New β-amylase and its use and production method

Abstract

The present invention addresses the problem of obtaining a β-amylase that exhibits heat resistance even with respect to high temperatures above 60°C. By screening and obtaining β-amylase-producing bacteria from soil samples, a novel Bacillus halosaccharovorans strain possessing a novel heat-resistant β-amylase, and a β-amylase derived from the novel B. halosaccharovorans strain are obtained.

Description

[Technical field]

[0001] The present invention relates to a novel β-amylase and a method for using and producing the same. [Background technology]

[0002] Starch is an important source of nutrition for living organisms, and like cellulose, it is one of the most abundant polysaccharides on Earth. The structure of starch is composed of amylose, which is a linear polymer of glucose molecules linked together by α-1,4 bonds, and amylopectin, which is branched amylose linked together by α-1,6 bonds. When native starch is suspended in water and heated, the amylose and amylopectin molecules disperse to form a starch solution or starch paste. Starch that has a natural crystalline and granular structure is called raw starch, in order to distinguish it from heat-gelatinized starch. The crystalline structure of raw starch is destroyed by heating and hydration. Amylase is a general term for enzymes that hydrolyze the α-1,4 and α-1,6 bonds of amylose and amylopectin in starch.

[0003] Amylases can be broadly classified into two types, endo-amylase and exo-amylase, based on their mode of action. α-amylase is known as an endo-amylase and is an enzyme that randomly hydrolyzes the glucose chains of starch. β-amylase is known as an exo-amylase and is an enzyme that acts on polysaccharides such as starch and glycogen, which are polymerized with α-1,4 glucose bonds, and breaks them down into maltose (malt sugar) units from the non-reducing end.

[0004] β-amylase is used in maltose production and food processing because of its ability to produce maltose from starch. β-amylase has been found in sweet potatoes, wheat, barley, soybeans, etc., and has come to be known as an enzyme widely distributed in higher plants. On the other hand, it was long thought that β-amylase derived from microorganisms did not exist, but since the 1970s, β-amylases possessed by microorganisms have been discovered one after another (Non-Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2011-036237 A [Non-patent literature]

[0006] [Non-Patent Document 1] Experimental Methods for Starch and Related Carbohydrates (1989) [Non-Patent Document 2] Applied Glycoscience Vol. 1 No. 2 194-200(2011) Summary of the Invention [Problem to be solved by the invention]

[0007] Plant-derived β-amylase can be produced relatively cheaply, so plant materials have been the main source of industrial production of β-amylase to date. However, with the recent increase in global population and the growing demand for biofuels as renewable resources such as bioethanol, grain demand and grain prices have been on the rise worldwide. In light of this, it is unclear whether there will be a stable and cheap supply of grains, which are the raw material for plant-derived β-amylase, in the future.

[0008] Although β-amylases derived from microorganisms are being discovered one after another, few have been put to practical use. This is because the β-amylases derived from microorganisms reported so far have low heat resistance and production volume, and many of the producing bacteria are classified as pathogenic bacteria and are not suitable for use in food. Only Amano Enzyme Co., Ltd. sells β-amylase derived from Bacillus flexus as an industrial enzyme (Patent Document 1, Non-Patent Document 2). Although the heat resistance of this β-amylase derived from Bacillus flexus is relatively high compared to β-amylases derived from other microorganisms, it is lower than the soybean-derived enzyme, which is the most heat-resistant plant-derived enzyme, and cannot be said to have sufficient heat resistance. In addition, the soybean-derived enzyme, which has excellent heat resistance, is also known to have low decomposition activity for raw starch. Generally, when starch is enzymatically hydrolyzed industrially with amylase, the starch is heated once. However, from the viewpoint of recent energy conservation, it is desirable to be able to directly subject raw starch to an enzymatic reaction with high efficiency without heat gelatinization.

[0009] For these reasons, there is a demand for the development of β-amylases derived from non-pathogenic microorganisms. [Means for solving the problem]

[0010] The present inventors have surprisingly found that the non-pathogenic strain Bacillus halosaccharovorans No. 58, which they have newly isolated, produces a β-amylase that is more thermostable than those derived from conventional grains and microorganisms.

[0011] Thus, the present invention provides a bacterium identified by accession number NITE BP-02937. The present invention also provides a β-amylase produced by the bacterium identified by accession number NITE BP-02937.

[0012] The present invention also provides a method for producing a method for manufacturing a semiconductor device comprising the steps of: (i) the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 12, or (ii) an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added in the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 12; or (iii) A β-amylase having an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 12. Furthermore, the present invention provides a β-amylase that contains one or more substitutions selected from a substitution in which threonine at the position corresponding to amino acid number 4 in the amino acid sequence set forth in SEQ ID NO:2 is changed to proline, a substitution in which threonine at the position corresponding to amino acid number 15 is changed to lysine or arginine, or a substitution in which glutamine at the position corresponding to amino acid number 306 is changed to aspartic acid. Furthermore, the present invention provides (i) an amino acid sequence set forth in any one of SEQ ID NOs: 18 to 25; or (ii) an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added in any one of the amino acid sequences set forth in SEQ ID NO: 18 to SEQ ID NO: 25; or (iii) A β-amylase having an amino acid sequence having 90% or more sequence identity with any one of the amino acid sequences set forth in SEQ ID NO:18 to SEQ ID NO:25.

[0013] Furthermore, the present invention provides a DNA encoding the above-mentioned β-amylase. Furthermore, the present invention relates to a DNA encoding a protein having β-amylase activity, the DNA comprising: (i) a nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13 (ii) A nucleotide sequence that is 90% or more identical to the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13. (iii) providing a DNA that hybridizes under stringent conditions with the DNA having the base sequence represented by (i) or (ii). Furthermore, the present invention relates to a DNA encoding a protein having β-amylase activity, the DNA comprising: (i) a nucleotide sequence set forth in any one of SEQ ID NOs: 26 to 33; or (ii) a DNA having a base sequence having 90% or more sequence identity with any one of the base sequences set forth in SEQ ID NO: 26 to SEQ ID NO: 33; or (iii) providing a DNA that hybridizes under stringent conditions with the DNA having the base sequence represented by (i) or (ii). Furthermore, the present invention provides DNAs consisting of degenerate sequences of the nucleotide sequences represented by SEQ ID NO:1, SEQ ID NO:13 and SEQ ID NOs:26-33.

[0014] Furthermore, the present invention provides a vector carrying the above DNA. Furthermore, the present invention provides a microorganism having a vector carrying the above-mentioned DNA. Furthermore, the present invention provides a method for producing β-amylase, which comprises the step of extracting β-amylase from the above-mentioned bacterium or a culture of the above-mentioned microorganism. Furthermore, the present invention provides a method for producing maltose, which comprises treating starch with the above-mentioned β-amylase. Furthermore, the present invention provides a method for producing maltose, which comprises treating starch with the above bacterium or the above microorganism. Furthermore, the present invention provides a method for producing maltose, which comprises treating raw starch with the above-mentioned β-amylase. Furthermore, the present invention provides a method for modifying food using the above bacterium, or the above β-amylase, or the above microorganism. Furthermore, the present invention provides an enzyme preparation using the above bacterium, or the above β-amylase, or the above microorganism. Effect of the Invention

[0015] According to the present invention, a novel β-amylase having no pathogenicity is provided. [Brief description of the drawings]

