Messenger RNA Compositions, Methods and Uses

Abstract

The present invention provides, in particular, methods and compositions for cancer treatment.The methods and compositions disclosed herein are particularly effective for reducing tumor size / volume and inhibiting tumor growth.In one aspect, the present invention provides, in particular, a method for treating cancer, comprising administering to a subject who needs cancer treatment, a composition comprising mRNA encoding protein or peptide encapsulated in lipid nanoparticles at an effective dose and administration interval, so that tumor size is reduced or tumor growth is inhibited.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62 / 913,035, filed October 9, 2019, the contents of which are incorporated herein by reference in their entirety. [Background technology]

[0002] Cancer is the most common cause of death in many parts of the world, with over 2.5 million cancer cases diagnosed worldwide each year. Recent advances in the understanding of the molecular biology of cancer indicate that cancer is a genetic disorder that causes abnormal proliferation of diseased cells. Many cancer treatments exist, including surgery, chemotherapy, radiation therapy, gene therapy, and small and protein molecules. However, these treatments often work by non-specific interactions with cellular targets, causing unwanted side effects and not treating the root of the disease. Cancer remains highly resistant to currently available treatments. Summary of the Invention [Means for solving the problem]

[0003] The present invention provides improved mRNA therapeutics for the treatment of cancer. In particular, the methods described herein provide effective in vivo delivery of mRNAs encoding immune-modulating proteins or peptides useful in cancer immunotherapy (immune-oncology).

[0004] In one aspect, the present invention provides, inter alia, a method of treating cancer comprising administering to a subject in need of cancer treatment a composition comprising mRNA encoding a protein or peptide encapsulated in lipid nanoparticles at an effective dose and at an administration interval such that tumor size is reduced or tumor growth is inhibited.

[0005] In another aspect, the present invention provides a method of treating cancer comprising administering to a subject in need of cancer treatment a composition comprising two or more mRNAs, each encoding a protein or peptide, encapsulated within one or more lipid nanoparticles at an effective dose and at an administration interval such that tumor size is reduced or tumor growth is inhibited, wherein at least two of the two or more mRNAs each encode a protein or peptide that is different from the other mRNAs.

[0006] In some embodiments, the two or more mRNAs include a first mRNA encoding a first protein or peptide encapsulated in a first lipid nanoparticle and a second mRNA encoding a second protein or peptide encapsulated in a second lipid nanoparticle.

[0007] In some embodiments, at least one of the proteins or peptides modulates an immune response, hi some embodiments, at least one of the proteins or peptides is IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof.

[0008] In some embodiments, two of the two or more mRNAs each encode IL-12 and STING. In some embodiments, the two or more mRNAs each include at least three mRNAs each encoding STING, IL-12, and GM-CSF. In some embodiments, the two or more mRNAs each include at least four mRNAs each encoding STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, the two or more mRNAs each include at least four mRNAs each encoding STING, IL-12, NLRP3, and GM-CSF. In some embodiments, the two or more mRNAs each include at least four mRNAs each encoding STING, IL-12, IL-2, and GM-CSF.

[0009] In some embodiments, STING is a mutant form of STING, hi some embodiments, the mutant form allows STING to become constitutively active.

[0010] In some embodiments, at least one of the proteins or peptides does not modulate an immune response.

[0011] In some embodiments, the method results in greater than 50% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 60% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 70% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 90% tumor growth inhibition 20 days after administration of the first dose compared to the control.

[0012] In some embodiments, administration of the composition results in a change in body weight in the subject of less than 15% compared to a control. In some embodiments, administration of the composition results in a change in body weight in the subject of less than 10% compared to a control. In some embodiments, administration of the composition results in a change in body weight in the subject of less than 5% compared to a control.

[0013] In some embodiments, the control is a subject with a comparable disease state who is not receiving treatment. In some embodiments, the control is the body weight of the subject prior to administration of the composition.

[0014] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the lipid nanoparticles comprise cholesterol or one or more cholesterol-based lipids.

[0015] In some embodiments, a first lipid nanoparticle comprises a first cationic lipid and a second lipid nanoparticle comprises a second cationic lipid, and the first cationic lipid is different from the second cationic lipid.

[0016] In some embodiments, the one or more cationic lipids are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof. In some embodiments, the one or more cationic lipids include cKK-E12.

[0017] In some embodiments, the composition is administered intratumorally. In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intravenously. In some embodiments, the composition is administered by pulmonary administration. In some embodiments, the composition is administered by aerosolization.

[0018] In some embodiments, the method includes injecting a single dose. In some embodiments, the method includes periodically injecting multiple doses. In some embodiments, the single or multiple doses are in the range of about 0.1 μg to 100 mg of mRNA. In some embodiments, the single or multiple doses are in the range of about 0.1 μg to 50 mg of mRNA. In some embodiments, the single or multiple doses are in the range of about 0.1 μg to 25 mg of mRNA. In some embodiments, the single or multiple doses are in the range of about 0.1 μg to 10 mg of mRNA. In some embodiments, the single or multiple doses are in the range of 1 μg to 1 mg. In some embodiments, the single or multiple doses are in the range of 1 μg to 100 μg of mRNA.

[0019] In some embodiments, the single dose is 0.1 μg or the multiple doses are 0.1 μg. In some embodiments, the single dose is 0.3 μg or the multiple doses are 0.3 μg. In some embodiments, the single dose is 0.5 μg or the multiple doses are 0.5 μg. In some embodiments, the single dose is 1 μg or the multiple doses are 1 μg. In some embodiments, the single dose is 5 μg or the multiple doses are 5 μg. In some embodiments, the single dose is 10 μg or the multiple doses are 10 μg. In some embodiments, the single dose is 25 μg or the multiple doses are 25 μg. In some embodiments, the single dose is 50 μg or the multiple doses are 50 μg. In some embodiments, the single dose is 100 μg or the multiple doses are 100 μg.

[0020] In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 10 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 8 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 6 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 1 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

[0021] In some embodiments, each of the multiple doses comprises the same dosage of the mRNA. In some embodiments, each of the multiple doses comprises a different dosage of the mRNA.

[0022] In some embodiments, each of the multiple doses is injected at intervals of 1 day to 3 weeks. In some embodiments, each of the multiple doses is injected daily. In some embodiments, each of the multiple doses is injected at intervals of 3 days. In some embodiments, each of the multiple doses is injected weekly. In some embodiments, each of the multiple doses is injected at intervals of 10 days. In some embodiments, each of the multiple doses is injected every other week. In some embodiments, each of the multiple doses is injected monthly. In some embodiments, each of the multiple doses is injected every other month.

[0023] In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR). In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR). In some embodiments, the mRNA comprises a 3' untranslated region (3'UTR).

[0024] In some embodiments, administration of the composition activates T cells in the subject. In some embodiments, the method further comprises administering to the subject a composition comprising a checkpoint inhibitor. In some embodiments, the method does not comprise administering to the subject a composition comprising a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, the checkpoint inhibitor inhibits PD1. In some embodiments, the checkpoint inhibitor inhibits PD-L1. In some embodiments, the checkpoint inhibitor inhibits CTLA-4. In some embodiments, the checkpoint inhibitor inhibits B7. In some embodiments, the checkpoint inhibitor inhibits BTLA. In some embodiments, the checkpoint inhibitor inhibits HVEM. In some embodiments, the checkpoint inhibitor inhibits TIM-3. In some embodiments, the checkpoint inhibitor inhibits GAL-9. In some embodiments, the checkpoint inhibitor inhibits LAG3. In some embodiments, the checkpoint inhibitor inhibits VISTA. In some embodiments, the checkpoint inhibitor inhibits KIR. In some embodiments, the checkpoint inhibitor inhibits 2B4. In some embodiments, the checkpoint inhibitor inhibits CD160. In some embodiments, the checkpoint inhibitor inhibits CGEN-15049. In some embodiments, the checkpoint inhibitor inhibits CHK1. In some embodiments, the checkpoint inhibitor inhibits CHK2. In some embodiments, the checkpoint inhibitor inhibits A2aR.

[0025] In some embodiments, one or more mRNAs are encapsulated within the same lipid nanoparticle. In some embodiments, one or more mRNAs are encapsulated within separate lipid nanoparticles.

[0026] In one aspect, the present invention provides a pharmaceutical composition for treating cancer, comprising one or more mRNAs encoding IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof, wherein the one or more mRNAs are encapsulated within one or more lipid nanoparticles, including at least one lipid nanoparticle comprising cKK-E12 as a cationic lipid.

[0027] In some embodiments, the one or more mRNAs encode IL-12 and STING. In some embodiments, the one or more mRNAs encode STING, IL-12, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, IL-2, and GM-CSF.

[0028] In some embodiments, the composition further comprises an additional mRNA encoding a checkpoint inhibitor, hi some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof.

[0029] In some embodiments, the method produces an ascopal effect. In some embodiments, the method produces an abscopal effect.

[0030] In some embodiments, the method results in greater than 50% tumor growth inhibition of untreated tumors compared to controls 7 days after administration of the first dose.

[0031] In some embodiments, the method results in greater than 60%, greater than 70%, or greater than 80% tumor growth inhibition of untreated tumors compared to controls 10 days after administration of the first dose.

[0032] In some embodiments, the method results in greater than 80%, greater than 85%, or greater than 90% tumor growth inhibition of untreated tumors compared to controls 20 days after administration of the first dose.

[0033] In some embodiments, the methods increase survival of a subject with cancer.

