Rice kernels with thickened aleurone

Abstract

The present invention relates to rice grains having thickened aleurone. It also provides rice containing at least one genetic mutation in which the activity of at least one ROS1a gene is reduced in the plant. The grains of the present invention, or their aleurone, have improved nutritional properties and are therefore particularly useful for human and animal feed products.

Description

[Technical field]

[0001] The present invention relates to rice grains having thickened aleurone. Also provided is a rice plant comprising at least one genetic mutation that reduces the activity of at least one ROS1a gene in the plant. The grains of the present invention, or the aleurone therefrom, have improved nutritional properties and are therefore particularly beneficial for human and animal feed products. [Background technology]

[0002] Worldwide, cereal grains such as wheat, rice, maize, and to a lesser extent barley, oats, and rye are the major source of human caloric intake from the starch content of the grain. Cereal grains are also important in providing other nutritional components such as protein, vitamins, minerals, and dietary fiber. To these nutritional components, different parts of the grain contribute differently. Starch is stored in the starchy endosperm of the cereal grain, while other nutritional components are more concentrated in the germ and bran (Buri et al., 2004). However, the bran is often removed before being used in food, especially in rice eaten as white rice.

[0003] Cereal grains develop from a double fertilization event between female and male gametophytes. One of the two sperm cells from the pollen tube fuses with an egg cell to produce a zygote that develops into an embryo, and the other sperm cell fuses with the diploid central cell of the female gametophyte (megagametophyte) to produce the primary endosperm nucleus from which the genetically triploid endosperm develops. Thus, the aleurone-containing endosperm is triploid with two copies of the female haploid genome and one copy of the male haploid genome. In dicotyledonous seeds, the endosperm is consumed by the developing embryo, whereas in monocotyledonous plants such as rice, the endosperm persists to make up the majority of the mature grain.

[0004] The mature endosperm of cereals has four cell types with different properties: the starchy endosperm, characterized by starch granules and storage proteins; the epidermis-like aleurone, which is one cell layer thick and most often surrounds most of the starchy endosperm; the transport cells at the base of the seed above the main female vasculature; and the layer of embryo-peripheral cells, which form the lining of the embryo early in the development of the grain, but may later surround only the suspenders connecting the embryo and the starchy endosperm (Becraft et al., 2001a). The embryo forms in the cavity of the starchy endosperm. Thus, the cereal aleurone tissue comprises the outermost layer of the endosperm in the cereal grain and surrounds the starchy endosperm and part of the embryo.

[0005] Aleurone cells are distinguished from starchy endosperm cells by their morphology, biochemical composition and gene expression profile (Becraft and Yi, 2011). Aleurone cells are generally rich in oil and protein and secrete enzymes that allow translocation of endosperm reserves during seed germination. Each aleurone cell is enclosed within a fibrous cell wall that is thicker than the endosperm cell wall and is composed mainly of arabinoxylans and beta-glucans in varying proportions and is highly autofluorescent. The aleurone layer is the only layer in cereals that is sometimes stained by anthocyanins.

[0006] Cereal aleurone is only one cell layer thick in wheat and wild-type maize (Buttrose 1963; Walbot, 1994), from one to up to three cell layers mainly in the dorsal region of the endosperm of rice (Hoshikawa, 1993), and three cell layers in wild-type barley (Jones, 1969). In normal endosperm, aleurone is very regular and the cell division pattern is highly organized. Wild-type mature aleurone cells are roughly rectangular in section with dense cytoplasm containing granules, vesicles, and inclusions composed of proteins, lipids, and phytin or protein + carbohydrate. In mature cereal grains, aleurone is the only endosperm tissue that is alive, albeit in a dormant, dry form. Upon imbibition, the embryo produces gibberellins which induce the synthesis of amylases and other hydrolytic enzymes by the aleurone which are released into the starchy endosperm to break down storage compounds and form sugars and amino acids in order to accelerate the embryo's growth into a seedling.

[0007] The control of aleurone development in cereal grains was reviewed by Becraft and Yi (2011). Multiple levels of gene regulation control cell fate, differentiation and organization, and many genes are involved in this process, only some of which have been identified. For example, maize defective kernal1 (dek1) loss-of-function mutants lack an aleurone layer indicating that the wild-type Dek1 polypeptide is required for specifying the outer cell layer as aleurone (Becraft et al., 2002). The Dek1 polypeptide is a large integral membrane protein with 21 transmembrane domains and a cytoplasmic domain that contains an active calpain protease. Another maize gene, CRINKLY4 (CR4), encodes a receptor kinase that functions as a positive regulator of aleurone fate, and cr4 mutants have reduced aleurone (Becraft et al., 2001b).

[0008] Several examples of thickened aleurone in cereal grain mutants have been reported in the literature, but have not proven to be useful for pleiotropic effects or agronomic and production problems.

[0009] Shen et al. (2003) reported the identification of maize mutants in the supernumary aleurone layers1 (sal1) gene that had two to three or up to seven layers of aleurone cells instead of the normal single layer. The SAL polypeptide was identified as a class E vacuolar-localized protein. Homozygous sal1-1 mutant kernels failed to germinate and had defective embryos with highly reduced starchy endosperm. Incomplete mutants homozygous for the sal1-2 allele showed two cell layers of aleurone. However, the mutant plants grew only 30% of the height of the wild type, had reduced root mass, and poor seed set (Shen et al. 2003). These plants were not agriculturally useful.

[0010] Yi et al. (2011) reported the identification of the thick aleurone1 (thk1) mutant in maize. The mutant kernels showed numerous aleurone layers. However, the mutant kernels lacked mature embryos and did not germinate when sown. The wild-type Thk1 gene encodes a Thk1 polypeptide that acts downstream of the Dek1 polypeptide, which is required for aleurone development in maize (Becraft et al., 2002).

[0011] Maize extra cell layer (Xcl) gene mutants were identified by their leaf morphological effects. The mutants produced a double aleurone layer as well as a multi-layered leaf epidermis (Kessler et al., 2002). The Xcl mutation was a semi-dominant mutant that disrupted cell division and differentiation patterns in maize, producing thick and narrow leaves with an abnormal glossy appearance.

[0012] Maize mutants in the disorgal1 and disorgal2 (dil1 and dil2) genes exhibited aleurone with a variable number of layers with cells of irregular shape and size (Lid et al., 2004). However, kernels of homozygous dil1 and dil2 mutants were shrunken due to reduced starch accumulation, and mature mutant kernels had low germination rates and did not develop into viable plants.

[0013] In barley, elo2 mutants similarly exhibited disorganized cells and irregular aleurone layers as a result of abnormal parallel cell division (Lewis et al., 2009). The plants also exhibited increased cell layers in the leaf epidermis, with bulging and distorted cells on the epidermis. Importantly, homozygous mutant plants were dwarfed, yielding kernel weights less than 60% of the wild type, and were not useful for grain production.

[0014] In rice, two transcription factors that control the expression of seed storage proteins also affect aleurone cell fate (Kawakatsu et al., 2009). Reduction of expression by a co-suppression construct of the gene encoding the rice prolamin box-binding factor (RPBF) polypeptide, a class of DOF zinc finger transcription factors, resulted in sporadic multilayered aleurone consisting of large irregular cells. There was also a significant reduction in the expression and accumulation of seed storage proteins, and starch and lipids accumulated at substantially reduced levels. Expression of the rice homologs of the maize Dek1, CR4 and SAL1 genes was also reduced, indicating that the RPBF and RISBZ1 factors act in the same regulatory pathway as their genes.

[0015] DNA demethylation In a completely different area of ​​plant science, DNA demethylation is currently being summarized. Plants methylate some cytosine nucleotides in nuclear DNA at carbon 5 of the pyrimidine ring to form 5-methylcytosine (5-meC). Methylated cytosine can occur in one of three contexts, namely CG, CHG (where H=A, C or T) and CHH methylation, each catalyzed by a different methyltransferase. At least in Arabidopsis thaliana and probably in most plants, including rice (Zemach et al., 2010), CG methylation is catalyzed by enzymes in the methyltransferase 1 (Met1) family, CHG methylation is catalyzed by methylases in the chromomethylase family, and CHH methylation occurs via an RNA-mediated reaction catalyzed by Domains Rearranged Methylases (DRMs) that use small RNAs as guide sequences. Cytosine methylation, occurring at a small percentage of all cytosines, occurs frequently in heterochromatic DNA and in regions rich in repetitive DNA and transposons, repressing their activity. It also occurs in transcribed regions of nuclear DNA, including gene promoters, thereby participating in the control of expression of many genes.

[0016] DNA cytosine methylation is reversible via demethylation, which can occur passively through DNA replication or via the activity of demethylases. One route for active demethylation of DNA in plants is through the base excision repair (BER) pathway, which uses DNA glycosylase enzymes. These enzymes remove 5-meC from the double-stranded DNA backbone and then cleave the DNA backbone at the abasic site by successive β- and δ-elimination reactions (lyase activity). Repair is completed by insertion of an unmethylated cytosine nucleotide by DNA polymerase activity.

[0017] There are four 5-meC DNA glycosylases / lyases in the Arabidopsis genome, named Demeter (DME), Demeter-like 2 (DML2), Demeter-like 3 (DML3), and Repressor of Silencing (ROS1). Genetic and biochemical analyses have shown that all four function as DNA demethylases, with DME functioning primarily in egg cells and endosperm and differently in other tissues (Gong et al., 2002; Agius et al., 2006; Morales-Ruiz et al., 2006). Other plants express multiple demethylases as well (Zemach et al., 2010).

[0018] There is a need for rice grains having thickened aleurone from plants, particularly rice, which are phenotypically normal and agronomically useful. Summary of the Invention

[0019] In one aspect, the invention provides a rice grain comprising aleurone, a starchy endosperm, ROS1a encoding a ROS1a polypeptide, and one or more genetic mutations that (i) respectively reduce the activity of at least one ROS1a in the plant when compared to a corresponding wild-type rice, and / or (ii) the aleurone is thickened compared to aleurone from a corresponding wild-type grain.

[0020] In one embodiment, the ROS1a polypeptide has a level of DNA glycosylase activity that is between 2% and about 60% of the level of DNA glycosylase activity of a corresponding wild-type ROS1a polypeptide and / or a ROS1a polypeptide having an amino acid sequence as set forth in SEQ ID NO:2.

[0021] In other embodiments, the ROS1a polypeptides are variants of the corresponding wild-type ROS1a polypeptides in that their amino acid sequences differ. In a preferred embodiment, the rice kernel comprises a ROS1a(Ta2) variant polypeptide having the amino acid sequence provided as SEQ ID NO:1, the polypeptide being a variant of the wild-type ROS1a polypeptide whose amino acid sequence is provided as SEQ ID NO:2.

[0022] In one embodiment, the grain has a level of ROS1a polypeptide present in the grain that is between 2% and about 60% compared to the level of ROS1a polypeptide in a corresponding wild type grain.

[0023] In one embodiment, the thickened aleurone comprises at least 2 layers, at least 3 layers, at least 4 layers or at least 5 layers of cells, about 3 layers, about 4 layers, about 5 layers or about 6 layers of cells, or 2-8, 2-7, 2-6 or 2-5 layers of cells. In one embodiment, the grain is from rice and the thickened aleurone comprises 5-8, 5-7, 5-6 or 2-5 layers. In one embodiment, the aleurone layer is increased in thickness by about 100%, or about 150%, or about 200%, or about 250% compared to a wild type rice grain.

[0024] The introduction of a genetic mutation, preferably a genetic mutation, that reduces the activity of at least one ROS1a gene in a plant can be any genetic manipulation that reduces or prevents the production of wild-type levels of ROS1a polypeptide in rice grains. Examples of such genetic mutations include, but are not limited to, the following: (a) a ROS1a gene encoding a mutant ROS1a polypeptide having reduced DNA glycosylase activity relative to the wild-type ROS1a polypeptide (SEQ ID NO: 2); (b) a ROS1a gene that upon expression results in reduced levels of wild-type ROS1a polypeptide, e.g., a ROS1a gene that contains a splice site mutation that results in a reduced level of expression of the ROS1a gene and is related to the wild-type ROS1a gene, the cDNA sequence of which is provided as SEQ ID NO:8, or the ROS1a gene contains a mutation in its promoter that results in reduced expression of ROS1a relative to wild-type ROS1a; (c) an exogenous nucleic acid construct encoding a polynucleotide that reduces expression of the rice ROS1a gene, preferably the nucleic acid construct comprises a DNA region encoding a polynucleotide operably linked to a promoter that is expressed in developing grains of rice at least at a time point between flowering and 7 days after flowering; and (d) a ROS1a gene that contains a premature translational stop codon in the protein coding region, such as a gene that encodes a polypeptide that is truncated relative to the wild-type ROS1a polypeptide, but which may or may not be produced; Includes.

