Monoacyl-MEL producing bacteria

Abstract

Provided is a monoacylated MEL. A microorganism Pseudozyma producing a monoacylated MEL-B.

Description

[Technical field]

[0001] Disclosed are a biosurfactant (more specifically, a monoacyl-type MEL)-producing bacterium and a technique for producing monoacyl-type MEL using the same. [Background technology]

[0002] Biosurfactants are natural surfactants produced by microorganisms, which are highly biodegradable, have low environmental impact, and have various beneficial physiological functions. Therefore, their use in the food, cosmetics, pharmaceutical, chemical, and environmental industries is meaningful in realizing an environmentally harmonious society.

[0003] Biosurfactants are classified into five types: glycolipids, acyl peptides, phospholipids, fatty acids, and polymers. Among these, glycolipid surfactants have been most extensively studied. Known examples of such glycolipid biosurfactants include mannosylerythritol (hereinafter also referred to as ME), in which erythritol is glycoside-bonded to mannose, and mannosylerythritol lipid (hereinafter also referred to as MEL), in which fatty acids are further ester-bonded to mannosylerythritol lipid (hereinafter also referred to as MEL), as well as rhamnolipid, ustyladic acid, trehalose lipid, and sophorose lipid.

[0004] MEL has various structures that differ in the position and number of fatty acid residues and acetyl groups bound to it. FIG. 1 shows the structural formula of MEL, in which hydrogen atoms, acetyl groups, and fatty acid residues with 3 to 18 carbon atoms are indicated by R1 to R5. A structure in which R1 and R2 are fatty acid residues and R3 and R4 are acetyl groups is defined as MEL-A, a structure in which R3 is a hydrogen atom and R4 is an acetyl group is defined as MEL-B, a structure in which R3 is an acetyl group and R4 is a hydrogen atom is defined as MEL-C, and a structure in which R3 and R4 are hydrogen atoms is defined as MEL-D. Depending on whether the hydroxymethyl group of erythritol bound to mannose is derived from the 1st carbon or the 4th carbon, the structure of the obtained ME differs as shown in FIG. 2(a) and (b). MEL having 4-O-β-D-mannopyranosyl-erythritol as the sugar skeleton shown in FIG. 2(a) is called 4-O-β-D-MEL. Pseudozyma tsukubaensis is known to produce 1-O-β-D-MEL-B, which has 1-O-β-D-mannopyranosyl-erythritol as the sugar skeleton, as shown in Figure 2(b). 1-O-β-MEL-B has improved hydration and vesicle-forming ability compared to 4-O-β-MEL-B, making it a promising biomaterial for use in skin care products.

[0005] It has been reported that by culturing MEL-producing bacteria using glucose as the only carbon source, monoacyl-type MEL (single-chain MEL) is produced, in which a fatty acid is bound only to R2 in MEL in Figure 1, and R1, R3, and R4 are hydrogen atoms (Non-Patent Document 1). This monoacyl-type MEL has improved hydrophilicity compared to conventional diacyl-type MEL (Non-Patent Document 1).

[0006] The MEL biosynthetic pathway has already been reported, in which MEL is synthesized intracellularly through the reactions of glycosyltransferases that link mannose and erythritol, acyltransferases that link fatty acids, and acetyltransferases that link acetyl groups (Non-Patent Document 2).

[0007] The present inventors discovered that by deleting the gene encoding acyltransferase in a microorganism capable of producing a biosurfactant, it is possible to obtain monoacyl-type MEL in which an aliphatic acyl group is bound only to R1 in the structural formula shown in Figure 1 (Patent Document 1). [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Patent application 2016-191438 [Non-patent literature]

[0009] [Non-Patent Document 1] Fukuoka et al., Appl. Microbiol. Biotechnol. (2007) 76: 801-810. [Non-Patent Document 2] Hewald et al., Appl. Environ. Microbiol. (2006) 72: 5469-5477 Summary of the Invention [Problem to be solved by the invention]

[0010] Given the current situation described above, one of the challenges is to provide a new MEL. [Means for solving the problem]

[0011] As a result of intensive research aimed at solving such problems, it was found that by deleting the gene encoding a transporter from a microorganism capable of producing a biosurfactant, it is possible to obtain a monoacyl-type MEL in which only R1 has an aliphatic acyl group and R4 is bound to an acetyl group or a hydroxyl group, as shown in the structural formula in Figure 1. Based on these findings, further research and studies have led to the provision of the following representative inventions.