[0034] The drawings are for purposes of illustration and not limitation. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A method for treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising mRNA encoding a protein or peptide encapsulated in lipid nanoparticles at an effective dose and at an administration interval such that tumor size is reduced or tumor growth is inhibited. (Item 2) A method for treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising two or more mRNAs, each encoding a protein or peptide, encapsulated in one or more lipid nanoparticles, at an effective dose and at an administration interval such that tumor size is reduced or tumor growth is inhibited, wherein at least two of the two or more mRNAs each encode a protein or peptide that is different from the other mRNAs. (Item 3) The method of claim 2, wherein the two or more mRNAs include a first mRNA encoding a first protein or peptide encapsulated in a first lipid nanoparticle and a second mRNA encoding a second protein or peptide encapsulated in a second lipid nanoparticle. (Item 4) 4. The method according to any one of items 1 to 3, wherein at least one of the proteins or peptides modulates an immune response. (Item 5) 5. The method of claim 4, wherein the protein or peptide is IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof. (Item 6) 4. The method of item 2 or 3, wherein two of the two or more mRNAs encode IL-12 and STING, respectively. (Item 7) 4. The method of item 2 or 3, wherein the two or more mRNAs comprise at least three mRNAs encoding STING, IL-12, and GM-CSF, respectively. (Item 8) 4. The method of claim 2 or 3, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L and GM-CSF, respectively. (Item 9) 4. The method of claim 2 or 3, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3 and GM-CSF, respectively. (Item 10) 4. The method of claim 2 or 3, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2 and GM-CSF, respectively. (Item 11) 11. The method of any one of items 5 to 10, wherein the STING is a mutant form of STING. (Item 12) 12. The method of claim 11, wherein the mutant form enables the STING to become constitutively active. (Item 13) 13. The method according to any one of items 1 to 12, wherein at least one of the proteins or peptides does not modulate an immune response. (Item 14) 14. The method according to any one of items 1 to 13, wherein the method results in a tumor growth inhibition rate of more than 50% compared to a control 7 days after administration of the first dose. (Item 15) 15. The method of any one of items 1 to 14, wherein the method results in a tumor growth inhibition rate of more than 60%, more than 70%, or more than 80% compared to a control 10 days after administration of the first dose. (Item 16) 16. The method of any one of items 1 to 15, wherein the method results in a tumor growth inhibition rate of more than 80%, more than 85%, or more than 90% compared to a control 20 days after administration of the first dose. (Item 17) 17. The method of any one of items 1-16, wherein the administration of the composition results in a percent change in body weight in the subject of less than 15%, less than 10%, or less than 5% compared to a control. (Item 18) 17. The method of claim 15 or 16, wherein the control is a subject with a comparable disease state who is not receiving treatment. (Item 19) 18. The method of claim 17, wherein the control is the subject's body weight prior to the administration of the composition. (Item 20) 20. The method according to any one of items 1 to 19, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. (Item 21) 21. The method of claim 20, wherein the lipid nanoparticles further comprise cholesterol or one or more cholesterol-based lipids. (Item 22) 4. The method of claim 3, wherein the first lipid nanoparticle comprises a first cationic lipid and the second lipid nanoparticle comprises a second cationic lipid, and the first cationic lipid is different from the second cationic lipid. (Item 23) 23. The method according to any one of items 1 to 22, wherein the composition is administered intratumorally. (Item 24) 24. The method according to any one of items 1 to 23, wherein the composition is administered subcutaneously. (Item 25) 25. The method according to any one of items 1 to 24, wherein the composition is administered intradermally. (Item 26) 26. The method of any one of items 1 to 25, wherein the composition is administered intravenously. (Item 27) 27. The method of any one of items 1 to 26, wherein the composition is administered by pulmonary administration. (Item 28) 28. The method according to any one of items 1 to 27, wherein the composition is administered by spraying. (Item 29) 29. The method according to any one of items 1 to 28, wherein the method comprises injecting a single dose. (Item 30) 29. The method according to any one of items 1 to 28, wherein the method comprises periodically injecting multiple doses. (Item 31) 31. The method of claim 29 or 30, wherein the single dose or the multiple doses are in the range of 0.1 μg to 100 mg of mRNA. (Item 32) 31. The method of claim 29 or 30, wherein the single dose or the multiple doses are in the range of 0.1 μg to 50 mg, 0.1 μg to 25 mg, 0.1 μg to 10 mg, 1 μg to 1 mg, or 1 μg to 100 μg of mRNA. (Item 33) 31. The method of claim 29 or 30, wherein the single dose or the multiple doses are selected from 0.1 μg, 0.3 μg, 0.5 μg, 1 μg, 5 μg, 10 μg, 25 μg, 50 μg, or 100 μg. (Item 34) 31. The method according to item 29 or 30, wherein the single dose or the multiple doses are in the range of 0.01 μg / kg to 10 mg / kg (mRNA / body weight). (Item 35) 31. The method of claim 29 or 30, wherein the single dose or the multiple doses are in the range of 0.01 μg / kg to 8 mg / kg, 0.01 μg / kg to 6 mg / kg, 0.01 μg / kg to 5 mg / kg, 0.1 μg / kg to 5 mg / kg, 0.1 μg / kg to 1 mg / kg, or 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight). (Item 36) 36. The method of any one of items 30 to 35, wherein each of the multiple doses comprises the same dosage of mRNA. (Item 37) 37. The method of any one of items 30 to 36, wherein each of the multiple doses comprises a different dosage of the mRNA. (Item 38) 38. The method of any one of items 30 to 37, wherein each of the multiple doses is injected at intervals of 1 day to 3 weeks. (Item 39) 39. The method of any one of items 30 to 38, wherein each of the multiple doses is injected weekly. (Item 40) 40. The method according to any one of items 1 to 39, wherein the mRNA comprises one or more modified nucleotides. (Item 41) 41. The method according to any one of items 1 to 40, wherein the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR). (Item 42) 42. The method of any one of items 1-41, wherein said administering of said composition activates T cells in said subject. (Item 43) 43. The method of any one of items 1 to 42, wherein the method further comprises administering to the subject a composition comprising a checkpoint inhibitor. (Item 44) 43. The method of any one of items 1 to 42, wherein the method does not include administering to the subject a composition comprising a checkpoint inhibitor. (Item 45) 43. The method of item 42, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. (Item 46) 1. A pharmaceutical composition for treating cancer comprising one or more mRNAs each encoding IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof, wherein the one or more mRNAs are encapsulated within one or more lipid nanoparticles, including at least one lipid nanoparticle comprising cKK-E12 as a cationic lipid. (Item 47) 47. The pharmaceutical composition of claim 46, wherein the composition further comprises an additional mRNA encoding a checkpoint inhibitor. (Item 48) 48. The pharmaceutical composition of item 46 or 47, wherein the one or more mRNAs comprise at least two mRNAs encoding IL-12 and STING, respectively. (Item 49) 48. The pharmaceutical composition of item 46 or 47, wherein the one or more mRNAs comprise at least three mRNAs encoding STING, IL-12, and GM-CSF, respectively. (Item 50) 48. The pharmaceutical composition of item 46 or 47, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L, and GM-CSF, respectively. (Item 51) 48. The pharmaceutical composition of item 46 or 47, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3, and GM-CSF, respectively. (Item 52) 48. The pharmaceutical composition of item 46 or 47, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2, and GM-CSF, respectively. (Item 53) 53. The pharmaceutical composition according to any one of items 46 to 52, wherein the STING is a mutant form of STING. (Item 54) 54. The pharmaceutical composition of item 53, wherein the mutant form enables the STING to become constitutively active. (Item 55) 55. The pharmaceutical composition according to any one of items 46 to 54, further comprising an additional mRNA encoding a protein or peptide that does not modulate the immune response. (Item 56) 56. The pharmaceutical composition of any one of items 47 to 55, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. (Item 57) 57. The pharmaceutical composition according to any one of items 46 to 56, wherein the lipid nanoparticles further comprise one or more non-cationic lipids, and one or more PEG-modified lipids. (Item 58) 58. The pharmaceutical composition according to any one of items 57, further comprising cholesterol or a cholesterol-based lipid. (Item 59) A second lipid nanoparticle is provided, the second lipid nanoparticle being free of cKK-E12 and being selected from the group consisting of OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2- 59. The pharmaceutical composition according to any one of items 46 to 58, further comprising a second lipid nanoparticle comprising a cationic lipid selected from the group consisting of: 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof. (Item 60) 46. ​​The method according to any one of items 1 to 45, wherein the method produces an ascopal effect. (Item 61) 61. The method of claim 60, wherein the method results in a tumor growth inhibition rate of untreated tumors of greater than 50% compared to a control 7 days after administration of the first dose. (Item 62) 61. The method of claim 60, wherein the method results in a tumor growth inhibition rate of untreated tumors of greater than 60%, greater than 70%, or greater than 80% compared to a control 10 days after administration of the first dose. (Item 63) 61. The method of claim 60, wherein the method results in a tumor growth inhibition rate of untreated tumors of greater than 80%, greater than 85%, or greater than 90% compared to a control 20 days after administration of the first dose. (Item 64) 64. The method of any one of items 1-45 or 60-63, wherein the method increases survival of a subject having cancer. [Brief description of the drawings]

[0035] [Figure 1] 1 is a graph showing comparative data on the efficacy of various mRNA-LNPs in antitumor activity in vivo. After intratumoral administration of mRNA-LNPs to MC38 mice according to the dose and frequency shown in Table 2, the average tumor volume of each group was measured throughout the study. [Diagram 2] Graph showing the mean percent tumor volume of Groups B through I compared to control Group A. [Diagram 3] 1 is a graph showing the mean inhibition of tumor volume in groups B through I compared to group A, which is the control group. [Figure 4] Scatter plot showing tumor volumes of individual mice in each group on day 46. The mean tumor volume for each group is shown. [Figure 5A] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5B] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5C] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5D] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5E]FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5F] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5G] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5H] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 5I] FIG. 5 is a set of tables showing the tumor volumes (mm3) of individual mice in groups A (FIG. 5A), B (FIG. 5B), C (FIG. 5C), D (FIG. 5D), E (FIG. 5E), F (FIG. 5F), G (FIG. 5G), H (FIG. 5H), and I (FIG. 5I). Mean and standard deviation values ​​are shown in the last two rows. Blanks indicate deaths. Sample size for each group was 10. [Figure 6] Graph showing the average percent change in body weight over the study period compared to body weight on day 1. [Figure 7]Graph showing tumor growth following administration of lipid-encapsulated constitutively active STING mRNA, negative control, or vehicle control into the MC38 mouse cancer model. [Figure 8] FIG. 1 is a series of graphs showing survival of MC38 cancer mice following treatment with 1) lipid-encapsulated, constitutively active STING mRNA and isotype control antibody, 2) negative control mRNA and isotype control antibody, or 3) vehicle control compared to MC38 cancer mice treated with 1) lipid-encapsulated, constitutively active STING mRNA and anti-PD-1 antibody, 2) negative control mRNA and anti-PD-1 antibody, or 3) vehicle control.

[0036] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of the following terms, as well as other terms, are set forth throughout the specification.

[0037] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animals are mammals (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, animals may be transgenic animals, genetically engineered animals, and / or clones.

[0038] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise specified or otherwise clear from the context (except when such number exceeds 100% of possible values).

[0039] Delivery: As used herein, the term "delivery" includes both local delivery and systemic delivery.For example, the delivery of mRNA includes the situation where mRNA is delivered to target tissue, its encoded protein is expressed and retained in the target tissue (also referred to as "local distribution" or "local delivery"), the situation where mRNA is delivered to target tissue, its encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), and distributed throughout the body and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0040] Encapsulation: As used herein, the term "encapsulation," or grammatical equivalents, refers to the process of confining individual mRNA molecules within a nanoparticle.

[0041] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production" and grammatical equivalents are used interchangeably.

[0042] Half-life: As used herein, the term "half-life" is the time it takes for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of the value measured at the beginning of a period.

[0043] Improve, increase, or reduce: As used herein, "improve," "increase," or "reduce," or grammatical equivalents, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated and of approximately the same age as the subject being treated.

[0044] In vitro: As used herein, the term "in vitro" refers to events that take place in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multicellular organism.

[0045] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as humans and non-human animals. In the context of cell-type systems, the term can be used to mean events that occur within a living cell (e.g., as opposed to an in vitro system).

[0046] Local distribution or delivery: As used herein, the terms "local distribution", "local delivery", or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or delivery requires an mRNA-encoded protein (e.g., an enzyme) that is translated and expressed intracellularly or that is secreted to the limited extent to avoid entering the patient's circulatory system.

[0047] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may include one or more coding and non-coding regions. mRNA may be purified from natural sources, produced using recombinant expression systems, and optionally purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, mRNA may include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is selected from the group consisting of natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, , C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0048] Patient: As used herein, the term "patient" or "subject" refers to any organism to which a provided composition may be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0049] Pharmaceutically acceptable: As used herein, the term "pharmacologically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, inflammatory irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0050] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, the subject is a human. A subject may be a patient, and refers to a human who visits a health care provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may suffer from or be susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0051] Substantially: As used herein, the term "substantially" refers to a qualitative state of exhibiting the full or nearly full extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to completion and / or reach completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0052] Systemic distribution or delivery: As used herein, the terms "systemic distribution", "systemic delivery", or grammatical equivalents, refer to a delivery or distribution mechanism or approach that affects the entire body or organism. Typically, systemic distribution or delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery".

[0053] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes tissue that exhibits pathology, symptoms, or characteristics associated with the disease.

[0054] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of symptoms of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. Those skilled in the art will appreciate that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.

[0055] Treating: As used herein, the terms "treat", "treatment", or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not exhibit signs of the disease and / or who exhibit only early signs of the disease, with the goal of reducing the risk of developing a condition associated with the disease. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0056] The present invention provides an improved mRNA therapeutic agent for the treatment of cancer.In particular, the method disclosed herein is effective for reducing or decreasing the size, mass, and / or volume of tumors, or inhibiting or delaying tumor growth in subjects in need thereof, by administering a composition comprising one or more mRNAs that directly or indirectly regulate immune response at an effective dose and administration interval.In some embodiments, the method disclosed herein increases survival.

[0057] Various aspects of the invention are described in detail in the following sections. The use of the sections is not meant to limit the invention. Each section can be applied to any aspect of the invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0058] cancer Cancer cells express antigens that are not generally expressed by non-cancerous cells or tissues. These cancer antigens are not presented by antigen-presenting cells (APCs) in a manner similar to viral antigens, i.e., in association with MHC-1 molecules that classify the antigen as foreign, but cytotoxic T cells are able to differentiate and identify mutant self-antigens and have the unique property of seeking out and destroying cells that carry mutant antigens. Thus, one goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells directed against mutant antigens. The methods and compositions according to the present invention are effective in inducing the subject's own cytotoxic T cells to generate the immune response necessary to destroy tumor cells.

[0059] Normal tissue homeostasis is a highly regulated process of cell proliferation and cell death. An imbalance in proliferation of cells or cell death can result in a cancerous state (Solyanike et al., 1995; Stokke et al., 1997; Mumby and Walter, 1991; Natolie et al., 1998; Magi-Galluzzi et al., 1998). For example, cervical, renal, lung, pancreatic, colorectal and brain cancers are just a few of the many cancers that can occur (Erlandsson, 1998; Kolmel, 1998; Mangray and King, 1998; Gertig and Hunter, 1997; Mougine et al., 1998). In fact, the incidence of cancer is so high that more than 500,000 deaths per year in the United States are attributable to cancer.

[0060] Cell proliferation and maintenance of cell death are at least partially regulated by proto-oncogenes. Proto-oncogenes can code for proteins that induce cell proliferation (e.g., sis, erbB, src, ras, and myc), inhibit cell proliferation (e.g., Rb, p53, NF1, and WT1), or regulate programmed cell death (e.g., bcl-2) (Ochi et al., 1998; Johnson and Hamdy, 1998; Lieberman et al., 1998). However, genetic rearrangements or mutations to these proto-oncogenes convert them into potent oncogenes that cause cancer. In many cases, a single point mutation is sufficient to convert a proto-oncogene into an oncogene. For example, a mutation at codon 12 or 13 in the K-ras gene can convert a proto-oncogene into an oncogene.