[0025] In a preferred embodiment, the rice kernel comprises (i) aleurone, (ii) starchy endosperm, and (iii) a ROS1a gene comprising a genetic mutation that reduces the activity of the rice ROS1a gene compared to a wild-type ROS1a gene, wherein the ROS1a gene comprising said genetic mutation encodes a mutant ROS1a polypeptide relative to SEQ ID NO:2, and the aleurone is thickened compared to the aleurone from the corresponding wild-type rice kernel. In one embodiment, the genetic mutation of the ROS1a gene is an introduced genetic modification. In a preferred embodiment, the mutant ROS1a polypeptide differs in amino acid sequence from the sequence provided as SEQ ID NO:2 by at least one or more amino acid insertions or deletions, or amino acid substitutions, compared to SEQ ID NO:2. In an even more preferred embodiment, the mutant ROS1a polypeptide differs in amino acid sequence from the sequence provided as SEQ ID NO:2 by one or more amino acid insertions or single amino acid substitutions, compared to SEQ ID NO:2, such as, for example, a single amino acid substitution as set forth in Table 3. The rice kernel may be treated, e.g., cooked, so that it is no longer able to germinate, or may be untreated so that it is able to germinate and grow, thereby providing the rice of the present invention. In a most preferred embodiment, the aleurone of the rice kernel is pigmented, e.g., the rice kernel is pigmented with chromium (black rice), as defined herein.

[0026] In another preferred embodiment, the rice grain comprises (i) aleurone, (ii) starchy endosperm, and (iii) a ROS1a gene comprising a genetic mutation that reduces activity of the ROS1a gene in rice compared to a wild-type ROS1a gene, wherein said ROS1a gene comprising said genetic mutation encodes a ROS1a polypeptide that is the same amino acid sequence as a wild-type ROS1a polypeptide, such as SEQ ID NO: 2, wherein said ROS1a gene is expressed in rice at a reduced level compared to the wild-type ROS1a gene, and wherein the aleurone is thickened compared to aleurone from a corresponding wild-type rice grain. In one embodiment, the genetic mutation in the ROS1a gene is a genetic modification introduced such that the ROS1a gene is expressed at a reduced level. In one embodiment, the genetic variation is selected from the group consisting of: (i) a splice site mutation resulting in a reduced level of expression of the ROS1a gene relative to the wild type ROS1a gene, the cDNA sequence of which is provided as SEQ ID NO:8; (ii) a ROS1a gene promoter mutation resulting in a reduced expression of the ROS1a gene relative to the wild type ROS1a gene; and (iii) an exogenous nucleic acid molecule encoding an RNA polynucleotide, preferably integrated into the nuclear genome of rice, that reduces the expression of the ROS1a gene in rice. The rice kernel may be treated, e.g., cooked, such that it is no longer capable of germination, or may not be treated to allow germination and growth, thereby providing the rice of the present invention. In a most preferred embodiment, the aleurone of the rice kernel is pigmented, e.g., the rice kernel is pigmented, e.g., with chromium (black rice), as defined herein.

[0027] In one embodiment, the rice has a level of DNA glycosylase activity in its developing grain that is between 2% and about 60% of the level of DNA glycosylase activity in a corresponding wild-type developing grain. In a preferred embodiment, the rice has a level of DNA glycosylase activity in its developing grain that is between 2% and 50%, or between 2% and 40%, or between 2% and 30%, or between 2% and 20% of the level of DNA glycosylase activity in a corresponding wild-type developing grain.

[0028] In one embodiment, activity of at least one ROS1a gene in rice is reduced in one or more or all of the aleurone, pericarp, nucellar projections, ovary, seed coat and starchy endosperm of the developing grain.

[0029] In one embodiment, activity of the ROS1a gene is reduced in egg cells at least between flowering time and 7 days after flowering and / or prior to flowering, hi one embodiment, the exogenous nucleic acid molecule may be operably linked to a promoter that is expressed at a time point at least between flowering time and 7 days after flowering, such that the encoded RNA polynucleotide reduces expression of the rice ROS1a gene during that time.

[0030] In one embodiment, rice bears seeds with stamens and pistils.

[0031] In one embodiment, the rice exhibits delayed grain maturation, hi one embodiment, grain maturation is delayed by 2 to 10 days or 2 to 15 days compared to wild type rice.

[0032] In one embodiment, the grain comprises one or more or all of the following, based on the respective weights, when compared to the corresponding wild type grain: i) a higher mineral content, preferably the mineral content being one or more or all of zinc, iron, potassium, magnesium, phosphorus and sulfur; ii) higher antioxidant content; iii) higher phytic acid content; iv) a higher content of one or more or all of the vitamins B3, B6 and B9; v) higher dietary fiber and / or insoluble fiber content; vi) a starch content that is between about 90% and about 100% by weight relative to the starch content of the corresponding wild-type grain; vii) higher sucrose content; viii) higher monosaccharide content, and ix) A lipid content of at least 90% or at least 100% relative to the lipid content of the corresponding wild type grain. In one embodiment, the ingredient content is increased by 10-50% or preferably 10-100% relative to the content of the corresponding wild type rice kernel.

[0033] In one embodiment, the grain comprises an embryo.

[0034] In one embodiment the grain is a whole grain or a broken grain.

[0035] In one embodiment, the grains have been treated so that they can no longer germinate, preferably by heat treatment, for example the grains are cooked in water at 100° C. for at least 5 minutes, in one embodiment the grains are cracked or crushed grains.

[0036] In another embodiment, the grains have a germination rate of between about 70% and about 100% relative to the germination rate of corresponding grains, i.e., a population of at least 100 grains has an average germination rate of 70-100% compared to the wild type. When the grains germinate and grow, the rice plant of the present invention is produced.

[0037] In one embodiment, the grain comprises a ROS1a gene, preferably in one or more of the aleurone, seed coat and starchy endosperm of the grain, encoding a ROS1a polypeptide having DNA glycosylase activity, wherein the ROS1a polypeptide having DNA glycosylase activity is preferably a mutant ROS1a polypeptide.

[0038] In another embodiment, the grain comprises a mutant ROS1a polypeptide having reduced DNA glycosylase activity expressed in rice compared to the corresponding wild-type ROS1a polypeptide, preferably the mutant ROS1a polypeptide comprises one or more amino acid substitutions, deletions or insertions that reduce DNA glycosylase activity compared to the corresponding ROS1a polypeptide. The mutant ROS1a polypeptide may not have DNA glycosylase activity, provided that the grain comprises another ROS1a having DNA glycosylase activity. For example, the ROS1a gene may encode two ROS1a polypeptides through alternative splicing, one of which has DNA glycosylase activity and the other does not. In a preferred embodiment, the mutant ROS1a polypeptide has an insertion of 7 amino acids compared to the wild-type ROS1a polypeptide, such as the mutant ROS1a polypeptide having the amino acid sequence provided as SEQ ID NO:1.

[0039] In a further embodiment, the grain has a reduced total amount of ROS1a polypeptide, preferably reduced in one or more of the aleurone, seed coat and starchy endosperm of the grain, compared to the corresponding wild-type grain, provided that the grain comprises a ROS1a gene encoding a ROS1a polypeptide having DNA glycosylase activity. The total amount of ROS1a polypeptide may also be reduced in rice pollen.

[0040] In another embodiment, the genetic variation, preferably the introduced genetic variation, is an exogenous nucleic acid construct encoding a polynucleotide that reduces expression of the ROS1a gene in rice, preferably at least at a time point between flowering and 7 days after flowering in rice, provided that the grain comprises at least one ROS1a gene encoding a ROS1a polypeptide having DNA glycosylase activity.

[0041] In one embodiment, the grain is pigmented at its outer layer, for example the grain is a brown or black grain of rice, the grain comprising (i) an aleurone having a thickness of at least 2 cell layers, or between 2 and 7 cell layers, (ii) a mutant ROS1a gene encoding a ROS1a polypeptide comprising one or more amino acid substitutions, insertions or deletions that have reduced DNA glycosylase activity when compared to a corresponding wild-type rice ROS1a polypeptide, the reduced DNA glycosylase activity occurring in the rice at a time point between at least flowering and 7 days after anthesis, provided that the rice has between 2% and about 60% of the level of DNA glycosylase activity in the developing grain at a time point between at least flowering and 7 days after anthesis when compared to wild-type rice.

[0042] In one embodiment, the grain is pigmented at its outer layer, for example, the grain is a brown or black grain of rice, and comprises (i) an aleurone having a thickness of at least 2 cell layers, or 2-7 cell layers, and (ii) an exogenous nucleic acid construct encoding a polynucleotide that reduces expression of the rice ROS1a gene, wherein the exogenous nucleic acid construct comprises a DNA region encoding a polynucleotide operably linked to a promoter that is expressed in developing grains of the rice at a time point at least between flowering and 7 days after flowering, such that at a time point at least between flowering and 7 days after flowering, the rice has between 2% and about 60% of the level of DNA glycosylase activity in the developing grain compared to wild-type rice. In a preferred embodiment, the promoter is a promoter other than a constitutive promoter, for example, a promoter that is expressed in the endosperm of the developing seed. In a most preferred embodiment, the promoter is an LTP promoter.

[0043] In other embodiments, the ROS1a polypeptide comprises amino acids whose sequence is at least 95% identical to SEQ ID NO:2, or the ROS1a polypeptide comprises amino acids whose sequence is at least 95% identical, at least 97.5% identical, or at least 99% identical to SEQ ID NO:2, and wherein the sequence differs from the amino acid sequence of the corresponding wild-type ROS1a polypeptide.

[0044] In one embodiment, the ROS1a polypeptide comprises one or more or all of the following motifs; DHGSIDLEWLR (SEQ ID NO:44), GLGLKSVECVRLLTLHH (SEQ ID NO:45), AFPVDTNVGRI (SEQ ID NO:46), VRLGWVPLQPLPESLQLHLLE (SEQ ID NO:47), ELHYQMITFGKVFCTKSKPNCN (SEQ ID NO:48), and HFASAFASARLALP (SEQ ID NO:49).

[0045] The present invention also provides a population of rice kernels, each of which has the same genetic variation, the same ROS1a gene, the same ROS1a polypeptide, and / or the same characteristics as described in the above embodiments. That is, the population is genetically and / or phenotypically homogeneous. Such a population of rice kernels can be obtained or derived from a single ancestral rice plant or kernel, for example, may be derived from at least two, at least three, or at least four progeny generations from the ancestral plant or kernel.

[0046] The present inventors have identified mutant ROS1a polypeptides that have reduced DNA glycosylase activity. Accordingly, in another aspect, the present invention provides purified and / or recombinant ROS1a polypeptides that have an amino acid sequence that differs from the amino acid sequence of a corresponding wild-type ROS1a polypeptide and that have reduced, preferably no, DNA glycosylase activity when compared to a corresponding wild-type ROS1a polypeptide.

[0047] In one embodiment, the purified and / or recombinant ROS1a polypeptide comprises amino acids having a sequence that is at least 95% identical, at least 97.5% identical, or at least 99% identical to SEQ ID NO:2.

[0048] In another aspect, the present invention provides isolated and / or exogenous polynucleotides encoding the ROS1a polypeptides of the present invention.

[0049] In a further aspect, the present invention provides an isolated and / or exogenous polynucleotide that, when present in rice, reduces expression of the ROS1a gene.

[0050] Those skilled in the art are familiar with the different types of polynucleotides that can be used to reduce the expression of a target gene and how these polynucleotides can be designed. Examples include, but are not limited to, antisense polynucleotides, sense polynucleotides, catalytic polynucleotides, microRNAs, double-stranded RNA (dsRNA) molecules or processed RNA products thereof.

[0051] In one embodiment, the polynucleotide is a dsRNA molecule, or a processed RNA product thereof, that comprises at least 19 contiguous nucleotides that are at least 95% identical to the complement of SEQ ID NO: 7 or 8 (wherein thymine (T) is uracil (U)) or at least 95% identical to the mRNA complement encoding a ROS1a polypeptide, the amino acid sequence of which is provided as SEQ ID NO: 1 or 2.

[0052] In other embodiments, the dsRNA molecule is a microRNA (miRNA) precursor and / or wherein its processed RNA product is a miRNA.

[0053] In one embodiment, the polynucleotides are used to reduce expression of the ROS1a gene in developing grains of rice at least at a time point between flowering and 7 days after flowering.

[0054] In a further aspect, the present invention provides a nucleic acid construct and / or vector encoding a polynucleotide of the present invention, wherein the nucleic acid construct or vector comprises a DNA region encoding the polynucleotide operably linked to a promoter that is expressed in developing grains of rice at least at a time point between flowering and 7 days after flowering.

[0055] In a further aspect, the present invention provides a recombinant cell comprising the exogenous polynucleotide of the invention, or the nucleic acid construct and / or vector of the invention.

[0056] In one embodiment, the cell is a rice cell, for example a rice kernel cell, preferably a rice cell, such as rice aleurone.

[0057] In one embodiment, the exogenous polynucleotide, nucleic acid construct or vector is integrated into the cell genome, preferably into the nuclear genome.

[0058] Also provided are rice cells containing a ROS1a gene encoding a ROS1a polypeptide and a genetic mutation, preferably an introduced genetic mutation, that reduces activity of at least one ROS1a gene in the cell when compared to a corresponding wild-type cell.