[0012] Item 1 A Pseudozyma microorganism that produces monoacyl-type MEL-B. Section 2 Item 1. The microorganism according to Item 1, wherein the gene encoding the transporter (PtMMF1) is deleted. Section 3 Item 3. The microorganism according to Item 1 or 2, which further produces monoacyl MEL-D. Section 4 Item 4. The microorganism according to any one of Items 1 to 3, wherein the microorganism is Pseudozyma tsukubaensis. Item 5. A method for producing monoacyl-type MEL-B using the microorganism according to any one of Items 1 to 4. Section 6 Item 5. A composition containing MEL obtained by culturing the microorganism according to any one of Items 1 to 4. Effect of the Invention

[0013] Means are provided for producing monoacyl MEL-B. [Brief description of the drawings]

[0014] [Figure 1] The structure of MEL is shown below. [Diagram 2] The structures of 4-O-β-D-mannopyranosyl-erythritol (a) and 1-O-β-D-mannopyranosyl-erythritol (b) are shown. [Diagram 3] The PtMMF1 disruption vector is shown. [Figure 4] The results of colony PCR of transformants are shown. [Diagram 5] The results of thin-layer chromatography analysis of the PtMMF1-disrupted strain culture are shown. [Figure 6] The results of analyzing the culture of the PtMMF1-disrupted strain using a high-performance liquid chromatography-mass spectrometry are shown. [Figure 7] The results of analyzing the culture of the PtMMF1 disruptant by nuclear magnetic resonance spectroscopy are shown. [Figure 8] The results of measuring the surface tension of an acetone extract of the culture medium of the PtMMF1-disrupted strain are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The microorganism preferably produces monoacyl MEL-B. As described above, in the structural formula of monoacyl MEL-B shown in Figure 1, R1 is an aliphatic acyl group having 2 to 24 carbon atoms, R2 is a hydrogen atom, R3 is a hydrogen atom, and R4 is an acetyl group. The number of carbon atoms in the aliphatic acyl group is preferably 2 to 24, and more preferably 6 to 14.

[0016] The type of microorganism that produces monoacyl-type MEL-B is not particularly limited. In one embodiment, the microorganism that produces monoacyl-type MEL-B preferably belongs to the genus Pseudozyma, Moesziomyces, Ustilago, Sporisorium, Melanopsichium, or Kurtzmannomyces. Preferred microorganisms of the genus Pseudozyma include Pseudozyma antarctica (Moesziomyces antarcticus), Pseudozyma parantarctica, Pseudozyma rugulosa, Pseudozyma siamensis, Pseudozyma shanxiensis, Pseudozyma crassa, Pseudozyma churashimaensis, Pseudozyma aphidis (Moesziomyces aphidis), Pseudozyma hubeiensis, and Pseudozyma tsukubaensis. Preferred Moesziomyces microorganisms are Moesziomyces antarcticus and Moesziomyces aphidis. Preferred Ustilago microorganisms are Ustilago hordei and Ustilago maydis. Preferred Sporisorium microorganisms are Sporisorium reilianum and Sporisorium scitamineum. Preferred Melanopsichium microorganisms are Melanopsichium pennsylvanicum. Preferred Kurtzmanomyces microorganisms are Kurtzmanomyces sp. I-11. In a preferred embodiment, the MEL-producing microorganism is a microorganism of the genus Pseudozyma, more preferably a microorganism belonging to Pseudozyma tsukubaensis, and more specifically, Pseudozyma tsukubaensis 1E5 (JCM16987 strain) or NBRC1940 (ATCC24555, CBS422.96, CBS6389, DBVPG6988, PYCC4855, JCM10324, MUCL29894, NCYC1510, NRRLY-7792).Microorganisms belonging to Pseudozyma tsukubaensis are known to selectively produce 1-O-β-MEL-B.

[0017] In one embodiment, the monoacyl MEL-producing microorganism can be obtained by introducing a mutation into a microorganism that produces conventional MEL. Here, the conventional MEL is diacyl MEL. The type of mutation is not particularly limited, but it is preferably a mutation that disrupts a gene encoding a transporter contained in the MEL-producing microorganism. Disruption of a gene means that a protein (e.g., a transporter) encoded by the gene becomes non-functional, and the manner of disruption is not particularly limited. In one embodiment, a microorganism that produces monoacyl MEL can be obtained by disrupting a gene encoding a transporter contained in the MEL-producing microorganism. MEL-producing microorganisms generally have a transporter (MMF1).