[0016] [Figure 1] This shows the results of TLC analysis of starch degradation products produced by culture supernatants of candidate strains. [Diagram 2] FIG. 13 is a graph showing the temperature stability of amylase at 60° C. in the culture supernatant of strain No. 58. [Diagram 3] FIG. 1 shows the relationship between the amount of reducing sugar produced and the relative KI / I2 value for various amylases. [Figure 4] This is the result of subjecting purified β-amylase to SDS-PAGE. [Diagram 5] 1 shows the nucleotide sequence and deduced amino acid sequence of the β-amylase gene of the present invention. [Figure 6] 1 is a graph showing the optimum pH of β-amylase derived from No. 58 strain. [Figure 7] 1 is a graph showing the pH stability of β-amylase derived from No. 58 strain. [Figure 8] 1 is a graph showing the optimum temperature of β-amylase derived from No. 58 strain. [Figure 9] This is the result of comparing the residual enzyme activity when five types of β-amylase, including the β-amylase derived from No. 58 strain, were heat-treated at 60°C. [Figure 10] This is the result of comparing the residual enzyme activity when five types of β-amylase, including the β-amylase derived from No. 58 strain, were heat-treated at 65°C. [Figure 11] 1 is a graph showing the decomposition rate of raw starch when raw wheat starch was enzymatically treated with three types of β-amylase, including the β-amylase derived from the No. 58 strain. [Figure 12] 1 is a graph showing the decomposition rate of raw starch when raw corn starch was enzymatically treated with three types of β-amylase, including the β-amylase derived from the No. 58 strain. [Figure 13] This shows the results of SDS-PAGE of the purified mutant β-amylase enzyme. [Figure 14] This is a graph showing the temperature stability of amylase at 65°C in β-amylase mutant enzymes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] Properties of β-amylase The enzyme according to the present invention is a β-amylase, which degrades α-1,4 glucosidic bonds in glucose polysaccharides in starch from the non-reducing end to produce maltose units. The β-amylase produced by strain No. 58 has the following properties: (1) The substrate of the β-amylase of the present invention is not limited to starch. The β-amylase of the present invention can react with, for example, amylose, amylopectin, glycogen, and dextrin. (2) The molecular weight of this enzyme is approximately 60,000 Da. (3) The optimum temperature for this enzyme is about 50°C. When reacted with the substrate for 10 minutes at about 37°C to 60°C and pH 7.0, this enzyme exhibits 70% or more of the activity at 50°C. Furthermore, the activity of this enzyme is not lost even when treated at 60°C for 75 minutes. Even when treated at 65°C for 30 minutes, the activity is 40% of the activity at 50°C. (4) The optimum pH of this enzyme is about 7.0. When this enzyme is reacted with a substrate for 10 minutes at pH 6.0-9.0 and 37°C, it shows a residual activity of 80% or more compared to the activity at pH 7.0. In addition, even when this enzyme is left at pH 5.0-9.0 and 4°C for 16 hours, and then the pH is returned to 7.0 and it is reacted with a substrate for 10 minutes at 37°C, it still shows a residual activity of 80% or more compared to the activity of a sample left at pH 7.0 and 4°C for 16 hours. (5) It has activity against raw starch, and can degrade 65% of wheat-derived raw starch in 24 hours at 60°C and pH 7.0, and can degrade 27% of corn-derived raw starch in 8 hours at 70°C and pH 7.0. (6) It breaks down starch to produce only maltose.

[0018] The β-amylase of the present invention may be a β-amylase consisting of an amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 12, an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted and / or added in the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 12, or an amino acid sequence having 90% or more sequence identity with the amino acid sequence described in SEQ ID NO: 2 or SEQ ID NO: 12. The identity of the amino acid sequence is preferably 95%, more preferably 99% or more. In addition, the β-amylase of the present invention may be in the form of a fusion protein added to another protein, or may be immobilized on a resin such as beads, so long as it has β-amylase activity. Examples of the fusion protein include a protein bound to a debranching enzyme, isoamylase, pullulanase, glucosidase, glucoamylase, α-amylase, protease, lipase, phosphatase, xylanase, etc., and a protein fused with a histidine (His) tag, a maltose-binding protein (MBP) tag, or glutathione S-transferase (GST) for purification. The substitution is preferably conservative. Conservative substitution refers to a substitution that does not change the properties of the amino acid to be replaced, such as acidity or basicity. Specifically, it refers to a substitution between Phe, Trp, and Tyr, between Leu, Ile, and Val, between Lys, Arg, and His, between Asp and Glu, and between Ser and Thr. In particular, with regard to deletion at the N-terminus and / or C-terminus of the amino acid sequence, as long as it has an enzyme activity equivalent to that of β-amylase having the amino acid sequence represented by SEQ ID NO: 2, there is no limitation on the number of amino acids deleted at the N-terminus and / or C-terminus of the amino acid sequence, and such a deletion can be easily obtained without trial and error. The term "one to several" as used herein can be, for example, 1 to 9, preferably 1 to 8, more preferably 1 to 6, more preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, or more preferably 1 to 2. Furthermore, if the substitution site is selected from one or more of the following in the amino acid sequence described in SEQ ID NO: 2: a substitution in which threonine at amino acid position 4 is changed to proline (SEQ ID NO: 18), or a substitution in which threonine at amino acid position 15 is changed to lysine (SEQ ID NO: 19), or a substitution in which threonine at amino acid position 15 is changed to arginine (SEQ ID NO: 20), or a substitution in which glutamine at amino acid position 306 is changed to aspartic acid (SEQ ID NO: 21), or in the amino acid sequence described in SEQ ID NO: 12: a substitution in which threonine at amino acid position 33 is changed to proline (SEQ ID NO: 22), or a substitution in which threonine at amino acid position 44 is changed to lysine (SEQ ID NO: 23), or a substitution in which threonine at amino acid position 44 is changed to arginine (SEQ ID NO: 24), or a substitution in which glutamine at amino acid position 335 is changed to aspartic acid (SEQ ID NO: 25), a β-amylase with even better heat resistance can be obtained. The β-amylase of the present invention may be a β-amylase consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 18 to 25, or an amino acid sequence in which one to several amino acid residues have been deleted, substituted, inserted, and / or added in the amino acid sequence set forth in any one of SEQ ID NOs: 18 to 25, or an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in any one of SEQ ID NOs: 18 to 25. These sequences preferably have the above-mentioned substitutions. The identity of the amino acid sequence is preferably 95%, more preferably 99% or more.

[0019] In the present invention, identity is calculated as the percentage of matching bases or amino acids at corresponding positions between two sequences when the two sequences are aligned to maximize identity. Identity is calculated as the percentage of matching bases or amino acids at corresponding positions between two sequences when the following function is satisfied: Identity (%) = (number of matching bases or amino acids at corresponding positions between two sequences) / (total number of bases or amino acids in the reference sequence × 100) It can be expressed as: Analysis of amino acid sequences or comparison of the identity of two or more amino acid sequences can be performed using analysis programs commonly used by those skilled in the art. For example, GENETYX-WIN Ver. 7 can be used to analyze amino acid sequences, and BLAST search at NCBI (http: / / www.ncbi.nlm.nih.gov / ) can be used to search for identity of amino acid sequences. As with amino acid sequences, analysis and search of base sequences can also be performed using analysis programs commonly used by those skilled in the art.

[0020] The enzyme activity of the amylase of the present invention can be measured by any method that can quantitatively measure the sugars that are generated by the enzyme decomposing a substrate, for example, by using a reducing sugar quantification method such as the Somogyi-Nelson method. In addition to the quantitative detection method described above, the enzymatic reaction product of the amylase of the present invention may be detected using a qualitative detection method when the purpose is only to detect the sugar contained therein. This method is not particularly limited as long as it can identify the sugars contained in the analyte, and for example, a detection method using thin layer chromatography (TLC) is considered.

[0021] The β-amylase of the present invention may have at least 80% of the activity of unheated β-amylase even after heat treatment at 60° C. for 10 minutes. Furthermore, the enzyme may have at least 80% of the activity of unheated β-amylase even after heat treatment at 60° C. for 20, 40, or 80 minutes.

[0022] The β-amylase of the present invention may have raw starch decomposition activity. Raw starch in the present invention is starch that has not been heat-treated. Unlike heat-gelatinized starch, raw starch has a crystalline / granular structure. The crystalline structure of raw starch is destroyed by heating and hydration. The heating temperature varies depending on the type of raw starch. For example, starch derived from wheat or corn has a high gelatinization temperature, and heating to a gelatinization temperature of 80° C. or higher is required. Starch, which is the substrate for the enzyme, does not depend on a specific organism, and can be, for example, soybean, adzuki bean, barley, wheat, corn, rice, potato, sweet potato, kudzu, bracken, mung bean, broad bean, lotus root, cassava, sago palm, dogtooth violet, etc.

[0023] One specific example of the bacterium obtained in the present invention is Bacillus halosacchalovorans No. 58 (also referred to simply as "No. 58 strain" in this specification), which was deposited at the National Institute of Technology and Evaluation Patent Microorganism Deposit Center (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) under the deposit number NITE BP-02937 on April 12, 2019. The No. 58 strain is an aerobic bacterium with a rod-shaped cell morphology, which forms cream-colored colonies and forms spores. Since this strain is non-pathogenic, it can be suitably used in food and other applications. The β-amylase having the amino acid sequence set forth in SEQ ID NO:2 according to the present invention is an enzyme obtained from strain No. 58. Strain No. 58 has the DNA sequence set forth in SEQ ID NO:1 and has β-amylase, which is a protein having the amino acid sequence set forth in SEQ ID NO:2.