[0059] In one embodiment, the cell is aleurone, pericarp, nucellus, ovary, seed coat or starchy endosperm.

[0060] In another aspect, the invention provides a rice plant or a population of rice plants producing the grain of the invention, the polypeptide of the invention, the polynucleotide of the invention, the nucleic acid construct and / or the vector of the invention and / or comprising a cell of the invention, in one embodiment each being rice.

[0061] Also provided is a population of at least 100 or at least 1,000 of the rice plants of the invention growing in the field. In a preferred embodiment, the rice plants in the field are predominantly (>50%), preferably all, of the rice plants of the invention. In a most preferred embodiment, the at least 100, at least 1,000 rice plants are genetically and / or phenotypically identical, e.g., comprise the same genetic variations.

[0062] In another aspect, the present invention provides a method for producing a cell of the present invention, said method comprising the step of introducing an exogenous polynucleotide of the present invention, or a nucleic acid construct and / or vector of the present invention into a cell, preferably a rice cell.

[0063] In a further aspect, the present invention provides a method for producing the rice of the present invention, or transgenic grain therefrom, said method comprising the steps of: i) introducing an exogenous polynucleotide of the invention, or a nucleic acid construct and / or a vector of the invention into a rice cell; ii) obtaining transgenic rice plants from the cells obtained from step i), the transgenic plants being transgenic for the exogenous polynucleotide, nucleic acid construct or vector or a part thereof; and iii) optionally harvesting grain from the plant of step ii), wherein the grain is transgenic for the exogenous polynucleotide, nucleic acid construct or vector; and iv) optionally producing one or more generations of transgenic progeny plants from the transgenic grain, wherein the progeny plants are the exogenous polynucleotide, nucleic acid construct or vector; Thereby producing rice or transgenic grain.

[0064] In another aspect, the present invention provides a method for producing the rice or grain thereof of the present invention, said method comprising the steps of: i) introducing a mutation in an endogenous ROS1a gene, such as a mutated ROS1a gene encoding a ROS1a polypeptide of the invention or not encoding a ROS1a polypeptide, into a rice cell; and ii) obtaining rice plants containing a mutation in the endogenous ROS1a gene from the cells obtained from step i); and iii) optionally harvesting grain from the plant of step ii), wherein the grain comprises a mutation in the endogenous ROS1a gene; and iv) optionally producing one or more generations of progeny plants derived from the kernel, wherein the progeny plants comprise a mutation in the endogenous ROS1a gene; This produces rice or grain.

[0065] In one embodiment, the rice or grain comprises at least one ROS1a gene encoding a ROS1a polypeptide having DNA glycosylase activity.

[0066] In a further aspect, the present invention provides a method for selecting a rice plant or rice grain of the present invention, said method comprising the steps of: i) screening a population of rice or grains obtained from a mutagenesis treatment of an ancestral rice cell, grain or plant, respectively, for the production of a grain of the invention or for the presence of a mutation in the ROS1a gene or for the presence of a rice grain of the invention; and ii) selecting from the population of step (i) a rice plant producing the grain of the invention or comprising a mutant ROS1a gene, or a rice grain of step (i) which is a rice grain of the invention; Thereby, rice or grain is selected.

[0067] The method may include harvesting one or more progeny plants or grains from the selected rice plant, or at least two generations of progeny plants, and / or grains from the progeny plants. Preferably, the progeny plants are homozygous for the genetic variation.

[0068] In a further aspect, the present invention provides a method for selecting a rice plant of the present invention, said method comprising the steps of: i) producing one or more progeny plants from the rice kernel, the rice kernel being derived from a cross of two parental rice plants; ii) screening one or more progeny plants of step i) for the production of grain of the invention; and iii) selecting progeny plants that produce grain; Thereby, rice is selected. In a preferred embodiment, the rice kernel is a black rice kernel.

[0069] In one embodiment, the screening step i) or step ii) comprises one or more or all of the following steps; i) analyzing a sample containing DNA from the progeny plants for genetic variations; ii) analyzing the aleurone thickness of grains obtained from the progeny plants; iii) Analysing the nutritional content of the grain or a part thereof.

[0070] Preferably, the genetic variation is an induced genetic variation.

[0071] In one embodiment, step iii) comprises one or more or all of the following steps; i) selecting progeny plants that are homozygous for a genetic mutation, wherein the genetic mutation reduces DNA glycosylase activity in the rice when compared to the corresponding wild-type rice; ii) selecting progeny plants whose grains exhibit increased aleurone thickness compared to corresponding wild type grains; iii) selecting progeny plants having an altered nutritional content of the kernel or part thereof compared to the corresponding wild-type kernel or part thereof.

[0072] In a further embodiment, the method further comprises: i) crossing two parent rice plants, preferably where one parent rice produces grain of the present invention; ii) backcrossing one or more progeny plants from step i) with a plant of the same genotype as the first parent that does not produce grain of the invention a sufficient number of times to produce a plant that has most of the genotype of the first parent rice plant but that produces grain of the invention; and iii) selecting progeny plants which produce grain of the invention.

[0073] Rice and rice grains produced using the methods of the invention, and products therefrom, are also provided.

[0074] Further provided is the use of an exogenous polynucleotide of the invention, or a nucleic acid construct and / or vector of the invention, for producing a recombinant cell, a transgenic rice or a transgenic grain.

[0075] In one embodiment the use is to produce rice grain of the present invention.

[0076] In a further aspect, the present invention provides a method for identifying a rice plant which produces grain of the present invention, said method comprising the steps of: i) obtaining a nucleic acid sample from rice; and ii) screening the samples for the presence or absence of a genetic mutation that reduces the activity of the ROS1a gene in rice when compared to the corresponding wild-type rice.

[0077] In one embodiment, the genetic variation includes one or both of the following: a) a nucleic acid construct expressing a polynucleotide that reduces expression of the ROS1a gene when present in rice, or a polynucleotide encoded thereby; and b) A gene expressing a mutant ROS1a polypeptide, or the mRNA encoded thereby, having reduced ROS1a polypeptide activity.

[0078] In one embodiment, the presence of the genetic variation indicates that the grain of the plant has thickened aleurone when compared to a corresponding plant that does not have the genetic variation.

[0079] In yet another aspect, the present invention provides a method for identifying a rice plant that produces grain of the present invention, said method comprising the steps of: i) obtaining grains from rice; and ii) screening the grain or part thereof for one or more of: a) thickened aleurone, b) the amount of ROS1a polypeptide and / or activity in the grain, and c) The amount of mRNA encoded by the ROS1a gene in grains.

[0080] In one embodiment, the method identifies a rice plant of the present invention.

[0081] In another aspect, the present invention provides a method for producing a rice part, preferably a grain, said method comprising: a) cultivating the rice of the present invention or cultivating at least 100 individual rice plants outdoors; and b) harvesting the rice part or rice derived from rice.

[0082] In a further aspect, the present invention provides a method for producing rice flour, bran, wholemeal, malt, starch or oil from the obtained grain, said method comprising the steps of: a) obtaining the grain of the invention; and b) Processing the grain to produce flour, bran, wholemeal flour, malt, starch or oil.

[0083] In another aspect, the present invention provides a product produced from the grain of the present invention, or the rice of the present invention, or a part of said grain or rice.

[0084] In one embodiment, the product comprises one or more or all of the ROS1a gene, the genetic variation (preferably an introduced genetic variation), the exogenous nucleic acid construct, and thickened aleurone.

[0085] In one embodiment, the portion is rice bran.

[0086] In one embodiment, the product is a food ingredient, beverage ingredient, food product or beverage product. Examples include, but are not limited to, i) the food or beverage ingredient is selected from the group consisting of whole grain flour, flour, bran, starch, malt and oil; ii) the food product is selected from the group consisting of food products including leavened or unleavened bread, pasta, noodles, animal feed, breakfast cereals, snack foods, cakes, pastries and powder-based sauces; or iii) The beverage product is a packaged beverage or a beverage containing ethanol.

[0087] In a further aspect, the present invention provides a method of preparing a food or beverage product of the present invention, said method comprising processing the grain of the present invention, or bran, flour, wholemeal, malt, starch or oil derived from the grain, to produce a food or beverage ingredient.

[0088] In another aspect the invention provides a method of preparing a food or beverage product of the invention, said method comprising the step of mixing the grain of the invention, or bran, flour, wholemeal, malt, starch or oil derived from the grain, with other food or beverage ingredients. Preferably the amount of bran, flour, wholemeal, malt, starch or oil used in the method is at least 10% by weight of the food product.

[0089] There is also provided the use of the grain of the invention or parts thereof, or the rice of the invention or parts thereof, as animal feed or food, or to produce feed for animal consumption or food for human consumption.

[0090] In a further aspect, the present invention provides one or more of the polypeptides of the invention, the polynucleotides of the invention, the nucleic acid constructs and / or vectors of the invention, or the cells of the invention, and one or more acceptable carriers.

[0091] Any embodiment herein shall apply mutatis mutandis to any other embodiment unless otherwise stated.

[0092] The present invention is not to be limited in scope by the specific embodiments described herein, which are for the purpose of illustration only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention as described herein.

[0093] Throughout the specification of the present invention, unless otherwise stated or the context otherwise requires, references to a single step, composition of matter, group of steps or group of compositions of matter should be interpreted as encompassing one and more (i.e., one or more) of that step, composition of matter, group of steps or composition of matter. [Prior art documents] [Non-patent literature]

[0094] [Non-Patent Document 1] Agius et al. (2006) Proc. Natl. Acad. Sci. USA 103:11796-11801. [Non-Patent Document 2] Almeida and Allshire (2005) TRENDS Cell Biol 15: 251-258. [Non-Patent Document 3] Barker et al. (1983) Plant Mol. Biol. 2: 235-350. [Non-Patent Document 4] Baumlein et al. (1991) Mol. Gen. Genet. 225:459-467. [Non-Patent Document 5] Becraft et al. (2001a) In Bhojwani and Soh (eds). Current Trends in the [Non-Patent Document 6] Embryology of Angiosperms, Kluwer Academic Publishers, pp353-374. [Non-Patent Document 7] Becraft et al. (2001b) Plant Physiol. 127:4039-4048. [Non-licensed document 8] Becraft et al. (2002) Development 129:5217-5225.

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

Non-licensed Document 21

Non-licensed Document 22

Non-licensed Document 23

Non-licensed Document 24

Non-licensed Document 25

Non-licensed Document 26

Non-licensed Document 27

Non-licensed Document 28

Non-licensed Document 29

Non-licensed Document 30

Non-licensed Document 31

Non-licensed Document 32

Non-licensed Document 33

Non-licensed Document 34

Non-licensed Document 35

Non-licensed Document 36

Non-licensed Document 37

Non-licensed Document 38

Non-licensed Document 39

Non-licensed Document 40

Non-licensed Document 41

Non-licensed Document 42

Non-licensed Document 43

Non-licensed Document 44

Non-licensed Document 45

Non-licensed Document 46

Non-licensed Document 47

Non-licensed Document 48

Non-licensed Document 49

Non-licensed literature 50

Non-licensed Document 51

Non-licensed Document 52

Non-licensed Document 53

Non-licensed Document 54

Non-licensed Document 55

Non-licensed Document 56

Non-licensed Document 57

Non-licensed Document 58

Non-licensed Document 59

Non-licensed Document 60

Non-licensed Document 61

Non-licensed Document 62

Non-licensed Document 63

Non-licensed Document 64

Non-Patent Document 65

Non-Patent Document 66

Non-Patent Document 67

Non-Patent Document 68

Non-Patent Document 69

Non-Patent Document 70

Non-Patent Document 71

Non-Patent Document 72

Non-Patent Document 73

Non-Patent Document 74

Non-Patent Document 75

Non-licensed Document 76

Non-licensed Document 77

Non-licensed Document 78

Non-licensed Document 79

Non-licensed Document 81

Non-licensed Document 82

Non-licensed Document 84

Non-licensed Document 85

Non-licensed Document 86

Non-licensed Document 87

Non-licensed Document 88

Non-licensed Document 89

Non-licensed literature 90

Non-licensed Document 91

Non-licensed Document 92

Non-licensed Document 93

Non-licensed Document 94

Non-licensed Document 95

Non-licensed Document 96

Non-licensed Document 97

[0095] The invention will now be described with reference to the following non-limiting Examples and the accompanying drawings. [Brief description of the drawings]

[0096] [Figure 1]Schematic diagram of map-based cloning of the ta2 gene. Numbers under each line indicate the number of recombinants in the mapping population that showed recombination between the marker and the ta2 gene. Solid lines in the third row indicate the extent of the coding region on the rice chromosome. Solid lines in the fourth row indicate the protein coding region in the gene, and intervening lines represent introns (intron 1 is in the 5'UTR and is not shown here). Asterisks indicate the location of the ta2 mutation in intron 14 at position Chr1:6451738 with reference to the rice genome. [Diagram 2] Nucleotide sequences of cDNA corresponding to mRNA obtained from developing kernels of wild type (WT) and ta2 genotypes. Dashes in WT and two of the ta2 sequences indicate the absence of nucleotides. Most ta2 mRNAs had a 21 nucleotide insertion. The wild type sequence is SEQ ID NO:10 and the mutant sequence is SEQ ID NO:11. [Diagram 3] Amino acid sequences predicted from cDNA corresponding to mRNA obtained from developing kernels of wild type (upper amino acid sequence, SEQ ID NO:12) and ta2 (lower amino acid sequence, SEQ ID NO:13). Dashes in the WT sequence indicate the absence of amino acids as opposed to a 7 amino acid insertion in the ta2 polypeptide (CSNVMRQ; SEQ ID NO:14). Stars below the sequences indicate that the same amino acids were present in the wild type and mutant polypeptides at those positions. [Figure 4] Amino acid sequence alignment of Arabidopsis DME (NM001085058.1), Arabidopsis ROS1a (NM129207.4) and rice ROS1a homolog. Asterisks below the alignment represent amino acid positions that are conserved in all three polypeptides. Semicolons represent fully conservative amino acid changes, while single dots represent partially conservative amino acid changes. [Diagram 5]Amino acid sequence alignment of Arabidopsis ROS1a (NM129207.4) and rice ROS1a homologs. Asterisks below the alignment indicate amino acid positions that are conserved in all three polypeptides. Semicolons represent fully conservative amino acid changes, while single dots represent partially conservative amino acid changes. [Figure 6] Real-time RT-PCR results showing the relative expression of the TA2 gene in multiple tissues.

