Recombinant acid-tolerant yeast with suppressed lactic acid metabolism and alcohol production and method for producing lactic acid using the same

Abstract

To provide an acid-resistant yeast in which lactate consumption reaction is reduced and to which lactic acid-producing ability is imparted, and which exhibits improved lactic acid-producing ability and inhibited ethanol production, and a method of producing lactic acid using the same.SOLUTION: In a recombinant strain having lactic acid-producing ability, a gene encoding an enzyme converting lactate to pyruvate is deleted or attenuated from an acid-resistant yeast YBC strain (KCTC13508BP), and a gene encoding a lactate dehydrogenase is introduced. A method of producing lactic acid comprises: culturing the recombinant strain to produce lactic acid; and obtaining the produced lactic acid.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a recombinant acid-tolerant yeast having suppressed lactic acid metabolism and ethanol production, and a method for producing lactic acid using the same. More specifically, the present invention relates to a recombinant acid-tolerant yeast having improved lactic acid production ability and suppressed ethanol production by suppressing a lactic acid consumption reaction and imparting lactic acid production ability, and a method for producing lactic acid using the same. [Background technology]

[0002] Traditional lactic acid production processes use lactic acid bacteria, and to prevent the accumulation of lactic acid produced by the lactic acid bacteria from causing the bacteria to die or stop growing, fermentation is carried out while adjusting the pH to a neutral pH of 6-8 using neutralizing agents such as various forms of Ca salts / Mg salts or ammonia. When fermentation is complete, the microorganisms are separated, and since it is difficult to separate them from water and convert them into lactide in the salt form, sulfuric acid is added to convert the lactate salts into lactic acid, and Ca salts are converted into CaSO 4 This process removes the by-product CaSO in larger quantities than lactic acid. 4 This results in a decrease in process economy.

[0003] Polylactic acid (PLA) is a biodegradable polymer produced by converting lactic acid to lactide and then ring-opening polymerizing it; the raw material, lactic acid, is produced by fermentation. PLA can be used widely in disposable food containers, and is strong enough to be used alone or in the form of a composition or copolymer as a variety of industrial plastics, including in the automotive industry. Recently, it has also become a representative polymer used in 3D printing, and is an environmentally friendly polymer that emits little harmful gases and odors when used with a 3D printer. Meanwhile, lactic acid has optical isomers of L and D. Even in the case of lactic acid bacteria that mainly produce L, about 5 to 10% of D isomer is often produced together, and in the case of strains that mainly produce D, there are microbial groups with great diversity, such as those that produce D and L isomers together and those that produce D and ethanol together (Non-Patent Document 1).

[0004] PLA is generally produced by producing lactic acid through fermentation, and then converting the produced lactic acid into lactide through a purification process. To convert to lactide, a process of converting lactic acid into a hydrogenated form is required, and since the pH for general neutral fermentation is 6 to 7, a large amount of sulfuric acid is used to convert to an acidic pH. In this process, a large amount of neutralized salt is generated, and the economic efficiency is reduced due to the investment costs for removing the neutralized salt and the low value of the neutralized salt. On the other hand, lactic acid bacteria that produce lactic acid in nature ( Lactobacillus ), in order to commercially produce lactic acid, a large amount of expensive nutrients must be used as a medium, and such excessive nutrient components significantly inhibit the polymerization process in the subsequent steps or the lactide conversion process when lactide is used as an intermediate, so that in order to obtain a high-yield, high-purity polymer or its precursor, purification steps such as adsorption, distillation, and ion exchange are required, which also results in high production costs. As a method to solve this problem, research using yeast has been presented. Yeast is known to be able to grow / ferment smoothly even when low-value nutrients are used, and is also known to have high resistance to acidity.

[0005] When lactic acid is produced using yeast that grows well in acidic conditions (hereinafter referred to as acid-tolerant yeast), there is no need to use a neutralizing agent during fermentation to maintain the medium at pH 6-7, which simplifies the fermentation process and also eliminates the need for a downstream purification process to remove the neutralizing agent. In addition, since yeast produces many of the components necessary for metabolism, it can be cultured in media with lower nutritional levels than bacteria, especially lactic acid bacteria, so many downstream purification processes can be omitted, which can significantly reduce production costs. However, there is a prerequisite for the lactic acid production technology using yeast, which is that the yield, productivity, and lactic acid concentration, which are indicators of the fermentation performance of the strain, must be maintained at a high level similar to that of lactic acid bacteria in order to be commercially applicable. There have been attempts to develop technology for producing acid-resistant lactic acid using yeast. However, in practice, high fermentation ability is often achieved when fermentation is accompanied by a neutralization reaction and the pH is maintained at 3.7 or higher, which is above the pKa value of lactic acid. This makes it difficult to express this as a practical acid-resistant technology, and it is also difficult to obtain the effect of reducing production costs in the process (Non-Patent Document 2). Therefore, acid-tolerant yeast, which can reduce process costs, must complete fermentation when the pH of the fermentation liquid is below the pKa value while using no or a minimum amount of neutralizing agent, and only have commercial applicability when the three major fermentation indicators achieve levels similar to those of lactic acid bacteria. Generally, when glucose is fermented, yeast metabolizes ethanol as the main product, and it is very rare to produce lactic acid. In addition, the probability of selecting a strain that produces lactic acid from microorganisms with high acid tolerance is very low, so the present inventors selected a yeast strain with excellent acid tolerance and attempted to produce a strain that has lactic acid production ability but suppresses ethanol production ability from the selected strain by a genetic engineering method. Therefore, the inventors made extensive efforts to produce an acid-tolerant bacterial strain that has the ability to produce lactic acid but has a suppressed ability to produce ethanol. As a result, they created a recombinant strain in which a gene involved in the reaction of converting lactic acid to pyruvic acid was removed from an acid-tolerant yeast and a gene encoding lactate dehydrogenase was additionally introduced. They confirmed that when lactic acid is produced using the recombinant strain, the ability to produce lactic acid is improved and the ability to produce ethanol is blocked, thereby completing the present invention. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Ellen I. Garvie, Microbiological Reviews, 106-139, 1980 [Non-Patent Document 2] Michael Sauer et al., Biotechnology and Genetic Engineering Reviews, 27:229-256, 2010 Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide a recombinant acid-tolerant yeast having increased lactic acid production ability and decreased ethanol production ability. Another object of the present invention is to provide a method for producing lactic acid using the recombinant acid-tolerant yeast. It is still another object of the present invention to provide a gene having an enzyme activity that converts lactic acid derived from the acid-tolerant yeast into pyruvic acid. It is yet another object of the present invention to provide a promoter capable of inducing gene expression by lactate, which can be used to construct a recombinant strain capable of producing lactate. [Means for solving the problem]