[0024] The β-amylase of the present invention can be obtained by culturing a bacterium having the DNA shown in SEQ ID NO:1, such as the No. 58 strain, or a recombinant having a vector containing said sequence, or into which said sequence has been incorporated. The No. 58 strain or recombinant can be cultured by a method generally used by those skilled in the art for amylase production. The host microorganism can also be one generally used by those skilled in the art. The host microorganism is not particularly limited, and examples that can be used include non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, and Bacillus subtilis. The culture conditions can be appropriately adjusted to be optimal for the host and expression system. The medium is not particularly limited as long as the culture target can grow in it. The medium may be solid or liquid, but is preferably liquid. As a more specific example, a β-amylase gene is inserted into an expression vector for E. coli, and E. coli is transformed. The resulting transformant is inoculated into 2 ml of 2×TY medium containing an antibiotic as necessary, and cultured with shaking at 30° C. for 24 hours to obtain bacterial cells, which are then collected and ultrasonically disrupted to obtain β-amylase in the disruption solution. Possible solid media include biomass derived from plant resources such as fruit residues of bananas, apples, oranges, etc., beans such as soybeans, and vegetable oil residues.

[0025] In the present invention, a culture is a mixture containing a substrate and its reaction product, and cultured cells, in which a microorganism is added to a culture substrate and cultured. The culture includes, but is not limited to, cultured microorganisms (inoculated microorganisms and microorganisms grown from the microorganisms), medium, medium supplements / additives, and substances secreted from the cultured microorganisms. The culture may be entirely or partially liquid or solid. A liquid culture is also called a culture solution. The culture preferably comprises at least one of cultured microorganisms and secretions from the cultured microorganisms. The culture is preferably a culture solution.

[0026] The DNA of the present invention is a DNA encoding the above-mentioned β-amylase. The DNA of the present invention is a DNA encoding a protein having β-amylase activity, (i) a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13 (ii) a nucleotide sequence that is 90% or more identical to the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13 or It may be a DNA that hybridizes under stringent conditions with the DNA having the base sequence represented by (i) or (ii). The term "identical" with respect to the base sequence is as explained above. Stringent conditions are generally known to those skilled in the art, and examples thereof include a condition in which hybridization is performed at 68°C in a commercially available hybridization solution, ExpressHyb Hybridization Solution (Takara Bio), or a condition in which hybridization is performed at about 65°C in the presence of 0.7M to 1.0M NaCl using a filter on which DNA is fixed, and then washing is performed at about 65°C using a 0.1 to 2x SSC solution (1xSSC solution: 150 mM NaCl, 15 mM sodium citrate, pH 7.0). The base sequence has a base sequence that is preferably 95% or more, more preferably 99% or more identical to the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13. The substitution site of the DNA sequence may be, for example, a substitution in which the 97th adenine base of SEQ ID NO:1 is changed to a cytosine base (SEQ ID NO:26), a substitution in which the 131st cytosine base of SEQ ID NO:1 is changed to an adenine base (SEQ ID NO:27), a substitution in which the 130th adenine base of SEQ ID NO:1 is changed to a cytosine base, the 131st cytosine base of SEQ ID NO:1 is changed to a guanine base, and the 132nd adenine base of SEQ ID NO:1 is changed to a cytosine base (SEQ ID NO:28), a substitution in which the 1003rd cytosine base of SEQ ID NO:1 is changed to a guanine base, and the 1005th adenine base of SEQ ID NO:1 is changed to a cytosine base (SEQ ID NO:29), or By selecting one or more of the following substitutions, a β-amylase with superior heat resistance can be obtained: a substitution in which the 10th adenine base is changed to a cytosine (sequence number 30); a substitution in which the 44th cytosine base of SEQ ID NO:13 is changed to an adenine base (sequence number 31); a substitution in which the 43rd adenine base of SEQ ID NO:13 is changed to a cytosine base, the 44th cytosine base of SEQ ID NO:13 is changed to a guanine base, and the 45th adenine base of SEQ ID NO:13 is changed to a cytosine base (sequence number 32); and a substitution in which the 916th cytosine base of SEQ ID NO:13 is changed to a guanine base and the 918th adenine base of SEQ ID NO:13 is changed to a cytosine base (sequence number 33). The DNA of the present invention is a DNA encoding a protein having β-amylase activity, (i) a nucleotide sequence set forth in any one of SEQ ID NOs: 26 to 33; (ii) a DNA having a base sequence having 90% or more, preferably 95% or more, more preferably 99% or more sequence identity with any one of the base sequences set forth in SEQ ID NO: 26 to SEQ ID NO: 33; or (iii) It may be a DNA that hybridizes under stringent conditions with a DNA consisting of the base sequence represented by (i) or (ii).

[0027] The DNA of the present invention may be a DNA consisting of a degenerate sequence of the nucleotide sequences set forth in SEQ ID NO: 1, SEQ ID NO: 13, and SEQ ID NO: 26 to 33. Here, degeneracy refers to the presence of multiple types of codons encoding one amino acid. Thus, for example, when one amino acid in a degenerate sequence is arginine, the nucleotide sequence may be a sequence corresponding to any of the six types of codons (CGU, CGC, CGA, CGG, AGA, AGG) that encode arginine.

[0028] The DNA of the present invention can be produced by using genetic engineering techniques commonly used by those skilled in the art. The DNA sequence shown in SEQ ID NO: 1 may be obtained by PCR using a corresponding primer, or may be synthesized based on the sequence information.

[0029] The DNA of the present invention can also be provided in the form of a vector carrying the DNA of the present invention. The vector is not limited as long as it is commonly used by those skilled in the art and satisfies the purpose of incorporating the gene of the present invention, and for example, pBluescript II SK (+) vector or pBluescript II SK (-) vector can be used.

[0030] The present invention provides a microorganism having a vector carrying the DNA of the present invention. The host microorganism is not particularly limited as long as it is one that is generally used as a vector carrier by those skilled in the art, and examples that can be used include non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, and Bacillus subtilis.

[0031] The present invention also provides a method for producing β-amylase. The β-amylase of the present invention may be obtained by isolating it from a culture medium of a microorganism containing β-amylase. The isolation method can be a method commonly used by those skilled in the art. The production method includes a step of culturing the cells and a step of extracting β-amylase from the culture or the cultured cells. In the step of culturing the bacterial cells, the No. 58 strain or a recombinant microorganism containing the DNA of the present invention is cultured. The host to be the recombinant is not particularly limited as long as it can be cultured and can express a protein, and examples of the host that can be used include non-pathogenic Escherichia coli, yeast, actinomycetes, algae, lactic acid bacteria, and Bacillus subtilis. The culture conditions can be appropriately adjusted to be optimal for the host and expression system. The medium is not particularly limited as long as the culture target can grow in it. The medium may be solid or liquid, but is preferably liquid. The culture method is not particularly limited as long as the culture target can grow. For example, static culture, shaking culture, anaerobic culture, etc. can be used. For example, the following conditions can be used when using the No. 58 strain: The medium used can be a liquid medium for amylase-producing bacteria, 2xTY medium (described in Tables 1 and 2 in the Examples), LB medium, Nutrient Agar medium (Difco), or the like. The pH of the medium is preferably 6.0 to 9.0, more preferably pH 7.0. The culture temperature is preferably 20 to 50°C, more preferably 45°C. The bacteria can be cultured under aerobic conditions as stationary culture, shaking culture or rotary culture.

[0032] In the step of recovering β-amylase from the culture or cultured cells, β-amylase can be obtained by purifying the culture or cultured cells containing β-amylase in the purification step. The method of purifying the enzyme is not particularly limited as long as β-amylase can be obtained from the culture or cultured cells. For example, the culture supernatant is subjected to centrifugation or filtration to remove cells and solids, and then the enzyme can be purified by combining filtration or concentration using an ultrafiltration filter, salting out, chromatography using a column, adsorption with activated carbon, etc. The column to be used is not particularly limited as long as it can separate the enzyme from other proteins and impurities without inactivating the enzyme, and examples of the column include an anion exchange chromatography column, a cation exchange chromatography column, a hydrophobic interaction chromatography column, a gel filtration chromatography column, and an affinity chromatography column. For example, a TOYOPEARL Butyl-650M column, which is a hydrophobic interaction chromatography column, and a TOYOPEARL DEAE-650M column, which is an anion exchange chromatography column, are used. The detection of the crudely purified or purified protein can be carried out by any method that can separate and detect the protein contained in the sample, for example, a method using electrophoresis such as SDS-PAGE. The buffer solution used for the enzyme activity measurement or enzyme purification described below can be appropriately changed depending on the purpose of the experiment. The buffer solution preferably has properties that do not affect the activity or stability of the enzyme. For example, Tris-HCl can be used as the buffer solution.