[0018] Gene disruption can be carried out by any method. For example, gene disruption can be carried out by a method of introducing a mutation into the base sequence of the gene, a method of disrupting or deleting the expression control region (promoter, etc.) of the gene, or a method of inhibiting the translation of the transcription product of the gene. These can be carried out using, for example, the homologous recombination method, the transposon method, the transgene method, the post-transcriptional gene silencing method, the RNAi method, the nonsense mediated decay (NMD) method, the ribozyme method, the antisense method, the miRNA (micro-RNA) method, the siRNA (small interfering RNA) method, etc.

[0019] In one embodiment, gene disruption is preferably performed using a homologous recombination method. Techniques for disrupting genes by homologous recombination are known. For example, target gene disruption by homologous recombination is a method in which a gene cassette is created by inserting a selection marker gene, such as a gene that complements drug resistance or auxotrophy, into the ORF of the target gene, and the gene cassette is incorporated into an appropriate vector (e.g., a plasmid), which is then introduced into a host microorganism (e.g., a conventional MEL-producing microorganism), and the marker gene is inserted into the target gene by homologous recombination. A microorganism in which the target gene has been disrupted can be selected by the expression of the marker gene.

[0020] The marker gene used in the homologous recombination method may be a selectable marker gene for transformants that is commonly used in genetic engineering, such as genes that confer resistance to drugs such as hygromycin, zeocin, kanamycin, chloramphenicol, and G418, and genes that complement auxotrophy such as uracil synthase, leucine synthase, adenine synthase, and lysine synthase.

[0021] In one embodiment, the target gene is preferably the MMF1 gene. Representative examples of the MMF1 gene are as follows: SEQ ID NO: 1 is a nucleotide sequence encoding a transporter (PaMMF1) derived from Pseudozyma antaractica T34 strain. SEQ ID NO: 2 is a nucleotide sequence encoding a transporter (PaMMF1) derived from Pseudozyma antaractica JCM10317 strain. SEQ ID NO: 3 is a nucleotide sequence encoding a transporter (PhMMF1) derived from Pseudozyma hubeiensis SY62 strain. SEQ ID NO: 4 is a nucleotide sequence encoding a transporter (PtMMF1) derived from Pseudozyma tsukubaensis NBRC1940 strain. SEQ ID NO: 5 is a nucleotide sequence encoding a transporter (PtMMF1) derived from Pseudozyma tsukubaensis 1E5 strain. SEQ ID NO: 6 is a nucleotide sequence encoding a transporter (MMF1) derived from Pseudozyma aphidis DSM70725 strain. Based on this sequence information, a vector for disrupting the transporter gene can be constructed. P. antarctica T-34 is also called "Moesziomyces antarcticus T-34". P. aphidis is also called "Moesziomyces aphidis".

[0022] The type of vector used for gene disruption is arbitrary and can be appropriately selected depending on the type of host. When the host is a Pseudozyma genus, examples of vectors include pUXV1 ATCC 77463, pUXV2 ATCC 77464, pUXV5 ATCC 77468, pUXV6 ATCC 77469, pUXV7 ATCC 77470, pUXV8 ATCC 77471, pUXV3 ATCC 77465, pU2X1 ATCC 77466, pU2X2 ATCC 77467, pTA2, pUXV1-neo, pPAX1-neo, pPAA1-neo (Appl Microbiol Biotechnol (2016) 100:3207-3217), pUC_neo, and pUC TExamples include _neo.

[0023] The vector can be introduced into the host cell by any method, which can be appropriately selected depending on the type of the host cell and the vector, etc. The vector can be introduced by, for example, electroporation, calcium phosphate coprecipitation method, lipofection, microinjection, lithium acetate method, etc.

[0024] The microorganism preferably produces monoacyl MEL-D in addition to monoacyl MEL-B. Such a microorganism can also be obtained by the above-mentioned transporter gene disruption. In one embodiment, the microorganism preferably produces monoacyl MEL-B, monoacyl MEL-D, and diacyl MEL-B. Such a microorganism can also be obtained by the above-mentioned transporter gene disruption.