[0008] To achieve the above-mentioned objective, the present invention provides a recombinant strain capable of producing lactic acid, in which a gene encoding an enzyme that converts lactic acid to pyruvate is deleted or weakened from the acid-tolerant yeast YBC strain (KCTC13508BP) and a gene encoding lactate dehydrogenase is introduced. The present invention also provides a recombinant strain capable of producing lactic acid, in which the g2947 gene, which is a gene encoding an enzyme that converts lactic acid to pyruvate, the g4423 gene, which is a gene encoding alcohol dehydrogenase, and the g3002 gene, which is a gene encoding pyruvate decarboxylase, are deleted from the acid-tolerant yeast YBC strain (KCTC13508BP) and a gene encoding lactate dehydrogenase has been introduced. The present invention also provides a method for producing lactic acid, comprising: (a) culturing the recombinant strain to produce lactic acid; and (b) obtaining the produced lactic acid. The present invention also provides a gene encoding a protein having the enzyme activity of converting lactate to pyruvate and having the amino acid sequence of SEQ ID NO:3 or SEQ ID NO:4. The present invention also provides a protein having an enzyme activity that converts lactate to pyruvate, and having the amino acid sequence of SEQ ID NO:3 or SEQ ID NO:4. The present invention also provides a promoter of the g2947 gene having the base sequence shown in SEQ ID NO:5 or SEQ ID NO:6. Effect of the Invention

[0009] The recombinant acid-tolerant yeast according to the present invention is capable of suppressing ethanol production, inhibiting the conversion of intracellular lactate to pyruvic acid, and strongly expressing LDH enzyme, thereby producing lactate at a high yield. [Brief description of the drawings]

[0010]

Figure 1

Figure 2

Figure 3

[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein is well known and commonly used in the art.

[0012] Acid-tolerant yeast has the characteristics of consuming sugar at a high rate even at acidic pH, showing a high growth rate, and converting consumed sugar into products under fermentation conditions. The present inventors selected the acid-tolerant yeast YBC strain (KCTC13508BP) from yeasts having such characteristics through many yeast libraries. The acid-tolerant yeast YBC strain (KCTC13508BP) is a strain that shows high growth and sugar consumption rate even under conditions of lactic acid concentration of 40 g / L to 80 g / L. The acid-tolerant yeast YBC strain was subjected to metabolic pathway regulation for increasing lactic acid production ability and decreasing ethanol production ability, and a gene encoding alcohol dehydrogenase and a gene encoding pyruvate decarboxylase were deleted from the YBC strain into which the lactate dehydrogenase gene was introduced, thereby producing a recombinant strain by deleting a gene encoding an enzyme that converts lactate to pyruvate, and it was confirmed that the recombinant strain has high lactic acid production ability while suppressing ethanol production ability.