[0061] Currently, there are few effective options for the treatment of many common cancers. The course of treatment for a particular individual depends on the diagnosis, the stage at which the disease has developed, and factors such as the patient's age, sex, and overall health. The most common options for cancer treatment are surgery, radiation therapy, and chemotherapy. Surgery plays an important role in the diagnosis and treatment of cancer. Typically, a surgical approach is required for biopsy and removal of the cancerous growth. However, if the cancer has metastasized and spread widely, surgery is unlikely to be curative and a different approach must be taken. Radiation therapy, chemotherapy, and immunotherapy are alternatives to surgical treatment of cancer (Mayer, 1998, Ohara 1998, Hoet al., 1998). Radiation therapy involves precisely targeting high-energy radiation to destroy the cancer and, like cells in surgery, is primarily effective in treating localized cancer cells, not metastases. Side effects of radiation therapy include skin irritation, difficulty swallowing, dry mouth, nausea, diarrhea, hair loss and loss of energy (Curran, 1998; Brizel, 1998).

[0062] Chemotherapy, the treatment of cancer with anti-cancer drugs, is another method of cancer treatment. The effectiveness of anti-cancer drug therapy is often limited because drug administration is difficult to achieve in all solid tumors (el-Kareh and Secomb, 1997). Chemotherapy strategies are based on the growth of solid tumors, where anti-cancer drugs are selected based on the target cancer cells that are rapidly dividing. Most chemotherapy approaches include combinations of multiple anti-cancer drugs that have been shown to increase response rates in various cancers. The main side effect of chemotherapy drugs is that they also affect normal tissue cells, which are likely to be affected as they are rapidly dividing (e.g., bone marrow, digestive tract, reproductive system, and hair follicles). Other side effects of chemotherapy drugs are ulcers in the mouth, difficulty swallowing, dry mouth, nausea, diarrhea, vomiting, fatigue, bleeding, hair loss, and infections. Other forms of chemotherapy can be used to treat non-cancerous hyperproliferative disorders. These include the use of traditional chemotherapy agents such as methotrexate and cyclophosphamide for hyperproliferative diseases such as rheumatoid arthritis and psoriasis. Paw chemotherapy proliferative diseases can also include immunosuppressants such as steroids, azathioprine, cyclosporine, and immunomodulators such as fumaric acid derivatives.

[0063] Immunotherapy, a rapidly developing field of cancer research, is yet another option for treating certain types of cancer. For example, the immune system identifies tumor cells as foreign and therefore selected as targets for destruction by the immune system. Unfortunately, the response is usually not sufficient to prevent most tumor growth. However, more recently, the field of immunotherapy has focused on developing methods to enhance or complement the immune system's natural defense mechanisms.

[0064] As mentioned above, proto-oncogenes play important roles in cancer biology. For example, the Rb tumor suppressor, p53, NF1, and WT1 are essential for maintaining the non-tumorigenic phenotype of cells (reviewed by Soddu and Sacchi, 1998). Approximately 50% of all cancers are known to be associated with mutations in the p53 gene, resulting in the loss of p53 tumor suppressor properties (see Levine et al., 1991; Vogelstein and Kinzler, 1992; Hartmann et al., 1996a; Hartmann et al., 1996b). The high incidence of p53 gene mutations in cancer has led many research groups to investigate p53 as a route for cancer therapy via gene transfer or replacement. The sis proto-oncogenes, erbB, src, ras, and myc, which code for proteins that induce cell proliferation, as well as the Bcl-2 family of proto-oncogenes that regulate programmed cell death, also play important roles in the non-tumorigenic phenotype of cells.

[0065] In some embodiments, the cancer is head cancer, neck cancer, ovarian cancer, breast cancer, colon cancer, prostate cancer, liver cancer, leukemia, glioma, melanoma, pancreatic cancer, testicular cancer, melanoma, bladder cancer, lung cancer, sarcoma, squamous cell carcinoma, small cell lung cancer, ductal carcinoma of the breast, infiltrating lobular carcinoma of the breast, intraductal carcinoma, mucinous carcinoma of the breast, promyelocytic leukemia in peripheral blood, ovarian adenocarcinoma, ovarian adenocarcinoma metastasized to the peritoneal cavity, prostate adenocarcinoma, transitional cell carcinoma of the bladder, an epitheliod carcinoma in a pancreatic duct, adenocarcinoma of the pancreatic duct, adenocarcinoma of the cervical epithelium, cervical cancer, gastrointestinal cancer, genitourinary cancer, brain cancer, mesothelioma, renal cell carcinoma, gynecological cancer, or endometrial cancer.

[0066] Cancer Treatment In one aspect, the present invention provides a method for treating cancer. The method disclosed herein is effective for reducing or decreasing the size, mass, and / or volume of a tumor or inhibiting or delaying tumor growth in a subject in need thereof by administering a composition comprising one or more mRNAs encoding a protein or peptide that directly or indirectly modulates an immune response at an effective dose and administration interval. The method disclosed herein is also effective for increasing the survival of a subject. For example, in some embodiments, the method and composition described herein can increase the survival of a subject suffering from cancer by about 1 month to 12 months, 1 year and 5 years, 5 years and 10 years, 10 years and 15 years.

[0067] In one aspect, the present invention relates to a method of treating cancer via administration of mRNA encoding an immunomodulatory protein or peptide useful for cancer immunotherapy (IO), including but not limited to interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-la, monocyte chemotactic protein (MCP)-1 MCP-3, macrophage colony stimulating factor (M-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony stimulating factor (G-CSF), cluster of differentiation antigen (CCL5), and the like. These include (CD)80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family pyrin domain containing 1 (NLRP1), NLRP3, stimulator of interferon genes (STING), absent in melanoma 2 (AIM2), pyrin, IFN-inducible protein 16 (IFI16), and OX40L.

[0068] Tumor size The methods of treating cancer disclosed herein are effective to reduce the size of a tumor in a subject in need thereof as compared to a control. In some embodiments, the control is an untreated subject with a comparable disease state. In some embodiments, the control is a pre-treatment subject. In some embodiments, administration of the composition reduces the size of the tumor by at least 5% to 99% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 5% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 10% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 15% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 20% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 25% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 30% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 35% as compared to the control. In some embodiments, administration of the composition reduces the size of the tumor by at least 40% as compared to the control. In some embodiments, administration of the composition reduces the size of a tumor by at least 45% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 50% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 60% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 70% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 80% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 85% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 90% compared to a control. In some embodiments, administration of the composition reduces the size of a tumor by at least 95% compared to a control.In some embodiments, administration of the composition reduces the size of a tumor by at least 99% compared to a control, hi some embodiments, administration of the composition results in the disappearance of a tumor.

[0069] In some embodiments, administration of the composition reduces the size of the tumor 1 day after administration. In some embodiments, administration of the composition reduces the size of the tumor 2 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 4 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 5 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 7 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 10 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 12 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 15 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 18 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 20 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 25 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 30 days after administration.

[0070] In some embodiments, administration of the composition results in a reduction in tumor size compared to the control over the treatment period. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 5 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 7 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 10 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 15 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 20 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 25 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 30 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 35 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 40 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 45 days.

[0071] Tumor growth inhibition The methods for treating cancer disclosed herein are effective in inhibiting or slowing tumor growth. Tumor growth inhibition is calculated as follows: (mean(C)-mean(T)) / mean(C)*100%, where T is the test group tumor volume, C is the control group tumor volume, and the control is an untreated subject. In some embodiments, the method results in a tumor growth inhibition rate of 5% to more than 99% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 5% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 10% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 15% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 20% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 25% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 30% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 35% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 40% compared to the control. In some embodiments, the method results in greater than 45% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 50% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 60% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 70% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 75% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 90% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 95% tumor growth inhibition compared to the control. In some embodiments, the method results in greater than 99% tumor growth inhibition compared to the control.

[0072] In some embodiments, the method results in tumor growth inhibition 1 day after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 3 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 5 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 7 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 10 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 15 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 20 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 25 days after administration of the first dose. In some embodiments, the method results in tumor growth inhibition 30 days after administration of the first dose.

[0073] In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control over the treatment period. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 1 day. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 5 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 7 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 10 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 15 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 20 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 25 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 30 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 35 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 40 days. In some embodiments, administration of the composition results in inhibition of tumor growth compared to a control for 45 days.

[0074] In some embodiments, the method results in greater than 50% tumor growth inhibition 5 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 50% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 60% tumor growth inhibition 5 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 60% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 50% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 70% tumor growth inhibition 5 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 70% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 70% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 5 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 10 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 15 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 80% tumor growth inhibition 25 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition 15 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 85% tumor growth inhibition compared to a control 25 days after administration of the first dose.In some embodiments, the method results in greater than 90% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 90% tumor growth inhibition 15 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 90% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 90% tumor growth inhibition 25 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 95% tumor growth inhibition 7 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 95% tumor growth inhibition 15 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 95% tumor growth inhibition 20 days after administration of the first dose compared to the control. In some embodiments, the method results in greater than 95% tumor growth inhibition 25 days after administration of the first dose compared to the control.

[0075] In some embodiments, the method is effective to promote an anti-tumor effect (e.g., induce T cell proliferation, induce T cell infiltration into a tumor, induce a memory T cell response, increase the number of K cells, etc.) by administering a composition described herein. In one embodiment, the present invention provides a method of activating T cells in a subject in need of T cell activation, a method of inducing T cell proliferation in a subject in need of inducing T cell infiltration into a tumor in a subject in need of inducing T cell infiltration into a tumor, and / or a method of inducing a memory T cell response in a subject in need of inducing a memory T cell response, comprising administering a composition disclosed herein to the subject. In some embodiments, administration of a composition described herein activates T cells in the subject. T cell activation can be characterized by any method known in the art. In some embodiments, the activated T cells express CD4. In some embodiments, the activated T cells express CD8. In certain embodiments, the activated T cells express CD4 and CD8. In certain embodiments, the activated T cells express CD4 + T cells, CD8+ T cells, or CD4 + T cells and CD8 + In some embodiments, T cell activation includes both T cells and T cells. In some embodiments, T cell activation includes increasing the number of tumor-infiltrating T cells. In certain embodiments, the number of tumor-infiltrating T cells in the tumor is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 50-fold, or at least about 100-fold compared to the number of tumor-infiltrating T cells in the tumor before administration of the composition.

[0076] Weight change Weight loss is common in cancer subjects. Alleviating side effects, including weight loss, is an important part of cancer care and treatment. In some embodiments, administration of the composition results in a change in body weight in the subject of 60% to less than 1% compared to a control. In some embodiments, the control is the body weight of the subject prior to administration of the composition. In some embodiments, administration of the composition results in a change in body weight in the subject of 60% to less than 50% compared to a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 40% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 30% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 25% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 20% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 15% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of 10% to less than a control. In some embodiments, administration of the composition results in a change in body weight in the subject of less than 5% compared to a control. In some embodiments, administration of the composition results in a change in body weight in the subject of less than 1% compared to a control. In some embodiments, administration of the composition results in substantially no change in body weight in the subject compared to a control.

[0077] Complete success Long-term efficacy is another important factor in cancer treatment. In some embodiments, the method results in complete remission, partial remission, stable disease, partial response, or complete response. In some embodiments, complete response means that signs of cancer have disappeared or inhibition of tumor growth is maintained. In some embodiments, partial response means that the degree of damage of multiple tumors is reduced in response to treatment. The complete response rate is the percentage of subjects who show a complete response after administration of the composition. In some embodiments, the complete response rate is greater than 50%. In some embodiments, the complete response rate is greater than 60%. In some embodiments, the complete response rate is greater than 70%. In some embodiments, the complete response rate is greater than 80%. In some embodiments, the complete response rate is greater than 85%. In some embodiments, the complete response rate is greater than 90%. In some embodiments, the complete response rate is greater than 95%. In some embodiments, the complete response rate is greater than 99%.

[0078] Dosage and interval As used herein, the term "therapeutically effective amount" is primarily based on the total amount of mRNA contained in the vaccine composition of the present invention. In general, a therapeutically effective amount is an amount sufficient to achieve a meaningful benefit to the subject (e.g., treat, regulate, cure, inhibit, prevent, and / or delay cancer or its symptoms). For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. In general, the amount of therapeutic agent (e.g., mRNA encoding a therapeutic protein or peptide) administered to a subject in need of treatment will vary depending on the characteristics of the subject. Such characteristics include the subject's condition, disease severity, general health, age, sex, and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other relevant factors. Furthermore, both objective and subjective assays can be optionally used to identify optimal dosage ranges.