[0097] Sequence Listing Essentials SEQ ID NO:1 - Rice ROS1a mutant (Ta2) polypeptide. SEQ ID NO:2 - wild-type rice ROS1a polypeptide. SEQ ID NO:3 - Wild-type rice ROS1b polypeptide. SEQ ID NO:4 - Wild-type rice ROS1c polypeptide. SEQ ID NO:5 - Wild-type rice ROS1d polypeptide. SEQ ID NO:6 - Arabidopsis DEMETER polypeptide. SEQ ID NO:7 - Full length cDNA encoding the rice ROS1a mutant (Ta2) polypeptide. The open reading frame spans nucleotides 341 to 6220. SEQ ID NO:8 - Full length cDNA encoding rice ROS1a polypeptide. The open reading frame spans nucleotides 341 to 6199. SEQ ID NO:9 - Rice ROS1a gene. Promoter and 5'UTR: nucleotides 1-4726, translation start codon ATG 4727-4729; translation stop codon TAG 15867-15869; 3'-UTR from 15870-16484, downstream of the gene from 16485-16885. The nucleotide positions of the introns are: intron 1, 7494-7724; 2, 7816-7909; 3, 9426-9571; 4, 9652-10452; 5, 10538-10628; 6, 10721-10795; 7, 10865-10951; 8, 10989-11069; 9, 11153-11834; 10, 12282-12385; 11, 12423-12508; 12, 12567-12650; 13, 12791-13017; 14, 13084-13201; 15, 13317-14668; 16, 14708-15732.-11006. The sequence contains 401 nucleotides at the 3' end that do not form part of the gene. SEQ ID NO:10 - A portion of the wild-type rice ROS1a cDNA sequence is shown in FIG. SEQ ID NO:11 - A portion of the mutant (Ta2) rice ROS1a cDNA sequence is shown in FIG. SEQ ID NO:12 - Wild type rice ROS1a A portion of the protein sequence is shown in FIG. SEQ ID NO:13 - Mutant (Ta2) rice ROS1a Part of the protein sequence is shown in FIG. SEQ ID NO:14 - Additional amino acids in the ROS1a mutant (Ta2) polypeptide compared to the wild type (SEQ ID NO:2). SEQ ID NOs: 15 to 43 - oligonucleotide primers. SEQ ID NOs:44-49 - Highly conserved amino acid motifs within the glycosylase domain of wild-type rice ROS1a polypeptide. SEQ ID NO:50 - Arabidopsis thaliana ROS1a polynucleotide. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0098] Common Techniques and Definitions Unless otherwise defined, all technical and scientific terms used herein should be interpreted as having the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).

[0099] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described, for example, in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), TA Brown (ed.), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), as well as FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (eds.) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and JE Coligan et al. (eds.) Current Protocols in It is described and explained throughout the literature in sources such as Immunology, John Wiley & Sons (including all updates to date).

[0100] The term "and / or", e.g., "X and / or Y", is understood to mean "X and Y" or "X or Y" and is used to explicitly endorse both meanings or either meaning.

[0101] As used herein, the term "about" refers to + / - 10%, more preferably + / - 5%, more preferably + / - 2.5%, and even more preferably + / - 1% of the specified value, unless stated to the contrary.

[0102] Throughout this specification, the term "comprise", or variations such as "comprises" or "comprising", may be understood to mean the inclusion of the stated elements, integers or steps, or group of elements, integers or steps, but not the exclusion of any elements, integers or steps, or group of elements, integers or steps.

[0103] Selected Definitions The terms "aleurone" and "aleurone layer" are used interchangeably herein. The aleurone layer is the outermost layer of the endosperm of the rice kernel, unlike the starchy endosperm, and surrounds the starchy endosperm and part of the germ. Thus, the cells that make up the aleurone layer are the outermost cells of the endosperm, the starchy component of the kernel. Although it is technically part of the endosperm and is sometimes called the peripheral endosperm, from a practical standpoint, aleurone is considered part of the bran, since it is removed together with the pericarp and seed coat of the bran. Unlike the cells of the starchy endosperm, the aleurone cells remain active during grain ripening. The aleurone layer is an important part of the nutritional value of the rice kernel, including minerals, vitamins such as vitamin A and B vitamins, phytochemicals, and fiber.

[0104] Embodiments of the present invention relate to a range of numbers of "layers of cells" at least in part because the layers of cells observed at any single point within or across a cross-section of any one cross-section of a grain of the present invention may vary to some extent. More specifically, an aleurone layer having, for example, seven layers of cells may not have seven layers surrounding the entire inner starchy endosperm, but has seven layers surrounding at least half of the inner starchy endosperm.

[0105] The term "thickened" when used in reference to the aleurone of the grain of the invention is a relative term used in comparison with the corresponding wild type grain of the grain of the invention. The aleurone of the grain of the invention has an increased cell number and / or an increased cell layer when compared with the aleurone of the corresponding wild type grain. Thus, the aleurone has an increased thickness, measured in μm. In one embodiment, the thickness is increased by at least 50%, preferably at least 100%, and can be increased by as much as 500% or 600%, each percentage being related to the thickness of the aleurone of the corresponding wild type grain, and each percentage being understood to be an average increase over the ventral side of the grain, preferably the entire grain. In one embodiment, the thickness of the aleurone layer is determined over the entire cross section of the grain. In one embodiment, the thickness of the aleurone is determined by analysis of at least the ventral side of the grain. In one embodiment, the thickened aleurone of the grain of the invention comprises cells of various sizes and irregular orientations compared with those of the corresponding wild type grain, whose aleurone generally has short cells with regular orientation.

[0106] Polypeptides As used herein, the term "ROS1 polypeptide" refers to members of a protein family of DNA glycosylase-related molecules related in amino acid sequence to SEQ ID NO: 1-5, meaning that they are at least 95% identical to one or more of the amino acid sequences set forth in SEQ ID NO: 1-5. ROS1 polypeptides include wild-type rice ROS1a, ROS1b, ROS1c, and ROS1d polypeptides (including naturally occurring variants and mutants thereof). ROS1 polypeptides include those found in wild-type rice, as well as any variants thereof, either artificially produced or found in nature, such as those found in either indica and japonica rice, and either have or do not have DNA glycosylase activity, including ROS1 polypeptides that have DNA glycosylase activity but at a reduced level when compared to the corresponding wild-type ROS1 polypeptide. Examples of wild-type rice ROS1 polypeptides include those having an amino acid sequence set forth in one of SEQ ID NOs: 2-5, as well as mutant and naturally occurring ROS1 polypeptides having an amino acid sequence that is at least 95%, at least 97%, or at least 99% identical to one or more of the amino acid sequences set forth in SEQ ID NOs: 2-5. As used herein, ROS1 polypeptides do not include Demeter (DME) polypeptides, a DNA glycosylase-related family, that have an amino acid sequence that is less than 95% identical to the amino acid sequence of SEQ ID NOs: 1-5.

[0107] As used herein, the term "ROS1a polypeptide" refers to a DNA glycosylase-related molecule whose amino acid sequence is at least 95% identical to SEQ ID NO:2, preferably at least 97% or more preferably at least 99% identical to SEQ ID NO:2. ROS1a polypeptides include polypeptides found in wild-type rice, either artificially or naturally produced, and with or without DNA glycosylase activity, provided they have the requisite level of amino acid sequence identity to SEQ ID NO:2, as well as variants thereof. For example, a ROS1a polypeptide whose sequence is provided as SEQ ID NO:1 is considered to have no DNA glycosylase activity, and is a ROS1a polypeptide as defined herein. In a preferred embodiment, the ROS1a polypeptide has some DNA glycosylase activity, but at a reduced level compared to the wild-type ROS1a polypeptide whose amino acid sequence is provided as SEQ ID NO:2. For example, Table 3 lists ROS1a mutant polypeptides that are considered to have reduced DNA glycosylase activity.

[0108] One skilled in the art can readily use known techniques to distinguish ROS1a polypeptides from other structurally related proteins, such as other ROS1 polypeptides, specifically ROS1b, ROS1c and ROS1d polypeptides, for example, by using in silico phylogenetic analysis or protein alignment. Thus, a ROS1a polypeptide can be identified as a ROS1a polypeptide based solely on structural features. See, for example, Figures 4 and 5 herein. The ROS1a polypeptides of the present invention may or may not have DNA glycosylase activity, or may have reduced DNA glycosylase activity, when compared to a wild-type ROS1a polypeptide, such as one having the amino acid sequence set forth in SEQ ID NO:2.

[0109] As used herein, the term "sequence differs from the amino acid sequence of the corresponding wild-type ROS1a polypeptide" or similar phrases is a comparative term in which the amino acid sequence of the ROS1a polypeptide of the present invention differs from the amino acid sequence of the most closely related protein from which it is derived and / or which occurs in nature. In one embodiment, the amino acid sequence of the ROS1a polypeptide has one or more insertions, deletions, or amino acid substitutions (or a combination thereof) relative to the corresponding amino acid sequence. The ROS1a polypeptide may have 2, 3, 4, 5, or 6-10 amino acid substitutions compared to the corresponding wild-type ROS1a polypeptide. In a preferred embodiment, the ROS1a polypeptide has only a single insertion, a single deletion, or a single amino acid substitution compared to the corresponding wild-type polypeptide. In this context, "single insertion" and "single deletion" include cases where multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) consecutive amino acids are inserted or deleted, respectively, and "corresponding wild-type polypeptide" refers to the wild-type polypeptide from which the variant is derived and / or the naturally occurring polypeptide to which the variant is most closely related. The ROS1a polypeptide may be an incomplete polypeptide, such as, for example, a ROS1a gene that contains a premature translation stop codon in the protein open reading frame compared to the wild-type ROS1a gene from which it is derived, or the ROS1a polypeptide may be complete, i.e., have the same number of amino acid residues as the corresponding wild-type ROS1a polypeptide. An example of a naturally occurring (wild-type) ROS1a polypeptide is the one whose amino acid sequence is shown as SEQ ID NO: 2, and examples of mutant ROS1a polypeptides having only a single insertion, deletion or amino acid substitution are shown in SEQ ID NO: 1 and Table 3.

[0110] As used herein, the term "DNA glycosylase activity" refers to an enzyme involved in base excision repair (classified under the EC number EC 3.2.2). The enzyme typically also has DNA lyase activity, in which DNA bases are excised and the backbone DNA strand is cleaved. In one embodiment, "DNA glycosylase activity" as used herein refers to an active demethylation in which 5-methylcytosine residues are excised and replaced with unmethylated cytosine. In a preferred embodiment, the ROS1a polypeptide of the present invention having DNA glycosylase activity has at least five identifiable motifs. One is a helix-hairpin-helix (HhH) motif (e.g., amino acids 1491-1515 of SEQ ID NO: 2 or a homologous amino acid sequence). Another is a glycine / proline-rich motif followed by a conserved aspartic acid (GPD) and four conserved cysteine ​​residues to hold the [4Fe-4S] cluster in place (within the region of amino acids 1582-1598 of SEQ ID NO:2). A lysine-rich domain (e.g., amino acids 87-139 of SEQ ID NO:2 or a homologous amino acid sequence) is also present. Unlike other members of the HhH DNA glycosylase superfamily, ROS1a polypeptide family members contain two additional conserved domains (domains A and B) that flank the central glycosylase domain. In the rice ROS1a polypeptide (SEQ ID NO:2), domain A occurs at amino acids 859-965, the glycosylase domain occurs at amino acids 1403-1616, and domain B occurs at amino acids 1659-1933. Domain A contains a repeating mixed charge cluster at amino acids 882-892. DNA glycosylase activity can be measured using standard techniques known in the art, such as that described in Example 8.