[0013] Therefore, in one aspect, the present invention relates to a recombinant strain capable of producing lactic acid, which is obtained by deleting or weakening a gene encoding an enzyme that converts lactic acid to pyruvate in an acid-tolerant yeast YBC strain (KCTC13508BP) and introducing a gene encoding lactate dehydrogenase. There are two ways to suppress the lactate depletion reaction of the YBC strain (KCTC13508BP). The first is to find and remove the transporter that introduces lactate into the cell from the outside. The second is to find and remove the enzyme (lactate dehydrogenase) that converts lactate to pyruvate. In the case of transporters, many monocarboxylase transporter families have been studied. Among them, Ady2 Jen1, which has been studied extensively in yeast, is known to be responsible for transporting lactate from the outside (Ref: Antonio Pacheco et al., FEMS Yeast Res. 12 (2012) 375-381). However, in the case of fermentation using an acid-tolerant strain as in the present invention, most of the lactic acid is transported by such transporters and due to the low external pH, about 80% to 90% of the lactic acid exists as a hydrogenated form of lactic acid at pH 3, depending on the culture conditions and the composition of the fermentation liquid, and it is known that such lactic acid is transported to the inside of the cell by direct mass transfer through the cell membrane rather than being transported by the transporters in an uncharged state (Minoska Valli et al., Appl Environ Microbio., 72:5492, 2006). In addition, some monocarboxylate transporters play a role in transporting dissociated salts from the inside to the outside of the cell, thereby alleviating acid stress of the cell, so that depending on the type of such transporter, it may be possible to increase the stress caused by lactic acid. Therefore, the present inventors determined that removing the transporter does not have a significant effect on inhibiting inward lactate transport, and therefore created a strain in which the enzyme primarily responsible for the reaction of directly converting lactate inside the cell to pyruvate has been removed. Known enzymes / genes that convert lactate to pyruvate in yeast include the CYB2 gene for L-lactate and the DLD1 gene for D-lactate (Guiard, B., EMBO J., 4:3265, and 1985; Lodi, T., and Ferrero, I., Mol. Gen. Genet., 238:315, 1993), each of which has the function of converting the corresponding lactate to pyruvate in the mitochondrial membrane. In addition, CYB2 was selected as the target gene based on a report that removal of CYB2 associated with L-lactate can suppress consumption of produced lactic acid and increase the fermentation yield of lactic acid (Aki Ookubo et al., Biosci. Biotechnol. Biochem., 72:3063, 2008).

[0014] In one embodiment of the present invention, a recombinant strain YBC2 was prepared by removing the g4423 gene, which is the main ADH gene, from a YBC strain, and introducing the LDH gene of sequence number 28 derived from Lactobacillus plantarum at the g4423 position, and the g3002 gene (hereinafter referred to as the g3002-1 gene) was removed and the LDH gene was introduced at the g3002 gene position, and a recombinant strain YBC4 was prepared by further removing the g2947 gene from recombinant strain YBC2 and introducing the LDH gene. When the recombinant strains were cultured, it was confirmed that lactic acid production ability was improved and ethanol production ability was decreased. In the present invention, the gene encoding the enzyme that converts lactate to pyruvate may be the g2947 gene. In the present invention, the g2947 gene may have the base sequence of SEQ ID NO:1 or SEQ ID NO:2. In the present invention, the recombinant strain may be characterized in that a gene encoding alcohol dehydrogenase (ADH gene) is additionally deleted, and the gene encoding alcohol dehydrogenase may be the g4423 gene. In the present invention, the recombinant strain may additionally have an LDH gene introduced therein instead of the ADH gene. In the present invention, the recombinant strain may be characterized in that a gene encoding pyruvate decarboxylase (PDC gene) is additionally deleted, and the gene encoding pyruvate decarboxylase may be the g3002 gene. In the present invention, the recombinant strain may additionally have an LDH gene introduced therein instead of the PDC gene. In the present invention, the gene encoding lactate dehydrogenase may be introduced to replace the g2947 gene and may be regulated by the promoter of the g2947 gene. In the present invention, the deletion or weakening of the g2947 gene may result in an increased ability to produce lactic acid compared to the parent strain, YBC strain (KCTC13508BP), and a decreased or blocked ability to produce ethanol. In the present invention, the gene encoding lactate dehydrogenase to be introduced is L.helveticus oryzae-derived LDH gene, or L.plantarum It is preferable that the LDH gene is derived from L.plantarum It is preferable that the LDH gene is derived from a mammalian animal.

[0015] Therefore, in another aspect, the present invention relates to a recombinant strain capable of producing lactic acid, which is obtained by deleting the g2947 gene, which is a gene encoding an enzyme that converts lactic acid to pyruvate, the g4423 gene, which is a gene encoding alcohol dehydrogenase, and the g3002 gene, which is a gene encoding pyruvate decarboxylase, from the acid-tolerant yeast YBC strain (KCTC13508BP) and introducing a gene encoding lactate dehydrogenase. In the present invention, the gene encoding lactate dehydrogenase may be introduced by replacing one or more of the g2947 gene, the g4423 gene, and the g3002 gene, and may be regulated by the promoter of the replaced gene.

[0016] In one embodiment of the present invention, it was confirmed that the YBC4 strain (Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh) had a significantly increased lactic acid fermentation yield compared to the YBC2 strain (Δg4423::ldh / Δg3002-1::ldh). Meanwhile, the ethanol fermentation yield of the YBC4 strain was reduced by more than 90% compared to the YBC2 strain, indicating that all carbon flux was converted from ethanol to lactic acid. From this, it was confirmed that the lactic acid yield was increased to 84% of the theoretical value (see Table 2 and FIG. 2). Therefore, in another aspect, the present invention relates to a method for producing lactic acid, comprising the steps of (a) culturing the recombinant strain to produce lactic acid, and (b) obtaining the produced lactic acid. According to the present invention, an excellent acid-tolerant bacterial strain with significantly increased lactic acid productivity and significantly reduced ethanol production can be obtained.