[0079] The delivery vehicle containing the mRNA may be administered and dosed according to current medical practice, taking into consideration the subject's clinical condition, the site and method of administration (e.g., local and systemic, including intratumoral, intravenous, and by injection), administration schedule, the subject's age, sex, weight, and other factors relevant to the clinician in the art. For purposes herein, an "effective amount" may be determined by such relevant considerations known to those skilled in the art of experimental clinical studies, pharmacology, clinical, and medical fields. In some embodiments, the amount administered is effective to achieve at least some stabilization, amelioration, or elimination of symptoms (e.g., reduction in tumor size and / or inhibition of tumor growth), as well as other indicators selected by those skilled in the art as appropriate measures of cancer progression, regression, or amelioration.

[0080] In some embodiments, the method comprises injecting a single dose, hi some embodiments, the method comprises injecting multiple doses periodically.

[0081] In some embodiments, a suitable dose is in the range of 0.1 μg to 100 mg of mRNA. In some embodiments, the single dose or multiple doses are in the range of 0.1 μg to 50 mg. In some embodiments, the single dose or multiple doses are in the range of 0.1 μg to 25 mg. In some embodiments, the single dose or multiple doses are in the range of 0.1 μg to 10 mg. In some embodiments, the single dose or multiple doses are in the range of 1 μg to 1 mg. In some embodiments, the single dose or multiple doses are in the range of 1 μg to 100 μg of mRNA. In some embodiments, the single dose or multiple doses are 0.1 μg. In some embodiments, the single dose or multiple doses are 0.3 μg. In some embodiments, the single dose or multiple doses are 0.5 μg. In some embodiments, the single dose or multiple doses are 1 μg. In some embodiments, the single dose or multiple doses are 5 μg. In some embodiments, the single dose or multiple doses are 7.5 μg. In some embodiments, the single dose or multiple doses are 10 μg. In some embodiments, the single dose or multiple doses are 15 μg. In some embodiments, the single dose or multiple doses are 20 μg. In some embodiments, the single dose or multiple doses are 25 μg. In some embodiments, the single dose or multiple doses are 30 μg. In some embodiments, the single dose or multiple doses are 40 μg. In some embodiments, the single dose or multiple doses are 50 μg. In some embodiments, the single dose or multiple doses are 100 μg. In some embodiments, the single dose or multiple doses are 1 mg. In some embodiments, the single dose or multiple doses are 5 mg. In some embodiments, the single dose or multiple doses are 7.5 mg. In some embodiments, the single dose or multiple doses are 10 mg. In some embodiments, the single dose or multiple doses are 20 mg. In some embodiments, the single dose or multiple doses are 30 mg. In some embodiments, the single dose or multiple doses are 50 mg.In some embodiments, the single dose or multiple doses are 100 mg.

[0082] In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 500 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 400 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 300 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 200 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 100 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 90 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 80 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 70 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 60 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 50 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 40 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 30 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 25 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 20 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 15 mg per kg of body weight. In some embodiments, the therapeutically effective dose is in the range of about 0.005 mg to 10 mg per kg of body weight.

[0083] In some embodiments, the therapeutically effective dose of the composition is greater than about 0.1 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 0.5 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 1.0 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 3 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 5 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 10 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 15 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 20 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 30 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 40 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 50 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 60 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 70 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 80 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 90 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 100 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 150 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 200 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 250 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 300 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 350 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 400 mg / kg body weight.In some embodiments, the therapeutically effective dose of the composition is greater than about 450 mg / kg body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 500 mg / kg body weight. In some embodiments, the therapeutically effective dose is 1.0 mg / kg body weight. In some embodiments, the therapeutically effective dose of 1.0 mg / kg body weight is administered subcutaneously, intramuscularly or intravenously.

[0084] The provided method of the present invention contemplates single administration as well as multiple administration of a therapeutically effective amount of the therapeutic agent described herein. The composition can be administered at regular intervals depending on the nature, severity and extent of the subject's condition, such as tumor size, metastatic progression, or cancer stage. In some embodiments, the therapeutically effective amount of the composition of the present invention can be administered at regular intervals (e.g., daily, twice a week, once every 4 days, once a week, once every 10 days, every other week, monthly, bimonthly, twice a month, once every 30 days, once every 28 days, or continuously on a regular basis.

[0085] In some embodiments, the liposomes and / or compositions provided are formulated for sustained release of the mRNA contained therein. Such sustained release compositions can be administered to a subject over extended dosing intervals as appropriate. For example, in some embodiments, the compositions of the present invention are administered to a subject twice a day. In some embodiments, the compositions are administered to a subject twice a day. In some embodiments, the compositions are administered to a subject every day. In some embodiments, the compositions are administered to a subject every other day. In some embodiments, the compositions are administered to a subject twice a week. In some embodiments, the compositions are administered to a subject once a week. In some embodiments, the compositions are administered to a subject once every 7 days. In some embodiments, the compositions are administered to a subject once every 10 days. In some embodiments, the compositions are administered to a subject once every 14 days. In some embodiments, the compositions are administered to a subject once every 28 days. In some embodiments, the compositions are administered to a subject once every 30 days. In some embodiments, the compositions are administered to a subject once every 2 weeks. In some embodiments, the compositions are administered to a subject once every 3 weeks. In some embodiments, the composition is administered to the subject once every four weeks. In some embodiments, the composition is administered to the subject once a month. In some embodiments, the composition is administered to the subject twice a month. In some embodiments, the composition is administered to the subject once every six weeks. In some embodiments, the composition is administered to the subject once every eight weeks. In some embodiments, the composition is administered to the subject once every other month. In some embodiments, the composition is administered to the subject once every three months. In some embodiments, the composition is administered to the subject once every four months. In some embodiments, the composition is administered to the subject once every six months. In some embodiments, the composition is administered to the subject once every eight months. In some embodiments, the composition is administered to the subject once every nine months. In some embodiments, the composition is administered to the subject annually. Compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) are also contemplated for either delivery or release of mRNA over an extended period of time.Preferably, the sustained release measures employed are combined with modifications made to the mRNA to enhance stability.

[0086] The therapeutically effective amount is generally administered in a dosage regimen that may include multiple unit doses.For any particular vaccine, the therapeutically effective amount and the administration interval (and / or the appropriate unit dose within an effective dosage regimen) may vary, for example, depending on the administration route, depending on the combination with other pharmaceuticals.Also, the therapeutically effective amount (and / or unit dose) specific to any particular patient may depend on various factors, including the disorder being treated and the severity of the disorder; the activity of the specific vaccine agent being adopted; the specific composition being adopted; the age, weight, general health, sex, and diet of the patient; the administration time, administration route, and / or the excretion or metabolic rate of the specific protein being adopted; the duration of treatment; and similar factors well known in the medical field.

[0087] In some embodiments, the first dose and the subsequent doses are the same amount. In some embodiments, the first dose and the subsequent doses are different amounts. In some embodiments, the first dose is larger than the subsequent doses. In some embodiments, the first dose is smaller than the subsequent doses. In some embodiments, each of the multiple doses comprises the same dosage of mRNA. In some embodiments, each of the multiple doses comprises a different dosage of mRNA.

[0088] Compositions of the Invention In one aspect, the present invention relates to a method for treating cancer through administration of a composition comprising one or more mRNAs encoding proteins or peptides encapsulated in lipid nanoparticles.In one aspect, the present invention provides a pharmaceutical composition for treating cancer, comprising one or more mRNAs encoding immunomodulatory proteins or peptides, respectively, wherein the one or more mRNAs are encapsulated in lipid nanoparticles.In some embodiments, the pharmaceutical composition comprises two or more mRNAs encoding one or more checkpoint inhibitors.

[0089] mRNA In some embodiments, the one or more mRNAs encode immunomodulatory proteins or peptides useful for cancer immunotherapy (IO), including interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-la, monocyte chemotactic protein (MCP)-1 MCP-3, macrophage colony stimulating factor (M-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony stimulating factor (G-CSF), cluster of differentiation antigen (CCL5), and the like. These include (CD)80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family pyrin domain containing 1 (NLRP1), NLRP3, stimulator of interferon genes (STING), absent in melanoma 2 (AIM2), pyrin, IFN-inducible protein 16 (IFI16), and OX40L.

[0090] In some embodiments, one or more mRNAs are codon-optimized. In some embodiments, the protein or peptide encoded by the mRNA is wild type. In some embodiments, the protein or peptide encoded by the mRNA contains mutation or modification. In some embodiments, STING contains R293M mutation. In some embodiments, NLRP3 contains D301N mutation.

[0091] In some embodiments, the protein or peptide encoded by the mRNA modulates an immune response. In some embodiments, the protein or peptide is a fragment or a full-length cytokine. In some embodiments, a suitable protein or peptide is IL-1. In some embodiments, a suitable protein or peptide is IL-2. In some embodiments, a suitable protein or peptide is IL-3. In some embodiments, a suitable protein or peptide is IL-4. In some embodiments, a suitable protein or peptide is IL-5. In some embodiments, a suitable protein or peptide is IL-6. In some embodiments, a suitable protein or peptide is IL-7. In some embodiments, a suitable protein or peptide is IL-8. In some embodiments, a suitable protein or peptide is IL-10. In some embodiments, a suitable protein or peptide is IL-11. In some embodiments, a suitable protein or peptide is IL-12. In some embodiments, a suitable protein or peptide is IL-13. In some embodiments, a suitable protein or peptide is IL-15 / 15R. In some embodiments, a suitable protein or peptide is IL-18. In some embodiments, a suitable protein or peptide is IL-21. In some embodiments, a suitable protein or peptide is IL-27. In some embodiments, a suitable protein or peptide is MIP-Iβ. In some embodiments, a suitable protein or peptide is MIP-la. In some embodiments, a suitable protein or peptide is monocyte chemotactic protein (MCP)-1. In some embodiments, a suitable protein or peptide is MCP-3. In some embodiments, a suitable protein or peptide is M-CSF. In some embodiments, a suitable protein or peptide is GM-CSF. In some embodiments, a suitable protein or peptide is RANTES or CCL5.In some embodiments, a suitable protein or peptide is IFN-γ. In some embodiments, a suitable protein or peptide is TNF-α. In some embodiments, a suitable protein or peptide is G-CSF. In some embodiments, a suitable protein or peptide is CD80. In some embodiments, a suitable protein or peptide is CD86. In some embodiments, a suitable protein or peptide is EFNα. In some embodiments, a suitable protein or peptide is IFNp. In some embodiments, a suitable protein or peptide is IFN. In some embodiments, a suitable protein or peptide is FLT3L. In some embodiments, a suitable protein or peptide is NLRP1. In some embodiments, a suitable protein or peptide is NLRP3. In some embodiments, a suitable protein or peptide is STING. In some embodiments, a suitable protein or peptide is AIM2. In some embodiments, a suitable protein or peptide is pyrin. In some embodiments, a suitable protein or peptide is IFI16. In some embodiments, a suitable protein or peptide is OX40L.

[0092] In some embodiments, the one or more mRNAs encode IL-12 and STING. In some embodiments, the one or more mRNAs encode STING, IL-12, and GM-CS. In some embodiments, the one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, IL-2, and GM-CSF.

[0093] In one aspect, the present invention provides a method of treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising two or more mRNAs, each encoding a protein or peptide, encapsulated in a lipid nanoparticle, at an effective dose and at an administration interval such that tumor size is reduced or tumor growth is inhibited. In some embodiments, the two or more mRNAs each encode an immune-modulating enzyme and / or a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, a suitable checkpoint inhibitor inhibits PD1. In some embodiments, a suitable checkpoint inhibitor inhibits PD-L1. In some embodiments, a suitable checkpoint inhibitor inhibits CTLA-4. In some embodiments, a suitable checkpoint inhibitor inhibits B7. In some embodiments, a suitable checkpoint inhibitor inhibits BTLA. In some embodiments, a suitable check point inhibitor inhibits HVEM. In some embodiments, a suitable check point inhibitor inhibits TIM-3. In some embodiments, a suitable check point inhibitor inhibits GAL-9. In some embodiments, a suitable check point inhibitor inhibits LAG3. In some embodiments, a suitable check point inhibitor inhibits VISTA. In some embodiments, a suitable check point inhibitor inhibits KIR. In some embodiments, a suitable check point inhibitor inhibits 2B4. In some embodiments, a suitable check point inhibitor inhibits CD160. In some embodiments, a suitable check point inhibitor inhibits CGEN-15049. In some embodiments, a suitable check point inhibitor inhibits CHK1. In some embodiments, a suitable check point inhibitor inhibits CHK2. In some embodiments, a suitable check point inhibitor inhibits A2aR.In some embodiments, the checkpoint inhibitor is an antagonist to PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, the checkpoint inhibitor is an antibody or fragment thereof. In some embodiments, the antibody or fragment thereof is humanized. In some embodiments, the composition comprises a checkpoint inhibitor.