[0025] The production of monoacyl type MEL-B, monoacyl type MEL-D, and / or diacyl type MEL-B using the above-mentioned microorganisms can be carried out by any method. For example, monoacyl type MEL-B, monoacyl type MEL-D, and / or diacyl type MEL-B can be produced by culturing the above-mentioned microorganisms in a medium suitable for culturing. Such a medium is not particularly limited, but it is preferable to use, for example, carbohydrates such as glucose, sucrose, and blackstrap molasses as the carbon source. In addition to or instead of carbohydrates, fats and oils can also be used as carbon sources. The type of fats and oils is not particularly limited, and it is preferable to add, for example, vegetable fats and oils, or fatty acids or esters thereof.

[0026] In one embodiment, it is preferable to add vegetable oil to the medium. The type of vegetable oil is not particularly limited and can be appropriately selected depending on the type of MEL of interest. Examples of the vegetable oil include soybean oil, olive oil, rapeseed oil, safflower oil, sesame oil, palm oil, sunflower oil, coconut oil, cocoa butter, and castor oil. Examples of fatty acids include caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, behenic acid, and nervonic acid. In one embodiment, the preferred fatty acid is oleic acid.

[0027] In one embodiment, a microorganism producing monoacyl MEL-B, monoacyl MEL-D, and / or diacyl MEL-B can be cultured in a medium containing only glucose as a carbon source. As the nitrogen source, an organic nitrogen source and an inorganic nitrogen source can be used in combination. For example, as the organic nitrogen source, one or more selected from the group consisting of yeast extract, malt extract, peptone, polypeptone, corn steep liquor, casamino acid, and urea can be used in combination.

[0028] The inorganic nitrogen source may be one or a combination of two or more selected from the group consisting of sodium nitrate, potassium nitrate, ammonium nitrate, ammonium sulfate, and ammonia. In another embodiment, there is provided a method for producing monoacyl type MEL-B, monoacyl type MEL-D, and / or diacyl type MEL-B, comprising culturing the above-mentioned microorganism in a medium supplemented with a fatty acid and glycerin.

[0029] The amounts of fatty acids and oils and fats are not particularly limited, but for example, each can be added so that the concentration in the medium is 0.1 to 40% by volume.

[0030] The culture conditions for the microorganism are not particularly limited. For example, the microorganism can be cultured at pH 5 to 8, preferably pH 6, at a temperature of 20 to 35° C., preferably 22 to 28° C., for 3 to 7 days.

[0031] The monoacyl MEL-B, monoacyl MEL-D, and / or diacyl MEL-B produced by the above-mentioned microorganisms can be extracted by any method. For example, the culture solution or cell lysate is centrifuged to recover the supernatant, an appropriate extraction solvent is added to the supernatant, the extraction solvent layer is recovered, and further purification is performed as necessary to obtain monoacyl MEL. In one embodiment, the extraction solvent used for extracting monoacyl MEL is preferably one or more selected from the group consisting of ethyl acetate, methanol, ethanol, acetone, and mixtures thereof.

[0032] The culture (or an extract thereof) obtained by culturing the above-mentioned microorganism is preferably a composition containing monoacyl MEL-B, a composition containing monoacyl MEL-B and monoacyl MEL-D, or a composition containing monoacyl MEL-B, monoacyl MEL-D, and diacyl MEL-B. In one embodiment, the MEL-containing composition preferably contains monoacyl MEL-B, monoacyl MEL-D, and diacyl MEL-B, and the ratio of each MEL to the total MEL is preferably about 50% by mass for monoacyl MEL-B, about 17% by mass for monoacyl MEL-D, and about 33% by mass for diacyl MEL-B. Such a MEL-containing composition (MEL mixture) can be dissolved in an aqueous solvent at a higher concentration. EXAMPLES

[0033] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0034] material ·Bacteria used Pseudozyma tsukubaensis strain 1E5 (JCM16987) Culture medium YM medium: Prepared by dissolving 3 g of yeast extract, 3 g of malt extract, 5 g of peptone, and 10 g of glucose in 1 L of deionized water. If necessary, add 20 g of agar to make an agar medium. Glycerol-added YM medium: prepared by dissolving 3 g of yeast extract, 3 g of malt extract, 5 g of peptone, 10 g of glucose, and 50 g of glycerol in 1 L of deionized water. MEL production medium: Prepared by dissolving 5 g yeast extract, 3 g sodium nitrate, 0.3 g potassium dihydrogen phosphate, 0.3 g magnesium sulfate heptahydrate, and 20 g glycerol in 1 L of deionized water. 5-FOA agar medium: Prepared by dissolving 1.7 g yeast nitrogen base w / o AA, 5 g ammonium sulfate, 20 g glucose, 0.5 g uracil, 2 g 5-FOA, and 20 g agar in 1 L of deionized water.

