Treatment of muscular dystrophy targeting the LAMA1 gene

Abstract

The present invention aims to provide a novel means for treating human muscular dystrophy (particularly MDC1A). The present invention provides a polynucleotide comprising the following base sequence: (a) a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (b) A base sequence encoding (i) a guide RNA targeting a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a guide RNA targeting a continuous region represented by SEQ ID NO: 124, or (iii) a guide RNA targeting a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene.

Description

[Technical field]

[0001] The present invention relates to a method for treating muscular dystrophy, particularly merosin-deficient congenital muscular dystrophy (MDC1A), targeting the laminin-α1 chain (LAMA1) gene, etc. More specifically, the present invention relates to a method for treating or preventing muscular dystrophy by complementing LAMA2 or its function that is deleted due to a mutation, by augmenting the expression of the human LAMA1 gene, which is not originally expressed much in muscle tissue, using a guide RNA targeting a specific sequence of the human LAMA1 gene and a fusion protein of a transcription activator and a CRISPR effector protein, and a therapeutic or preventive agent for muscular dystrophy, etc. [Background technology]

[0002] Muscular dystrophies are a general term for genetic diseases accompanied by progressive muscle atrophy and muscle weakness. At present, there are no effective drugs for treating muscular dystrophies, and only symptomatic treatments are performed. One type of muscular dystrophies is known as merosin-deficient congenital muscular dystrophy (MDC1A), an autosomal recessive disease.

[0003] MDC1A is a Western-type congenital muscular dystrophy lacking mental retardation, caused by a deficiency of merosin, a component of the skeletal muscle basement membrane. Merosin is a heterotrimer composed of laminin chains that binds to α-dystroglycan via its glycan structure, and its deficiency disrupts the connection between the cytoskeleton and the extracellular matrix via the dystrophin glycoprotein complex. It is the most common congenital muscular dystrophy in Europe and the United States (approximately 50%). It is caused by a mutation in the laminin α2 chain gene (LAMA2 gene) located at 6q22.33.

[0004] Cohn et al. 2J / dy 2JWe report a method to correct a splice site mutation leading to alteration of the LAMA2 gene in a mouse model through systemic delivery of an adeno-associated virus (AAV) carrying CRISPR / Cas9 genome editing components. 2J / dy 2J The mice showed substantial improvement in muscle histopathology and function, and no signs of paralysis were observed (Non-Patent Document 1). Bassi also showed that the LAMA1 gene may be a disease-modifying gene for MDC1A. The LAMA1 gene encodes a laminin α1 chain protein that is structurally similar to the laminin α2 chain. Specifically, experiments using mice have shown that the expression of LAMA1 can be upregulated using the CRISPR / Cas9 system of S. aureus to compensate for the deficiency of laminin α2 chain (Non-Patent Document 2, Non-Patent Document 3). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kemaladewi, DU, Maino, E., Hyatt, E., Hou, H., Ding, M., Place, KM, Zhu, X., Bassi, P., Baghestani, Z., Deshwar, AG, Merico, D., Xiong, HY, Frey, BJ, Wilson, MD, Ivakine, EA, Cohn, RD Nat Medicine. 23:8. 2017. [Non-Patent Document 2] Prabhpreet Singh Bassi, A thesis submitted in conformity with the requirements for the degree of Master of Science, Department of Molecular Genetics, University of Toronto. 2017: Assessing the Therapeutic Potential of CRISPR / Cas9-Mediated Gene Modulation in Merosin-Deficient Congenital Muscular Dystrophy Type 1A [Non-Patent Document 3] Dwi U. Kemaladewi, Prabhpreet S. Bassi, Steven erwood, Dhekra Al-Basha, Kinga I. Gawlik, Kyle Lindsay, elzbieta Hyatt, rebekah Kember, Kara M. Place, ryan M. Marks, Madeleine Durbeej, Steven A. Prescott, evgueni A. Ivakine & ronald D. Cohn, Nature 572, p125, 2019: A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene Summary of the Invention [Problem to be solved by the invention]

[0006] An object of the present invention is to provide a novel means for treating human muscular dystrophy (particularly MDC1A). [Means for solving the problem]

[0007] As a result of intensive research into the above-mentioned problems, the present inventors have found that the expression of the human LAMA1 gene can be upregulated in muscle cells by using a guide RNA targeting a specific sequence of the human LAMA1 gene (Gene ID: 284217) and a fusion protein of a transcription activator and a nuclease-deficient CRISPR effector protein. Based on these findings, the present inventors have completed the present invention.

[0008] The present invention may include the following inventions. [1] A polynucleotide comprising the following nucleotide sequence: (a) a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (b) A base sequence encoding (i) a guide RNA targeting a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a guide RNA targeting a continuous region represented by SEQ ID NO: 124, or (iii) a guide RNA targeting a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene. [2] The nucleotide sequence encoding the guide RNA is (i) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, (iii) a nucleotide sequence represented by SEQ ID NO: 178, 193, or 195; or The polynucleotide according to [1] above, which comprises a base sequence in which 1 to 3 bases have been deleted, substituted, inserted, and / or added. [3] The polynucleotide according to [1] or [2] above, wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), microVR, and mutants thereof having transcription activation ability. [4] The polynucleotide according to [3] above, wherein the transcriptional activator is miniVR. [5] The polynucleotide according to any one of [1] to [4] above, wherein the nuclease-deficient CRISPR effector protein is dCas9. [6] The polynucleotide according to [5] above, wherein dCas9 is derived from Staphylococcus aureus (Streptococcus aureus). [7] The polynucleotide according to any one of [1] to [6] above, further comprising a promoter sequence for a base sequence encoding a guide RNA and / or a promoter sequence for a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator. [8] The polynucleotide according to [7] above, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter. [9] The polynucleotide according to [8] above, wherein the promoter sequence for the base sequence encoding the guide RNA is a U6 promoter.

[10] The polynucleotide according to any one of [7] to [9] above, wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is a ubiquitous promoter or a muscle-specific promoter.

[11] The polynucleotide according to

[10] above, wherein the ubiquitous promoter is selected from the group consisting of an EFS promoter, a CMV promoter, and a CAG promoter.

[12] The polynucleotide according to

[10] above, wherein the muscle-specific promoter is selected from the group consisting of a CK8 promoter, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter, a synthetic C5-12 (Syn) promoter, and an unc45b promoter.

[13] A vector comprising the polynucleotide according to any one of [1] to

[12] above.

[14] The vector according to

[13] above, which is a plasmid vector or a viral vector.

[15] The vector described in

[14] above, wherein the viral vector is selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, and a lentiviral vector.

[16] The vector described in

[15] above, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, and AAV9 and variants thereof.

[17] A therapeutic or prophylactic agent for MDC1A, comprising the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above.

[18] A method for treating or preventing MDC1A, comprising administering to a subject in need thereof the polynucleotide described in any of [1] to

[12] above, or the vector described in any of

[13] to

[16] above.

[19] The polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above, for use in the treatment or prevention of MDC1A.

[20] Use of the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above, in the manufacture of a pharmaceutical composition for treating or preventing MDC1A.