[0111] Highly conserved amino acid motifs within the glycosylase domain of wild-type rice ROS1a polypeptides include DHGSIDLEWLR (SEQ ID NO:44, amino acids 1467-1477 in SEQ ID NO:2), GLGLKSVECVRLLTLHH (SEQ ID NO:45, amino acids 1493-1509 in SEQ ID NO:2), AFPVDTNVGRI (SEQ ID NO:46, amino acids 1511-1521 in SEQ ID NO:2), VRLGWVPLQPLPESLQLHLLE (SEQ ID NO:47, amino acids 1523-1543 in SEQ ID NO:2), ELHYQMITFGKVFCTKSKPNCN (SEQ ID NO:48, amino acids 1569-1590 in SEQ ID NO:2), and HFASAFASARLALP (SEQ ID NO:49, amino acids 1600-1613 in SEQ ID NO:2). One or two amino acid substitutions may or may not be present in these motifs. Other conserved amino acids can be readily identified by aligning the amino acid sequence of wild-type rice ROS1a (SEQ ID NO:2) with the DME polypeptide from Arabidopsis thaliana (SEQ ID NO:6) and / or the Arabidopsis ROS1a polypeptide (see Figures 4 and 5). Further guidance on identifying conserved amino acids can be obtained from Kapazoglou et al. (2012).

[0112] As used herein, the terms "reduced DNA glycosylase activity compared to the corresponding wild-type ROS1a polypeptide," "reduced, but preferably not, DNA glycosylase activity when compared to the corresponding wild-type ROS1a polypeptide," or similar phrases are hypothetical terms in which the DNA glycosylase activity of a mutant / mutant ROS1a polypeptide is lower than the naturally occurring and / or most closely related protein. For example, as one of skill in the art would appreciate, the rice Ta2 mutant described herein (SEQ ID NO:1) has reduced DNA glycosylase activity when compared to the corresponding wild-type ROS1a polypeptide (SEQ ID NO:2). Other examples of ROS1a polypeptides having reduced DNA glycosylase activity include mutations / alterations corresponding to the amino acids listed in Table 3 that confer thickened aleurone, such as replacing the serine at amino acid position corresponding to amino acid number 156 of SEQ ID NO:2 with another amino acid, such as phenylalanine, replacing the serine at amino acid position corresponding to amino acid number 214 of SEQ ID NO:2 with another amino acid, such as phenylalanine, replacing the serine at amino acid position corresponding to amino acid number 1413 of SEQ ID NO:2 with another amino acid, such as asparagine, replacing the alanine at amino acid position corresponding to amino acid number 441 of SEQ ID NO:2 with another amino acid, such as valine, replacing the serine at amino acid position corresponding to amino acid number 1357 of SEQ ID NO:2 with another amino acid, such as phenylalanine, replacing the lysine at amino acid position corresponding to amino acid number 501 of SEQ ID NO:2 with another amino acid, such as serine, and replacing the arginine at amino acid position corresponding to amino acid number 482 of SEQ ID NO:2 with another amino acid, such as lysine. In a particularly preferred embodiment, the grain has at least some DNA glycosylase activity, preferably some ROS1a DNA glycosylase activity, since there is evidence suggesting that lack of DNA glycosylase activity in egg cells and early seed development is lethal to rice plants.In one embodiment, the grain has between about 30%-98%, or between about 40%-98%, or between about 40%-90%, or between about 40%-85%, or between about 40%-80% less DNA glycosylase activity when compared to grain from a corresponding isogenic plant lacking a genetic mutation (preferably an introduced mutation) that reduces DNA glycosylase activity in the grain.

[0113] By "substantially purified polypeptide" or "purified polypeptide" is meant a polypeptide that has been generally separated from lipids, nucleic acids, other peptides, and other contaminating molecules with which it is naturally associated. Preferably, a substantially purified polypeptide is at least 90% free from other components with which it is naturally associated. In one embodiment, the polypeptide of the invention has an amino acid sequence that differs from a naturally occurring ROS1a polypeptide, i.e., an amino acid sequence variant as defined above.

[0114] The grains, plants and host cells of the invention may contain an exogenous polynucleotide encoding a polypeptide of the invention. In these cases, the grains, plants and cells produce recombinant polypeptides. In the context of a polypeptide, the term "recombinant" refers to a polypeptide that, when produced by a cell, is encoded by an exogenous polynucleotide, where the polynucleotide has been introduced into the cell or into a progenitor cell by recombinant DNA or RNA techniques, such as transformation. Typically, the cell contains a non-endogenous gene that causes an altered amount of the polypeptide to be produced. In one embodiment, a "recombinant polypeptide" is a polypeptide made by expression of an exogenous (recombinant) polynucleotide in a plant cell.

[0115] The terms "polypeptide" and "protein" are commonly used interchangeably.

[0116] The percent identity of the polypeptides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap refinement penalty=5 and a gap extension penalty=3. The query sequence is at least 1,000 amino acids in length and the GAP analysis aligns the two sequences over a span of at least 1,000 amino acids. More preferably, the query sequence is at least 1,250 amino acids in length and the GAP analysis aligns the two sequences over a span of at least 1,250 amino acids. More preferably, the query sequence is at least 1,500 amino acids in length and the GAP analysis aligns the two sequences over a span of at least 1,500 amino acids. Even more preferably, the GAP analysis aligns the two sequences over their entire length, which for the ROS1a polypeptide is about 1,800-2,100 amino acid residues.

[0117] With respect to the defined polypeptides, it will be understood that higher % identities than those provided above encompass preferred embodiments. Thus, where applicable, with respect to minimum values ​​of % identity, it is preferred that the polypeptide comprises an amino acid sequence that is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0118] As used herein, the phrase "at a position corresponding to an amino acid number" or variations thereof refers to the relative position of an amino acid compared to the surrounding amino acids. In this regard, in some embodiments, the polypeptides of the invention may have deletion or substitution mutations that change the relative position of an amino acid, for example, when aligned against SEQ ID NO: 2. It is well within the capabilities of one of ordinary skill in the art to determine corresponding amino acid positions between two closely related proteins.

[0119] Amino acid sequence mutants of the polypeptides of the invention can be prepared by introducing appropriate nucleotide changes into the nucleic acids of the invention or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletion, insertion or substitution of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final peptide product has the desired properties. Preferred amino acid sequence mutants have only 1, 2, 3, 4 or less than 10 amino acid changes compared to the reference wild-type polypeptide. The mutant polypeptides of the invention have reduced "ROS1a polypeptide activity" when compared to the corresponding wild-type native ROS1a polypeptide (e.g., a polypeptide comprising an amino acid sequence set forth as SEQ ID NO:2).

[0120] Mutant (altered) polypeptides can be prepared using any technique known in the art, such as directed evolution or rational design strategies (see below). Products derived from mutated / modified DNA can be readily screened using the techniques described herein to determine whether they have reduced ROS1a polypeptide activity, such as reduced DNA glycosylase activity, when compared to one or more or all of the ROS1a polypeptides comprising the amino acid sequence provided as SEQ ID NO:2. For example, the method can include producing transgenic plants expressing the mutated / modified DNA and determining i) the effect of the mutated / modified DNA on aleurone thickness and ii) whether the ROS1a gene is mutated / modified.

[0121] In designing amino acid sequence mutants, the location of the mutation sites and the nature of the mutation will depend on the property to be altered. The sites for mutation can be altered individually or sequentially, for example, by (1) substituting non-conservative amino acid choices, (2) deleting the target residue, or (3) inserting another residue adjacent to the site.

[0122] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 contiguous residues.

[0123] Substitution mutants have at least one amino acid residue in a polypeptide molecule removed and a different residue inserted in its place. When maintaining a certain activity or reducing a certain activity is undesirable, it is preferable to make non-conservative substitutions, especially at amino acid positions that are highly conserved in related protein families. Examples of conservative substitutions are shown in Table 1; non-conservative substitutions are those not shown in Table 1.

[0124] In one embodiment, the mutant / variant polypeptide has one or two or three or four amino acid changes compared to the naturally occurring polypeptide. In a preferred embodiment, the changes are one or more motifs that are highly conserved between different ROS1a polypeptides provided herein, particularly between known conserved structural domains. As will be appreciated by those skilled in the art, such changes can be reasonably expected to change the activity of the polypeptide when expressed in a cell.

[0125] The primary amino acid sequence of the polypeptide of the invention can be used to design variants / mutants thereof based on comparison with closely related enzymes, particularly DNA glycosylases. As one skilled in the art will recognize, residues that are highly conserved among closely related proteins are particularly more susceptible to modification than non-conservative substitutions and are more likely to result in reduced activity than residues that are not conserved (see above).

[0126] Table 1. Conservative substitutions [Table 1]

[0127] Also included within the scope of the invention are polypeptides of the invention that have been differentially modified after synthesis by post-translational modifications within a cell, for example by phosphorylation, which can regulate their activity.

[0128] Polynucleotides and Genes The present invention relates to various polynucleotides. As used herein, "polynucleotide" or "nucleic acid" or "nucleic acid molecule" refers to a polymer of nucleotides that may be DNA or RNA, including genomic DNA, mRNA, cRNA, dsRNA and cDNA. It may be DNA or RNA of cellular, genomic or synthetic origin, for example made on an automated synthesizer, and may be combined with carbohydrates, lipids, proteins or other materials, may be labeled with fluorescent or other groups, or may be attached to a solid support to perform a specific activity defined herein, and may contain one or more modified nucleotides not found in nature, known to those skilled in the art. The polymer may be single-stranded, essentially double-stranded or partially double-stranded. Base pairing, as used herein, refers to standard base pairing between nucleotides, including G:U base pairs. "Complementary" means that two polynucleotides can base pair (hybridize) along a portion of their length or along the entire length of one or both. "Hybridized polynucleotide" means that the polynucleotide is actually base paired to its complement. The term "polynucleotide" is used interchangeably herein with the term "nucleic acid." Preferred polynucleotides of the invention encode a polypeptide of the invention.

[0129] By "isolated polynucleotide" is meant a polynucleotide that is generally separated from polynucleotide sequences with which it is naturally associated or linked when the polynucleotide occurs in nature. Preferably, an isolated polynucleotide is at least 90% free from other components with which it is naturally associated when it occurs in nature. Preferably, the polynucleotide does not occur in nature, for example, by covalently linking two shorter polynucleotide sequences in a manner not found in nature (chimeric polynucleotide).

[0130] The present invention includes the reduction of gene activity and the construction and use of chimeric genes. As used herein, the term "gene" includes any deoxyribonucleotide sequence that contains a protein coding region or is not translated but is transcribed in a cell, as well as associated non-coding and regulatory regions. Such associated regions are typically located adjacent to the coding or transcribed region at both the 5' and 3' ends, at a distance of about 2 kb on either side. A gene may then include control signals, such as promoters, enhancers, termination and / or polyadenylation signals naturally associated with a given gene, or heterologous control signals, in which case the gene is referred to as a "chimeric gene." Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene.

[0131] "Allele" refers to one of the specific forms of a genetic sequence (such as a gene) in a cell, an individual plant, or a population, a specific form that differs from other forms of the same gene in at least one sequence, and a variant site in the sequence of a gene at one or more frequencies. The sequences of these variant sites that differ between different alleles are called "divergences" or "polymorphisms". "Polymorphism" as used herein refers to the variation in nucleotide sequence between alleles at the locus of the invention, between different species, cultivars, lines, or individuals of a plant. "Polymorphic position" is a preselected nucleotide position in the sequence of a gene at which a sequence difference occurs. In some cases, a genetic polymorphism causes an amino acid sequence change in a polypeptide encoded by a gene, and thus a polymorphic position may result in the position of a polymorphism in the amino acid sequence at a given position in the sequence of the polypeptide. In other cases, a polymorphic region may be present in a non-polypeptide coding region of a gene, such as a promoter region, thereby affecting the expression level of the gene. Typical polymorphisms are deletions, insertions, or substitutions. These may involve a single nucleotide (single nucleotide polymorphism or SNP) or two or more nucleotides.

[0132] As used herein, a "mutation" is a polymorphism that results in a phenotypic change in a plant or part thereof. As known in the art, some polymorphisms are silent, e.g., a single nucleotide change in a protein-coding region that does not change the amino acid sequence of the encoded polypeptide due to redundancy in the genetic code. Diploid plants typically have one or two different alleles of a single gene, but only one when both copies of the gene are identical, i.e., the plant is homozygous for the allele. Polyploid plants generally have more than one homolog of any particular gene. For example, hexaploid wheat has three subgenomes (often called "genomes") called A, B, and D genomes, and therefore has three homologs of most of the genes, one in each of the A, B, and D genomes.

[0133] As used herein, the term "ROS1a gene encoding a ROS1a polypeptide" or "ROS1a gene" refers to a nucleotide sequence encoding a ROS1a polypeptide as defined herein. The ROS1a gene may be an endogenous naturally occurring gene or may comprise a genetic mutation (preferably an introduced genetic mutation) as defined herein. The ROS1a gene encoding a ROS1a polypeptide in the grain of the present invention may or may not have an intron. In one embodiment, the grain of the present invention is derived from rice, and at least one allele of the ROS1a gene encodes a ROS1a polypeptide having reduced DNA glycosylase activity (e.g., including an amino acid sequence as provided in SEQ ID NO: 2) when compared to a corresponding ROS1a polypeptide from wild-type rice. An example of such a ROS1a polypeptide having reduced DNA glycosylase activity is the rice Ta2 mutant (SEQ ID NO: 1).