[0035] 1. Identification of uracil-requiring mutants A loopful of Pseudozyma tsukubaensis 1E5 strain was inoculated into 2 ml of YM medium and cultured at 25°C and 180 rpm for 24 hours with shaking. The culture was spread on a petri dish and the plate was placed 45 cm from a UV lamp (Panasonic GL15 germicidal lamp). UV was irradiated and 0.2 ml of culture was collected. The collected culture was incubated at 25°C for 3 hours and inoculated onto 5-FOA agar medium. The inoculated plate was incubated at 25°C for 10 days to grow colonies. The colonies grown on the 5-FOA agar medium were transferred to YM agar medium with a toothpick, and a portion of the bacteria was subjected to colony PCR and sequence analysis. The PCR primers used had the following base sequences: seq_PtURA3_F1: GCTGCTGTGTCCGCTGCACG (SEQ ID NO: 7) seq_PtURA3_F2: GAGATGTCGTCGGCTGGAGC (SEQ ID NO: 8) seq_PtURA5_F1: GAGTGCCGACGGTGGACGTC (SEQ ID NO: 9) seq_PtURA5_F2: CAGAACTCAAAGGTCGTGTC (SEQ ID NO: 10) Sequence analysis confirmed that the mutation was inserted into the PtURA5 gene. Furthermore, the auxotrophy test of the obtained uracil-requiring mutant confirmed that it had uracil auxotrophy and maintained MEL production ability.

[0036] 2. Obtaining a mutant with the PtMMF1 gene disrupted 2-1.Construction of PtMMF1 vector The PtMMF1 gene region (including 2 kb upstream and downstream of the gene) was amplified by PCR using the genomic DNA of Pseudozyma tsukubaensis 1E5 strain as a template. The PCR primers used had the following base sequences: PtMMF1_pUC18_IF_F: CTCTAGAGGATCCCCTTATCCACCTGCCCGTTTTAGCAC (SEQ ID NO: 11) PtMMF1_pUC18_IF_R: TCGAGCTCGGTACCCATAACCTCTGTGTTACTGACCGTGC (SEQ ID NO: 12) The amplified DNA fragment was ligated to a pUC18 vector to prepare a pUC-PtMMF1 vector.

[0037] 2-2. Construction of PtMMF1 disruption vector The PtURA5 gene fragment was obtained by amplifying the PtURA5 gene region (including 1 kb upstream and 0.5 kb downstream of the gene) using the genomic DNA of Pseudozyma tsukubaensis 1E5 strain as a template by PCR. The PCR primers used had the following base sequences: PtMMF1_URA5_IF_F: GCACAAGGACACATCCCGAAGGTCATGGTGTTCCCGGTG (SEQ ID NO: 13) PtMMF1_URA5_IF_R: AGAAGGTCATGGCATACAAGCCAGATCAAGTTCGTCATG (SEQ ID NO: 14) Next, the linearized pUC-PtMMF1 vector was amplified by PCR using the pUC-PtMMF1 vector as a template to obtain a gene fragment. The PCR primers used had the following base sequences: PtMMF1_pUC18_inverse_F: ATGCCATGACCTTCTTCCAAGTGTG (SEQ ID NO: 15) PtMMF1_pUC18_inverse_R: GATGTGTCCTTGTGCTTGCCTGAAG (SEQ ID NO: 16) The linearized pUC-PtMMF1 vector and the PtURA5 gene fragment obtained above were ligated to prepare a PtMMF1 disruption vector. Sequence analysis of the PtMMF1 disruption vector confirmed that the target fragment had been inserted. The structure of the PtMMF1 disruption vector is shown in Figure 3. In the figure, URA5-P indicates 1 kb upstream of the PtURA5 gene, and URA5-T indicates 0.5 kb downstream of the PtURA5 gene.