[21] A method for upregulating expression of the human LAMA1 gene in a cell, comprising: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (d) a guide RNA targeting (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene; The method of claim 1, further comprising expressing

[22] Ribonucleoproteins, including: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (d) A guide RNA targeting (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene.

[23] A kit for upregulating the expression of the human LAMA1 gene, comprising: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) A guide RNA or a polynucleotide encoding the guide RNA that targets (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene.

[24] A method for treating or preventing MDC1A, comprising administering the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) A guide RNA or a polynucleotide encoding the guide RNA that targets (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene.

[25] Use of the following (e) and (f) in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) A guide RNA or a polynucleotide encoding the guide RNA that targets (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 in the expression control region of the human LAMA1 gene. Effect of the Invention

[0009] According to the present invention, the expression of the human LAMA1 gene can be upregulated, and as a result, it is expected that the present invention can treat MDC1A. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 shows the location of the targeted genomic regions in the human LAMA1 gene. [Diagram 2] 2 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary skeletal muscle myoblasts (HSMM cells) derived from donor #3 using sgRNA containing crRNA encoded by the targeting sequences shown in SEQ ID NOs: 1 to 16 and mini-VR. The horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Diagram 3] 3 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells derived from donor #5 using sgRNA containing crRNA encoded by the targeting sequences represented by SEQ ID NOs: 1 to 16 and mini-VR. The horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Figure 4]4 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells derived from donor #3 using sgRNA containing crRNA encoded by the targeting sequences represented by SEQ ID NOs: 10, 11, 15, and 17 to 61 and mini-VR. The horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Diagram 5] 5 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells derived from donor #3 using sgRNA containing crRNA encoded by a targeting sequence located in the R1 or R2 region and mini-VR. The horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Figure 6] 6 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells (derived from donors #3, #121, #368, and #617) using sgRNAs containing crRNAs encoded by the targeting sequences represented by SEQ ID NOs: 130 to 221 and mini-VR. The horizontal axis shows sgRNAs containing crRNAs encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Figure 7A]7A shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells (derived from donors #3 and #121) using sgRNAs (sgLAMA1-155, sgLAMA1-170, sgLAMA-172) containing crRNA encoded by the targeting sequence represented by SEQ ID NO: 178, 193, or 195 and mini-VR. The horizontal axis indicates each condition, and the vertical axis indicates the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. The experiment was repeated three times, and the average value and SD are shown. [Figure 7B] FIG. 7B shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells (derived from donors #368 and #617) using sgRNAs (sgLAMA1-155, sgLAMA1-170, sgLAMA-172) containing crRNA encoded by the targeting sequence represented by SEQ ID NO: 178, 193, or 195 and mini-VR. The horizontal axis indicates each condition, and the vertical axis indicates the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. The experiment was repeated three times, and the average value and SD are shown. [Figure 8] 8 shows the results of evaluating the expression level of the human LAMA1 gene in primary HSMM cells (derived from donors #3, #121, #368, and #617). The horizontal axis indicates donor number, and the vertical axis indicates the expression level when HPRT control was used. [Figure 9] 9 shows the results of evaluating the expression enhancing effect on the human LAMA1 gene in primary HSMM cells (derived from donor #3) using sgRNAs (sgLAMA1-155, sgLAMA1-170, sgLAMA-172) containing crRNA encoded by the targeting sequence represented by SEQ ID NO: 178, 193, or 195 and various activating moieties. The horizontal axis indicates each condition, and the vertical axis indicates the ratio of the expression level of the LAMA1 gene when each sgRNA is used to the expression level of the LAMA1 gene when the control sgRNA is used, which is set to 1. [Figure 10] Figure 10 shows the results of evaluating the expression enhancement effect of the human LAMA1 gene at the protein level in primary HSMM cells (derived from donors #3 and #617) using sgRNA containing crRNA encoded by a targeting sequence represented by sequence number 178, 193, or 195 and microVR. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Hereinafter, an embodiment of the present invention will be described in detail.

[0012] 1. Polynucleotides The present invention provides a polynucleotide (hereinafter, also referred to as "polynucleotide of the present invention") comprising the following base sequence: (a) a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (b) In the expression control region of the human LAMA1 gene, (i) a guide RNA targeting a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a guide RNA targeting the continuous region represented by SEQ ID NO: 124, or (iii) a guide RNA targeting the continuous region represented by SEQ ID NO: 178, 193, or 195 A base sequence encoding The polynucleotide of the present invention is introduced into a desired cell and transcribed to generate a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and a guide RNA that targets a specific region in the expression control region of the human LAMA1 gene. The fusion protein and the guide RNA form a complex (hereinafter, the complex may be referred to as "ribonucleoprotein (RNP)") and act cooperatively on the specific region to activate the transcription of the human LAMA1 gene.

[0013] (1) Definition As used herein, the term "expression control region of the human laminin-α1 chain (LAMA1) gene" refers to any region in which the expression of the human LAMA1 gene can be activated by RNP binding to that region. In other words, the expression control region of the human LAMA1 gene may be present in any region of the human LAMA1 gene, such as the promoter region, enhancer region, intron, or exon, as long as the expression of the human LAMA1 gene is activated by RNP binding. In the present specification, when an expression control region is represented by a certain sequence, the expression control region is a concept that includes both the sense strand sequence and the antisense strand sequence. In the present invention, a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is recruited to a specific region in the expression control region of the human LAMA1 gene by a guide RNA. As used herein, a "guide RNA targeting ~" refers to a "guide RNA that recruits a fusion protein to ~". As used herein, "guide RNA (sometimes referred to as "gRNA")" refers to an RNA that contains a genome-specific CRISPR-RNA (referred to as "crRNA"). The crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described below). When Cpf1 is used as a CRISPR effector protein, the "guide RNA" refers to an RNA that contains an RNA consisting of crRNA and a specific sequence attached to its 5' end (for example, in the case of FnCpf1, the RNA sequence represented by SEQ ID NO: 65). When Cas9 is used as a CRISPR effector protein, the "guide RNA" refers to a chimeric RNA (referred to as "single guide RNA (sgRNA)") that contains crRNA and a trans-activating crRNA (referred to as "tracrRNA") linked to its 3' end. (See, e.g., Zhang F. et al., Hum Mol Genet. 2014 Sep 15;23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, the contents of which are incorporated by reference in their entireties.) As used herein, a complementary sequence to a sequence to which crRNA binds in the expression control region of the human LAMA1 gene is referred to as a "targeting sequence." That is, as used herein, a "targeting sequence" is a DNA sequence that is present in the expression control region of the human LAMA1 gene and is adjacent to a PAM (protospacer adjacent motif). When Cpf1 is used as the CRISPR effector protein, the PAM is adjacent to the 5' side of the targeting sequence. When Cas9 is used as the CRISPR effector protein, the PAM is adjacent to the 3' side of the targeting sequence. The targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the expression control region of the human LAMA1 gene (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15;23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22;163(3):759-71, the contents of which are incorporated herein by reference in their entireties).