[0134] As used herein, the phrases "inactivation of the ROS1a gene" or "reducing expression of the ROS1a gene" or a mutation thereof refer to any genetic mutation that reduces (partially) or completely prevents expression of a gene encoding a functional ROS1a polypeptide. Such genetic mutations include mutations in the promoter region of a gene that reduces transcription of the transcribed gene, for example, by gene editing to delete or replace nucleotides from the promoter of the ROS1a gene, or by using intron splicing mutations to change the amount or position of splicing to form an mRNA.

[0135] Genomic forms or clones of a gene containing a transcribed region may be interrupted with non-coding sequences called "introns" or "intervening regions" or "intervening sequences", which may be either homologous or heterologous with respect to the "exons" of the gene. As used herein, an "intron" is a segment of a gene that is transcribed as part of the primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; introns are therefore not present in messenger RNA (mRNA). As used herein, an "exon" refers to a region of DNA that corresponds to an RNA sequence that is present in a mature mRNA or mature RNA molecule when the RNA molecule is not translated. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes synthetic or fusion molecules that code for all or part of the inventive proteins described herein and for complementary nucleotide sequences to any one of the above. The gene may be introduced into an appropriate vector for extrachromosomal maintenance in a cell, or preferably for integration into the host genome.

[0136] As used herein, "chimeric gene" refers to any gene that contains covalently linked sequences that are not found associated in nature. Typically, chimeric genes contain regulatory and transcriptional or protein coding sequences that are not found together in nature. Thus, chimeric genes may contain regulatory and coding sequences that are derived from different sources, or regulatory and coding sequences that are derived from the same source but arranged in a different manner than found in nature. In one embodiment, the protein coding region of the ROS1a gene is operably linked to a promoter or polyadenylation / terminator region that is heterologous to the ROS1a gene, thereby forming a chimeric gene. In another embodiment, a gene encoding a polynucleotide that downregulates the production and / or activity of a ROS1a polypeptide in grain is operably linked to a promoter or polyadenylation / terminator region that is heterologous to the polynucleotide when present in rice grain, thereby forming a chimeric gene.

[0137] As used herein, the term "endogenous" is used to refer to a substance that is normally present or produced in an unmodified plant at the same developmental stage as the plant under test. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, "recombinant nucleic acid molecule," "recombinant polynucleotide," or variations thereof, refer to a nucleic acid molecule that has been constructed or modified by recombinant DNA technology. The terms "foreign polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide," etc., refer to any nucleic acid that is introduced into the genome of a cell by experimental manipulation.

[0138] A foreign or exogenous gene can be a gene inserted into a non-native organism, a native gene introduced into a new location in the native host, or a chimeric gene. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. The term "genetic modification" includes introducing a gene into a cell by transformation or transduction, mutating a gene in a cell, and modifying or modulating the regulation of a gene in a cell or organism or their progeny in which these actions have been performed.

[0139] Furthermore, in terms of polynucleotides (nucleic acids), the term "exogenous" refers to a polynucleotide when present in a cell that does not naturally contain the polynucleotide. A cell may be a cell that contains a non-endogenous polynucleotide that results in an altered amount of production of an encoded polypeptide, for example, an exogenous polynucleotide that increases expression of an endogenous polypeptide, or a cell that does not produce a polypeptide in its native state. Increasing production of a polypeptide of the invention is also referred to herein as "overexpression." Exogenous polynucleotides of the invention include polynucleotides that have not been separated from other components of a transgenic (recombinant) cell or cell-free expression system in which it is present, as well as polynucleotides produced in such cells or cell systems that have been purified from at least other components. An exogenous polynucleotide (nucleic acid) may be a stretch of contiguous nucleotides present in nature, or may contain two or more contiguous stretches of nucleotides from different sources (naturally occurring and / or synthetic) linked to form a single polynucleotide. Typically, such chimeric polynucleotides include at least an open reading frame encoding a polypeptide of the invention operably connected to a promoter suitable for driving transcription of the open reading frame in the cell of interest.

[0140] The percent identity of polynucleotides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap refinement penalty of 5 and a gap extension penalty of 3. The query sequence is at least 3,000 nucleotides in length, and the GAP analysis aligns the two sequences over a range of at least 3,000 nucleotides. Even more preferably, the query sequence is at least 3,750 nucleotides in length, and the GAP analysis aligns the two sequences over a range of at least 3,750 nucleotides. Even more preferably, the query sequence is at least 4,500 nucleotides in length, and the GAP analysis aligns the two sequences over a range of at least 4,500 nucleotides. Even more preferably, the GAP analysis aligns the two sequences over their entire length.

[0141] It will be understood that with respect to the defined polynucleotides, higher % identity numbers than those provided above encompass preferred embodiments. Thus, where applicable, in view of the minimum % identity numbers, it is preferred that the polynucleotide comprises a nucleotide sequence that is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0142] The present invention also relates to the use of oligonucleotides, for example in methods of screening polynucleotides of the invention or in methods of encoding polypeptides of the invention. As used herein, an "oligonucleotide" is a polynucleotide up to 50 nucleotides in length. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the nucleic acid molecule of the invention. They can be either RNA, DNA, or combinations or derivatives thereof. Oligonucleotides are typically relatively short single-stranded molecules of 10-30 nucleotides, generally 15-25 nucleotides in length. When used as a probe or primer in an amplification reaction, the minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the target nucleic acid molecule. Preferably, the oligonucleotide is at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides in length. The oligonucleotides of the present invention used as probes are typically conjugated to a label, such as a radioisotope, an enzyme, biotin, a fluorescent molecule, or a chemiluminescent molecule.

[0143] The present invention includes oligonucleotides that can be used, for example, as probes to identify nucleic acid molecules or as primers to generate nucleic acid molecules. Probes and / or primers can be used to clone homologs of the polynucleotides of the present invention from other species. Additionally, hybridization techniques known in the art can be used to screen genomic or cDNA libraries for such homologs.

[0144] Polynucleotides and oligonucleotides of the invention include those that hybridize under stringent conditions to one or more of the sequences provided as SEQ ID NO: 1 or 2. As used herein, stringent conditions include (1) using low ionic strength and high temperature for washing, e.g., 0.015M NaCl / 0.0015M sodium citrate / 0.1% NaDodSO4 at 50°C; (2) using a formamide, e.g., 50% (vol / vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate (42°C) during hybridization; or (3) using 50% formamide, 5xSSC (0.75M The conditions used were denaturing agents such as NaCl, 0.075 M sodium citrate, 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate (42°C, 0.2x SSC, and 0.1% SDS).

[0145] The polynucleotides of the invention may have one or more mutations, which are deletions, insertions or substitutions of nucleotide residues, when compared to naturally occurring molecules. Mutants can be naturally occurring (i.e., isolated from a natural source) or synthetic (e.g., by subjecting the nucleic acid to site-directed mutagenesis). Variants of the polynucleotides or oligonucleotides of the invention include molecules that are close in size and / or hybridizable to the rice genome to that of the reference polynucleotide or oligonucleotide molecule defined herein, preferably the endogenous ROS1a gene. For example, the variants may contain additional nucleotides (e.g., 1, 2, 3, 4 or more), or fewer nucleotides, so long as they still hybridize to the target region. Furthermore, some nucleotides can be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. In addition, variants can be readily designed that hybridize close to, for example within 50 nucleotides, the region of the plant genome to which the specific oligonucleotide defined herein hybridizes. In particular, this includes polynucleotides that encode the same polypeptide or amino acid sequence, but differ in nucleotide sequence due to redundancy in the genetic code. The terms "polynucleotide variant" and "variant" also encompass naturally occurring allelic variants.

[0146] Genetic mutations As used herein, the term "genetic variation" refers to a cell of one or more grains, preferably a cell in at least one or more or all of the aleurone, pericarp, nucellus, ovary, seed coat and starchy endosperm of a developing grain, or a cell of a plant of the invention or part thereof having a genetic modification that may be introduced by human, or a cell that may be naturally present in rice (e.g., crossed to produce a plant of the invention).

[0147] As used herein, the term "introduced genetic variation(s)" refers to one or more cells of a grain, preferably at least one or more or all of the cells in the aleurone, pericarp, nucellus, ovary, seed coat and starchy endosperm of a developing grain, or the cells of a plant of the invention or part thereof having a genetic modification that may be introduced by a human. In a preferred embodiment, all cells in the grain or plant or part thereof contain the introduced genetic variation. As one of skill in the art can appreciate, many different types of genetic modifications can be made, including, but not limited to, nucleic acid constructs encoding exogenous polynucleotides that reduce expression of the ROS1a gene (e.g., dsRNA molecules or microRNAs), nucleic acid constructs encoding exogenous polynucleotides that encode ROS1a polypeptides having amino acid sequences that differ from the amino acid sequence of the corresponding wild-type ROS1a polypeptide and that have reduced (preferably some, but potentially no) DNA glycosylase activity when compared to the corresponding wild-type ROS1a polypeptide, genomes engineered by gene editing to reduce activity of the endogenous ROS1a gene, and using TILLING to introduce mutations and select plants that produce grain with reduced ROS1a polypeptide DNA glycosylase activity.

[0148] As used herein, the term "reduced activity of at least one ROS1a gene" in relation to "one or more genetic variations" or "one or more introduced genetic variations" refers to a genetic variation that results in a reduction in the amount or activity of a ROS1a polypeptide expressed by the gene when compared to a corresponding wild-type rice. In one embodiment, the grain comprises a ROS1a polypeptide having at least some DNA glycosylase activity.

[0149] In one embodiment, the genetic variation does not downregulate the DNA glycosylase activity of a non-ROS1a polypeptide. For example, the genetic variation does not reduce the DNA glycosylase activity of each of the rice ROS1b, ROS1c and ROS1d polypeptides of the present invention by more than 10% or 30%. Alternatively, the genetic variation reduces the DNA glycosylase activity of at least one of the ROS1b, ROS1c and ROS1d polypeptides by at least 30%.

[0150] RNA interference RNA interference (RNAi) is particularly useful for specifically reducing the expression of a gene, so that if the gene codes for a protein, the production of the particular protein is reduced. Without wishing to be limited by theory, Waterhouse et al. (1998) provided a model of the mechanism by which protein production can be reduced using dsRNA (double-stranded RNA). This technique relies on the presence of a dsRNA molecule that contains a sequence that is essentially identical to the mRNA of the gene of interest or a portion thereof. Advantageously, the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and antisense sequences are flanked by unrelated sequences that can hybridize to form a dsRNA molecule with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules is well within the capabilities of one of skill in the art having regard to, inter alia, Waterhouse et al. (1998), Smith et al. (2000), WO 99 / 32619, WO 99 / 53050, WO 99 / 49029 and WO 01 / 34815.

[0151] In one embodiment, DNA is introduced that directs the synthesis of at least partially double-stranded RNA products with homology to the ROS1a gene. Thus, the DNA contains both sense and antisense sequences that can hybridize to form a double-stranded RNA region when transcribed into RNA. In one embodiment of the present invention, the sense and antisense sequences are separated by a spacer region that contains an intron that is spliced ​​out when transcribed into RNA. This arrangement has been shown to result in higher efficiency of gene silencing (Smith et al., 2000). The double-stranded region can contain one or two RNA molecules transcribed from either one or two DNA regions. The presence of the double-stranded molecules is believed to trigger a response of the endogenous system that destroys both the double-stranded RNA and the homologous RNA transcript from the target gene, effectively reducing or eliminating the activity of the target gene.

[0152] The length of the hybridizing sense and antisense sequences is preferably at least 19 consecutive nucleotides, preferably at least 30 or at least 50 consecutive nucleotides, more preferably at least 100 or at least 200 consecutive nucleotides, respectively. Typically, sequences of 100-1000 nucleotides are used that correspond to a region of the target gene mRNA. Full-length sequences corresponding to the entire gene transcript may be used. The degree of identity of the sense sequence to the target transcript (and thus the identity of the antisense sequence to the complement of the target transcript) should be at least 85%, at least 90%, or 95-100%, and is preferably identical to the target sequence. Naturally, the RNA molecule may contain unrelated sequences that may function to stabilize the molecule. The RNA molecule may be expressed under the control of an RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.

[0153] Preferred small interfering RNA ("siRNA") molecules comprise a nucleotide sequence that is identical to about 19-25 contiguous nucleotides of the target mRNA. Preferably, the siRNA sequence begins with the dinucleotide AA, contains a GC content of about 30-70% (preferably 30-60%, more preferably 40-60%, more preferably about 45-55%), and does not have a high percentage identity, as determined by, for example, a standard BLAST search, to any nucleotide sequence other than the target sequence in the genome of the organism into which it is to be introduced.