[0017] In yet another aspect, the present invention relates to a gene encoding a protein having an activity of converting lactate to pyruvate and having 90% homology with the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2. In yet another aspect, the present invention relates to a gene encoding a protein having an activity of converting lactate to pyruvate and having the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4. In the present invention, the gene may be represented by the base sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0018] In yet another aspect, the present invention relates to a protein having an amino acid sequence represented by SEQ ID NO:3 or SEQ ID NO:4, and having an activity of converting lactate to pyruvate. In yet another aspect, the present invention relates to a promoter of the g2947 gene having the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6. The g2947 gene (CYB2) promoter of the present invention can express the LDH gene by inducing its own expression in the recombinant yeast strain that produces lactic acid according to the present invention. This promoter is strongly expressed in the early stage of culture under high glucose concentration conditions, which is different from promoters that are strongly expressed under general corresponding process conditions, and has the characteristic of being able to express the LDH gene in the later stage of culture and continuously maintain the lactic acid production ability of the cells, and is highly useful for producing a highly efficient lactic acid producing strain.

[0019] In the present invention, an 'acid-tolerant yeast' is defined as a yeast that can maintain at least 10% of a biomass consumption rate (such as a sugar consumption rate) or at least 10% of a specific growth rate at a pH lower than the pKa value of the organic acid when the medium contains 1 M or more of an organic acid (particularly lactic acid) compared to when the medium does not contain an organic acid. More specifically, in the present invention, an 'acid-tolerant yeast' is defined as a yeast that can maintain at least 10% of a biomass consumption rate (such as a sugar consumption rate) or at least 10% of a specific growth rate at a pH of 2 to 4 compared to when the medium contains a pH of 5 or higher. The recombinant yeast according to the present invention can be produced by inserting the gene into the chromosome of a host yeast by a conventional method, or by introducing a vector containing the gene into a host yeast. The host yeast is typically a host cell that has a high DNA introduction efficiency and a high expression efficiency of the introduced DNA. In one embodiment of the present invention, an acid-tolerant yeast was used, but the present invention is not limited thereto, and any type of yeast may be used as long as the target DNA can be sufficiently expressed. The recombinant yeast can be produced by any transformation method. "Transformation" refers to the phenomenon of introducing DNA into a host cell to make the DNA replicable as a chromosomal factor or by chromosomal integration, and artificially inducing genetic changes by introducing external DNA into the cell. Common transformation methods include electroporation and lithium acetate-PEG method.

[0020] In addition, in the present invention, any commonly known genetic engineering method can be used to insert a gene into the chromosome of a host microorganism. Examples include methods using retroviral vectors, adenoviral vectors, adeno-associated virus vectors, herpes simplex virus vectors, poikilvirus vectors, lentivirus vectors, non-viral vectors, etc. "Vector" refers to a DNA construct that contains a DNA sequence operably linked to a suitable regulatory sequence that allows the DNA to be expressed in a suitable host. A vector can be a plasmid, a phage particle, or simply a potential genome insert. When transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Plasmids are currently the most commonly used form of vector, and linearized DNA is also a commonly used form for integration into the yeast genome. A typical plasmid vector has a structure including (a) an origin of replication that allows efficient replication so that each host cell contains the plasmid vector, (b) an antibiotic resistance gene or an auxotrophic marker gene that allows host cells transformed with the plasmid vector to be screened, and (c) a restriction enzyme cleavage site that allows a foreign DNA fragment to be inserted. Even if there is no suitable restriction enzyme cleavage site, the vector and foreign DNA can be easily ligated (Gibson assembly) using a synthetic oligonucleotide adaptor or linker by a conventional method, and a method of synthesizing the entire desired sequence and using it as necessary is also commonly used.

[0021] A gene is also "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. This can be a gene and a regulatory sequence(s) linked in a manner that allows for gene expression when the appropriate molecule (e.g., a transcriptional activator protein) is bound to the regulatory sequence(s). For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and that the secretory leader is contiguous and in reading frame; however, enhancers need not be contiguous. Linking of these sequences can be accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used by conventional techniques. Of course, not all vectors function equally well to express the DNA sequence of the present invention, and similarly not all hosts function equally well for the same expression system. However, one skilled in the art can appropriately select and apply various different vectors, expression control sequences, and hosts without undue experimental burden, without departing from the scope of the present invention. For example, the host must be considered when selecting a vector, since the vector must replicate therein, and the number of copies of the vector, the ability to regulate the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

[0022] In the present invention, the carbon source may be one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomers, and glycerol, but is not limited thereto. In the present invention, the culture can be performed under conditions that prevent the microorganism, such as Escherichia coli, from acting any more (e.g., preventing the production of metabolites). For example, the culture can be characterized by a pH of 1.0 to 6.5, preferably 1.0 to 6.0, and more preferably 2.6 to 4.0, but is not limited thereto. EXAMPLES

[0023] The present invention will be described in more detail below based on examples. It is clear to those skilled in the art that these examples are intended solely to illustrate the present invention and are not intended to limit the scope of the present invention.