[0014] (2) Nuclease-deficient CRISPR effector protein In the present invention, a nuclease-deficient CRISPR effector protein is used to recruit a transcription activator fused thereto to the expression control region of the human LAMA1 gene. The nuclease-deficient CRISPR effector protein used in the present invention (hereinafter simply referred to as "CRISPR effector protein") is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression control region of the human LAMA1 gene, and examples thereof include nuclease-deficient Cas9 (hereinafter also referred to as "dCas9") or nuclease-deficient Cpf1 (hereinafter also referred to as "dCpf1"). Examples of the dCas9 include, but are not limited to, nuclease-deficient mutants of Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence: NGG (N is A, G, T, or C; the same applies below)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence: NNAGAAW (W is A or T; the same applies below)), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence: NNNNGATT), or Cas9 derived from Staphylococcus aureus (SaCas9; PAM sequence: NNGRRT (R is A or G; the same applies below)), etc. (e.g., Nishimasu et al., Cell. 2014 Feb 27; 156(5): 935-49, Esvelt KM et al., Nat Methods. 2013 Nov;10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct 15;60(2):242-55, and Friedland AE et al., Genome Biol. 2015 Nov 24;16:257, the entire contents of which are incorporated herein by reference. For example, in the case of SpCas9, a double mutant (sometimes referred to as "dSpCas9") in which the 10th Asp residue is converted to an Ala residue and the 840th His residue is converted to an Ala residue can be used (see, for example, Nishimasu et al., Cell. 2014, supra).Alternatively, in the case of SaCas9, a double mutant in which the 10th Asp residue is converted to an Ala residue and the 580th Asn residue is converted to an Ala residue (SEQ ID NO: 66), or a double mutant in which the 10th Asp residue is converted to an Ala residue and the 557th His residue is converted to an Ala residue (SEQ ID NO: 67) (hereinafter, either double mutant may be referred to as "dSaCas9") can be used (see, for example, Friedland AE et al., Genome Biol. 2015, supra, the contents of which are incorporated herein by reference in their entireties). In one embodiment of the present invention, dCas9 may be a variant in which a part of the amino acid sequence of the dCas9 is further modified, and the variant may form a complex with gRNA and be recruited to the expression control region of the human LAMA1 gene. Examples of such variants include truncated variants in which a part of the amino acid sequence is deleted. In one embodiment of the present invention, dCas9 may be a variant disclosed in U.S. Provisional Patent Applications 62 / 682,244 and 62 / 749,855 (the entire contents of which are incorporated herein by reference). Specifically, dSaCas9 (SEQ ID NO: 68), a double mutant in which the 10th Asp residue is converted to an Ala residue and the 580th Asn residue is converted to an Ala residue, may be used, in which the 721st to 745th amino acids of dSaCas9 have been deleted, or the deleted portion has been replaced with a peptide linker (for example, SEQ ID NO: 70 shows the deleted portion replaced with a GGSGGS linker (SEQ ID NO: 69)), or dSaCas9 (SEQ ID NO: 71), the double mutant in which the 482nd to 648th amino acids of dSaCas9 have been deleted, or the deleted portion has been replaced with a peptide linker (SEQ ID NO: 72 shows the deleted portion replaced with a GGSGGS linker). Examples of the dCpf1 include, but are not limited to, nuclease-deficient mutants of Cpf1 (FnCpf1; PAM sequence: NTT) derived from Francisella novicida, Cpf1 (AsCpf1; PAM sequence: NTTT) derived from Acidaminococcus sp., or Cpf1 (LbCpf1; PAM sequence: NTTT) derived from Lachnospiraceae bacterium (see, for example, Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, Yamano T et al., Cell. 2016 May 5; 165(4): 949-62, and Yamano T et al., Mol Cell. 2017 Aug 2018). 17;67(4):633-45, the entire contents of which are incorporated herein by reference). For example, in the case of FnCpf1, a double mutant in which the 917th Asp residue is converted to an Ala residue and the 1006th Glu residue is converted to an Ala residue can be used (for example, see Zetsche B et al., Cell. 2015, supra, the entire contents of which are incorporated herein by reference). In one embodiment of the present invention, a variant in which a part of the amino acid sequence of the dCpf1 is modified and which forms a complex with gRNA and is recruited to the expression control region of the human LAMA1 gene may be used as dCpf1. In one embodiment of the present invention, dCas9 is used as the CRISPR effector protein, and in a particular embodiment, dSaCa9 is used. A polynucleotide containing a base sequence encoding a CRISPR effector protein can be cloned, for example, by synthesizing an oligo DNA primer so as to cover a region encoding a desired portion of the protein based on the cDNA sequence information, and amplifying the polynucleotide by PCR using total RNA or an mRNA fraction prepared from a cell producing the protein as a template. A polynucleotide containing a base sequence encoding a CRISPR effector protein can also be obtained by introducing a mutation into the nucleotide sequence encoding the cloned CRISPR effector protein so that amino acid residues at sites important for DNA cleavage activity (for example, in the case of SaCas9, the 10th Asp residue, the 557th His residue, and the 580th Asn residue; in the case of FnCpf1, the 917th Asp residue and the 1006th Glu residue, etc., are converted to other amino acids, using a known site-directed mutagenesis method. Alternatively, a polynucleotide containing a base sequence encoding a CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR or Gibson Assembly based on the cDNA sequence information, and can also be constructed as a base sequence that has been codon-optimized to use codons suitable for expression in humans.

[0015] (3) Transcriptional activators In the present invention, activation of human LAMA1 gene expression is achieved by the action of a transcription activator fused to a CRISPR effector protein. In this specification, the term "transcription activator" refers to a protein having transcription activation ability of the human LAMA1 gene or a peptide fragment that retains its function. The transcription activator used in the present invention is not particularly limited as long as it can activate the expression of the human LAMA1 gene, and includes, for example, VP64, VP160, VPH, VPR, miniVR, and microVR, as well as variants thereof having transcription activation ability. VP64 is exemplified by a peptide consisting of 50 amino acids represented by SEQ ID NO: 73. VP160 is exemplified by a peptide consisting of 131 amino acids represented by SEQ ID NO: 84. VPH is a fusion protein of VP64, p65, and HSF1, and is specifically exemplified by a peptide consisting of 376 amino acids represented by SEQ ID NO: 74. VPR is a fusion protein of VP64, p65, and Epstein-Barr virus replication and transcription activator (RTA), specifically exemplified by a peptide consisting of 523 amino acids represented by SEQ ID NO: 75. VP64, VPH, and VPR are known and are disclosed in detail in, for example, Chavez A. et al., Nat Methods. 2016 Jul;13(7):563-7 and Chavez A. et al., Nat Methods. 2015 Apr;12(4):326-8 (the entire contents of which are incorporated herein by reference). miniVR and microVR are peptides containing the transcription activation domains of VP64 and RTA. The transcription activation domain of RTA is known and is disclosed in, for example, J Virol. 1992 Sep;66(9):5500-8, the entire contents of which are incorporated herein by reference. Specifically, miniVR is exemplified by a peptide consisting of 167 amino acids represented by SEQ ID NO:76, and microVR is exemplified by a peptide consisting of 140 amino acids represented by SEQ ID NO:77.The amino acid sequence represented by SEQ ID NO: 76 consists of an amino acid sequence in which amino acid residues at positions 493 to 605 of RTA and VP64 are linked via a GSGS linker (SEQ ID NO: 78). The amino acid sequence represented by SEQ ID NO: 77 consists of an amino acid sequence in which amino acid residues at positions 520 to 605 of RTA and VP64 are linked via a GSGS linker. Details of miniVR and microVR are described in U.S. Provisional Patent Application No. 62 / 715,432, the entire contents of which are incorporated herein by reference. Any of the above-mentioned transcriptional activators may be modified and / or altered as long as they maintain their transcriptional activation ability. A polynucleotide containing a nucleotide sequence encoding a transcriptional activator can be constructed by chemical synthesis or by a combination of chemical synthesis and PCR or Gibson assembly. Furthermore, a polynucleotide containing a nucleotide sequence encoding a transcriptional activator can be constructed as a DNA sequence that has been codon-optimized to be suitable for expression in humans. A polynucleotide containing a base sequence encoding a fusion protein of a transcription activator and a CRISPR effector protein can be prepared by ligating a base sequence encoding a transcription activator directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal), and / or tag to a base sequence encoding a transcription activator. In the present invention, the transcription activator may be fused to either the N-terminus or the C-terminus. In addition, as the linker, a linker having about 2 to 50 amino acids can be used, and specifically, a GSGS linker in which glycine (G) and serine (S) are alternately linked is exemplified, but is not limited to these.