[0154] dsRNA useful in the present invention can be readily produced using routine procedures.

[0155] MicroRNA MicroRNAs (abbreviated miRNAs) are non-coding RNA molecules generally 19-25 nucleotides in length (generally about 20-24 nucleotides in plants) that are derived from larger precursors that form imperfect stem-loop structures. miRNAs are typically, but not necessarily, perfectly complementary to the region of the target mRNA whose expression is to be reduced.

[0156] miRNAs bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing. As is well known in the art, artificial miRNAs (amiRNAs) can be designed based on natural miRNAs to reduce the expression of any gene of interest.

[0157] In plant cells, miRNA precursor molecules are believed to be mostly processed in the nucleus. The pri-miRNA (containing one or more local double-stranded or "hairpin" regions and the usual 5' "cap" and polyadenylated tail of the mRNA) is processed into a shorter miRNA precursor molecule that also contains a stem-loop or fold-back structure, and is called "pre-miRNA". In plants, the pre-miRNA is cleaved by different DICER-like (DCL) enzymes to generate miRNA:miRNA* duplexes. Before export from the nucleus, these duplexes are methylated.

[0158] In the cytoplasm, the miRNA strand from the miRNA:miRNA duplex is selectively incorporated into an active RNA-induced silencing complex (RISC) for target recognition. The RISC-complex contains a specific subset of Argonaute proteins that exert sequence-specific gene repression (e.g., Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005).

[0159] MicroRNAs useful in the present invention can be easily produced using routine procedures. For example, the design of ROS1a amiRNA (artificial microRNA) constructs can be based on the general method described by Fahim et al. (2012). WMD3 software (www.wmd3.weigelworld.org / ) can be used to identify suitable amiRNA targets in the ROS1a gene. The amiRNA targets are selected according to four criteria: 1) relative 5' instability by using a sequence that is AT-rich at the 5' end and GC-rich at the 3' end; 2) U at position 1 and A at the cleavage site (between positions 10 and 11); a maximum of 1 and 4 mismatches at positions 1-9 and 13-21, respectively, and a predicted free energy (ΔG) of -30 kcal mol when the amiRNA hybridizes to the target RNA. -1(Ossowski et al., 2008). For gene-specific reduction of expression, candidate amiRNA sequences were selected in the region showing the lowest homology to the alignment of all homologs of OsROS1a, thus reducing the possibility of off-target reduction of expression of ROS1 homologs and homologs. The precursor of rice miR395 (Guddeti et al., 2005; Jones-Rhoades and Bartel, 2004; Kawashima et al., 2009) can be selected as an amiRNA scaffold for insertion of amiRNA sequences. To design and generate the constructs, five endogenous miRNA targets in miR395 were replaced with five amiRNA targets for TA2 knockdown.

[0160] Co-suppression Genes can suppress the expression of related endogenous genes and / or transgenes already present in the genome, a phenomenon called homology-dependent gene silencing. Most examples of homology-dependent gene silencing fall into two classes: those that function at the transcriptional level of the transgene and those that function post-transcriptionally.

[0161] Post-transcriptional homology-dependent gene silencing (i.e., cosuppression) describes the loss of expression of a transgene and associated endogenous or viral genes in transgenic plants. Cosuppression is enriched in transgene transcripts and is generally thought to be induced at the level of mRNA processing, localization and / or degradation. There are several models that explain how cosuppression works (see Taylor, 1997).

[0162] Cosuppression involves introducing extra copies of a gene or its fragment into a plant in the sense orientation relative to the promoter for its expression. The size of the sense fragment, its correspondence to the target gene region and its degree of sequence identity to the target gene can be determined by those skilled in the art. In some cases, the additional copies of the gene sequence interfere with the expression of the target plant gene. For methods of carrying out the cosuppression approach, see WO 97 / 20936 and EP 0465572.

[0163] Antisense Polynucleotides The term "antisense polynucleotide" refers to a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule that codes for an endogenous polypeptide and that can interfere with post-transcriptional events such as mRNA translation. The use of antisense methods is well known in the art (see, for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)). The use of antisense technology in plants has been reviewed by Bourque (1995) and Senior (1998). Bourque (1995) gives numerous examples of how antisense sequences have been utilized in plant systems as a method of gene inactivation. Bourque also notes that it may not be necessary to achieve 100% inhibition of enzyme activity, since partial inhibition may result in measurable changes in the system. Senior (1998) notes that antisense methods are a very well-established technique for manipulating gene expression.

[0164] In one embodiment, the antisense polynucleotide is capable of hybridizing under physiological conditions, i.e., the antisense polynucleotide (which may be completely or partially single-stranded) is capable of forming at least a double-stranded polynucleotide with an mRNA encoding an endogenous ROS1a polypeptide under normal conditions in a cell.

[0165] Antisense molecules may contain sequences corresponding to structural genes or sequences that control gene expression or splicing events. For example, antisense sequences may correspond to the target coding region of endogenous genes, or the 5'-untranslated region (UTR) or 3'-UTR or combinations thereof. It may be partially complementary to intronic sequences that can be spliced ​​during or after transcription, preferably only to exon sequences of the target gene. Given the generally greater divergence of UTRs, targeting these regions provides higher specificity of gene inhibition.

[0166] The length of the antisense sequence is preferably at least 19 contiguous nucleotides, preferably at least 30 or at least 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides. A full-length sequence complementary to the entire gene transcript can be used. The length is most preferably 100 to 2000 nucleotides. The degree of identity of the antisense sequence to the target transcript is preferably at least 90%, more preferably 95 to 100%, typically 100% identical. Of course, antisense RNA molecules can contain unrelated sequences that may function to stabilize the molecule.

[0167] Genome editing using site-specific nucleases Genome editing employs engineered nucleases composed of a sequence-specific DNA-binding domain fused to a non-specific DNA cleavage module. These chimeric nucleases enable efficient and precise genetic modification by inducing targeted DNA double-strand breaks that stimulate the cell's endogenous cellular DNA repair mechanisms to repair the induced breaks. Such mechanisms include, for example, error prone non-homologous end joining (NHEJ) and homology directed repair (HDR).

[0168] In the presence of a donor plasmid with extended homology arms, HDR can lead to the introduction of single or multiple transgenes to correct or replace existing genes. In the absence of a donor plasmid, NHEJ-mediated repair generates targeted small insertion or deletion mutations that cause gene disruption.

[0169] Engineered nucleases useful in the methods of the invention include zinc finger nucleases (ZFNs), transcription activator-like (TAL) effector nucleases (TALENs) and CRISPR-Cas9 type site-specific nucleases.

[0170] Typically, the nuclease-encoded gene is delivered to the cell by plasmid DNA, viral vectors or in vitro transcribed mRNA. The use of fluorescent surrogate reporter vectors also allows enrichment of ZFN-, TALEN- or CRISPR-modified cells.

[0171] Complex genomes often contain multiple copies of sequences identical or highly homologous to the desired DNA target, potentially resulting in off-target activity and cytotoxicity. To address this, structural (Miller et al., 2007; Szczepek et al., 2007) and selection-based (Doyon et al., 2011; Guo et al., 2010) approaches can be used to generate improved ZFN and TALEN heterodimers with optimal cleavage specificity and reduced toxicity.

[0172] According to a preferred embodiment of the present invention, to target genetic recombination or mutation by ZFN, two 9bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites are inverted relative to each other and separated by approximately 6bp of DNA. ZFNs are then generated by designing and producing combinations of zinc fingers that specifically bind to DNA at the target locus, and then linking the zinc fingers to a DNA cleavage domain.

[0173] Transcription activator-like (TAL) effector nucleases (TALENs) contain a TAL effector DNA-binding domain and an endonuclease domain.

[0174] TAL effectors are proteins of plant pathogenic bacteria that are injected into plant cells by pathogens, where they translocate to the nucleus and function as transcription factors that activate specific plant genes. The primary amino acid sequence of a TAL effector dictates the nucleotide sequence to which it binds. Thus, target sites can be predicted for TAL effectors, and TAL effectors can be engineered and generated with the purpose of binding to specific nucleotide sequences.

[0175] Fused to the nucleic acid sequence encoding the TAL effector is a sequence encoding a nuclease or a portion of a nuclease, typically a non-specific cleavage domain from a type II restriction endonuclease such as FokI (Kim et al., 1996). Other useful endonucleases can include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. The fact that some endonucleases (e.g., FokI) function only as dimers can be exploited to increase the target specificity of the TAL effector. For example, in some cases, each FokI monomer can be fused to a TAL effector sequence that recognizes a different DNA target sequence, and the inactive monomers will join together to generate a functional enzyme only if the two recognition sites are in close proximity. By requiring DNA binding to activate the nuclease, highly site-specific restriction enzymes can be made.

[0176] Sequence-specific TALENs can recognize specific sequences within a preselected target nucleotide sequence present in a cell. Thus, in some embodiments, a target nucleotide sequence can be scanned for nuclease recognition sites, and a specific nuclease can be selected based on the target sequence. In other cases, TALENs can be engineered to target specific cellular sequences.

[0177] Nucleic Acid Constructs The invention includes nucleic acid constructs comprising the polynucleotides of the invention or useful in the invention, as well as vectors and host cells, including methods for their production and use, and their uses.

[0178] The present invention refers to operably connected or linked elements. "Operably connected" or "operably linked" and the like refer to the linking of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are linked contiguously, and, if necessary, contiguously and in reading frame to join two protein coding regions. A coding sequence is "operably connected" to another coding sequence when RNA polymerase transcribes the two coding sequences into a single RNA that, when translated, is translated into a single polypeptide having amino acids from both coding sequences. The coding sequences do not have to be contiguous to each other, so long as the expressed sequence is ultimately processed to produce the desired protein.

[0179] As used herein, the term "cis-acting sequence", "cis-acting element" or "cis-regulatory region" or "regulatory region" or similar terms should be taken to mean any nucleotide sequence, which, when appropriately positioned and linked to an expressible genetic sequence, is capable of at least partially regulating the expression of the genetic sequence. Those skilled in the art will recognize that a cis-regulatory region can activate, silence, enhance, repress or otherwise modify the expression level and / or cell type specificity and / or developmental specificity of a genetic sequence at the transcriptional or post-transcriptional level. In a preferred embodiment of the present invention, the cis-acting sequence is an activating sequence that enhances or stimulates the expression of an expressible genetic sequence.

[0180] "Operably linked" a promoter or enhancer element to a transcribable polynucleotide means placing a transcribable polynucleotide (e.g., a polynucleotide encoding a protein or other transcript) under the regulatory control of the promoter, which controls the transcription of that polynucleotide. In constructing heterologous promoter / structural gene combinations, it is generally preferred to position the promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide that is approximately the same as the promoter and protein coding region that it controls in its natural setting; i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., operator, enhancer, etc.) with respect to the transcribable polynucleotide under its control is defined by the positioning of the element in its natural setting; i.e., the gene from which it is derived.

[0181] As used herein, a "promoter" or "promoter sequence" refers to a gene region generally upstream (5') of an RNA coding region that controls the initiation and level of transcription in a cell of interest. A "promoter" includes classical genomic gene transcription control sequences, such as TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers and silencers) that alter gene expression in response to developmental and / or environmental stimuli, or in a tissue- or cell-specific manner. A promoter is usually, but not necessarily (e.g., PolIII promoters), located upstream of a structural gene and controls its expression. In addition, regulatory elements, including promoters, are usually located within 2 kb of the start site of transcription of the gene. A promoter may include additional specific regulatory elements located distal to the start site to further enhance expression in the cell and / or to alter the timing or inducibility of expression of the structural gene to which it is operatively linked.

[0182] "Constitutive promoter" refers to a promoter that directs expression of an operably linked transcribed sequence in many or all tissues of an organism, such as a plant. As used herein, the term "constitutive" does not necessarily indicate that the gene is expressed at the same level in all cell types, but rather that the gene is expressed in a wide range of cell types, although some variation in levels is often detectable. As used herein, "selective expression" refers to expression almost exclusively in a particular organ of the plant, such as, for example, the endosperm, embryo, leaf, fruit, tuber, or root. In a preferred embodiment, the promoter is selectively or preferentially expressed in the grain of the plant, preferably rice. Thus, selective expression can be contrasted with constitutive expression, which refers to expression in many or all tissues of the plant under most or all conditions experienced by the plant.

[0183] Selective expression may also result in compartmentalization of the gene expression product in specific plant tissues, organs or developmental stages. Compartmentalization in specific subcellular locations such as plastids, cytosol, vacuoles or apoplasts can be achieved by inclusion in the structure of the gene product of appropriate signals for transport to the required cellular compartment, e.g., signal peptides, or, in the case of semi-autonomous organelles (plastids and mitochondria), by integration of appropriate regulatory sequences with the transgene directly into the organelle genome.

[0184] A "tissue-specific promoter" or "organ-specific promoter" is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably most, if not all other tissues or organs, e.g., of a plant. Typically, the promoter is expressed at a 10-fold higher level in a particular tissue or organ than in other tissues or organs.