[0094] Synthesis of mRNA The mRNA of the present invention can be synthesized according to any of various known methods.For example, the mRNA of the present invention can be synthesized through in vitro transcription (IVT).Briefly, IVT is often carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAseI, pyrophosphatase, and / or RNAse inhibitor.The exact conditions will vary depending on the specific application. Exemplary mRNA Construct Design Construct Design: X-mRNA coding region-Y 5' and 3' UTR sequences: X(5'UTR sequence)= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0095] The present invention can be used to deliver mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more in length. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs ranging from about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb in length.

[0096] In some embodiments, for the preparation of mRNA according to the present invention, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7 or SP6 promoter, followed by the desired nucleotide sequence of the desired mRNA and a termination signal.

[0097] Synthesis of mRNA using SP6 RNA polymerase In some embodiments, mRNA is produced using SP6 RNA polymerase. SP6 RNA polymerase is a DNA-dependent RNA polymerase with high sequence specificity for the SP6 promoter sequence. SP6 polymerase catalyzes the 5'→3' in vitro synthesis of RNA in either single-stranded or double-stranded DNA downstream of the promoter, incorporating natural and / or modified and / or labeled ribonucleotides into the polymerized transcript. Examples of such labeled ribonucleotides include biotin, fluorescein, digoxigenin, aminoallyl, and isotopically labeled nucleotides.

[0098] The sequence of bacteriophage SP6 RNA polymerase was originally described (GenBank: Y00105.1) as having the following amino acid sequence: (SEQ ID NO: 4).

[0099] The SP6 RNA polymerase suitable for the present invention may be any enzyme that has substantially the same polymerase activity as bacteriophage SP6 RNA polymerase. Thus, in some embodiments, the SP6 RNA polymerase suitable for the present invention is modified from SEQ ID NO: 4. For example, a suitable SP6 RNA polymerase may contain one or more amino acid substitutions, deletions, or additions. In some embodiments, a suitable SP6 RNA polymerase has an amino acid sequence that is about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, or 60% identical or homologous to SEQ ID NO: 4. In some embodiments, a suitable SP6 RNA polymerase may be a truncated protein (N-terminal, C-terminal, or internal), but retains polymerase activity. In some embodiments, the preferred SP6 RNA polymerase is a fusion protein.

[0100] SP6 RNA polymerase suitable for the present invention may be a commercial product, for example, from Aldevron, Ambion, New England Biolabs (NEB), Promega, and Roche. SP6 may be ordered and / or custom-designed from commercial or non-commercial sources according to the amino acid sequence of SEQ ID NO: 4, or a variant of SEQ ID NO: 4, described herein. SP6 may be a standard fidelity polymerase, or a high fidelity / high efficiency / high capacity one that has been modified to promote RNA polymerase activity (e.g., mutations in the SP6 RNA polymerase gene, or post-translational modifications of the SP6 RNA polymerase itself). Examples of such modified SP6 include Ambion's SP6 RNA Polymerase-Plus™, NEB's HiScribe SP6, and Promega's RiboMAX™ and Riboprobe™ systems.

[0101] In some embodiments, the suitable SP6 RNA polymerase is a fusion protein. For example, the SP6 RNA polymerase may include one or more tags to facilitate the isolation, purification, or solubility of the enzyme. Suitable tags may be located at the N-terminus, C-terminus, and / or internally. Non-limiting examples of suitable tags include calmodulin-binding protein (CBP), Fasciola hepatica 8-kDa antigen (Fh8), FLAG tag peptide, glutathione-S-transferase (GST), histidine tag (e.g., hexahistidine tag (His6)), maltose-binding protein (MBP), N-utilization substance (NusA), small ubiquitin-like modifier (SUMO) fusion tag, streptavidin-binding peptide (STREP), tandem affinity purification (TAP), and thioredoxin (TrxA). Other tags may be used in the present invention. These and other fusion tags are described, for example, in Costa et al. Frontiers in Microbiology 5(2014):63 and PCT / US16 / 57044, the contents of which are incorporated herein by reference in their entireties. In certain embodiments, the His tag is located at the N-terminus of SP6.

[0102] SP6 promoter Any promoter that can be recognized by SP6 RNA polymerase can be used in the present invention. Typically, the SP6 promoter comprises 5'ATTTAGGTGACACTATAG-3' (SEQ ID NO: 5). Variants of the SP6 promoter have been discovered and / or created to optimize the recognition and / or binding of SP6 to the promoter. Non-limiting variants include, but are not limited to: 5'-ATTTAGGGGACACTATAGAAGAG-3', 5'-ATTTAGGGGACACTATAGAAGG-3', 5'-ATTTAGGGGACACTATAGAAGGG-3', 5'-ATTTAGGTGACACTATAGAA-3', 5'-ATTTAGGTGACACTATAGAAGA-3', 5'-ATTTAGGTGACACTATAGAAGAG-3', 5'-ATTTAGGTGACACTATAGAAGG-3', 5'-ATTTAGGTGACACTATAGAAGAG-3', 5'-ATTTAGGTGACACTATAGAAGG-3', 5'-ATTTAGGTGACACTATAGAAGGG-3', 5'-ATTTAGGTGACACTATAGAAGNG-3', and 5'-CATACGATTTAGGTGACACTATAG-3' (SEQ ID NO: 6 to SEQ ID NO: 15).

[0103] Additionally, an SP6 promoter suitable for the present invention may be about 95%, 90%, 85%, 80%, 75%, or 70% identical or homologous to any one of SEQ ID NO:5 through SEQ ID NO:15. Additionally, an SP6 promoter useful for the present invention may include one or more additional nucleotides 5' and / or 3' to any of the promoter sequences described herein.

[0104] DNA template Typically, the DNA template is either fully double-stranded or mostly single-stranded with the double-stranded SP6 promoter sequence.

[0105] Linearized plasmid DNA (linearized via one or more restriction enzymes), linearized genomic DNA fragments (via restriction enzymes and / or physical means), PCR products, and / or synthetic DNA oligonucleotides can be used as templates for in vitro transcription with SP6, provided that they contain a double-stranded SP6 promoter upstream (and in the correct orientation) of the DNA sequence to be transcribed.

[0106] In some embodiments, the linearized DNA template has blunt ends.

[0107] In some embodiments, the DNA sequence to be transcribed may be optimized to promote more efficient transcription and / or translation. For example, DNA sequences can be optimized with respect to cis-regulatory elements (e.g., TATA boxes, termination signals, and protein binding sites), artificial recombination sites, Chi sites, CpG dinucleotide content, negative CpG islands, GC content, polymerase slippage sites, and / or other elements related to transcription; DNA sequences can be optimized with respect to cryptic splice sites, mRNA secondary structure, mRNA stable free energy, repetitive sequences, RNA instability motifs, and / or other elements related to mRNA processing and stability; DNA sequences can be optimized with respect to codon usage bias, codon adaptability, internal Chi sites, ribosome binding sites (e.g., IRES), premature polyA sites, Shine-Dalgarno (SD) sequences, and / or other elements related to translation; and / or DNA sequences can be optimized with respect to codon context, codon-anticodon interactions, translational pause sites, and / or other elements related to protein folding. Optimization methods known in the art may be used in the present invention, such as GeneOptimizer and OptimumGene™ by ThermoFisher, and are described in US2011 / 0081708, the contents of which are incorporated herein by reference in their entirety.

[0108] In some embodiments, the DNA template comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0109] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' untranslated region can be 50-500 nucleotides in length or more.

[0110] Exemplary 3' and / or 5' UTR sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' UTR sequence can include a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide. Inclusion of a sequence encoding human growth hormone (hGH) or a fragment thereof in the 3' end or untranslated region of the polynucleotide (e.g., mRNA) is also contemplated to further stabilize the polynucleotide. Generally, these modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, for example, to improve the resistance of such polynucleotides to in vivo nuclease digestion.

[0111] Large-scale mRNA synthesis The present invention relates to large-scale production of wild-type or codon-optimized mRNA. In some embodiments, the method according to the present invention synthesizes at least 100 mg, 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 5 g, 10 g, 25 g, 50 g, 75 g, 100 g, 250 g, 500 g, 750 g, 1 kg, 5 kg, 10 kg, 50 kg, 100 kg, 1000 kg, or more of mRNA in a single batch. As used herein, the term "batch" refers to the quantity or amount of mRNA synthesized at one time, e.g., produced according to a single manufacturing setup. A batch may refer to the amount of mRNA synthesized in one reaction, which occurs via a single aliquot of enzyme and / or a single aliquot of DNA template for continuous synthesis under one set of conditions. mRNA synthesized in a single batch does not include mRNA synthesized at different times that are combined to achieve a desired amount. In general, the reaction mixture includes SP6 RNA polymerase, a linear DNA template, and an RNA polymerase reaction buffer (which may contain ribonucleotides or may require the addition of ribonucleotides).

[0112] According to the present invention, typically, 1-100 mg of SP6 polymerase is used per gram (g) of mRNA produced. In some embodiments, about 1-90 mg, 1-80 mg, 1-60 mg, 1-50 mg, 1-40 mg, 10-100 mg, 10-80 mg, 10-60 mg, 10-50 mg of SP6 polymerase is used per gram of mRNA produced. In some embodiments, about 5-20 mg of SP6 polymerase is used to produce about 1 gram of mRNA. In some embodiments, about 0.5-2 grams of SP6 polymerase is used to produce about 100 grams of mRNA. In some embodiments, about 5-20 grams of SP6 polymerase is used for about 1 kilogram of mRNA. In some embodiments, at least 5 mg of SP6 polymerase is used to produce at least 1 gram of mRNA. In some embodiments, at least 500 mg of SP6 polymerase is used to produce at least 100 grams of mRNA. In some embodiments, at least 5 grams of SP6 polymerase is used to produce at least 1 kilogram of mRNA. In some embodiments, about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of plasmid DNA is used per gram of mRNA produced. In some embodiments, about 10-30 mg of plasmid DNA is used to produce about 1 gram of mRNA. In some embodiments, about 1-3 grams of plasmid DNA is used to produce about 100 grams of mRNA. In some embodiments, about 10-30 grams of plasmid DNA is used for about 1 kilogram of mRNA. In some embodiments, at least 10 mg of plasmid DNA is used to produce at least 1 gram of mRNA. In some embodiments, at least 1 gram of plasmid DNA is used to produce at least 100 grams of mRNA. In some embodiments, at least 10 grams of plasmid DNA is used to produce at least 1 kilogram of mRNA.

[0113] In some embodiments, the concentration of SP6 RNA polymerase in the reaction mixture can be about 1-100 nM, 1-90 nM, 1-80 nM, 1-70 nM, 1-60 nM, 1-50 nM, 1-40 nM, 1-30 nM, 1-20 nM, or about 1-10 nM. In certain embodiments, the concentration of SP6 RNA polymerase is about 10-50 nM, 20-50 nM, or 30-50 nM. Concentrations of SP6 RNA polymerase of 100-10,000 units / ml can be used, and by way of example, concentrations of 100-9,000 units / ml, 100-8,000 units / ml, 100-7,000 units / ml, 100-6,000 units / ml, 100-5,000 units / ml, 100-1,000 units / ml, 200-2,000 units / ml, 500-1,000 units / ml, 500-2,000 units / ml, 500-3,000 units / ml, 500-4,000 units / ml, 500-5,000 units / ml, 500-6,000 units / ml, 1,000-7,500 units / ml, and 2,500-5,000 units / ml can be used.

[0114] The concentration of each ribonucleotide (e.g., ATP, UTP, GTP, and CTP) in the reaction mixture is about 0.1 mM to about 10 mM, for example, about 1 mM to about 10 mM, about 2 mM to about 10 mM, about 3 mM to about 10 mM, about 1 mM to about 8 mM, about 1 mM to about 6 mM, about 3 mM to about 10 mM, about 3 mM to about 8 mM, about 3 mM to about 6 mM, about 4 mM to about 5 mM. In some embodiments, each ribonucleotide is about 5 mM in the reaction mixture. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP, and UTP) used in the reaction is in the range of 1 mM to 40 mM. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP, and UTP) used in the reaction ranges from 1 mM to 30 mM, or 1 mM to 28 mM, or 1 mM to 25 mM, or 1 mM to 20 mM. In some embodiments, the total rNTPs concentration is less than 30 mM. In some embodiments, the total rNTPs concentration is less than 25 mM. In some embodiments, the total rNTPs concentration is less than 20 mM. In some embodiments, the total rNTPs concentration is less than 15 mM. In some embodiments, the total rNTPs concentration is less than 10 mM.