[0016] (4) Guide RNA In the present invention, the recruitment of a fusion protein of a CRISPR effector protein and a transcription activator to the expression control region of the human LAMA1 gene is achieved by a guide RNA. As described in the above section "(1) Definition", the guide RNA includes a crRNA, which binds to a complementary sequence of a targeting sequence. As long as the guide RNA can recruit the fusion protein to a target region, the crRNA does not have to be completely complementary to the complementary sequence of the targeting sequence, and may be a sequence in which at least 1 to 3 bases are deleted, substituted, inserted, and / or added. For example, when dCas9 is used as a CRISPR effector protein, the targeting sequence can be set using a publicly available gRNA design website (CRISPR Design Tool, CRISPR direct, etc.). Specifically, from among the sequences of the target gene (i.e., human LAMA1 gene), a list of candidate targeting sequences of about 20 nucleotides in length adjacent to the 3' side of PAM (e.g., in the case of SaCas9, NNGRRT) is made, and from among these candidate targeting sequences, those with a small number of off-target sites in the human genome can be used as the targeting sequence. The base length of the targeting sequence is 18 to 24 nucleotides, preferably 20 to 23 nucleotides, more preferably 21 to 23 nucleotides. As a primary screening for predicting the number of off-target sites, numerous bioinformatics tools are publicly known and available to the public, and can be used to predict the targeting sequence with the smallest off-target effect. Examples of bioinformatics tools include Benchling (https: / / benchling.com) and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (available on the Internet at https: / / crispr.bme.gatech.edu), which can summarize the similarity of the gRNA to the nucleotide sequence targeted by the gRNA. If the gRNA design software used does not have the function to search for off-target sites in the target genome, off-target sites can be searched for, for example, by performing a Blast search against the target genome for 8 to 12 nucleotides on the 3' side of the candidate targeting sequence (a seed sequence with high discriminatory ability for the target nucleotide sequence). In one embodiment of the present invention, the following regions present at position GRCh38.p13 of human chromosome 18 (Chr18) may be expression control regions of the human LAMA1 gene. These regions are strongly suggested to be expression control regions based on their histone modification patterns. Thus, in one embodiment of the present invention, the targeting sequence may be a base sequence of 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, and more preferably 21 to 23 nucleotides in length, located in at least one of the following regions present at position GRCh38.p13 of human chromosome 18 (Chr18): (1) 7,115,000-7,118,000. In one embodiment of the present invention, the targeting sequence may be a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61. In one embodiment of the invention, the targeting sequence can be 18-24 nucleotides in length, preferably 20-23 nucleotides in length, more preferably 21-23 nucleotides in length, located in at least one of the following regions present on human chromosome 18 (Chr18) at position GRCh38.p13: (2) 7,036,000-7,042,000. (3) 7,083,000-7,087,000 In one embodiment of the present invention, the targeting sequence may be the base sequence represented by SEQ ID NO:124. In one embodiment of the invention, the targeting sequence can be 18-24 nucleotides in length, preferably 20-23 nucleotides in length, more preferably 21-23 nucleotides in length, located in at least one of the following regions present on human chromosome 18 (Chr18) at position GRCh38.p13: (4) 7,118,000-7,133,000 In one embodiment of the present invention, the targeting sequence may be a nucleotide sequence represented by SEQ ID NO: 178, 193, or 195. In one embodiment of the present invention, the nucleotide sequence encoding the crRNA may be the same as the targeting sequence. For example, when the targeting sequence represented by SEQ ID NO: 15 (TCTCGCCTCCGCCGCCACTCG) is introduced into a cell as a nucleotide sequence encoding the crRNA, the crRNA transcribed from the sequence becomes UCUCGCCUCCGCCGCCACUCG (SEQ ID NO: 79), and binds to CGAGTGGCGGCGGAGGCGAGA (SEQ ID NO: 80), which is a complementary sequence of the nucleotide sequence represented by SEQ ID NO: 15, present in the expression control region of the human LAMA1 gene. In another embodiment, the nucleotide sequence encoding the crRNA may be a nucleotide sequence in which at least 1 to 3 nucleotides are deleted, substituted, inserted, and / or added to the targeting sequence, as long as the guide RNA can recruit the fusion protein to the region targeted by the fusion protein. Thus, in one embodiment of the present invention, the nucleotide sequence encoding crRNA may be the nucleotide sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61, or such a nucleotide sequence with 1-3 bases deleted, substituted, inserted, and / or added. In another embodiment of the present invention, the nucleotide sequence encoding crRNA may be the nucleotide sequence represented by SEQ ID NO: 124, or such a nucleotide sequence with 1-3 bases deleted, substituted, inserted, and / or added. In yet another embodiment of the present invention, the nucleotide sequence encoding crRNA may be the nucleotide sequence represented by SEQ ID NO: 178, 193, or 195, or such a nucleotide sequence with 1-3 bases deleted, substituted, inserted, and / or added. When dCpf1 is used as the CRISPR effector protein, the base sequence encoding the gRNA can be designed as a DNA sequence encoding a crRNA with a specific RNA attached to the 5' end. The RNA attached to the 5' end of such a crRNA and the DNA sequence encoding the RNA can be appropriately selected by those skilled in the art depending on the dCpf1 used. For example, when dFnCpf1 is used, the base sequence encoding the gRNA can be selected from the following: SEQ ID NO: 81;AATT on the 5' side of the targeting sequence. TCTAC T.G.T.T. GTAGA A base sequence with a T can be used (when transcribed into RNA, the underlined sequences form base pairs to form a stem-loop structure). Such a sequence added to the 5' end may be a sequence in which at least 1 to 6 bases have been deleted, substituted, inserted, and / or added to a sequence commonly used for various Cpf1 proteins, as long as the gRNA can recruit the fusion protein to the expression control region after transcription. In addition, when dCas9 is used as a CRISPR effector protein, the base sequence encoding the gRNA can be designed as a DNA sequence in which a DNA sequence encoding a known tracrRNA is linked to the 3' end of the DNA sequence encoding the crRNA. Such tracrRNA and the DNA sequence encoding the tracrRNA can be appropriately selected by those skilled in the art depending on the dCas9 used. For example, when dSaCas9 is used, the base sequence represented by SEQ ID NO: 82 is used as the DNA sequence encoding the tracrRNA. The DNA sequence encoding the tracrRNA may be a sequence in which at least 1 to 6 bases are deleted, substituted, inserted, and / or added to the base sequence encoding the tracrRNA commonly used for various Cas9 proteins, as long as the gRNA can recruit the fusion protein to the expression control region after transcription. A polynucleotide containing a base sequence encoding such a designed gRNA can be chemically synthesized using a known DNA synthesis method. In another embodiment of the present invention, the polynucleotide of the present invention may comprise two or more gRNAs with different crRNAs.