[0033] When cultured bacterial cells are used in the method for producing β-amylase of the present invention, the method further comprises a step of extracting β-amylase from the cultured bacterial cells. The method for extracting β-amylase from cultured cells is not particularly limited and may be any method known to those skilled in the art. β-amylase can be obtained, for example, by disrupting part or the whole of the cell surface structure (e.g., cell membrane) by solubilizing (sonication) the cells. The cells used for extraction may be live or dead. Since the β-amylase of the present invention produces only maltose from starch, the method for producing the β-amylase of the present invention makes it easy to produce maltose.

[0034] The present invention also provides a method for producing maltose, which comprises treating starch with the β-amylase of the present invention. Enzymatic treatment of starch is generally performed on starch that has been gelatinized by heating raw starch, so the saccharification process is performed before the enzymatic treatment. The heating temperature varies depending on the type of raw starch, but starch derived from wheat or corn has a high gelatinization temperature. If β-amylase with low heat resistance is used in this case, the enzyme will be inactivated by the heat of the heated starch, so it becomes necessary to cool the heated and gelatinized starch to a temperature appropriate for the enzyme reaction. This results in the cost of cooling the heated starch during the saccharification treatment of starch, as well as the cooling time. In addition, if the substrate is cooled before the reaction, the risk of bacterial growth increases. Since the β-amylase of the present invention has high heat resistance, it can reduce the cost of cooling starch and / or shorten the cooling time, and therefore can be suitably used in the saccharification of starch. Due to the high heat resistance of this β-amylase, it can be added to starch after heat treatment, or even to starch during heat treatment. As described in the above enzyme properties, the temperature and pH after the addition of β-amylase are not particularly limited as long as the enzyme can decompose starch, but the β-amylase of the present invention can be added when the temperature of the starch substrate is 70°C or lower, and can be added when the temperature is 60°C or higher and 70°C or lower. The starch substrate of the enzyme does not depend on a specific organism, and can be, for example, soybean, adzuki bean, barley, wheat, corn, rice, potato, sweet potato, kudzu, bracken, mung bean, broad bean, lotus root, cassava, sago palm, dogtooth violet, etc. The enzyme reaction can be stopped by inactivating the enzyme through chemical treatment such as reheating or pH adjustment. The β-amylase of the present invention can produce maltose from starch. Since the β-amylase of the present invention produces only maltose from starch, the present invention makes it easy to produce maltose.

[0035] The present invention also provides a method for producing maltose, which comprises treating starch with the microorganism of the present invention. When the No. 58 strain is cultured, it releases β-amylase from the cells as an extracellular enzyme into the culture medium. Therefore, when the No. 58 strain is cultured together with starch, β-amylase is released outside the cells, and the released β-amylase reacts with starch to produce maltose. As long as the β-amylase of the present invention can be released as an extracellular enzyme, the cells to be cultured are not limited to the No. 58 strain, and a recombinant microorganism having the β-amylase of the No. 58 strain may be used. The culture conditions are not particularly limited as long as the microorganism can be cultured, and may contain substances other than starch necessary for growth. Even if the microorganism does not release β-amylase outside the cell, as long as it takes in starch, converts the starch into maltose using the β-amylase inside the cell, and releases the maltose outside the cell, the recombinant microorganism used is not limited to a microorganism that can release β-amylase as an extracellular enzyme, but a microorganism that releases β-amylase outside the cell is preferred. Maltose can be produced from starch by the microorganism having the β-amylase of the present invention. The microorganism having the β-amylase of the present invention produces only maltose from starch, making it easy to produce maltose.

[0036] The present invention also provides a method for producing maltose, which comprises treating raw starch with the β-amylase of the present invention. Conventional β-amylases have low activity on raw starch and are not suitable for using raw starch as a substrate as it is. The β-amylase of the present invention has high enzymatic activity on raw starch and can be suitably used for enzymatic treatment of raw starch. The state of raw starch is not particularly limited as long as it is in a state in which the enzyme can react, but it is preferably in a state suspended in an aqueous solution. The temperature and pH after the addition of β-amylase are not particularly limited as long as the enzyme can decompose starch, as described in the above enzyme properties. The starch that is the substrate of the enzyme does not depend on a specific organism, and can be, for example, soybean, adzuki bean, barley, wheat, corn, rice, potato, sweet potato, kudzu, bracken, mung bean, broad bean, lotus root, cassava, sago palm, dogtooth violet, etc. The enzyme reaction can be stopped by inactivating the enzyme with chemical treatment such as heating or pH adjustment. The β-amylase of the present invention makes it possible to produce maltose from raw starch.

[0037] The present invention also provides a method for modifying food using the β-amylase of the present invention or the microorganism of the present invention. The modification of food refers to changing the characteristics of food. In the present invention, it refers to making the properties of food containing polysaccharides having α-1,4 glucoside bonds such as starch into a preferable form. For example, by blending the enzyme of the present invention into bread dough before baking, it is possible to improve the texture of the bread dough, increase the bread volume, prevent the aging of bread products (maintain softness), prevent the red color of bread dough stored frozen or refrigerated, and maintain the softness of mochi. Foods that can be used are not particularly limited, but are preferably foods containing polysaccharides having α-1,4 glucoside bonds such as starch. Examples include doughs for bread, mochi, donuts, pies, pizza, and buns. Raw materials are not limited to wheat-derived raw materials, and soybeans, red beans, barley, corn, rice, potatoes, sweet potatoes, kudzu, bracken, mung beans, broad beans, lotus root, cassava, sago palm, and dogtooth violets can also be used.

[0038] The β-amylase of the present invention is heat-resistant and active on raw starch, and therefore can be preferably used in food modification operations. In addition, since the No. 58 strain has only β-amylase as an extracellular enzyme, it does not cause excessive starch decomposition or Maillard reaction, which occurs when α-amylase or glucoamylase is used in bread dough. Therefore, the No. 58 strain is extremely useful as a source of purified β-amylase for these purposes. In addition, when the product is only maltose, it has the advantage of making the finished food have a mellow taste. The heat resistance of the enzyme also has the advantage that the reaction of the substrate can be easily controlled. Unlike many plant-derived β-amylases, which have an optimal pH on the acidic side and often require a pH adjuster for enzyme treatment, the optimal pH of the present enzyme is around neutral 7, so a pH adjuster may not be required. The activity of the enzyme on raw starch extends beyond that of non-gelatinized starches, allowing its use on a wide range of starch products and starch-containing substrates.

[0039] In addition, although this enzyme has excellent heat resistance, it does not retain its enzymatic activity even at high temperatures of 80°C or higher, and the enzymatic activity is lost at such temperatures. Due to this property, when this enzyme is kneaded into bread dough and baked, the enzymatic activity can be lost during the baking process. This allows the enzyme to react with the substrate only for the time required for the enzyme reaction, such as from the beginning to the middle of baking, and then the enzyme activity can be easily adjusted to eventually lose its activity.

[0040] The present invention is also provided in the form of an enzyme preparation containing the β-amylase of the present invention or the microorganism of the present invention. The enzyme in the enzyme preparation may be a purified enzyme or a crude enzyme such as a culture supernatant. The enzyme preparation may be composed of only β-amylase alone, or may contain additives as appropriate within a range that does not significantly impair the enzymatic properties. Examples of the form of the enzyme preparation include tablets, pills, powders, granules, capsules, and liquids. The enzyme preparation may be enclosed in a sprayer such as a spray, and may contain enzymes other than amylase. Examples of enzymes that may be contained together with the present enzyme include debranching enzymes, isoamylase, pullulanase, glucosidase, glucoamylase, α-amylase, protease, lipase, phosphatase, xylanase, etc., and one or more of these enzymes may be used in combination.

[0041] Examples of additives include binders (gum arabic, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone, etc.), fillers (lactose, sugar, calcium phosphate, sorbitol, glycine, etc.), disintegrants (crystalline cellulose, etc.), non-aqueous excipients (almond oil, fractionated coconut oil, or oily esters such as glycerin, propylene glycol, polyethylene glycol, and ethyl alcohol, etc.), preservatives (methyl or propyl p-hydroxybenzoate, sorbic acid, tocopherol, etc.), pH adjusters (sodium bicarbonate, potassium carbonate, citrates, acetates, etc.), thickeners (methylcellulose, etc.), antioxidants (vitamin C, vitamin E, etc.), flavors (synthetic flavors, natural flavors, esters, etc.), emulsifiers (lecithin, sorbitan monooleate, sucrose fatty acid esters, etc.), leavening agents (ammonium carbonate, etc.), and suspending agents (syrup, gelatin, water-added edible fats, etc.). The enzyme agent can be widely used for decomposing polysaccharides having α-1,4 glucoside bonds such as starch into maltose units to produce maltose, or for modifying food. For example, the enzyme agent can be added to dough for bread, mochi, donuts, pies, pizza, buns, etc. Also, the enzyme agent can be added to starchy grains such as wheat, soybeans, red beans, barley, corn, rice, potatoes, sweet potatoes, kudzu, bracken, mung beans, broad beans, lotus root, cassava, sago palm, and dogtooth violets, or to crushed grains thereof. Before the addition of the enzyme agent, pretreatment such as crushing, heating, or chemical treatment may be performed. The treatment conditions after the addition of the enzyme agent can be appropriately determined by those skilled in the art.