[0024] Example 1: Analysis of lactate depletion genes in the genome of the acid-tolerant yeast strain YBC The present inventors tested various yeast strains to select strains having acid tolerance, added lactic acid to the medium at the beginning of yeast culture, and checked the growth and sugar consumption rate of the microorganisms to select the YBC strain, which had the best acid tolerance, and deposited it at the Korea Institute of Bioscience and Biotechnology Biological Resource Center under the accession number KCTC13508BP. Phylogenetic analysis revealed that the YBC strain (KCTC13508BP) S.cerevisiae It was confirmed that the strain is similar to that described above, has diploid genes, and has Crab-tree positive characteristics. In Genome Full Sequencing Data, S.cerevisiae Using bioinformatics information, g2947 and g3864 were identified as genes annotated with CYB2, a gene encoding an enzyme that converts L-lactate to pyruvate, present in the genome of the YBC strain. S.cerevisiaeWhen protein domain analysis (http: / / smart.embl-heidelberg.de / ) was performed on the CYB2 gene, S.cerevisiae The CYB2 gene has the characteristics of the Cytochrome b5 family, heme-binding domain profile, and FMN-dependent alpha-hydroxy acid dehydrogenase domain profile. The same analysis was performed on the g2947 gene, and the results showed that it has the characteristics of the Cytochrome b5 family, heme-binding domain profile, and FMN-dependent alpha-hydroxy acid dehydrogenase domain profile. S.cerevisiae The g3864 gene showed the same characteristics as the CYB2 gene, whereas the g3864 gene was shown to lack a heme-binding domain profile and was judged to be unlikely to have CYB2 characteristics. S.cerevisiae Analysis of the ORFs near the CYB2 gene on the genome of showed that the ORFs of CMP2-IMD4-SPC2-CYB2-YML054c-A were sequentially arranged, and the same site was found in scaffold 41 of the YBC strain in which g2947 is found, suggesting the possibility that such ORFs exist as conserved regions. Therefore, a deletion cassette capable of deleting the g2947 gene (SEQ ID NO: 1 and SEQ ID NO: 2) and its protein (SEQ ID NO: 3 and SEQ ID NO: 4) was constructed. In this example, the native promoter of g2947 was used together with a cassette that only deleted it, to express the enzyme that produces lactate, L.plantarum A cassette capable of expressing the lactate dehydrogenase (LDH) gene derived from the ribosomal protein was also designed (Figure 1). The deletion cassette is shown in Figure 1, and the selection of the corresponding restriction enzyme site or antibiotic resistance gene and the method of deleting the antibiotic resistance gene are well known in the related art and can be used with various modifications.

[0025] Example 2: Construction of recombinant acid-tolerant yeast strains with deleted lactate depletion genes The target acid-tolerant yeast strain for removing the g2947 gene, which is expected to be a CYB2 gene, from its genome is a strain in which LDH is expressed when the g3002-1 gene (PDC gene) is additionally removed from the YBC1 strain, which is an existing wild-type strain in which the main ADH (alcohol dehydrogenase) gene has been removed and the LDH gene has been introduced, and is a YBC2 strain in which the ability to produce ethanol8 is blocked and which produces lactic acid with high efficiency. By removing the g2947 gene from the YBC2 strain (in the diploid strain, both Allele 1 and Allele 2 have been removed), two copies of L.plantarum A strain (YBC4) was prepared to express the LDH gene, and the genotype of the strain was confirmed by preparing the primers shown in Table 1 below and then checking the genomic DNA of the strain.

[0026] The method for preparing the above strain is as follows. The YBC1 strain is a strain in which the g4423 gene, which is the main ADH gene of the YBC strain, has been removed, and the LDH gene of SEQ ID NO: 7 derived from Lactobacillus plantarum has been introduced into the position of g4423. Based on the information of g4423 and its UTR, the ORF of each gene was removed, and a gene cassette with 5' and 3' UTR and an antibiotic marker was prepared and used as a donor DNA. For each allele of g4423, the corresponding 5' UTR is shown in SEQ ID NO: 8 and SEQ ID NO: 9, and the 3' UTR is shown in SEQ ID NO: 10 and SEQ ID NO: 11. The donor DNA was prepared by the cloning method using restriction enzymes, Gibson assembly, and gene synthesis method as described above. The LDH of SEQ ID NO: 7 was synthesized and introduced into the ORF site of g4423 to prepare donor DNA, which was then introduced into YBC to prepare recombinant strain YBC1. The g3002-1 gene is located at scaffold 72 in the genome of the YBC strain and acts as a PDC gene. The g3002-1 gene (located at scaffold 72) of the YBC1 strain was removed and the LDH gene of SEQ ID NO:7 was introduced to produce a recombinant strain YBC2. In particular, the g3002 gene was prepared using UTR. In the same manner as the method of introducing LDH into the g4423 gene (ADH) site of YBC1, the g3002-1 UTR was used. However, in order to simplify the process, the gene was replaced by preparing a donor cassette for one allele without considering allele variation, but it can also be prepared for each allele. In addition, in addition to the primers used for gene replacement, a primer pair that can check both the g3002-1 UTR and LDH was used to improve the accuracy of confirming gene replacement, as follows. g3002-1 UTR-LDH-fwd:GCAGGATATCAGTTGTTTG (SEQ ID NO: 12) g3002-1 UTR-LDH-rev: AATACCTTGTTGAGCCATAG (SEQ ID NO: 13)

[0027] The method for preparing the strain is as follows. The YBC4 strain is a strain in which the g2947 gene, which is a CYB2 gene of the YBC2 strain, has been removed and the LDH gene of SEQ ID NO: 7 derived from Lactobacillus plantarum has been introduced into the g2947 position, and the g2947 gene is a gene located at scaffold 41 in the genome of the YBC strain. Based on the information of g2947 and these UTRs, the ORF of each gene was removed, and a gene cassette with 5' and 3' UTRs and antibiotic markers was prepared and used as a donor DNA. For each allele of g2947, the corresponding 5' UTR is shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the 3' UTR is shown in SEQ ID NO: 14 and SEQ ID NO: 15. The donor DNA was prepared by the cloning method using restriction enzymes, Gibson assembly, and gene synthesis, as described above. However, in order to simplify the process, the donor cassette was prepared for one allele without considering allele variation, but it can also be prepared for each allele. In addition, in addition to the primers used for gene replacement, a primer pair that can check both the UTR and LDH of g2947 as shown in Table 1 below was used in addition to the primers used for the construction of the deletion strain to improve the accuracy of gene replacement confirmation.