[0017] (5) Promoter sequence In one embodiment of the present invention, a promoter sequence may be operably linked to the upstream portion of each of the base sequence encoding the fusion protein of the CRISPR effector protein and the transcription activator and / or the base sequence encoding the gRNA. The promoter that can be linked is not particularly limited as long as it has promoter activity in the target cell. For example, promoter sequences that can be linked upstream of the base sequence encoding the fusion protein include, but are not limited to, the EFS promoter, the CMV (cytomegalovirus) promoter, the CK8 promoter, the MHC promoter, the MYOD promoter, the hTERT promoter, the SRα promoter, the SV40 promoter, the LTR promoter, the CAG promoter, and the Rous sarcoma virus (RSV) promoter. Promoter sequences that can be linked upstream of the base sequence encoding the gRNA include, but are not limited to, the U6 promoter, the SNR6 promoter, the SNR52 promoter, the SCR1 promoter, the RPR1 promoter, the U3 promoter, the H1 promoter, and the tRNA promoter, which are pol III promoters. In one embodiment of the present invention, a muscle-specific promoter can be used as the promoter sequence that can be linked upstream of the base sequence encoding the fusion protein.Examples of such muscle-specific promoters include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac troponin C promoter, α-actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, dMCK promoter, tMCK promoter, enh348MCK promoter, synthetic C5-12 (Syn) promoter, unc45b promoter, Myf5 promoter, MLC1 / 3f promoter, MYOD promoter, Myog promoter, Pax7 promoter, and the like (for details of muscle-specific promoters, see, for example, US2011 / 0212529A, McCarthy JJ et al., Skeletal Muscle. 2012 May; 2(1): 8, and Wang B. et al., Gene Ther. 2008 Nov; 15(22): 1489-99, the contents of which are incorporated herein by reference in their entireties).

[0018] (6) Other base sequences Furthermore, the polynucleotide of the present invention may further contain known sequences such as a polyadenylation signal, a Kozak consensus sequence, etc., for the purpose of improving the translation efficiency of mRNA generated by transcription of a nucleotide sequence encoding a fusion protein of a CRISPR effector protein and a transcription activator. The polynucleotide of the present invention may also contain a nucleotide sequence encoding a linker sequence, a nucleotide sequence encoding an NLS, and / or a nucleotide sequence encoding a tag.

[0019] 2. Vector The present invention provides a vector comprising the polynucleotide of the present invention (hereinafter, may be referred to as "the vector of the present invention"). The vector of the present invention may be a plasmid vector or a viral vector. When the vector of the present invention is a plasmid vector, the plasmid vector used is not particularly limited and may be any plasmid vector such as a cloning plasmid vector, an expression plasmid vector, etc. The plasmid vector is prepared by inserting the polynucleotide of the present invention into the plasmid vector using a known method. When the vector of the present invention is a viral vector, the viral vector used may include, but is not limited to, an adenoviral vector, an adeno-associated viral (AAV) vector, a lentiviral vector, a retroviral vector, a Sendai viral vector, and the like. In this specification, the term "viral vector" or "viral vector" also includes derivatives thereof. Considering the use in gene therapy, an AAV vector is preferably used because it can express an introduced gene for a long period of time and is highly safe because it is derived from a non-pathogenic virus. The viral vector containing the polynucleotide of the present invention can be prepared by a known method. Briefly, a plasmid vector for viral expression into which the polynucleotide of the present invention is inserted is prepared, and the vector is transfected into an appropriate host cell to transiently produce the viral vector containing the polynucleotide of the present invention, and the viral vector is then recovered. In one embodiment of the present invention, when an AAV vector is used, the serotype of the AAV vector is not particularly limited as long as it can activate the expression of the human LAMA1 gene in a subject, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and derivatives may be used (for various serotypes of AAV, see WO2005 / 033321, the contents of which are incorporated herein by reference in their entirety). Examples of derivatives of AAV include, but are not limited to, novel capsid-modified serotypes (e.g., WO2012 / 057363, the contents of which are incorporated herein by reference in their entirety). In one example of preparing an AAV vector, first, a vector plasmid is prepared containing the inverted terminal repeats (ITRs) at both ends of the genome sequence of wild-type AAV and the polynucleotide of the present invention inserted in place of DNA encoding the Rep protein and the capsid protein. Meanwhile, DNA encoding the Rep protein and the capsid protein required for the formation of virus particles is inserted into another plasmid. Furthermore, a plasmid containing genes (E1A, E1B, E2A, VA, and E4orf6) that perform the adenovirus helper function required for the proliferation of AAV is prepared as an adenovirus helper plasmid. By cotransfecting these three types of plasmids into a host cell, a recombinant AAV (i.e., an AAV vector) is produced in the cell. As the host cell, it is preferable to use cells (e.g., 293 cells, etc.) that can supply a part of the gene product (protein) of the gene that performs the helper function, and when such a cell is used, it is not necessary to load a gene encoding a protein that can be supplied by the host cell into the adenovirus helper plasmid. Since the produced AAV vector is present in the nucleus, the virus is recovered by disrupting the host cells by freezing and thawing, and the viral fraction is separated and purified by density gradient ultracentrifugation using cesium chloride or column methods, etc., to prepare the desired AAV vector. AAV vectors have great advantages in terms of safety and gene transfer efficiency, and are used in gene therapy. However, it is known that the size of the polynucleotide that can be loaded into an AAV vector is limited. For example, the base length of the polynucleotide containing the base sequence encoding the fusion protein of dSaCas9 and miniVR or microVR, the base sequence encoding the gRNA targeting the expression control region of the human LAMA1 gene, and the EFS promoter sequence and U6 promoter sequence as promoter sequences, which is one embodiment of the present invention, and the ITR portion, is about 4.85 kb, so it can be loaded into a single AAV vector.