[0042] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0043] Experiment 1: Screening and identification of bacteria with thermostable β-amylase We isolated and separated β-amylase-producing thermotolerant bacteria from soil samples. The original soil for screening was obtained from Osaka Prefecture. A starch-utilizing strain was isolated from this soil. The isolated strain was cultured in a medium for amylase-producing bacteria (Table 1).

[0044] [Table 1] The basic pH was 7.0, and the medium composition and pH were changed depending on the experiment. When used for screening, the medium was adjusted to pH 7.0, and 1.0% gellan gum was added in addition to the above composition, and solidified on the plate before use.

[0045] A loopful of the isolated starch-utilizing strain was inoculated into a test tube containing 6 ml of liquid medium for amylase-producing bacteria, and cultured with shaking at 60°C for 3 days. After the culture was completed, the culture solution was centrifuged (3200 rpm, 10 min, 4°C) to collect the culture supernatant, which was used as a crude enzyme sample. 100 μl of this crude enzyme sample was added with 100 μl of substrate solution (1.5% soluble starch (Merck), 100 mM pH 7.0 Tris-HCl, 5 mM CaCl2) and reacted overnight at 37°C. 5 μl of the reaction solution after the reaction was subjected to thin-layer chromatography.

[0046] Thin Layer Chromatography (TLC) The silica gel plate used in the thin-layer chromatography was Silica Gel 60 F254 (Merck). The developing solvent used was 1-butanol / ethanol / chloroform / 25% (w / w) ammonia solution: (4 / 5 / 2 / 8, v / v / v / v). Maltose was detected by spraying the detection solution (concentrated sulfuric acid containing 1% vanillin) three times onto the silica gel plate after development, and then heating at 120°C for several minutes to cause color development.

[0047] The results of TLC are shown in Figure 1. As a result of screening, several maltose-producing strains were obtained. After careful examination of these strains, it was confirmed that one strain produced only maltose from soluble starch (Figure 1: No. 58 in the box; c is the control). This resulted in the selection of No. 58 strain, which had high maltose production ability.

[0048] Amylase activity measurement (reducing sugar quantification method) 100 μl of enzyme sample (culture supernatant or crude or purified enzyme described below) was taken in a test tube and pre-incubated at 37°C for 10 minutes. 100 μl of substrate solution (1.5% soluble starch, 100 mM Tris-HCl, 5 mM CaCl2, pH 7.0, 37°C) was added and reacted at 37°C for 10 minutes. The enzyme reaction was stopped by adding 400 μl of DNS solution (0.5% dinitrosalicylic acid, 0.4 N NaOH, 30% potassium sodium tartrate tetrahydrate). Next, the mixed solution was boiled at 100°C for 5 minutes, cooled in cold water for 5 minutes, and 1.8 ml of distilled water was added and stirred. The absorbance at 480 nm of the stirred solution was measured using a spectrophotometer. A blank was prepared by reacting distilled water instead of the enzyme sample, and the measurement value for the blank was subtracted from the measurement value for the enzyme sample. One unit (U) of enzyme activity was defined as the amount of enzyme that produces 1 μmol of maltose per minute. Enzyme reactions in the following experiments were also carried out in this manner unless otherwise specified. The protein concentration was determined by measuring the absorbance at 280 nm using a spectrophotometer.

[0049] Confirmation of β-amylase The temperature stability of the amylase possessed by the obtained No. 58 strain was evaluated. The obtained No. 58 strain was cultured, and the culture supernatant was collected to obtain a culture supernatant sample. The culture supernatant sample, which had been appropriately diluted, was placed in a microtube, and after incubation at 60°C, samples were taken after 10, 20, 40, and 80 minutes, and then cooled on ice. The remaining enzyme activity of the sample after cooling was measured by quantifying the amount of reducing sugar produced, and the temperature stability of the obtained amylase at 60°C was evaluated. As a control, a sample obtained by treating β-amylase derived from Brevibacillus sp. TMK-672 strain (TBA strain) in the same manner was used. The results are shown in Figure 2. The data are shown as relative values, with the value at 0 minutes of treatment taken as 100%. In Figure 2, No. 58 represents the strain of the present invention, and TBA represents the comparative subject. Furthermore, confirmation of whether the obtained amylase was β-amylase was performed by determining the relationship between the amount of reducing sugar produced and the relative KI / I2 value.

[0050] The relative KI / I2 value was calculated as follows: 200 μl of the enzyme solution was placed in a test tube and pre-incubated at 37°C for 10 minutes. 400 μl of the substrate solution, which had also been pre-incubated, was added, and the mixture was reacted at 37°C for 10 minutes. The reaction was stopped by adding 1 ml of a reaction stop solution (a mixture of 0.5N acetic acid and 0.5N HCl in a ratio of 5:1). 200 μl of the reaction solution after the reaction was stopped was placed in another test tube, 5 ml of iodine solution (0.005% I2, 0.05% KI) was added, and the absorption at 660 nm was measured with a spectrophotometer after 20 minutes. The relative KI / I2 value when the amount of reducing sugar was 0 was set to 100%. The concentration of the sample to be measured was appropriately changed, and this value was plotted against the value obtained by the reducing sugar quantification method described above. As a positive control for α-amylase, human saliva-derived α-amylase and as a positive control for β-amylase, β-amylase derived from the TMK-672 strain were used to compare the results and determine whether the amylase derived from the obtained strain was β-amylase. The results are shown in Figure 3. In Figure 3, HSA represents α-amylase derived from human saliva.

[0051] From the results in Figure 2, it was revealed that the enzyme derived from No. 58 strain did not show any decrease in activity within the time period examined, making it an enzyme with extremely high temperature stability. From the results in Figure 3, the plot of the enzyme derived from No. 58 strain matched with that of the β-amylase derived from TMK-672 strain, making it clear that this enzyme is a β-amylase that cleaves starch chains in maltose units from the non-reducing end of the starch chain.

[0052] Preparation of chromosomal DNA The No. 58 strain was inoculated into 100 ml of 2 × TY liquid medium (Table 2) and cultured at 37°C for 2 days, and the cells were harvested by centrifugation (6,000 rpm, 10 min, 4°C). Next, the cells were suspended in 9 ml of Solution I (50 mM glucose, 25 mM Tris-HCl, EDTA, pH 8.0), after which several mg of lysozyme was added and incubated at 37°C for 2 hours or more.

[0053] [Table 2] The pH was adjusted to 7.0. In some experiments, ampicillin was added to the medium at a concentration of 100 μg / ml.

[0054] Then, 10% SDS solution was added to the Solution I solution containing the cultured bacteria so that the final concentration was 0.5%, and the mixture was shaken for 10 minutes. Furthermore, 5M NaCl solution was added to this mixed solution so that the final concentration of NaCl was 0.7M or more, and the mixture was shaken for 10 minutes. Then, phenol / chloroform extraction was performed, and the resulting phenol / chloroform-added solution was centrifuged (13,500 rpm, 10 minutes, 4°C) to separate the aqueous layer and the oil layer, and the aqueous layer was collected. 12 ml of ice-cold 2-propanol was added to the collected material, and after mixing by inversion, the DNA precipitate was sucked up and collected with a Pasteur pipette. The DNA was rinsed twice with 30 ml of 70% ethanol, transferred to a new tube, dried under reduced pressure, and suspended in 500 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). 5 μl of RNase A solution (10 mg / ml) was added to the suspension, and the mixture was incubated at 37°C for 30 minutes, after which it was extracted again with phenol / chloroform. 50 μl of 3M sodium acetate and 500 μl of ice-cold 2-propanol were added and left on ice for 10 minutes. The DNA precipitate was collected by sucking with a Pasteur pipette, rinsed twice with 1 ml of 70% ethanol, transferred to an empty tube, dried under reduced pressure, and dissolved in 300 μl of TE buffer.