[0028] [Table 1]

[0029] The genotype of the recombinant strain thus constructed is as follows: YBC2:Δg4423::ldh / Δg3002-1::ldh YBC4:Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh

[0030] Example 3: Confirmation of the inhibitory effect on lactic acid production and ethanol production in a recombinant YBC strain in which the CYB2 gene was deleted from the YBC2 strain and LDH was introduced The recombinant strains YBC2 and YBC4 prepared in Example 2 were inoculated at an OD of 0.5 and cultured in YP medium (20 g / L peptone, 10 g / L yeast extract) with 6% glucose at 30°C and 175 rpm in a 100 ml flask for 4 hours, followed by culture at 125 rpm.

[0031] [Table 2]

[0032] As a result, as shown in Table 2 and Figure 2, the lactic acid fermentation yield of the YBC4 strain was significantly higher than that of the YBC2 strain. Meanwhile, the ethanol fermentation yield of the YBC4 strain was reduced by more than 90% compared to the YBC2 strain, and it was found that all the carbon flux was converted from ethanol to lactic acid, and the lactic acid yield was increased to 84% of the theoretical value. Generally, in neutral fermentation, the lactic acid yield can be as high as about 90% to 94%, excluding the carbon consumed for the growth of the strain. However, in acid-tolerant strains, there is a flow of undissociated lactic acid that diffuses from the outside through the cell membrane, and transport by a transporter to the outside is necessary to reduce the stress caused by the internally generated lactic acid and the lactic acid that flows in from the outside. In such transport, when the external lactic acid concentration is low, transport in the form of a simple permease is possible. In this case, ATP consumption is unnecessary, but if the concentration of external lactate increases, energy is required to transport lactate against the concentration gradient, and ATP is consumed in the process (Antonius JA van Maris et al., Metabolic Engineering 6: 245, 2004). Such ATP consumption inevitably causes additional carbon loss, and to date, the present invention is the only one that has shown a yield of 0.8 or more while producing high-concentration lactate of 50g / L at pH 3 or less without or with minimal use of neutralizing agents.

[0033] Regarding the original role of g2947, which is to consume lactate, we confirmed whether lactate was consumed in the absence of glucose after the end of cultivation. As a result, we found that lactate gradually disappeared in the YBC2 strain, as in previous results, but no reduction in lactate was observed in the YBC4 strain, in which the g2947 gene was deleted, confirming that the g2947 gene is a CYB2 gene.

[0034] The most remarkable performance of the YBC4 strain is the complete blockage of ethanol production along with an increase in lactate yield. Meanwhile, it has been reported that the effect of removing the CYB2 gene is that the lactate produced is not consumed and disappears even when the glucose concentration is low in the latter half of fermentation, and that the yield of some lactate increases. The increase in yield was not observed at pH levels above the pKa, but showed a tendency to increase from 19.3% to 28.6% only at pH 3.5 (Aki Ookubo et al., Biosci. Biotechnol. Biochem., 72:3063,2008). However, this example showed that the addition of a strain (YBC2) that shows a high lactate production yield along with blocking lactate consumption resulted in a dramatic increase and a complete blockage of ethanol production. The reasons for this can be explained as follows. First, the CYB2 gene can supply additional pyruvate by converting lactate to pyruvate in the mitochondrial membrane, and this pyruvate can be converted to ethanol, so the ethanol produced from this can be suppressed by removing the CYB2 gene. In particular, since the genotype of this strain only had the main ADH and main PDC removed, it is believed that a small amount of ethanol was produced by auxiliary ADH, including ADH3, which plays a role in mitochondria, and auxiliary PDC. Secondly, the additional expression of LDH introduced into the CYB2 position strengthened LDH inside the YBC bacteria, and the pathway from pyruvate to lactate became more selective since the pathway from pyruvate to ethanol was already weak, which is thought to have reduced the yield of ethanol. It is believed that these two effects occur together and ethanol production is completely blocked.

[0035] Example 4: Confirmation of the inhibitory effect on lactic acid production and ethanol production in a recombinant YBC strain in which the CYB2 gene was deleted from a wild-type YBC strain and LDH was introduced The results of Example 3 confirmed that lactic acid production increased and ethanol production decreased due to the removal of the g2947 gene and the expression of LDH. However, because the YBC2 strain used as the parent strain was a strain lacking the ADC and PDC genes, these results were due to the combined effect of the removal of genes other than the g2947 gene. Therefore, a strain expressing LDH was prepared by deleting only the g2947 gene from the wild-type YBC strain, and its lactate production ability and ethanol production inhibition were confirmed. The cassettes used to prepare the recombinant strain and the primers used to confirm the genotype were those shown in Figure 1 and Table 1, and were prepared by the method shown in Example 2. The strain in which the g2947 gene was deleted from the YBC strain and LDH was inserted was named YBC_a and had the following genotype: YBC_a:Δg2947::ldh The recombinant strain was inoculated at an OD value of about 0.5 and cultured in mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH 2 PO 4 , 2g / L MgSO 4 7H 2 0, 0.15 g / L uracil) with 6% glucose, and cultivated in 50 ml culture volumes in 500 ml flasks at 30°C and 125 rpm. In order to further observe the induction effect of lactic acid, an initial lactic acid concentration of 11.5 g / L was added to the culture medium at the beginning of the cultivation.