[0115] RNA polymerase reaction buffers typically contain salts / buffers such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride.

[0116] The pH of the reaction mixture may be between about 6-8.5, 6.5-8.0, 7.0-7.5, and in some embodiments, the pH is 7.5.

[0117] Combine linear or linearized DNA template (e.g., as described above and in sufficient amounts / concentrations to provide the desired amount of RNA), RNA polymerase reaction buffer, and SP6 RNA polymerase to form a reaction mixture. Incubate the reaction mixture at about 37 °C to about 42 °C for 30 minutes to 6 hours, e.g., about 60 to about 90 minutes.

[0118] In some embodiments, about 5 mM NTPs, about 0.05 mg / mL SP6 polymerase, and about 0.1 mg / mL DNA template in a suitable RNA polymerase reaction buffer (final reaction mixture pH of about 7.5) are incubated at about 37° C. to about 42° C. for 60 to 90 minutes.

[0119] In some embodiments, the reaction mixture contains the linearized double-stranded DNA template along with SP6 polymerase-specific promoter, SP6 RNA polymerase, RNase inhibitor, pyrophosphatase, 29 mM NTPs, 10 mM DTT, and reaction buffer (for 10x, 800 mM HEPES, 20 mM spermidine, 250 mM MgCl2, pH 7.7), and sufficient quantity (QS) to bring to the desired reaction volume with RNase-free water, and then the reaction mixture is incubated at 37°C for 60 minutes. The polymerase reaction was then quenched by adding DNase I and DNase I buffer (for 10x - 100 mM Tris-HCl, 5 mM MgCl2 and 25 mM CaCl2, pH 7.6) to facilitate digestion of the double-stranded DNA template in preparation for purification. This embodiment has been shown to be sufficient to produce 100 grams of mRNA.

[0120] In some embodiments, the reaction mixture comprises NTPs at a concentration ranging from 1 to 10 mM, DNA template at a concentration ranging from 0.01 to 0.5 mg / ml, and SP6 RNA polymerase at a concentration ranging from 0.01 to 0.1 mg / ml, for example, the reaction mixture comprises NTPs at a concentration of 5 mM, DNA template at a concentration of 0.1 mg / ml, and SP6 RNA polymerase at a concentration of 0.05 mg / ml.

[0121] nucleotide A variety of naturally occurring or modified nucleosides may be used to produce mRNA according to the present invention. In some embodiments, the mRNA may be modified with natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-ur ... The nucleic acid may be or contain a 5'-amino-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0122] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. The non-standard nucleotide residues may include, for example, 5-methyl-cytidine ("5mC"), pseudouridine ("ψU"), and / or 2-thio-uridine ("2sU"). For a discussion of such residues and their incorporation into mRNA, see, for example, U.S. Pat. No. 8,278,036 or WO2011 / 012316. The mRNA may be RNA, defined as RNA in which 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings regarding the use of RNA are disclosed in U.S. Patent Application Publication No. 2012 / 0195936 and WO2011 / 012316, both of which are incorporated herein by reference in their entireties. The presence of non-standard nucleotide residues can make the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, the mRNA may include one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, as well as combinations of these and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of 2'-O-alkyl modifications, locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications may include, but are not limited to, 2'-deoxy-2'-fluoro modifications, 2'-O-methyl modifications, 2'-O-methoxyethyl modifications, and 2'-deoxy modifications.In some embodiments, any of these modifications may be present individually or in combination in 0-100% of the nucleotides, e.g., 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 100% of the constituent nucleotides.

[0123] Post-composite processing Typically, the 5' cap and / or 3' tail may be added post-synthetically. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation.

[0124] A 5' cap is typically added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates. Guanosine triphosphate (GTP) is then added to the terminal phosphate via guanylyltransferase, resulting in a 5'5'5 triphosphate linkage. The 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G). Additional cap structures are described in published U.S. Patent Application No. 2016 / 0032356 and U.S. Provisional Patent Application No. 62 / 464,327, filed February 27, 2017, and are incorporated herein by reference.

[0125] The tail structure typically comprises a poly(A) tail and / or a poly(C) tail. A poly(A) tail or poly(C) tail on the 3' end of an mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 50 ... at least 50 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, respectively.In some embodiments, the poly-A tail or poly-C tail each comprises between about 10 and 800 adenosine or cytosine nucleotides (e.g., between about 10 and 200 adenosine or cytosine nucleotides, between about 10 and 300 adenosine or cytosine nucleotides, between about 10 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 300 and 400 adenosine or cytosine nucleotides, between about 300 and 400 adenosine or cytosine nucleotides, between about 300 and 400 adenosine or cytosine nucleotides, between about 300 and 500 adenosine or cytosine nucleotides, between about 350 and 500 adenosine or cytosine nucleotides, between about 40 ... The poly(A) tail structure may be a poly(C) tail of any of the following lengths: about 600 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides. In some embodiments, the tail structure comprises a combination of poly(A) tails and poly(C) tails of various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0126] As described herein, the addition of a 5' cap and / or 3' tail facilitates the detection of abortive transcripts generated during in vitro synthesis because, without capping and / or tailing, the size of those prematurely aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, a 5' cap and / or 3' tail is added to the synthetic mRNA before the mRNA is tested for purity (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, a 5' cap and / or 3' tail is added to the synthetic mRNA before the mRNA is purified as described herein. In some embodiments, a 5' cap and / or 3' tail is added to the synthetic mRNA after the mRNA is purified as described herein.

[0127] The mRNA synthesized according to the present invention may be used without further purification. In particular, the mRNA synthesized according to the present invention may be used without a step of removing shortmers. In some embodiments, the mRNA synthesized according to the present invention may be further purified. Various methods can be used to purify the mRNA synthesized according to the present invention. For example, purification of the mRNA can be carried out using centrifugation, filtration, and / or chromatography methods. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted with a standard phenol:chloroform:isoamyl alcohol solution well known to those skilled in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include those described in US2016 / 0040154, US2015 / 0376220, PCT application PCT / US18 / 19954, filed February 27, 2018, entitled "METHODS FOR PURIFICATION OF MESSENGER RNA," and PCT application PCT / US18 / 19978, filed February 27, 2018, entitled "METHODS FOR PURIFICATION OF MESSENGER RNA," all of which are incorporated herein by reference and may be used to practice the present invention.

[0128] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified before and after capping and tailing.

[0129] In some embodiments, the mRNA is purified by centrifugation either before or after capping and tailing, or both before and after capping and tailing.

[0130] In some embodiments, the mRNA is purified by filtration either before or after capping and tailing, or both before and after capping and tailing.

[0131] In some embodiments, the mRNA is purified by tangential flow filtration (TFF) either before or after capping and tailing, or both before and after capping and tailing.

[0132] In some embodiments, the mRNA is purified by chromatography either before or after capping and tailing, or both before and after capping and tailing.

[0133] mRNA characterization Full length or abortive transcripts of mRNA may be detected and quantified using any method available in the art. In some embodiments, the synthesized mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV), or UPLC, or a combination thereof. The present invention includes other detection methods known in the art. In some embodiments, the synthesized mRNA molecules are detected using UV absorption spectroscopy with separation by capillary electrophoresis. In some embodiments, the mRNA is first denatured by glyoxal dye prior to gel electrophoresis ("glyoxal gel electrophoresis"). In some embodiments, the synthesized mRNA is characterized prior to capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.

[0134] In some embodiments, the mRNA produced by the methods disclosed herein contains less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1% of impurities other than full-length mRNA. Impurities include IVT contaminants, such as proteins, enzymes, free nucleotides, and / or shortmers.

[0135] In some embodiments, the mRNA produced according to the present invention is substantially free of shortmers or abortive transcripts. In particular, the mRNA produced according to the present invention contains undetectable levels of shortmers or abortive transcripts by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the term "shortmer" or "abortive transcript" refers to any transcript that is less than full length. In some embodiments, the "shortmer" or "abortive transcript" is less than 100 nucleotides in length, less than 90 nucleotides in length, less than 80 nucleotides in length, less than 70 nucleotides in length, less than 60 nucleotides in length, less than 50 nucleotides in length, less than 40 nucleotides in length, less than 30 nucleotides in length, less than 20 nucleotides in length, or less than 10 nucleotides in length. In some embodiments, the shortmers are detected or quantified after adding a 5'-cap and / or a 3'-polyA tail.

[0136] Delivery Vehicle According to the present invention, the mRNA encoding a protein or peptide described herein (e.g., full-length, fragments, or portions of a protein or peptide) may be delivered as naked RNA (unpackaged) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "transfer vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.

[0137] The delivery vehicle may be formulated in a pharmaceutical composition in combination with one or more additional nucleic acids, carriers, targeting ligands or stabilizing reagents, or mixed with a suitable excipient. Techniques for drug formulation and administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition. A particular delivery vehicle is selected based on its ability to facilitate transfection of nucleic acid into target cells.

[0138] In some embodiments, the delivery vehicle containing one or more mRNAs is administered intravenously, intratumorally, intradermally, subcutaneously, intramuscularly, intraperitoneally, epidurally, intrathecally, or by pulmonary delivery, including, for example, nebulization. In some embodiments, the mRNA is expressed in the tissue to which the delivery vehicle is administered. Additional teachings of pulmonary delivery and nebulization are described in related international application PCT / US17 / 61100, filed by the applicant on November 10, 2017, entitled "NOVEL ICE-BASED LIPID NANOPARTICLE FORMULATION FOR DELIVERY OF MRNA," and U.S. Provisional Patent Application No. 62 / 507,061, each of which is incorporated by reference in its entirety.

[0139] In some embodiments, the mRNA that codes for a protein or peptide may be delivered via a single delivery vehicle.In some embodiments, the mRNA that codes for a protein or peptide may be delivered via one or more delivery vehicles, each of which has a different composition.In some embodiments, one or more mRNAs are encapsulated in the same lipid nanoparticle.In some embodiments, one or more mRNAs are encapsulated in separate lipid nanoparticles.

[0140] According to various embodiments, suitable delivery vehicles include, but are not limited to, polymer-based carriers such as polyethyleneimine (PEI), lipid nanoparticles, and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural lamellar bodies, synthetic lamellar bodies, and semi-synthetic lamellar bodies, nanoparticles, calcium phospho-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gel, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vectorial tags.Also contemplated as suitable transport vehicles are bio-nanocapsules and other viral capsid protein assemblies. (See Hum. Gene Ther. 2008 September;19(9):887-95.

[0141] Liposomal Delivery Vehicles In some embodiments, the suitable delivery vehicle is a liposomal delivery vehicle, for example, a lipid nanoparticle. As used herein, a liposomal delivery vehicle, for example, a lipid nanoparticle, is usually characterized as a microscopic vesicle with an internal aqueous space separated from the external medium by one or more bilayer membranes. The bilayer membrane of a liposome is typically formed by amphiphilic molecules such as lipids of synthetic or natural origin, which contain spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome may also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, a liposomal delivery vehicle typically serves to transport desired mRNA to target cells or tissues. In some embodiments, the nanoparticle delivery vehicle is a liposome. In some embodiments, the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.In some embodiments, the liposome comprises three or less distinct lipid components.In some embodiments, one distinct lipid component is a sterol-based cationic lipid.

[0142] Cationic lipids In some embodiments, liposomes may contain one or more cationic lipids. As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. Some cationic lipids have been described in the literature, many of which are commercially available. Cationic lipids suitable for use in the compositions and methods of the present invention include those described in International Patent Publication Nos. 2010 / 053572 (e.g., CI 2-200, described in paragraph

[0225] ) and 2012 / 170930, both of which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include, for example, (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ( No. 61 / 617,468, filed March 29, 2012 (hereby incorporated by reference), such as (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002).

[0143] In some embodiments, the provided liposomes comprise cationic lipids as described in WO2013 / 063468 and in U.S. Provisional Application No. 2013 / 063468, entitled "Lipid Formulations for Delivery of Messenger RNA," filed concurrently herewith, both of which are incorporated herein by reference.

[0144] In some embodiments, the cationic lipid is a compound of formula I-c1-a: [ka] , or a pharma- ceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is alkyl, each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is alkyl, Each R L is independently 8-12 It is an alkyl.

[0145] In some embodiments, each R 2 is independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0146] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0147] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0148] In some embodiments, each R L is independently 8-12 In some embodiments, each R L are independent of each other, 8-12 In some embodiments, each R L is independently 9-11 In some embodiments, each R L are independent of each other, 9-11 In some embodiments, each R L is independently 10 In some embodiments, each RL are independent of each other, 10 It is an alkyl.