[0020] 3. MDC1A treatment or prevention agent The present invention also provides an agent for treating or preventing MDC1A (hereinafter sometimes referred to as "the agent of the present invention"), which comprises the polynucleotide of the present invention or the vector of the present invention. The agent of the present invention contains the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and can be prepared as a formulation containing such an active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, usually, a pharma- ceutical acceptable carrier. The agent of the present invention may be administered parenterally and locally or systemically. For example, but not limited to, the agent of the present invention may be administered intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly. The amount of the agent of the present invention administered to a subject is not particularly limited as long as it is an effective amount for treatment and / or prevention, and may be appropriately optimized depending on the active ingredient, dosage form, age and weight of the subject, administration schedule, administration method, etc. In one embodiment of the present invention, the agent of the present invention can be administered prophylactically not only to subjects suffering from MDC1A, but also to subjects who may develop MDC1A in the future based on genetic background analysis or the like. In addition, the term "treatment" in this specification can include remission of a disease in addition to cure of the disease. In addition, the term "prevention" can include delaying the onset of a disease in addition to preventing the onset of the disease. The agent of the present invention can also be referred to as the "pharmaceutical composition of the present invention" or the like.

[0021] 4. Method for treating or preventing MDC1A The present invention also provides a method for treating or preventing MDC1A (hereinafter, sometimes referred to as "the method of the present invention"), which comprises administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof. The present invention also includes the polynucleotide of the present invention or the vector of the present invention for use in treating or preventing MDC1A. Furthermore, the present invention includes the use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for treating or preventing MDC1A. The method of the present invention can be carried out by administering the agent of the present invention described above to a subject suffering from MDC1A, and the dosage, administration route, subject, etc. are the same as those described above. Symptoms may be measured prior to the initiation of treatment using the methods of the invention, and may also be measured at any time following treatment to determine the subject's response to treatment. The method of the present invention can improve the function of skeletal muscles and / or cardiac muscles of a subject. The muscle whose function can be improved is not particularly limited, and any muscle or muscle group is exemplified.

[0022] 5. Ribonucleoproteins The present invention provides a ribonucleoprotein (hereinafter, sometimes referred to as "RNP of the present invention") comprising: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (d) In the expression control region of the human LAMA1 gene, (i) a continuous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a continuous region represented by SEQ ID NO: 124, or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195 A guide RNA that targets The CRISPR effector protein, transcription activator, and guide RNA contained in the RNP of the present invention can be the CRISPR effector protein, transcription activator, and guide RNA described in detail in the above section "1. Polynucleotide". The fusion protein of the CRISPR effector protein and transcription activator contained in the RNP of the present invention can be produced, for example, by introducing a polynucleotide encoding the fusion protein into a cell, a bacterium, or other organism and expressing it, or by using the polynucleotide in an in vitro translation system. The guide RNA contained in the RNP of the present invention can be produced, for example, by chemical synthesis, or by using a polynucleotide encoding the guide RNA in an in vitro translation system. The RNP of the present invention can be prepared by mixing the CRISPR effector protein and guide RNA thus produced. If necessary, other substances such as gold particles may be mixed. In order to directly deliver the RNP of the present invention to target cells, tissues, etc., the RNP may be encapsulated in lipid nanoparticles (LNPs) by a known method. The RNP of the present invention can be introduced into target cells, tissues, etc. by a known method. For methods of encapsulation and introduction into LNPs, see, for example, Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, and WO 2016 / 153012 (the contents of which are incorporated by reference in their entirety into this specification). In one embodiment of the present invention, the guide RNA included in the RNP of the present invention targets a contiguous region of 18 to 24 nucleotides, preferably 20 to 23 nucleotides, more preferably 21 to 23 nucleotides, in at least one of the following regions located at position GRCh38.p13 of human chromosome 18 (Chr18): (1) 7,115,000-7,118,000. In one embodiment, the guide RNA targets a region including all or part of the sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61. (2) 7,036,000-7,042,000. (3) 7,083,000-7,087,000 In one embodiment, the guide RNA targets a region including all or part of the sequence represented by SEQ ID NO:124. (4) 7,118,000-7,133,000. In one embodiment, the guide RNA targets a region including all or part of the sequence represented by SEQ ID NO: 178, 193, or 195.

[0023] 6.Other The present invention also provides a composition or kit for activating expression of the human LAMA1 gene, comprising: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) In the expression control region of the human LAMA1 gene, (i) a contiguous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a contiguous region represented by SEQ ID NO: 124; or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195; A guide RNA targeting a gene or a polynucleotide encoding the guide RNA. The present invention also provides a method for treating or preventing MDC1A, comprising administering (e) and (f) below: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) In the expression control region of the human LAMA1 gene, (i) a contiguous region represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a contiguous region represented by SEQ ID NO: 124; or (iii) a continuous region represented by SEQ ID NO: 178, 193, or 195; A guide RNA targeting a gene or a polynucleotide encoding the guide RNA. The CRISPR effector protein, transcription activator, guide RNA, and the polynucleotides encoding them and the vectors carrying them used in these inventions can be those described in detail in the above sections "1. Polynucleotides," "2. Vectors," and "5. Ribonucleoproteins." The dosage, administration route, subjects, formulations, etc. of (e) and (f) above are the same as those described in the section "3. Treatment or prophylaxis of MDC1A."

[0024] Other features of the present invention will become apparent from the following description of exemplary embodiments given by way of illustration of the invention and are not intended to be limiting thereof. EXAMPLES

[0025] Experimental Method Selection of LAMA1 targeting sequence Based on the genomic H3K4me3 and H3K27Ac patterns in human skeletal muscle cells, we further scanned the putative gene control regions (R1 and R2) of the two human LAMA1 genes for sequences targeted by catalytically inactive SaCas9 (D10A and N580A mutants; dSaCas9) complexed with gRNA, defined herein as targeting sequences. The location of the targeted genomic regions relative to the LAMA1 gene is shown in Figure 1, with the coordinates given below: 1.Chr18:GRCh38 / hg38;7,036,000-7,042,000->~6kb(R1) 2.Chr18:GRCh38 / hg38;7,083,000-7,087,000->~4kb(R2)

[0026] The targeting sequence was specified as a 21 nucleotide segment (5'-21nt targeting sequence-NNGRRT-3') adjacent to a protospacer adjacent motif (PAM) with the sequence NNGRRT (Table 1).

[0027] In addition, we scanned a region approximately 15 kb upstream of the human LAMA1 TSS site and selected only those that perfectly matched the corresponding region in the cynomolgus monkey (Macaca fascicularis) genome (targeting and PAM sequences). The location of the target genomic region relative to the LAMA1 gene is shown in Figure 1, and its coordinates are shown below. Chr18:GRCh38 / hg38;7,118,000-7,133,000->~15kb(cyno-match)

[0028] Table 1. Targeting sequences used for screening the expression control region of the LAMA1 gene

[0029] [Table 1-1]

[0030] [Table 1-2]

[0031] [Table 1-3]

[0032] [Table 1-4]

[0033] [Table 1-5]

[0034] [Table 1-6]

[0035] [Table 1-7]

[0036] [Table 1-8]

[0037] In Table 1, "Position" indicates the potential cleavage sites of SaCas9 for all indicated gRNAs when SaCas9 is used. SEQ ID NOs: 1 to 61 are located in the TSS region, SEQ ID NOs: 85 to 113 are located in the R1 region, SEQ ID NOs: 114 to 129 are located in the R2 region, and SEQ ID NOs: 130 to 221 are located in the cyno-match region (FIG. 1).