[0055] Obtaining and analyzing 16S rRNA The 16S rRNA gene was amplified by PCR. The template was the extracted chromosomal DNA, and the primers used were a forward primer (5´- AGRRTTTGATYHTGGYTCAG 3´: SEQ ID NO: 3) and a reverse primer (5´- TGACGGGCGGTGTGTACAAG -3´: SEQ ID NO: 4) designed based on a region highly conserved in the bacterial 16S rRNA gene. PCR amplification of the 16S rRNA region was performed using PrimeSTAR HS DNA polymerase (Takara Bio), and the temperature cycle was 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 90 seconds for 30 cycles. The PCR product obtained was inserted into pBluescript II SK (+) (Stratagene) digested with EcoR V, transformed into E. coli, and the plasmid was extracted. Sequence analysis was outsourced to Eurofins Genomics. The nucleotide sequences were analyzed using GENETYX-WIN Ver. 7 (GENETYX), and the BLAST search of NCBI (http: / / www.ncbi.nlm.nih.gov / ) was used to search for identity of the nucleotide sequences.

[0056] Through these analyses, the No. 58 strain of the present invention was identified as Bacillus halosaccharovorans No. 58 strain (No. 58 strain). This strain was deposited at the Patent Microorganism Deposit Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on April 12, 2019. The accession number is NITE BP-02937.

[0057] Experiment 2 Purification of β-amylase Mass cultivation of strain No. 58 and obtaining crude enzyme solution In eight 2.0 L Erlenmeyer flasks containing 650 ml of amylase-producing medium with a composition changed to 1.5% dextrin, 0.3% peptone, 0.3% yeast extract, and 0.3% CaCl2, 6.5 ml of the No. 58 strain solution that had been shake-cultured at 45°C for 48 hours was inoculated and shake-cultured for 48 hours at 45°C. The culture solution of No. 58 strain was centrifuged (9,000 rpm, 60 minutes, 4°C) to recover the culture supernatant, which was used as a crude enzyme solution. The protein concentration was determined by measuring the absorbance at 280 nm using a spectrophotometer.

[0058] Purification using TOYOPEARL Butyl-650M column To the 5.0 L of the obtained culture supernatant, 570 g of ammonium sulfate was added little by little while stirring to 20% saturation and dissolved. After dissolution, the supernatant was collected by centrifugation (10,800 rpm, 60 min, 4°C). The collected supernatant was poured into 100 ml of TOYOPEARL Butyl-650M equilibrated with 20 mM Tris-HCl buffer (pH 7.0) containing 20% ​​saturated ammonium sulfate, and washed with 2.0 L of the same buffer. The adsorbed substance was eluted with a reverse linear gradient (1.0 L) of 20 mM Tris-HCl buffer (pH 7.0) containing 20-0% saturated ammonium sulfate, and fractionated into 10 ml portions. The activity of each fraction was measured, and the fraction showing β-amylase activity was collected, ammonium sulfate was added to the mixture to 80% saturation, dissolved, and precipitates were formed at 4°C overnight. The precipitate was collected by centrifugation (10,800 rpm, 30 min, 4° C.) The collected precipitate was dissolved in a small amount of 20 mM Tris-HCl buffer (pH 7.0) and dialyzed against a large excess of 20 mM Tris-HCl buffer (pH 7.0) using a dialysis membrane.

[0059] Purification using TOYOPEARL DEAE-650M column The obtained dialyzed sample was loaded onto a TOYOPEARL DEAE-650M (100 ml) equilibrated with 20 mM Tris-HCl buffer (pH 7.0), washed with 500 ml of the same buffer, and the adsorbed substances were eluted with a linear gradient (1.0 L) of 20 mM Tris-HCl buffer (pH 7.0) containing 0-300 mM NaCl, and fractionated into 10 ml portions. The activity of each fraction was measured, and fractions showing β-amylase activity were collected, precipitated with ammonium sulfate, and dialyzed against a large excess of 20 mM Tris-HCl buffer (pH 7.0).

[0060] SDS-PAGE SDS-PAGE was performed according to the method of Laemmli (Laemmli UK, Nature, 227, 680-685, 1970). A polyacrylamide gel (acrylamide: N,N'-methylenebisacrylamide = 29.2:0.8) consisting of a 12.5% ​​separating gel and a 5.0% concentrating gel was prepared. 6x sample buffer (0.375M Tris-HCl, 60% glycerol, 6% 2-mercaptoethanol, 0.003% bromophenol blue, pH 6.8) was added to the sample and treated at 100°C for 10 minutes. Using a vertical slab electrophoresis device (ATTO), the sample was added to the polyacrylamide gel in 6x sample buffer and heated, and electrophoresis was performed at a constant current of 20 mA in the electrophoresis buffer (0.1% SDS, 25 mM Tris, 192 mM glycine). After electrophoresis, the samples were stained in CBB solution (0.2% Coomassie Brilliant Blue R-250, 50% ethanol, 10% acetic acid) and destained in destaining solution (10% methanol, 7.5% acetic acid). Protein Molecular Weight Marker (Broad) (Takara Bio) was used as a molecular weight marker for proteins.

[0061] The results of this series of purification experiments are shown in Table 3.

[0062] [Table 3]

[0063] The purified enzyme obtained from a series of purification experiments was subjected to SDS-PAGE, and the results are shown in Figure 4. As shown in Figure 4, a single band showing a molecular weight of 59.4 kDa was obtained by purification, indicating that the enzyme could be purified as a single enzyme. The purified enzyme obtained was used hereafter.

[0064] Experiment 3: β-amylase sequence analysis N-terminal amino acid sequence analysis After performing SDS-PAGE using the purified sample, the gel was gently shaken in blotting solution C (0.02% SDS, 25 mM Tris, 20% methanol, 25 mM boric acid) for 5 minutes. Six pieces of filter paper cut to the gel size were prepared, and two pieces each were immersed in blotting solution A (0.02% SDS, 300 mM Tris, 20% methanol), blotting solution B (0.02% SDS, 25 mM Tris, 20% methanol), and blotting solution C, and shaken for 15 minutes. In addition, a PVDF membrane (MILLIPORE) was cut to the gel size, shaken in methanol for 10 minutes, and then immersed in blotting solution C for 15 minutes. Next, from the negative pole of a semi-dry blotting device (Bio-Rad), stack two pieces of filter paper (blotting solution C), a gel, a PVDF membrane, two pieces of filter paper (blotting solution B), and two pieces of filter paper (blotting solution A) in that order, and place the gel at 1 cm depth. 2 Proteins were transferred to a PVDF membrane by electrophoresis for 50 minutes at a constant current of 2 mA per sample. After transfer, the PVDF membrane was lightly washed with ultrapure water, stained with Ponceau S staining solution (0.1% Ponceau S, 5% acetic acid) for 5 minutes, and then destained with ultrapure water. The band of interest was cut out, collected in a tube, and dried. Sequence analysis was outsourced to the Hokkaido University Global Facility Center Instrumental Analysis Contract Service. Analysis of the N-terminal amino acid sequence revealed that it was H2N-Glu-Ile-Lys-Thr-Asp-Tyr-Lys-Ala-Ser-Val-.

[0065] Cloning of the β-amylase gene The β-amylase gene was amplified by PCR. The template was the chromosomal DNA of strain No. 58 prepared by the method described in Experiment 1, and the primers used were the forward primer (5'-GTNTGGTGGGGNTAYGTNGA-3': SEQ ID NO: 5) and the reverse primer (5'-GGRTTRTTCATYTGCCARTG-3': SEQ ID NO: 6) designed based on a region highly conserved among bacterial β-amylases. PCR amplification was performed using PrimeSTAR HS DNA polymerase (Takara Bio Inc.), and the temperature cycle was 98°C for 10 seconds, 55°C for 5 seconds, and 72°C for 50 seconds for 30 cycles. The PCR product obtained was ligated to pBluescript II SK(-) digested with the restriction enzyme EcoR V, and transformed into E. coli. The strain was inoculated into 2 ml of 2xTY medium (containing 100 μg / ml ampicillin) and cultured at 30°C for 24 hours with shaking. Plasmids were extracted from the transformed E. coli and sequence analysis was performed to confirm that the plasmid contained a β-amylase sequence. Using the plasmid containing the obtained gene as a template, primers PS-F (5'-GGCAGCCCAGGTAATTTCTAC-3': SEQ ID NO: 7) and PS-R (5'-GGAGGGTTGACTTCACTCCA-3': SEQ ID NO: 8), which were designed from the determined β-amylase gene sequence, were used to synthesize a DIG (digoxigenin)-labeled probe. No. 58 strain genomic DNA was digested overnight with a combination of 10 restriction enzymes (Sac I, BamH I, Xba I, Sal I, Sph I, Hind III, Bgl II, Spe I, Nhe I, Xho I) and EcoR I and Kpn I, which have cutting sites in the obtained gene, and Southern blot analysis was performed using the synthesized probe. From this, it was predicted that the full-length gene of interest was contained in the Bgl II-digested gene fragment of approximately 6.3 kb. Therefore, the Bgl II-digested gene fragment equivalent to a size of approximately 6.3 kb was recovered and ligated to pBluescript II SK(-) digested with BamH I restriction enzyme, and then transformed into Escherichia coli.Plasmids containing the target gene were obtained by screening using the primers used to prepare the probe, digested with various restriction enzymes, subcloned into pBluescript II SK(-), and sequenced.