[0149] In some embodiments, each R 2 is independently hydrogen or methyl, each q is independently 3 to 5, each R' is independently hydrogen or methyl, and each R L is independently C 8-12 It is an alkyl.

[0150] In some embodiments, each R 2 is hydrogen, each q is independently 3 to 5, each R' is hydrogen, and each R L is independently C 8-12 It is an alkyl.

[0151] In some embodiments, each R 2 is hydrogen, each q is 4, each R' is hydrogen, and each R L is independently C 8-12 It is an alkyl.

[0152] In some embodiments, the cationic lipid is a compound of formula Ig: [ka] , or a pharma- ceutically acceptable salt thereof, wherein each R L is independently C 8-12 In some embodiments, each R L are independent of each other, 8-12 In some embodiments, each R L is independently 9-11 In some embodiments, each R L are independent of each other, 9-11 In some embodiments, each R L is independently 10 In some embodiments, each R L nC 10 It is an alkyl.

[0153] In certain embodiments, provided liposomes comprise the cationic lipid cKK-E12 or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below. [ka] .

[0154] Further exemplary cationic lipids are cationic lipids of formula I: [ka] and pharma- ceutically acceptable salts thereof, During the ceremony, R is [ka] or R is [ka] or R is [ka] or R is [ka] is (See, for example, Fenton, Owen S., et al., “Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery.” Advanced materials (2016)).

[0155] In some embodiments, the one or more cationic lipids may be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA" (Feigner et al. (Proc. Nat'l Acad. Sci. 84,7413 (1987), U.S. Pat. No. 4,897,355). DOTMA may be formulated alone or in combination with neutral lipids, dioleoylphosphatidyl-ethanolamine or "DOPE", or other cationic or non-cationic lipids, into liposome transfer vehicles or lipid nanoparticles, and such liposomes may be used to enhance delivery of nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-carboxyspermylglycine dioctadecylamide or "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium or "DOSPA" (Behr No. 5,171,678; U.S. Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane or "DODAP," and 1,2-dioleoyl-3-trimethylammonium-propane or "DOTAP."

[0156] Further exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-distearyl-N,N-dimethylammonium bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-dimethyl ... 2-(5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-l-(cis,cis-9',l-2'-octadecadienoxy)propane or "CLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "CpLinDMA", These are "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", l,2-N,N'-dilinoleylcarbival-3-dimethylaminopropane or "DLincarbDAP", l,2-dilinoleoylcarbival-3-dimethylaminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane or "DLin- -DMA”, 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane or “DLin-K-XTC2-DMA”, and 2-(2,2-di((9Z,12Z)-octadeca-9,l 2-dien-1-yl)-l,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA)) (WO2010 / 042877; Semple et al., Nature Biotech.28:172-176(2010)), or mixtures thereof. (Heyes, J., et al., J Controlled Release 107:276-287(2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007(2005); PCT Publication No. WO2005 / 121348A1). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0157] In some embodiments, the one or more cationic lipids are selected from the group consisting of XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-o NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (W No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety), ICE (WO 2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), amino alcohol lipidoids such as those disclosed in WO 2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic DLin-KC2-DMA (Semple, SC et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KP et al."Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010,107,1864-1869).

[0158] Sterol Cationic Lipids In some embodiments, sterol-based cationic lipid is dialkylamino-containing sterol-based cationic lipid, imidazole-containing sterol-based cationic lipid, and guanidinium-containing sterol-based cationic lipid.For example, certain embodiments are directed to compositions comprising one or more sterol-based cationic lipids that contain imidazole, for example, the imidazole cholesterol ester or "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by the following structure (II). In certain embodiments, lipid nanoparticles for delivery of RNA (e.g., mRNA) encoding a functional protein may include one or more imidazole-based cationic lipids, such as the imidazole cholesterol ester or "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by structure (II). [ka]

[0159] In some embodiments, the percentage of cationic lipid in the liposome can be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid comprises about 30-50% by weight of the liposome (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, the cationic lipid (e.g., ICE lipid) comprises about 30%, about 35%, about 40%, about 45%, or about 50% by molar ratio of the liposome.

[0160] Non-cationic / helper lipids In some embodiments, the provided liposomes include one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DPPG ... amine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), or mixtures thereof.

[0161] In some embodiments, such non-cationic lipids may be used alone, but are preferably used in combination with other lipids, such as cationic lipids. In some embodiments, the non-cationic lipids may comprise a molar ratio of about 5% to about 90%, or about 10% to about 70% of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that do not carry a net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the percentage of non-cationic lipids in the liposome may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0162] Cholesterol-Based Lipids In some embodiments, the liposomes provided include one or more cholesterol-based lipids. By way of example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), l,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Pat. No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise a molar ratio of about 2% to about 30%, or about 5% to about 20%, of the total lipid present in the liposome. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0163] PEG modified lipid The use of polyethylene glycol (PEG) modified phospholipids and derivatized lipids such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), alone or preferably in combination with other lipid formulations, including transfer vehicles (e.g., lipid nanoparticles), is also contemplated by the present invention. Contemplated PEG-modified lipids range in length from C6 to C 20 The addition of such moieties can prevent aggregation of the complex and can also increase circulation lifetime and provide a means for increasing delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237). Alternatively, these moieties can be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention can comprise a molar proportion of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipid present in the liposomal transfer vehicle.

[0164] According to various embodiments, the selection of cationic lipid, non-cationic lipid, and / or PEG-modified lipid, which comprises lipid nanoparticles, and the selection of the relative molar ratio of these lipids to each other are based on the properties of the selected lipid, the properties of the intended target cell, and the properties of the MCNA to be delivered.Additional considerations include, for example, the saturation degree of the alkyl chain of the selected lipid, as well as size, charge, pH, pKa, fusogenicity, and toxicity.Therefore, the molar ratio can be adjusted accordingly.

[0165] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, alone or in combination with other carriers, including various lipids as described herein. Thus, in some embodiments, liposomal delivery vehicles as used herein also encompass nanoparticles containing polymers. Suitable polymers may include, for example, polyacrylates, polyalkoxyanoacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is included, the PEI may be a branched PEI having a molecular weight in the range of 10-40 kDa, for example, a branched PEI of 25 kDa (Sigma#408727).

[0166] The liposome suitable for the present invention may comprise any one or more of the cationic lipid, non-cationic lipid, cholesterol lipid, PEG-modified lipid, and / or polymer described herein in various ratios.As a non-limiting example, the suitable liposome formulation may comprise a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K.

[0167] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the percentage of cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome by molar ratio.

[0168] In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid may be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is about 50:25:20:5.

[0169] Ratio of individual lipid components In embodiments in which the lipid nanoparticle comprises three or fewer distinct components of lipid, the ratio of the total lipid content (i.e., the ratio of lipid component (1):lipid component (2):lipid component (3)) may be expressed as x:y:z, (y+z)=100-x.

[0170] In some embodiments, each of "x," "y," and "z" represents the mole percentage of three separate components of the lipid, and the ratios are molar ratios.

[0171] In some embodiments, "x," "y," and "z" each represent the weight percentage of three separate components of the lipid, and the ratios are weight ratios.

[0172] In some embodiments, the lipid component (1), represented by the variable "x," is a sterol-based cationic lipid.

[0173] In some embodiments, the lipid component (2), represented by the variable "y", is a helper lipid.

[0174] In some embodiments, the lipid component (3), represented by the variable "z," is a PEG lipid.

[0175] In some embodiments, the variable "x", which represents the molar percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0176] In some embodiments, the variable "x", which represents the mole percent of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.

[0177] In some embodiments, the variable "x", which represents the mole percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%. In embodiments, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.

[0178] In some embodiments, the variable "x", which represents the weight percentage of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0179] In some embodiments, the variable "x", which represents the weight percent of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.

[0180] In some embodiments, the variable "x", which represents the weight percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%. In embodiments, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.

[0181] In some embodiments, the variable "z" representing the mole percent of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the variable "z" representing the mole percent of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%. In embodiments, the variable "z", representing the mole percent of lipid component (3) (e.g., a PEG lipid), is from about 1% to about 10%, from about 2% to about 10%, from about 3% to about 10%, from about 4% to about 10%, from about 1% to about 7.5%, from about 2.5% to about 10%, from about 2.5% to about 7.5%, from about 2.5% to about 5%, from about 5% to about 7.5%, or from about 5% to about 10%.

[0182] In some embodiments, the variable "z" representing the weight percent of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the variable "z" representing the weight percent of lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%. In embodiments, the variable "z", representing the weight percent of lipid component (3) (e.g., PEG lipid), is from about 1% to about 10%, from about 2% to about 10%, from about 3% to about 10%, from about 4% to about 10%, from about 1% to about 7.5%, from about 2.5% to about 10%, from about 2.5% to about 7.5%, from about 2.5% to about 5%, from about 5% to about 7.5%, or from about 5% to about 10%.

[0183] For compositions having only three separate lipid components, the variables "x," "y," and "z" may be in any combination as long as the sum of the three variables equals 100% of the total lipid content.

[0184] Formulation of liposomes encapsulating mRNA The liposome transfer vehicle for use in the composition of the present invention can be prepared by various techniques currently known in the art. The liposome for use in the provided composition can be prepared by various techniques currently known in the art. For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques, such as by dissolving the lipid in a suitable solvent, depositing selected lipids on the inner wall of a suitable container or vessel, and then evaporating the solvent to leave a thin film on the inside of the vessel, or spray drying. Aqueous phase can then be added to the vessel with vortexing, thus forming MLVs. Unilamellar vesicles (ULVs) can then be formed by homogenization, sonication, or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.

[0185] In certain embodiments, the provided composition comprises liposome, in which mRNA is associated on both surfaces of liposome and is encapsulated in the liposome.For example, during the preparation of the composition of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.For example, during the preparation of the composition of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.

[0186] In some embodiments, the compositions and methods of the present invention include mRNA encapsulated in liposomes. In some embodiments, one or more mRNA species can be encapsulated in the same liposome. In some embodiments, one or more mRNA species can be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes, which differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes can have different compositions of sterol-based cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes can have different molar ratios of cholesterol-based cationic lipids, neutral lipids, and PEG-modified lipids used to make the liposomes.

[0187] The process of incorporating desired mRNA into liposomes is often referred to as "loading". Exemplary methods are described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. Nucleic acids incorporated into liposomes may be located entirely or partially within the interior space of the liposome, i.e., within the bilayer membrane of the liposome, or may be associated with the outer surface of the liposome membrane. Incorporation of nucleic acids into liposomes is also referred to herein as "encapsulation", where the nucleic acid is completely contained within the interior space of the liposome. The purpose of incorporating mRNA into a transfer vehicle, such as a liposome, is often to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid, and / or systems or receptors that cause the nucleic acid to be rapidly excreted. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate the delivery of the mRNA to a target cell or tissue.

[0188] Suitable liposomes according to the present invention can be made in various sizes. In some embodiments, the provided liposomes can be made smaller than the conventionally known mRNA-encapsulating liposomes. In some embodiments, the reduced size of the liposomes increases the efficiency of mRNA delivery. The appropriate liposome size can be selected taking into account the site of the target cell or tissue, and also taking into account in part the application of the liposomes to be made.

[0189] In some embodiments, liposomes of appropriate size are selected to promote the systemic distribution of the antibody encoded by mRNA.In some embodiments, it may be desirable to limit the transfection of mRNA to specific cells or tissues.For example, to target hepatocytes, liposomes can be sized so that their size is smaller than the fenestration of the endothelial layer covering the hepatic sinusoids of the liver, and in this case, liposomes can easily penetrate the fenestration to reach the target hepatocytes.

[0190] Alternatively or additionally, liposomes may be sized such that the liposomes are of sufficient diameter to limit or purposely prevent distribution within particular cells or tissues.

[0191] A variety of alternative methods known in the art can be used to size liposome populations. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of the liposome suspension, either by bath or probe sonication, results in a gradual size reduction down to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method, which utilizes shear energy to fragment larger liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated using a standard emulsion homogenizer until a selected liposome size is observed, typically about 0.1 to 0.5 micrometers. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS evaluation to guide efficient liposome synthesis. EXAMPLES

[0192] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the present invention and are not intended to be limiting thereof.

[0193] Example 1. Formulation of mRNA-loaded LNPs for cancer treatment This example provides exemplary mRNA-loaded lipid nanoparticles (LNPs) for use in in vivo efficacy testing of cancer treatments.