[0038] Construction of lentiviral transfer plasmids (pED176 and derived plasmids) pLentiCRISPR v2 was purchased from Genscript (https: / / www.genscript.com) with the following modifications: the SpCas9 gRNA scaffold sequence was replaced with the SaCas9 gRNA scaffold sequence; the SpCas9-FLAG was replaced with dSaCas9 fused to the codon-optimized VP64-miniRTA (also called miniVR). The transcription activation domain of VP64-MiniRTA can activate gene expression by activating transcription when localized to a promoter. VP64-MiniRTA is bound to the C-terminus of dSaCas9 (D10A and N580A mutants) (hereafter called dSaCas9-VR), and is targeted to the regulatory region of the human LAMA1 gene as directed by the targeting sequence (Table 1, Figure 1). The prepared backbone plasmid was named pED176. Derivative plasmids were also prepared in which mini-VR was replaced with other activation domains, VP64-EBNA2, VP160, VP64-nanoRTA, and VP64-microRTA.

[0039] gRNA cloning Three control non-targeting targeting sequences and 164 targeting sequences (Table 1) were cloned into pED176. Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format; forward; 5'CACC(G)-20 base pair targeting sequence-3', and reverse; 5'AAAC-19 to 21 base pair reverse complementary targeting sequence-(C)-3' (bases in brackets were added if the target did not start with G). Oligos were resuspended at 100 μM in Tris-EDTA buffer (pH 8.0). 1 μl of each complementary oligo was combined in NE Buffer 3.1 (NEB catalog number: B7203S) to a 10 μl reaction. The reaction was heated to 95°C and cooled to 25°C in a thermocycler to anneal oligos with sticky overhangs compatible for cloning into pED176. The annealed oligos were combined with BsmBI-digested and gel-purified lentiviral transfer plasmid pED176 and ligated with T4 DNA ligase (NEB catalog number: M0202S) according to the manufacturer's protocol. 2 μl of the ligation reaction was transformed into 10 μl of NEB Stable Competent cells (NEB catalog number: C3040I) according to the manufacturer's protocol. The resulting construct drives the expression of sgRNAs, including crRNAs encoded by individual targeting sequences fused to tracrRNA (SEQ ID NO: 83), driven by the U6 promoter.

[0040] Lentivirus preparation Growth of HEK293TA cells to 0.75x10 cells in 6-well cell culture dishes (VWR catalog number: 10062-892) 6Cells / well were seeded and cultured in 2 ml growth medium (DMEM medium supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate, and non-essential amino acids) at 37°C / 5% CO2 for 24 h. The next day, TransIT-VirusGEN transfection reactions were set up according to the manufacturer's protocol with 1.5 μg of packaging plasmid mix [1 μg of packaging plasmid (pCMV delta R8.2; see addgene # 12263) and 0.5 μg of envelope expression plasmid (pCMV-VSV-G; see addgene # 8454)], and 1 μg of transfer plasmid containing sequences encoding dSaCas9-VR and the indicated sgRNA. 48 h after transfection, lentivirus was harvested by passing the culture supernatant through a 0.45 μM PES filter (VWR Cat. No.: 10218-488). The purified and aliquoted lentivirus was stored in a −80°C freezer until use.

[0041] Transduction of HSMM cells Primary skeletal muscle myoblasts (HSMMs) from five different human donors (designated donor #3, donor #5, donor #121, donor #368, and donor #617, respectively) ranging in age from 0 to 26 years were obtained from Lonza Inc. Cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (Lonza #CC-3244 & CC-3246)]. For transduction, 0.125–0.33 × 10 cells were cultured in a 6-well cell culture dish (VWR catalog number: 10062-894) containing growth medium. 6Cells were seeded at 1000 ng / well and cultured for 24 h at 37 °C / 5% CO2. The next day, 1.5 ml of growth medium supplemented with 8 μg / ml polybrene (Sigma catalog number: TR-1003-G) and 1.0 ml of lentiviral supernatant (see above) corresponding to each sgRNA containing the individual targeting sequence (Table 1) and the crRNA encoded by the tracrRNA were added to each well. After incubating the cells with the lentivirus for 6 h, the viral medium was removed and replaced with fresh growth medium. 72 h after transduction, the cells were fed with selection medium [growth medium supplemented with 0.5 μg / ml puromycin (Sigma Aldrich catalog number: P8833)]. The cells were fed with fresh selection medium every 2-3 days. 7-10 days after the cells were placed in selection medium, the cells were harvested and RNA was extracted with the RNeasy 96 kit (Qiagen catalog number: 74182) according to the manufacturer's instructions.

[0042] Gene expression analysis For gene expression analysis, cDNA was prepared from approximately 0.5–0.8 μg of total RNA in a volume of 10 μl according to the protocol of the High-Capacity cDNA Reverse Transcription Kit (AppliedBiosystems; Thermo Fisher catalog number: 4368813). The cDNA was diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix according to the manufacturer's protocol. Taqman probes (LAMA1: Assay Id Hs01074489_m1 FAM; HPRT: Assay Id Hs99999909_m1 VIC_PL) were obtained from Life Technologies. Taqman probe-based real-time PCR reactions were performed and analyzed using a QuantStudio 5 Real-Time PCR system according to the protocol of the Taqman Fast Advanced Master Mix.

[0043] After 7 days under puromycin selection, total protein was extracted from transduced HSMM cells using the QIAGEN Allprep Protein / RNA kit (Qiagen #80404) according to the manufacturer's instructions, then quantified and normalized to a final concentration of 1 μg / μL. 20 μg of each protein solution was separated on a NuPAGE Tris-Acetate 3-8% mini gel (FisherSci EA0375BOX) and transferred to a PVDF membrane (Bio-Rad) at 4°C for 70 min at 35 V. This was then incubated in SuperBlock T20 (PBS) blocking buffer (LifeTech 37516) for 1 h at RT to block nonspecific interaction sites. The membrane was then incubated overnight at 4°C with anti-LAMA1 antibody (1:100) (Santa Cruz Bio sc-74417) or anti-b-actin antibody (1:10000) (LifeTech MA1-140). The membrane was washed three times with washing solution (1XTBS and 0.05% Tween 20) for 10 min with agitation to remove excess or loosely bound antibodies after non-specific binding. Goat immunoglobulin anti-mouse conjugated with horseradish peroxidase (HRP; LifeTech) diluted 1:10,000 in blocking solution was incubated on the membrane for 1 h at RT with agitation. After three further washes, the membrane was immersed in SuperSignal West Femto Maximum Sensitivity Substrate (LifeTech 34094) for 1 min. Results were visualized with Azure C400.

[0044] 4. Data Analysis DeltaCt values ​​were calculated by subtracting the mean Ct value of the LAMA1 probe from the mean Ct value of the HPRT probe from three technical replicates for each sample and three controls (mean Ct LAMA1 - mean Ct HPRT). Expression values ​​were calculated using the 2 -(deltaCt)The expression values ​​of the samples were then normalized to the average expression values ​​of the three controls for each experiment to determine the relative LAMA1 expression level of each sample.