[0066] The results of the sequence analysis are shown in Figure 5. The obtained sequence consisted of 2536 bp (SEQ ID NO: 11), of which this gene consisted of an open reading frame (ORF) (SEQ ID NO: 1) consisting of 1,659 bp, and it was found that there was a ribosome binding site (RBS) 6 bp upstream of the start codon, a promoter region consisting of a -10 region approximately 56 bp upstream, and a -35 region approximately 82 bp upstream.

[0067] Analysis of the predicted amino acid sequence revealed that this gene is synthesized as a precursor protein consisting of 552 amino acids (SEQ ID NO: 12, corresponding base sequence is SEQ ID NO: 1). A sequence that perfectly matches the determined amino acid sequence of the N-terminal region was found, and this sequence revealed the presence of a signal sequence consisting of 29 amino acids (underlined in the figure), and the mature protein was found to be composed of 523 amino acids, with a molecular weight calculated from the amino acid sequence of 59,403 (SEQ ID NO: 2, corresponding base sequence is SEQ ID NO: 13). It was found that the mature protein is composed of a catalytic domain classified as Glycoside hydrolase family 14 (GH14) in the N-terminal region and a substrate-binding domain classified as Carbohydrate-binding module 20 (CBM20) on the C-terminal side.

[0068] Experiment 4: Examination of the properties of β-amylase Optimal pH and pH stability To determine the optimal pH of β-amylase, the purified enzyme was reacted with the substrate and the enzyme activity was measured in 50 mM universal buffer (McElvain buffer) of pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.2, 8.5, 9.0, 9.5, 10.0, and 10.75 in the same manner as the above amylase activity measurement except for pH. To confirm pH stability, the enzyme solution was added to 50 mM universal buffer of pH 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.2, 8.5, 9.0, 9.5, 10.0, and 10.75, and each mixed solution was left at 4°C for 16 hours. The mixed solution was diluted 10-fold with 100 mM Tris-HCl buffer (pH 7.0) to return the pH to 7.0. These diluted mixed solutions were reacted at 37°C for 10 minutes in the same manner as in the above-mentioned amylase activity measurement, and their residual activity was measured. The measurement results for pH optimum are shown in FIG. 6, and the measurement results for pH stability are shown in FIG. 7. In FIG. 6 and FIG. 7, the vertical axis is the relative activity value with the measured maximum activity value taken as 100%. As shown in FIG. 6, the enzyme showed maximum activity around pH 7.0. As shown in FIG. 7, it was revealed that the enzyme showed a residual activity of 80% or more in the pH range of 5.0 to 9.0.

[0069] Optimal temperature and temperature stability To determine the optimal temperature for β-amylase, the enzyme solution was reacted with the substrate for 10 minutes at temperatures between 37 and 70°C, using the same method as in the above-mentioned amylase activity measurement, except for the temperature, to measure the enzyme activity. The temperature stability was also measured by treating the enzyme solution (20 mM Tris-HCl buffer, pH 7.0) at 37, 45, 50, 55, 60, 65, and 70°C for 30 minutes, cooling it, and reacting it at 37°C for 10 minutes using the same method as in the above-mentioned amylase activity measurement. In addition, for 60°C and 65°C, the time course of the treatment time (15, 30, 45, 60, and 75 minutes) was taken, and the residual activity was also measured for soybean β-amylase, Brevibacillus sp. TMK-672 strain-derived β-amylase, Bacillus cereus-derived β-amylase, and barley-derived β-amylase, and the results were compared. FIG. 8 shows the results of the measurement of the optimum temperature, FIG. 9 shows the residual activity of each β-amylase at 60°C, and FIG. 10 shows the residual activity of each β-amylase at 65°C. FIG. 8 shows the relative activity value for each temperature, with the measured maximum activity value taken as 100%. In the graphs of the treatment time in FIG. 9 and FIG. 10, the value at 0 minutes of treatment is taken as 100% and the relative value is shown. From FIG. 8, it was found that the optimum temperature of this enzyme is around 50°C. From FIG. 9, the activity of the barley-derived β-amylase, the Bacillus cereus-derived β-amylase, and the Brevibacillus sp. TMK-672-derived β-amylase decreased in this order, and soybean-derived β-amylase, which is known to have heat resistance, showed about 80% residual activity after 60 to 80 minutes of treatment. On the other hand, the No. 58-derived β-amylase showed better heat resistance than soybean-derived β-amylase, and maintained 100% residual activity even after the heat treatment in this experiment. 10, after 30 minutes of heat treatment at 65° C., the remaining activity was about 25% for the soybean-derived enzyme and about 40% for the No. 58 strain-derived enzyme. These values ​​demonstrate that the β-amylase of the present invention exhibits superior heat resistance even at 65° C. compared with soybean-derived β-amylase and the like.

[0070] Raw starch decomposition activity An experiment was carried out to compare the decomposition activity of β-amylase on raw starch. Raw starch derived from corn and wheat was used. 1.0 mg / ml of each raw starch was reacted in the presence of 20 mM Tris-HCl buffer (pH 7.0), 5 mM CaCl2, and 0.1 μg / ml of enzyme, and the reaction was stopped by adding an appropriate amount of the reaction solution to a test tube containing 0.4 ml of DNS solution, and the raw starch decomposition activity was evaluated by the reducing sugar quantification method described in Experiment 1. As the β-amylase, the β-amylase of the present invention, β-amylase derived from barley, and β-amylase derived from soybean were used. β-amylase derived from barley is known to have raw starch decomposition activity, and β-amylase derived from soybean is known to have low activity on raw starch but high heat resistance. Wheat-derived starch was reacted at 60°C, and corn-derived starch was reacted at 70°C. The reaction results for wheat-derived starch are shown in FIG. 11, and the reaction results for corn-derived starch are shown in FIG. 12. As shown in FIG. 11, the barley-derived β-amylase and the soybean-derived β-amylase showed almost no degradation activity on wheat-derived raw starch, but the β-amylase of the present invention decomposed the raw starch by 65% ​​in 24 hours. Similarly, the results of FIG. 12 show that the barley-derived β-amylase and the soybean-derived β-amylase showed almost no degradation activity on corn-derived raw starch, but the β-amylase of the present invention decomposed the raw starch by 27% in 8 hours. These results show that the present enzyme decomposed raw starch well under high temperature conditions where the barley-derived enzyme, which has a relatively high raw starch degradation activity, cannot react. Furthermore, the soybean-derived enzyme, which has high temperature stability but low raw starch degradation activity, did not decompose raw starch. These results demonstrated that the β-amylase from strain No. 58 has a high ability to degrade raw starch and its activity is highly heat-resistant.

[0071] Experiment 5 Expression of β-amylase gene in Escherichia coli The β-amylase gene from strain No. 58 was heterologously expressed in E. coli. To express the β-amylase gene in E. coli, a DNA fragment containing the coding region and ribosome binding site of the β-amylase gene was first amplified by PCR using a plasmid containing the β-amylase gene as a template and primers RBS-F (5'-CCGAGCTCCTCGAGGCGTTTGCTTAGGTTTACGTA-3': SEQ ID NO: 9) and exp-R (5'-CCCTGCAGGATCCTACCACTGTATTGTATAACTTG-3': SEQ ID NO: 10). The amplified DNA fragment was cleaved with Xho I and Pst I, and inserted into pBluescript SK (-) cleaved with the same restriction enzymes to transform E. coli BL21 (DE3). The PCR conditions were the same as those in Experiment 3. The obtained transformant was inoculated into 2 ml of 2xTY medium (supplemented with 100 μg / ml ampicillin) and cultured at 30°C for 24 hours with shaking. The cells were collected by centrifugation (10,000 rpm, 2 min, 4°C), suspended in 1 ml of 20 mM Tris-HCl buffer pH 7.0, 5 mM CaCl2, and then ultrasonically disrupted for 4 cycles of 30 seconds using a Handy sonic disruptor UD1 (Tomy Seiko Co., Ltd.). The disrupted solution was centrifuged (15,000 rpm, 10 min, 4°C), and the supernatant was used as a crude enzyme. Amylase activity was measured, and the production of reducing sugars was confirmed using soluble starch as a substrate. The reaction product was detected by TLC, and was found to be only maltose. The enzyme activity was 55.1 U / ml per ml of culture solution.