[0036] [Table 3]

[0037] As shown in Table 3, in the case of the YBC_a strain, the yield was lower than the general ethanol yield of the wild-type strain, which was 0.43 to 0.45 g / g, and the effect of reducing the ethanol yield due to the removal of the CYB2 gene was confirmed. Interestingly, it was found that the LDH gene introduced into the position of the CYB2 gene alone was unable to produce much lactic acid, which indicates that the CYB2 promoter cannot be expressed without lactic acid under the presence of glucose, which is a general fermentation condition, and that there is an effect of reducing the amount of ethanol produced even though lactic acid is not produced. When lactic acid was added to the culture solution at the beginning of the culture to confirm the effect of inducing the expression of the CYB2 gene, this lactic acid was transferred or actively transferred inside the cells, and the CYB2 promoter reacted with this intracellular lactic acid, and expressed the LDH gene replaced at the CYB2 position, which increased the yield of lactic acid and reduced the yield of additional ethanol.

[0038] The CYB2 promoter can express the LDH gene by inducing its own expression in lactic acid producing strains. This promoter is strongly expressed in the early stage of culture under high glucose concentration conditions, which is different from the promoters that are strongly expressed under general process conditions. It is a promoter that has the characteristic of being able to continuously maintain the lactic acid production ability of the cells by expressing the LDH gene in the later stage of culture, and is highly useful for producing highly efficient lactic acid producing strains. The promoter region of the g2947 gene is shown in SEQ ID NO:5 and SEQ ID NO:6.

[0039] The effect of removing CYB2 is more obvious when compared with the prior art. Previous studies have reported that there was a partial increase in lactic acid yield only at low pH, but there was no explicit mention of ethanol reduction as in the present invention (Aki Ookubo et al., Biosci. Biotechnol. Biochem., 72:3063, 2008). In Natureworks' patents WO2007117282 and US8,137,953B, a strain that produces lactic acid was prepared from I. orientalis, and a strain was developed from this strain in which CYB2 was removed. Here, a strain that produced lactic acid at a rate of 0.35 g / L / hr at pH 3 with a concentration of 56 g / L and a yield of 69% produced lactic acid at a rate of 0.43 g / L / hr with a concentration of 66 g / L and a yield of 67% after CYB2 removal. The results showed that the production concentration of lactic acid increased, but the yield decreased, and glycerol as a by-product also increased. In addition, in Samsung Advanced Technology's US9,353,388B patent, a microorganism that produces lactic acid was created, and the CYB2 gene was either removed (performance evaluation of SP1002 in Table 3 of the patent), or a microorganism was created that expressed the LDH gene at the same time as the CYB2 gene was removed (see the effect of overexpressing Jen1 and Ady2 in sp1003 and sp1002 in Table 4 of the patent). This confirmed the effect of a significant increase in the production concentration of lactic acid. However, since the patent does not specify the effect of completely blocking ethanol, it can be said that the effect of removing the CYB2 gene and expressing the LDH gene in the YBC strain of the present invention is very excellent.

[0040] Example 5: Construction and performance evaluation of a strain expressing LDH when the CYB2 gene is removed from the YBC1 strain The results of YBC4 were obtained by deleting the g2947 gene from a YBC strain in which the main ADH (g4423) and main PDC (g3002-1) were deleted, and then inserting the LDH gene to confirm the inhibition of lactate production and ethanol production. Here, a recombinant strain was prepared to confirm the combined effect of only the ADH gene and the g2947 gene, and the fermentation ability was confirmed. A recombinant strain in which ADH (g4423) and g2947 were deleted and the LDH gene was inserted was prepared in the same manner as in Example 2 using the cassette and primer set used in Example 2. The recombinant strain constructed was named YBC_b and has the following genotype: YBC_b:Δg4423::ldh / Δg2947::ldh The recombinant strain was inoculated at an OD value of about 0.5 in mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH 2 PO 4 , 2g / L MgSO 4 7H 2 The culture was performed in a 500 ml flask with 60 ml of culture volume at 30°C and 150 rpm using 0.15 g / L uracil and 10% glucose. Since the initial glucose concentration was high, the pH drop due to the production of lactic acid was high, which was expected to inhibit growth, so the culture was performed in a 40% CaCO 3 The solution was injected twice, 1 ml each, to adjust the final pH to about pH 3. For comparison, the YBC4 strain was also cultured under the same conditions.

[0041] [Table 4]

[0042] As a result, as shown in Table 4, the YBC_b strain produced ethanol and had a lower lactate yield than the YBC4 strain, in which ethanol production was blocked. This is believed to be because the main PDC (g3002-1) in the YBC_b strain was active, causing LDH and PDC to compete with each other for pyruvate, which is how ethanol was produced. However, considering that the ethanol yield of the YBC1 (Δg4423::ldh) strain was about 0.07-0.1 g / g, the ethanol yield of the YBC_b strain was significantly low (0.023 g / g), and the effect of the g2947 gene deletion was still confirmed.