[0038] 2-3. Preparation of transformants The PtMMF1 disruption vector obtained in 2-2 above was linearized using restriction enzymes KpnI and XbaI, and then transformed into the uracil-requiring mutant obtained in 1 above by electroporation. Loss of uracil requirement was used to select transformants. Insertion of the target DNA fragment into the target genomic location by homologous recombination was confirmed by colony PCR and sequence analysis. The PCR primers used had the following base sequences: Primer pair A_F: TCGGTGGACTCAGCTGCTCC (SEQ ID NO: 17) Primer pair A_R: TGAATGTGTAGGCAGAGTG (SEQ ID NO: 18) Primer pair B_F: AGCTTTCCTCTCTTCAGGCAAGCAC (SEQ ID NO: 19) Primer pair B_R: ACATTTAAGGATTCTACACACTTGG (SEQ ID NO: 20) Primer pair C_F: AGAGGAGCGGACACTGAATTTTGG (SEQ ID NO: 21) Primer pair C_R: GTTCATGTGAGGGTGGTTGCCACG (SEQ ID NO: 22)

[0039] Figure 4 shows the results of colony PCR of the transformants. In the figure, ΔPtMMF1 indicates the PtMMF1-disrupted strain, and the arrows indicate the primers. In addition, in the figure, (a) shows the binding positions of the primers used in the colony PCR, (b) shows the results of colony PCR with primer pair A, (c) shows the results of colony PCR with primer pair B, and (d) shows the results of colony PCR with primer pair C. As a result of colony PCR, five mutant strains in which the PtMMF1 gene had been disrupted were obtained.

[0040] 3. Evaluation of products from PtMMF1 gene disruptants 3-1. Cultivation of the PtMMF1 gene disruptant Each of the five PtMMF1 gene disruptants was cultured in 2 mL of glycerol-supplemented YM medium at 25°C for 2 days with shaking at 250 rpm to obtain a preculture solution. Next, 1 mL of the preculture solution was inoculated into 20 mL of MEL production medium supplemented with 6% olive oil, and cultured at 25°C for 7 days with shaking at 250 rpm.

[0041] 3-2. Extraction of culture medium from PtMMF1 gene disruptant The bacterial culture obtained in 3-1 above was centrifuged at 3,000 rpm to recover the culture supernatant. The recovered supernatant was frozen at -20°C and then freeze-dried. Acetone was added to the dried supernatant, which was then stirred with a vortex mixer and allowed to stand overnight at room temperature. After standing, the acetone layer was recovered and filtered through a 0.45 μm filter to obtain the acetone extract.

[0042] 3-3. Evaluation of MEL in the extract The MEL contained in each acetone extract was analyzed by thin layer chromatography (TLC). The developing phase was chloroform:methanol:12% ammonia water = 55:25:2. After development, the TLC plate was sprayed with 2% anthrone sulfate reagent and heated at 95℃ for 5 minutes to detect MEL spots.

[0043] The results of culturing the PtMMF1 gene disruption strain are shown in Figure 5. In the figure, ΔPtMAT1 indicates the PtMAT1 disruption strain, ΔPtMAC2 indicates the PtMAC2 disruption strain, and ΔPtMMF1 indicates the PtMMF1 disruption strain. Analysis confirmed that the production of diacyl-type MEL-B was reduced in the PtMMF1 gene disruption strain, and that instead the production of monoacyl-type MEL-D and a glycolipid of unknown structure was predominant.

[0044] 4. Analysis of glycolipids with unknown structures 4-1. Analysis by high performance liquid chromatography-mass spectrometry (LC-MS) The culture of the PtMMF1 gene disruptant was extracted with acetone and the sample was analyzed by LC-MS. The analytical conditions were as follows: HPLC conditions Column: Asahipak NH2P-40-2D (manufactured by SHODEX) Mobile phase A: 10 mM ammonium formate Mobile phase B: Acetonitrile Gradient: A:B = 5:95 at the start of analysis, A:B = 60:40 at 20 minutes of analysis, A:B = 5:95 from 20.1 minutes to the end of analysis (35 minutes). Flow rate: 0.1mL / min Column temperature: 25℃ Sample injection volume: 5uL MS conditions Ionization mode: DUIS Scan range: 50-2000m / z

[0045] The results of the LC-MS analysis are shown in Figure 6. As shown in Figure 6, it was confirmed that the mass number of MEL of unknown structure produced by the PtMMF1 disruptant coincided with that of a formate ion adduct of monoacyl-type MEL-B (caprylic acid adduct).

[0046] 4-2. Analysis by Nuclear Magnetic Resonance Spectroscopy (NMR) The acetone extract was subjected to an open column using a silica gel column (Wakosil C-200, Fujifilm Wako Pure Chemical Industries, Ltd.) to purify MEL, whose structure was unknown. Chloroform and acetone were used as solvents.