[0072] Experiment 6 Site-directed mutagenesis of β-amylase gene Site-directed mutagenesis was performed on the β-amylase gene derived from strain No. 58, mutant enzymes were produced, and their enzyme activities were measured. Site-specific mutagenesis into the β-amylase gene was carried out by the PCR-mega primer method. First, using a plasmid containing the coding region and ribosome binding site of the β-amylase gene as a template, PCR was carried out in the same manner as in "Cloning of the β-amylase gene" using four types of mutagenesis primers (SEQ ID NO: 14 to 17) and the exp-R primer (SEQ ID NO: 10) shown in Table 4 below, to obtain mega primers. Next, PCR was performed in the same manner using the obtained mega primer and RBS-F primer (SEQ ID NO: 9) and the above plasmid containing the coding region and ribosome binding site of the β-amylase gene as a template to obtain the full-length β-amylase gene with the mutation. Expression plasmids were constructed from this gene fragment in the same manner as in Experiment 5, and these were transformed into the E. coli BL21 (DE3) strain to obtain transformants that produce the β-amylase mutant enzyme.

[0073] [Table 4]

[0074] Each of the obtained transformants was cultured and the cells were disrupted to obtain a crude enzyme in the same manner as in Experiment 5. The crude enzyme was purified in the same manner as in Experiment 2. The purification results of each mutant enzyme are shown in Figure 13. The temperature stability of these purified enzymes was evaluated in the same manner as in "Confirmation of β-amylase". Each enzyme sample was placed in a microtube, incubated at 65°C, sampled after 15, 30, and 60 minutes, and cooled on ice. The remaining enzyme activity of the cooled sample was measured by quantifying the amount of reducing sugar produced, and the temperature stability of the obtained amylase at 65°C was evaluated. As a control, the unmutated purified enzyme was also treated in the same manner and the temperature stability was evaluated. The results are shown in Figure 14. The data are shown as relative values, with the value at 0 minutes of treatment taken as 100%. In Figure 14, wt represents the β-amylase of the No. 58 strain of the present invention, and T4P, T15K, T15R, and Q306D represent mutant enzymes (for example, in the case of T4P, the fourth amino acid residue T in SEQ ID NO: 2 is mutated to P). The residual activity after 60 minutes was 37.7% for the unmutated β-amylase, compared with 80.9% for T4P, 50.1% for Q306DE, 44.4% for T15K, and 44.2% for T15R, indicating that the mutant enzymes had improved thermal stability compared to the unmutated β-amylase. The β-amylase mutant enzymes possessed by the four transformants obtained each have a mutation in which threonine at amino acid position 4 in the amino acid sequence set forth in SEQ ID NO: 2 is changed to proline (SEQ ID NO: 18: T4P in Figure 14), or a mutation in which threonine at amino acid position 15 is changed to lysine (SEQ ID NO: 19: T15K in Figure 14), or a mutation in which threonine at amino acid position 15 is changed to arginine (SEQ ID NO: 20: T15R in Figure 14), or a mutation in which glutamine at amino acid position 306 is changed to aspartic acid (SEQ ID NO: 21: Q306D in Figure 14).

Claims

1. (i) the amino acid sequence set forth in SEQ ID NO: 2; or (ii) an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 2; or (iii) an amino acid sequence having 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:2 and a β-amylase having a β-amylase activity on soluble starch after heat treatment at 60°C for 80 minutes that is at least 80% of that of a non-heat-treated β-amylase having the same amino acid sequence.

2. The β-amylase of claim 1, which comprises one or more substitutions selected from the following: a substitution of threonine at the position corresponding to amino acid position 4 with proline, a substitution of threonine at the position corresponding to amino acid position 15 with lysine or arginine, or a substitution of glutamine at the position corresponding to amino acid position 306 with aspartic acid, in reference to the amino acid sequence set forth in SEQ ID NO:

2.

3. (i) an amino acid sequence set forth in any one of SEQ ID NOs: 18 to 21; or (ii) an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added in any one of the amino acid sequences set forth in SEQ ID NO:18 to SEQ ID NO:21; or (iii) an amino acid sequence having 95% or more sequence identity with any one of the amino acid sequences set forth in SEQ ID NOs: 18 to 21; The β-amylase according to claim 2,

4. The β-amylase according to any one of claims 1 to 3, having raw starch decomposition activity.

5. The β-amylase according to any one of claims 1 to 4, having raw starch decomposition activity at 60°C.

6. A β-amylase produced by a bacterium identified by accession number NITE BP-02937.

7. A DNA encoding the β-amylase according to any one of claims 1 to 3.

8. A protein having β-amylase activity, which has at least 80% of β-amylase activity against soluble starch after heat treatment at 60° C. for 80 minutes compared to a non-heat-treated β-amylase having the same amino acid sequence, or a DNA encoding the protein and a signal sequence, wherein the DNA is (i) a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13, or (ii) A DNA having a nucleotide sequence that is 95% or more identical to the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO:

13.

9. A protein having β-amylase activity, which has at least 80% of β-amylase activity against soluble starch after heat treatment at 60° C. for 80 minutes compared to a non-heat-treated β-amylase having the same amino acid sequence, or a DNA encoding the protein and a signal sequence, wherein the DNA is (i) a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 13, or (ii) a nucleotide sequence that is 95% or more identical to the nucleotide sequence represented by SEQ ID NO:1 DNA having either

10. A protein having β-amylase activity, which has at least 80% of β-amylase activity against soluble starch after heat treatment at 60° C. for 80 minutes compared to a non-heat-treated β-amylase having the same amino acid sequence, or a DNA encoding the protein and a signal sequence, wherein the DNA is (i) a nucleotide sequence set forth in any one of SEQ ID NOs: 26 to 33, or (ii) a nucleotide sequence having 95% or more sequence identity with any one of the nucleotide sequences set forth in SEQ ID NO:26 to SEQ ID NO:33 DNA having either

11. The DNA according to claim 8 or 10, which has a base sequence that is 99% or more identical to the base sequence represented by SEQ ID NO: 1 or SEQ ID NO:

13.

12. A DNA consisting of a degenerate sequence of the base sequence represented by any one of SEQ ID NO: 1, SEQ ID NO: 13, and SEQ ID NO: 26 to 33.

13. A vector comprising the DNA according to any one of claims 7 to 12.

14. A microorganism comprising the vector of claim 13.

15. A bacterium identified by accession number NITE BP-02937.

16. A method for producing β-amylase, comprising the steps of culturing the microorganism described in claim 14 or the bacterium described in claim 15, and extracting β-amylase from the culture.

17. A method for producing maltose, comprising treating starch with the β-amylase according to any one of claims 1 to 6.

18. A method for producing maltose according to claim 17, characterized in that the β-amylase according to any one of claims 1 to 6 is added when the temperature of starch is 60°C or higher and 70°C or lower.

19. A method for producing maltose, comprising treating starch with a microorganism according to claim 14 or a bacterium according to claim 15.

20. A method for producing maltose, comprising treating raw starch with the β-amylase according to any one of claims 4 to 6.

21. A method for modifying a food containing a polysaccharide having α-1,4 glycosidic bonds, using a β-amylase according to any one of claims 1 to 6, a microorganism according to claim 14, or a bacterium according to claim 15.

22. An enzyme preparation comprising the β-amylase according to any one of claims 1 to 6, the microorganism according to claim 14, or the bacterium according to claim 15.

23. The β-amylase described in claim 1, which consists of an amino acid sequence having 99% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:

2.

24. A β-amylase consisting of the amino acid sequence set forth in SEQ ID NO: 2, which has a β-amylase activity on soluble starch after heat treatment at 60°C for 80 minutes that is at least 80% compared to a β-amylase having the same amino acid sequence that has not been heat treated.

25. A β-amylase consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 18 to 21, which has a β-amylase activity on soluble starch after heat treatment at 60°C for 80 minutes that is at least 80% compared to a β-amylase having the same amino acid sequence that has not been heat treated.

26. (i) the amino acid sequence set forth in SEQ ID NO: 2; or (ii) an amino acid sequence in which one to several amino acid residues are deleted, substituted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 2; or (iii) an amino acid sequence having 99% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:2; The β-amylase comprises: a β-amylase having β-amylase activity against soluble starch after heat treatment at 60°C for 75 minutes that is not reduced as compared to a β-amylase having the same amino acid sequence that has not been heat treated.

Images