[0043] Example 6: Construction of a strain in which only the CYB2 gene has been removed from the YBC2 strain and performance evaluation The results for the YBC4 strain confirmed that the deletion of the g2947 gene and the insertion of LDH in a strain in which the main ADH (g4423) and main PDC (g3002-1) were deleted increased lactate production and blocked ethanol production. To confirm the effect of removing LDH expression, a recombinant strain was created from the YBC2 strain in which only the g2947 gene was deleted, and its fermentation ability was confirmed. The recombinant strain was constructed in the same manner as in Example 2 using the cassette and primer set used in Example 2. Since there was no LDH expression, the 'primers for confirming G2947LDH introduction' in Table 1 was not used. The recombinant strain constructed was named YBC_c and had the following genotype: YBC_c:Δg4423::ldh / Δg3002-1::ldh / Δ2947 The recombinant strain was inoculated at an OD value of about 0.5 and grown in mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH 2 PO 4 , 2g / L MgSO 4 7H 2 The culture was performed in a 500-ml flask with 10% glucose (0.15 g / L uracil, 0.15 g / L glucose) at 30°C and 150 rpm in a culture volume of 60 ml. Since the initial glucose concentration was high, the pH drop due to the lactic acid produced was large, and growth inhibition was expected. Therefore, the culture was performed in a 40% CaCO 3 The solution was injected twice, 1 ml each, to adjust the final pH to about pH 3. For comparison, the YBC4 strain was also cultured under the same conditions.

[0044] [Table 5]

[0045] As a result, as shown in Table 5, when compared with the YBC4 strain, the YBC_c strain had the same effect on ethanol and lactic acid yields due to the non-expression of LDH, and when compared with YBC2 in Table 1, the effect of removing the g2947 gene was also clearly observed.

[0046] Example 7: Confirmation of the effect of increasing productivity depending on the initial inoculation concentration of the YBC4 strain Generally, when the initial inoculum concentration is increased in fermentation, the yield and productivity can be expected to increase. The same method was applied to the YBC4 strain to confirm the effect. The same seed culture of YBC4 was mixed with distilled water to vary the inoculation OD from 0.5 to 2. mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH 2 PO 4 , 2g / L MgSO 4 7H 2 O, 0.15 g / L uracil) with 8.7% glucose, and the cells were grown in 500-ml flasks with a culture volume of 55.5 ml at 30°C and 150 rpm.

[0047] [Table 6]

[0048] As a result, as shown in Table 6, an increase in productivity was observed as the initial inoculation OD value increased, but there was little change in yield. This suggests that the ratio of carbon consumed to reach a final OD of about 10 does not vary significantly due to the difference in the initial OD. The culture results are shown in Table 7, in comparison with two representative results of lactic acid production by acid-tolerant yeasts at pH 3 or less that have been previously reported.

[0049] [Table 7]

[0050] As shown in Table 7, the YBC4 strain had the highest lactic acid productivity.

[0051] Example 8: Evaluation of fermentation performance of YBC4 strain The YBC4 strain was cultured in a bioreactor instead of a flask culture to confirm its lactic acid fermentation performance. Inoculate the medium to an OD of 1 and culture in mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH2 PO 4 , 2g / L MgSO 4 7H 2 Cultures were started using 12% glucose in 0.2% CO and 0.15 g / L uracil. 3 The solution was injected intermittently to maintain the pH at about pH 3. The solution was injected into 2.5 L of culture medium and cultured at 30°C, 450 rpm, and air 0.1 vvm. As a result, as shown in Figure 3, it was confirmed that the YBC4 strain produced lactic acid while consuming all the glucose in the bioreactor in a short time, and showed a lactic acid yield of 0.8 (g / g), productivity of 2.0 g / L / hr, and a produced lactic acid concentration of 98.1 g / L at a final pH of 3.3. It is also believed that further improvements in performance will be possible by improving the initial OD and culture conditions in the future.

[0052] Although the specific parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific techniques are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention can be said to be defined by the appended claims and their equivalents.

Claims

1. A gene having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which encodes an enzyme that converts lactate to pyruvate, is deleted or weakened from the acid-tolerant yeast YBC strain deposited at the Korea Institute of Bioscience and Biotechnology, Bioresource Center under the name KCTC13508BP; The gene encoding alcohol dehydrogenase and / or the gene encoding pyruvate decarboxylase are deleted; A recombinant strain having the ability to produce lactic acid, into which a gene having the base sequence of SEQ ID NO: 7 encoding lactate dehydrogenase has been introduced.

2. The recombinant strain described in claim 1, characterized in that the gene having the base sequence of SEQ ID NO: 7 encoding the lactate dehydrogenase is introduced in place of the gene having the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 encoding the enzyme that converts lactate to pyruvate, and is regulated by the promoter of the gene having the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 encoding the enzyme that converts lactate to pyruvate.

3. (a) culturing the recombinant strain of claim 1 or 2 to produce lactic acid; (b) obtaining the produced lactic acid; A method for producing lactic acid, comprising:

4. A gene encoding a protein having an enzyme activity that converts lactate to pyruvate and represented by the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

4.

5. The gene according to claim 4, characterized in that it is represented by SEQ ID NO: 1 or SEQ ID NO:

2.

6. A promoter of a gene encoding an enzyme that converts lactate to pyruvate, having the base sequence shown in SEQ ID NO:5 or SEQ ID NO:6.

Images