[0194] Messenger RNA encoding codon-optimized, wild-type, or mutant IL-2, IL-12, STING, GM-CSF, FLT-3L, NLRP3, or combinations thereof, as shown in Table 1, was prepared and encapsulated into LNPs containing cKK-E12. As a negative control, firefly luciferase (FFL) mRNA was encapsulated into LNPs. [Table 1]

[0195] Example 2. Study design for in vivo efficacy of mRNA-LNP in the MC38 mouse model This example describes a study design to preclinically evaluate the in vivo therapeutic efficacy of mRNA-LNPs in treating a subcutaneous MC38 murine colon cancer syngeneic mouse model.

[0196] MC-38 (a murine colorectal cancer cell line) tumors were implanted subcutaneously in immunocompetent mice. Serum was collected 3–4 days prior to tumor inoculation and at the time of sacrifice. 3 When tumors had grown to a size of 1000 mm (day 1, d1), mice were intratumorally injected with various mRNA-LNPs prepared as described in Example 1. Six injections were given over a period of 20 days at intervals of 4 days, as shown in Table 2. Groups B and C received a single agent, whereas groups D-H received a combination of agents. Groups A and I received saline and FFL mRNA-LNPs, respectively, as negative controls. Mice were monitored throughout the study and continued to be followed up until day 46 or when tumor size reached 3000 mm . 3 Tumor volumes were measured until they exceeded 100 mm. [Table 2]

[0197] Example 3. In vivo antitumor efficacy of mRNA-LNPs in the MC38 mouse model This example demonstrates the in vivo efficacy of mRNA-LNPs made according to the present invention in reducing tumor size and inhibiting tumor growth.

[0198] Tumor volumes were measured at the indicated time points, as shown in Figure 1 and Table 3. The endpoint of the study was the death of the animals or a tumor volume of 3000 mm 3 It was either that or that.

[0199] FIG. 1 shows that the mean tumor volumes of mice in groups BH were significantly smaller than the mean tumor volumes of mice in groups A or I. Most of the mice in groups A and I either died before the completion of the study or had tumor volumes below 3000 mm. 3 At the end of the study (d46), the complete response (CR) rates were 100% in group B, 30% in group C, 90% in group D, 80% in group E, 90% in group F, 70% in group G, and 70% in group H (see Figures 5B-5G). Notably, tumor growth was significantly delayed in mice in groups B-H compared with the negative control. See Tables 3-6. In addition, the change rates of body weight in groups B-H were significantly lower compared with groups A or I (Figure 6). [Table 3]

[0200] The average tumor volume of each group was compared with that of the control group (Group A). ​​Specifically, the tumor volume (T) of the test group was divided by the tumor volume (C) of the control group at each time point, and the percentages were plotted as shown in Figure 2. Furthermore, the inhibition rate of tumor volume was calculated for each group as follows: (mean (C)-mean (T)) / mean (C)) x 100%, and plotted as shown in Figure 3 and Table 4. The tumor volume of each mouse in Groups B-H measured on day 46 was plotted as shown in Figure 4. The average value of each group is shown. [Table 4] [Table 5] [Table 6]

[0201] Overall, this example demonstrates that mRNA-LNPs produced according to the present invention have anti-tumor activity and are effective in treating cancer in vivo.

[0202] μμ Example 4. Administration of constitutively active STING mRNA encapsulated in lipid nanoparticles delays tumor growth and improves survival in animal models The effect of administration of lipid-encapsulated constitutively active STING mRNA on tumor growth and animals was evaluated. For these studies, mouse models (N=10) were inoculated with MC38 tumor cells and the cells were allowed to grow in the animal models to form tumors. The animal models were then administered lipid-encapsulated mRNA containing codon-optimized constitutively active STING. Lipid nanoparticles were formulated with cationic lipids of formula I (as described above) and 1.5% PEG. Animals received an intratumoral dose of 5 μg lipid-encapsulated mRNA every 4 days. Data from these studies are shown in FIG. 7. As shown in FIG. 7, animals administered constitutively active STING mRNA had less tumor growth compared to the vehicle-only control and compared to the additional negative control. These data indicate that administration of lipid-encapsulated constitutively active STING reduces tumor growth and delays the tumor growth profile. These data further indicate that lipid-encapsulated mRNA encoding constitutively active STING is a promising standalone therapeutic for the treatment of cancer.

[0203] Additional studies were performed using the MC38 mouse tumor model described above to evaluate survival of the animal model following administration of lipid-encapsulated constitutively active STING to the animals. For these studies, the study arms included the following: one group of animals was administered lipid-encapsulated constitutively active STING mRNA, and another group of mice was administered constitutively active STING mRNA in combination with a PD-1 monoclonal antibody. Data from these studies showed that administration of lipid-encapsulated constitutively active STING mRNA improved survival of the animal model without the addition of a PD-1 monoclonal antibody (Figure 8). Taken together, these data indicate that administration of lipid-encapsulated constitutively active STING mRNA reduces and delays tumor growth and improves survival.

[0204] Equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. A composition for use in a method for treating cancer comprising two or more mRNAs encapsulated within one or more lipid nanoparticles, each encoding a protein or peptide, said method comprising administering the composition to a subject in need thereof, two of the two or more mRNAs encoding STING and IL-12, respectively.

2. The composition of claim 1, wherein the two or more mRNAs comprise a first mRNA encoding a first protein or peptide encapsulated in a first lipid nanoparticle and a second mRNA encoding a second protein or peptide encapsulated in a second lipid nanoparticle.

3. The composition of claim 1 or 2, wherein the two or more mRNAs comprise at least three mRNAs encoding STING, IL-12, and GM-CSF, respectively.

4. The composition of claim 1 or 2, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L and GM-CSF, respectively.

5. The composition of claim 1 or 2, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3 and GM-CSF, respectively.

6. The composition of claim 1 or 2, wherein the two or more mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2 and GM-CSF, respectively.

7. The composition of any one of claims 1 to 6, wherein the STING is a mutant form of the STING.

8. The composition of claim 7, wherein the mutant form enables the STING to become constitutively active.

9. The composition of any one of claims 1 to 8, wherein said administration results in a tumor growth inhibition rate of greater than 50% compared to a control 7 days after administration of the first dose.

10. 10. The composition of any one of claims 1 to 9, wherein the administration results in greater than 60%, greater than 70%, or greater than 80% tumor growth inhibition compared to a control 10 days after administration of the first dose.

11. 11. The composition of any one of claims 1-10, wherein the administration results in greater than 80%, greater than 85%, or greater than 90% tumor growth inhibition compared to a control 20 days after administration of the first dose.

12. 12. The composition of any one of claims 1 to 11, wherein said administration of said composition results in a percent change in body weight in said subject of less than 15%, less than 10%, or less than 5% compared to a control.

13. The composition of claim 10 or 11, wherein the control is a subject with a comparable disease state who is not receiving treatment.

14. The composition of claim 12, wherein the control is the subject's body weight prior to the administration of the composition.

15. The composition of any one of claims 1 to 14, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

16. The composition of claim 15, wherein the lipid nanoparticles further comprise cholesterol or one or more cholesterol-based lipids.

17. 3. The composition of claim 2, wherein the first lipid nanoparticle comprises a first cationic lipid and the second lipid nanoparticle comprises a second cationic lipid, the first cationic lipid being different from the second cationic lipid.

18. The composition according to any one of claims 1 to 17, characterized in that the composition is administered intratumorally.

19. The composition according to any one of claims 1 to 18, characterized in that the composition is administered subcutaneously.

20. The composition according to any one of claims 1 to 19, characterized in that the composition is administered intradermally.

21. The composition according to any one of claims 1 to 20, characterized in that the composition is administered intravenously.

22. The composition according to any one of claims 1 to 21, characterized in that the composition is administered by pulmonary administration.

23. The composition of any one of claims 1 to 22, wherein the composition is administered by nebulization.

24. The method according to any one of claims 1 to 23, wherein the administration comprises injecting a single dose. composition.

25. The composition of any one of claims 1 to 23, wherein said administration comprises periodic injections of multiple doses.

26. 26. The composition of claim 24 or 25, wherein the single dose or the multiple doses range from 0.1 μg to 100 mg of mRNA.

27. 26. The composition of claim 24 or 25, wherein the single dose or the multiple doses are in the range of 0.1 μg to 50 mg, 0.1 μg to 25 mg, 0.1 μg to 10 mg, 1 μg to 1 mg, or 1 μg to 100 μg of mRNA.

28. 26. The composition of claim 24 or 25, wherein the single dose or the multiple doses are selected from 0.1 μg, 0.3 μg, 0.5 μg, 1 μg, 5 μg, 10 μg, 25 μg, 50 μg, or 100 μg.

29. The single dose or the multiple doses are from 0.01 μg / kg to 10 mg / kg (mRNP A composition according to claim 24 or 25, in which the total amount of the active ingredient is in the range of A / body weight.

30. 26. The composition of claim 24 or 25, wherein the single dose or the multiple doses are in the range of 0.01 μg / kg to 8 mg / kg, 0.01 μg / kg to 6 mg / kg, 0.01 μg / kg to 5 mg / kg, 0.1 μg / kg to 5 mg / kg, 0.1 μg / kg to 1 mg / kg, or 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

31. The composition of any one of claims 25 to 30, wherein each of the multiple doses comprises the same dosage of mRNA.

32. 32. The composition of any one of claims 25 to 31, wherein each of the multiple doses comprises a different dosage of the mRNA.

33. 33. The composition of any one of claims 25 to 32, wherein each of the multiple doses is injected at intervals of from 1 day to 3 weeks.

34. 34. The composition of any one of claims 25 to 33, wherein each of the multiple doses is injected weekly.

35. The composition of any one of claims 1 to 34, wherein the mRNA comprises one or more modified nucleotides.

36. The composition of any one of claims 1 to 35, wherein the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR).

37. The composition of any one of claims 1 to 36, wherein said administration of said composition activates T cells in said subject.

38. The composition according to any one of claims 1 to 37, characterized in that it is administered to the subject in combination with a composition comprising a checkpoint inhibitor.

39. The composition according to any one of claims 1 to 37, wherein the subject is not administered a composition comprising a checkpoint inhibitor.

40. 39. The composition of claim 38, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof.

41. The composition of any one of claims 1 to 40, wherein the one or more lipid nanoparticles comprise at least one lipid nanoparticle comprising a cationic lipid selected from cKK-E12, OF-00, OF-01, OF-02, and OF-03.

42. A pharmaceutical composition comprising at least two mRNAs encoding IL-12 and STING, wherein the at least two mRNAs are encapsulated in one or more lipid nanoparticles, the at least one or more lipid nanoparticles each comprising a cationic lipid, a non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid, and at least one of the at least one or more lipid nanoparticles comprises cKK-E12, OF-00, OF-01, OF-02, or OF-03 as a cationic lipid.

43. 43. The pharmaceutical composition of claim 42, wherein the composition further comprises an additional mRNA encoding a checkpoint inhibitor.

44. The pharmaceutical composition of claim 42 or 43, wherein the one or more mRNAs comprise at least three mRNAs encoding STING, IL-12, and GM-CSF, respectively.

45. The pharmaceutical composition of claim 42 or 43, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, FLT-3L, and GM-CSF, respectively.

46. The pharmaceutical composition of claim 42 or 43, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, NLRP3, and GM-CSF, respectively.

47. The pharmaceutical composition of claim 42 or 43, wherein the one or more mRNAs comprise at least four mRNAs encoding STING, IL-12, IL-2, and GM-CSF, respectively.

48. The pharmaceutical composition of any one of claims 42 to 47, wherein the STING is a mutant form of the STING.

49. The pharmaceutical composition of claim 48, wherein the mutant form enables the STING to become constitutively active.

50. 50. The pharmaceutical composition of any one of claims 42 to 49, further comprising an additional mRNA encoding a protein or peptide that does not modulate the immune response.

51. 51. The pharmaceutical composition of any one of claims 43-50, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof.

52. A second lipid nanoparticle does not include cKK-E12 and is selected from the group consisting of OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hi 52. The pharmaceutical composition of any one of claims 42 to 51, further comprising a second lipid nanoparticle comprising a cationic lipid selected from the group consisting of: 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof.

53. A composition according to any one of claims 1 to 42, wherein said administration produces an ascopal effect.

54. 54. The composition of claim 53, wherein said administration results in greater than 50% tumor growth inhibition of untreated tumors compared to controls 7 days after administration of the first dose.

55. 54. The composition of claim 53, wherein the administration results in a tumor growth inhibition rate of untreated tumors of greater than 60%, greater than 70%, or greater than 80% compared to a control 10 days after administration of the first dose.

56. 54. The composition of claim 53, wherein the administration results in greater than 80%, greater than 85%, or greater than 90% tumor growth inhibition of untreated tumors compared to controls 20 days after administration of the first dose.

57. The composition of any one of claims 1-41 or 53-56, wherein said administration increases survival of a subject with cancer.

Images