, wherein the pharma- ceutically acceptable diluent is water.

10. 8. The compound of any one of claims 1 to 7, wherein the oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO:2 over the entire length of the oligonucleotide.

11. the modified sugar moiety of each nucleoside of each wing segment is selected from 2'-O-Me, 2'-MOE, and cEt sugar moieties; A compound according to any one of claims 1 to 7 or 10.

12. The modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; Including, the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a cEt nucleoside; at least one internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine; A compound according to any one of claims 1 to 7 or 10 to 11.

13. The modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; a 3' wing segment consisting of three linked nucleosides; Including, the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a cEt nucleoside; each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine; A compound according to any one of claims 1 to 7 or 10 to 12.

Images