[0045] result Activation of LAMA1 gene expression by dSaCas9-VR:sgRNA We generated lentiviruses to deliver the VP64-miniRTA expression cassette and sgRNA for each targeting sequence into primary HSMM cells. Transduced cells were selected for resistance to puromycin, and LAMA1 expression was quantified using Taqman Assay. Expression values ​​for each sample were normalized to the average LAMA1 expression level in cells transfected with control sgRNA. As shown in Figure 2, of the 16 sequences tested, three targeting sequences were found to increase LAMA1 mRNA expression approximately 5- to 7-fold in HSMM donor #3 cells (Figure 2), and the same three sequences were found to increase it approximately 11- to 16-fold in donor #5 cells (Figure 3). After initial screening with 16 sgRNAs (sequence numbers 1-16) yielded promising upregulation results, we continued designing within the same region and screened an additional 45 sgRNAs (sequence numbers 17-61), identifying new potent sgRNAs, such as sgRNA25 and sgRNA50, which were approximately twice as potent as sgRNA15 (Figure 4). As shown in FIG. 5, of the 40 sequences examined in R1 and R2, only gRNA#101 was shown to increase LAMA1 mRNA expression by more than 3-fold in HSMM donor#3 cells. As shown in Figure 6, out of the 92 guide sequences examined that are located upstream of the LAMA1 TSS, only a handful of guide sequences were able to increase the expression of LAMA1 by more than 2-fold. The following validation experiments using primary HSMM cells of four different origins included the three most potent guide sequences, namely gRNA#155, gRNA#170, and gRNA#172. Three biological replicates were included for each treatment condition: 1. No virus was introduced; 2. dSaCas9-VR was introduced without sgRNA; 3. dSaCas9-VR was introduced with a non-targeting sgRNA; 4. dSaCas9-VR was introduced with gRNA#155; 5. dSaCas9-VR was introduced with gRNA#170; 6. dSaCas9-VR was introduced with gRNA#172. As shown in Figure 7, all three sgRNAs were able to consistently upregulate the expression level of LAMA1 to high levels (at least 3.5-fold) in all primary HSMM cells of four different origins. Additionally, variability in the ability to upregulate was observed between different HSMM origins (e.g., >35-fold in donor #368 vs. ~3.5-fold in donor #121), likely due to differences in basal LAMA1 expression (Figure 8). Next, we examined whether these sgRNAs could upregulate LAMA1 levels by changing the activation site. As shown in Figure 9, VP160, nanoVR, microVR, and miniVR were all able to upregulate LAMA1 expression by more than three times, and VP64-MyoD was able to upregulate LAMA1 expression by about two times. On the other hand, to examine whether the increase in LAMA1 mRNA level leads to an increase in protein level, total protein was extracted from the sample using microVR and a Western blot assay was performed. As shown in Figure 10, all three sgRNAs were able to increase LAMA1 protein level by at least 1.7 times in HSMM cells of two different origins. All patents and other publications mentioned above are hereby incorporated by reference in their entirety as if fully set forth herein. [Industrial Applicability]

[0046] INDUSTRIAL APPLICABILITY The present invention makes it possible to upregulate the expression of the LAMA1 gene in muscle cells derived from MDC1A patients, and is therefore expected to be extremely useful in the treatment and / or prevention of MDC1A. This application is based on a U.S. provisional patent application (No. 62 / 887,863, filing date: August 16, 2019) and a U.S. provisional patent application (No. 63 / 008,059, filing date: April 10, 2020) filed in the United States, the contents of which are incorporated in their entirety herein.

Claims

1. A polynucleotide comprising the following base sequence: (a) a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (b) (i) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, or (iii) a base sequence represented by SEQ ID NO: 178, 193, or 195 A base sequence encoding a guide RNA comprising:

2. 2. The polynucleotide of claim 1, wherein the transcriptional activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR) and microVR.

3. The polynucleotide of claim 2 , wherein the transcriptional activator is miniVR.

4. The polynucleotide of any one of claims 1 to 3, wherein the nuclease-deficient CRISPR effector protein is dCas9.

5. 5. The polynucleotide of claim 4, wherein the dCas9 is dCas9 derived from Staphylococcus aureus.

6. The polynucleotide according to any one of claims 1 to 5, further comprising a promoter sequence for a base sequence encoding a guide RNA and / or a promoter sequence for a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator.

7. The polynucleotide of claim 6, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of a U6 promoter, an SNR6 promoter, an SNR52 promoter, an SCR1 promoter, an RPR1 promoter, a U3 promoter, and an H1 promoter.

8. The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the guide RNA is a U6 promoter.

9. The polynucleotide according to any one of claims 6 to 8, wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is a ubiquitous promoter or a muscle-specific promoter.

10. The polynucleotide of claim 9, wherein the ubiquitous promoter is selected from the group consisting of an EFS promoter, a CMV promoter, and a CAG promoter.

11. 10. The polynucleotide of claim 9, wherein the muscle-specific promoter is selected from the group consisting of a CK8 promoter, a myosin heavy chain kinase (MHCK) promoter, a muscle creatine kinase (MCK) promoter, a synthetic C5-12 (Syn) promoter, and an unc45b promoter.

12. A vector comprising the polynucleotide according to any one of claims 1 to 11.

13. The vector according to claim 12 , wherein the vector is a plasmid vector or a viral vector.

14. 14. The vector of claim 13, wherein the viral vector is selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, and a lentiviral vector.

15. 15. The vector of claim 14, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, and AAV9.

16. A therapeutic or prophylactic agent for MDC1A, comprising the polynucleotide according to any one of claims 1 to 11, or the vector according to any one of claims 12 to 15.

17. A polynucleotide according to any one of claims 1 to 11, or a vector according to any one of claims 12 to 15, for use in the treatment or prevention of MDC1A.

18. Use of the polynucleotide according to any one of claims 1 to 11, or the vector according to any one of claims 12 to 15, in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.

19. A method for upregulating expression of the human LAMA1 gene in a cell other than a cell in a human body, comprising: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (d) guide RNA a method comprising expressing The base sequence encoding the guide RNA is (I) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, or (iii) a base sequence represented by SEQ ID NO: 178, 193, or 195 Includes.

20. Ribonucleoproteins, including: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator; and (d) a guide RNA; The base sequence encoding the guide RNA is (I) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, or (iii) a base sequence represented by SEQ ID NO: 178, 193, or 195 Includes.

21. A kit for upregulating the expression of the human LAMA1 gene, comprising: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) a guide RNA or a polynucleotide encoding the guide RNA; The base sequence encoding the guide RNA is (I) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, or (iii) a base sequence represented by SEQ ID NO: 178, 193, or 195 Includes.

22. Use of the following (e) and (f) in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein; and (f) a guide RNA or a polynucleotide encoding the guide RNA; The base sequence encoding the guide RNA is (I) a base sequence represented by SEQ ID NO: 15, 20, 25, 50, 56, or 61; (ii) a base sequence represented by SEQ ID NO: 124, or (iii) a base sequence represented by SEQ ID NO: 178, 193, or 195 Includes.

Images