[0047] 50 mg of MEL of unknown structure purified by silica gel column was dissolved in 1 mL of d4-methanol and analyzed by Bruker AVANCE 400 (400 MHz). The results of 1H-NMR and 2D NMR (COSY) are shown in Figure 7 (a) and (b). As shown in Figure 7, one signal derived from the proton of the acetyl group was detected at about 2.10 ppm, and the integral ratio with the signal at the 1st position of mannose (4.75 ppm) was 1:3, which indicated that MEL of unknown structure is monoacetyl type MEL with one acetyl group bonded. In addition, -CO CH Since the integral ratio of the 2- signal (2.43 ppm) to the mannose 1-position signal (4.75 ppm) was 1:2, the structure-unknown MEL was found to be a monoacyl-type MEL with one fatty acid chain bound thereto.

[0048] As shown in FIG. 7, the signal at mannose position 6 is shifted downfield to 4.23-4.48 ppm, and in addition, the P. tsukubaensis 1E5 strain, which is the parent strain of the PtMMF1 disruption strain, produces MEL-B in which an acetyl group is bound to mannose position 6, so the MEL with unknown structure is considered to be MEL-B. In addition, the signal at mannose position 2 is shifted downfield to 5.38-5.39 ppm, and in addition, the P. tsukubaensis 1E5 strain produces MEL-B in which a fatty acid chain is bound to mannose positions 2 and 3, so the fatty acid chain is considered to be bound to mannose position 2. From these results, it was found that the MEL with unknown structure produced by the PtMMF1 disruption strain is monoacyl type MEL-B in which one fatty acid chain is bound to mannose position 2.

[0049] 5. Measurement of surface tension of MEL mixture produced by PtMMF1 disruptant The surface activity of the MEL mixture, which was obtained by acetone extraction of the bacterial cell culture of the PtMMF1 disruptant strain and contains monoacyl MEL-B as the main component, monoacyl MEL-D, and diacyl MEL-B and diacyl MEL-D as the minor components, was evaluated. The acetone extract was subjected to an open column using a silica gel column (Wakosil C-200, Fujifilm Wako Pure Chemical Industries, Ltd.) to remove the residual oils and fatty acids in the extract. The surface tension was measured using a Dropmaster DMo-501 manufactured by Kyowa Interface Science Co., Ltd., and the surface tension of the MEL mixture at various concentrations was measured.

[0050] As shown in Figure 8, the surface tension value decreased with increasing concentration of the MEL mixture, and became constant when it reached the critical micelle concentration (CMC). From Figure 8, the CMC of the MEL mixture was 4.0 mg / mL. Based on the molecular weight of 452 of monoacyl type MEL-B (caprylic acid adduct), the main component of the MEL mixture, the CMC was calculated to be 8.88 x 10 -3 M. The γCMC was 33.1 mN / m.

[0051] The parent strain produced diacylated MEL-B with a CMC of 3.1x10 -6 It is known that the MEL mixture produced by the PtMMF1 disruptant has a CMC more than 1000 times higher than that of diacyl-type MEL-B, and even at high concentrations it disperses uniformly in water as a single MEL molecule, has improved water solubility, and can be dissolved rapidly in water. In other words, the MEL mixture produced by the PtMMF1 disruptant is easy to use in aqueous systems.

[0052] From the results shown in Figure 6, it is estimated that the MEL produced by the PtMMF1 disruptant is approximately 33% by mass diacyl MEL-B, approximately 50% by mass monoacyl MEL-B, and approximately 17% by mass monoacyl MEL-D.

Claims

1. A Pseudozyma microorganism that produces monoacyl-type MEL-B, The MMF1 gene is disrupted, A microorganism selected from the group consisting of Pseudozyma antarctica, Pseudozyma parantarctica, Pseudozyma rugulosa, Pseudozyma siamensis, Pseudozyma crassa, Pseudozyma churashimaensis, Pseudozyma aphidis, Pseudozyma hubeiensis, and Pseudozyma tsukubaensis.

2. The microorganism according to claim 1 , which further produces monoacyl MEL-D.

3. The microorganism according to claim 1 or 2, wherein the microorganism is Pseudozyma tsukubaensis.

4. A method for producing monoacyl-MEL-B using the microorganism according to any one of claims 1 to 3.

Images