[0185] Preferred seed-specific promoters of the present invention are the rapeseed napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis thaliana oleosin promoter (WO 98 / 45461), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91 / 13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters which induce seed-specific expression in rice and the like. Suitable notable promoters are the barley LPT2 or LPT1 gene promoters (WO 95 / 15389 and WO 95 / 23230) or the promoters described in WO 99 / 16890 (promoters from the barley hordein genes). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173. In one embodiment, the seed specific promoter is preferentially expressed in a restricted part of the seed, such as the endosperm, preferably the developing aleurone. In a further embodiment, after the seed has germinated the seed specific promoter is not expressed or is expressed only at low levels.

[0186] In one embodiment, it is active at least at a time between anthesis and 7 days after anthesis, or is fully active during this period. An example of such a promoter is the ROS1a gene promoter.

[0187] In one embodiment, the promoter operably linked to the exogenous polynucleotide that reduces expression of the ROS1a gene is not a high MW glutenin promoter.

[0188] Promoters contemplated by the present invention may be native to the host plant to be transformed or may be derived from alternative sources, where the region is functional in the host plant. Other sources include Agrobacterium T-DNA genes, such as promoters of genes for the biosynthesis of nopaline, octapine, mannopine or other opine promoters, tissue-specific promoters (see, e.g., US 5,459,252 and WO 91 / 13992); promoters from viruses (including host-specific viruses), or partially or completely synthetic promoters. Numerous promoters that are functional in monocotyledonous and dicotyledonous plants are well known in the art, including various promoters isolated from plants and viruses, such as the cauliflower mosaic virus promoters (CaMV 35S, 19S) (see, e.g., Greve, 1983; Salomon et al., 1984; Garfinkel et al., 1983; Barker et al., 1983). Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992 and 1993), Sambrook et al. (1989, supra) and US 5,164,316.

[0189] Alternatively or additionally, the promoter may be an inducible promoter or a developmentally regulated promoter capable of promoting expression of the introduced polynucleotide at the appropriate growth stage of the plant, for example. Enhancer regions are well known to those skilled in the art and may include an ATG translation initiation codon and adjacent sequences. If included, the initiation codon should be in phase with the reading frame of the coding sequence associated with the foreign or exogenous polynucleotide to ensure translation of the entire sequence when it is translated. The translation initiation region may be provided from the source of the transcription initiation region or from the foreign or exogenous polynucleotide. This sequence may also be derived from the source of the promoter selected to promote transcription and may be specifically modified to increase translation of mRNA.

[0190] The nucleic acid construct of the present invention may include a 3' untranslated sequence of about 50 to 1,000 nucleotide base pairs that may include a transcription termination sequence. The 3' untranslated sequence may include a transcription termination signal that may or may not include a polyadenylation signal and other regulatory signals capable of carrying out any mRNA processing. The polyadenylation signal functions to add a polyadenylic acid tract to the 3' end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical 5'AATAAA-3', although variations are not uncommon. Transcription termination sequences that do not include a polyadenylation signal include terminators for PolI or PolIII RNA polymerase that contain a run of four or more thymidines. Examples of suitable 3' non-translated sequences are the 3' transcribed untranslated regions containing the polyadenylation signals from the octopine synthase (ocs) or nopaline synthase (nos) genes of Agrobacterium tumefaciens (Bevan et al., 1983). Suitable 3' non-translated sequences can also be derived from plant genes such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those skilled in the art can also be used.

[0191] DNA sequences inserted between the transcription initiation site and the start of the coding sequence, i.e., untranslated 5' leader sequences (5'UTR), can affect gene expression when transcribed as well as translated, and specific leader sequences can be used. Suitable leader sequences include those that contain sequences selected to direct optimal expression of the foreign or endogenous DNA sequence. For example, such leader sequences include preferred consensus sequences that can increase or maintain mRNA stability and prevent inappropriate initiation of translation, e.g., as described in Joshi (1987).

[0192] The present invention includes the use of vectors for the manipulation or transfer of genetic constructs. By "chimeric vector" is meant a nucleic acid molecule, preferably a DNA molecule derived from a plasmid, bacteriophage, or plant virus, into which a nucleic acid sequence can be inserted or cloned. The vector is preferably double-stranded DNA, contains one or more unique restriction sites, and may be capable of autonomous replication in a defined host cell, including a target cell or tissue or a precursor cell or tissue thereof, or may integrate into a defined host genome such that the cloned sequence is reproducible. Thus, the vector may be an autonomously replicating vector, i.e. a vector whose replication exists as an extrachromosomal entity independent of chromosomal replication, e.g. a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may include any means for ensuring self-replication. Alternatively, the vector may be one which, when introduced into a cell, integrates into the genome of the recipient cell and replicates together with the chromosome into which it is integrated. The vector system may include a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA or transposon to be introduced into the genome of the host cell. The choice of vector typically depends on the compatibility of the vector with the cell into which the vector is to be introduced. The vector may also contain a selection marker, such as an antibiotic resistance gene, a herbicide resistance gene or other gene that can be used to select suitable transformants. Examples of such genes are well known to those skilled in the art.

[0193] The nucleic acid construct of the present invention can be introduced into a vector such as a plasmid. Plasmid vectors usually contain additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, including, for example, pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors that contain one or more T-DNA regions. The additional nucleic acid sequences include an origin of replication to provide autonomous replication of the vector, a selectable marker gene preferably encoding antibiotic or herbicide resistance, a unique multiple cloning site that provides multiple sites for inserting nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.

[0194] By "marker gene" is meant a gene that confers a distinct phenotype on cells expressing the marker gene, allowing cells so transformed to be distinguished from cells that do not possess the marker. A selectable marker gene confers a trait that can be "selected" for based on resistance to a selection agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment that is damaging to non-transformed cells). A screenable marker gene (or reporter gene) confers a trait that can be identified by observation or testing, i.e., "screening" (e.g., β-glucuronidase, luciferase, GFP, or other enzymatic activity not present in non-transformed cells). The marker gene and the nucleotide sequence of interest need not be linked.

[0195] To facilitate the identification of transformants, the nucleic acid construct desirably includes a selectable or screenable marker gene as or in addition to the foreign or exogenous polynucleotide. The actual selection of the marker is not critical as long as it is functional (i.e., selective) in combination with the selected plant cell. It is not necessary to link the marker gene and the foreign or exogenous polynucleotide of interest, since co-transformation of unlinked genes is also an efficient process in plant transformation, as described, for example, in US 4,399,216.

[0196] Examples of bacterial selectable markers are markers that confer antibiotic resistance, such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance. Examples of suitable markers for the selection of plant transformation include, but are not limited to, the hyg gene encoding hygromycin B resistance; the neomycin phosphotransferase (nptII) gene conferring resistance to kanamycin, paromomycin, G418; the glutathione-S-transferase gene from rat liver conferring resistance to glutathione-derived herbicides, e.g. as described in EP 256223; the glutamine synthetase gene, which upon overexpression confers resistance to glutamine synthetase inhibitors such as phosphinothricin, e.g. as described in WO 87 / 05327, the acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin, e.g. as described in EP 275957, e.g. such as the bar gene, which confers resistance to bialaphos, as described in WO 91 / 02071; a nitrilase gene, such as bxn from Klebsiella ozaenae, which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene, which confers resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinones, sulfonylureas or other ALS-inhibiting chemicals (EP 154,204); a mutant anthranilate synthase gene, which confers resistance to 5-methyltryptophan; or a dalapon dehalogenase gene, which confers resistance to herbicides.

[0197] Preferred screenable markers include, but are not limited to, the uidA gene, which encodes the β-glucuronidase (GUS) enzyme, for which various chromogenic substrates are known, the β-galactosidase gene, which encodes an enzyme for which chromogenic substrates are known, the aequorin gene (Prasher et al., 1985), which can be used for calcium-sensitive bioluminescence detection; the green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof, the luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art. As used herein, "reporter molecule" refers to a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates the determination of promoter activity by reference to the protein product.

[0198] Preferably, the nucleic acid construct is stably integrated into the genome of, for example, a plant or cell of the invention. Thus, the nucleic acid contains appropriate elements that allow the molecule to be integrated into the genome, or the construct is placed in an appropriate vector that can integrate into a chromosome of a plant cell.

[0199] One embodiment of the present invention includes a recombinant vector comprising at least one polynucleotide molecule of the present invention inserted into any vector capable of delivering the nucleic acid molecule to a host cell. Such vectors contain heterologous nucleic acid sequences, i.e., heterologous nucleic acid sequences that are not naturally found adjacent to the nucleic acid molecule of the present invention and that are preferably derived from a species other than the species from which the nucleic acid molecule is derived. Vectors can be either prokaryotic or eukaryotic, either RNA or DNA, and are typically viruses or plasmids.

[0200] Many vectors suitable for stable transfection of plant cells or establishment of transgenic plants are described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors contain one or more cloned plant genes under the transcriptional control of, for example, 5' and 3' regulatory sequences and a dominant selection marker. Such plant expression vectors can also contain a promoter regulatory region (e.g., a regulatory region that controls inducible or constitutive, environmentally or developmentally, or that controls cell-specific or tissue-specific expression), a transcription initiation site, a ribosome binding site, a transcription termination site, and / or a polyadenylation signal.

[0201] The level of ROS1s polypeptides is modulated by decreasing the expression level of the gene encoding the rice protein, resulting in increased aleurone thickness. The expression level of the gene can be modulated by altering the copy number per cell, for example, by introducing a synthetic gene construct comprising a coding sequence and a transcriptional control element operably linked thereto and functional in the cell. A number of transformants can be selected and screened for those with a preferred level and / or specificity of transgene expression resulting from the influence of endogenous sequences in the vicinity of the transgene integration site. The preferred level and pattern of transgene expression is one that results in increased aleurone. Alternatively, a population of mutagenized seeds or a population of plants from a breeding program can be screened for individual lines with increased aleurone thickness.

[0202] Recombinant cells Other embodiments of the invention include recombinant cells comprising a host cell transformed with one or more recombinant molecules of the invention or a progeny thereof. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into a cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, absorption, and apoplast fusion. The recombinant cell may remain unicellular or may develop into a tissue, organ, or multicellular organism. The transformed nucleic acid molecule of the invention may be integrated into one or more sites within the chromosome of the transformed (i.e., recombinant) cell in such a way that it retains its ability to be expressed. Preferred host cells are plant cells, more preferably rice cells.

[0203] Plants with genetic mutations The term "plant" as used herein as a noun refers to an entire plant and means any member of the plant kingdom, but when used as an adjective, refers to any material present in, obtained from, or associated with a plant, such as, for example, plant organs (e.g., leaves, stems, roots, flowers), single cells (e.g., pollen), seeds, plant cells, and the like. Seedlings with emerging roots and shoots and germinated seeds are also included within the meaning of "plant." As used herein, the term "plant part" refers to one or more plant tissues or organs obtained from a plant and that contain the genomic DNA of the plant. Plant parts include vegetative structures (e.g., leaves, stems), roots, floral organs / structures, seeds (including embryos, cotyledons, and seed coats), plant tissues (e.g., vascular tissue, ground tissue, etc.) cells and their progeny. As used herein, the term "plant cell" refers to a plant or a cell obtained from within a plant, including protoplasts or other cells derived from a plant, gamete-producing cells, and cells that regenerate into whole plants. The plant cells may be cells in culture. "Plant tissue" includes differentiated tissue in a plant or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissue such as crown galls ("explants"), and various forms of aggregations of plant cells in culture, such as callus. Exemplary plant tissues in or from seeds are cotyledons, embryos and hypocotyls. Thus, the present invention includes plants and plant parts and products containing these.

[0204] The terms "grain" and "seed" are used interchangeably herein. "Grain" refers to mature grain of a plant, developing grain of a plant, or to harvested grain or grain after processing such as grinding or polishing, where the majority of the grain is intact or remains after harvest or after germination, depending on the context. Mature grain typically has a moisture content of less than about 18-20%. In one embodiment, the developing grain of the present invention is at least about 10 days after pollination (DAP). In one embodiment, the developing grain of the present invention includes grain at least between anthesis and 7 days after anthesis.

[0205] As used herein, a "transgenic plant" refers to a plant that has one or more genetic variations as defined herein, including a nucleic acid construct that is not found in a wild-type plant of the same species, variety, or cultivar. That is, a transgenic plant (transformed plant) contains genetic material (transgene) that was not present prior to transformation. A transgene can include a genetic sequence obtained from a plant cell, or obtained from a plant cell, or another plant cell, or a non-plant source, or a synthetic sequence. Typically, a transgene is introduced into a plant by human manipulation, e.g., transformation, although any method can be used, as one of skill in the art will recognize. The genetic material is preferably stably integrated into the genome of the plant. The introduced genetic material can include sequences that occur naturally in the same species, but in a rearranged order, or a different arrangement of elements, e.g., antisense sequences. Plants that contain such sequences are included herein as "transgenic plants."

[0206] A "non-transgenic plant" is one that has not been genetically altered by the introduction of genetic material by recombinant DNA techniques.

[0207] As used herein, "wild type" refers to a cell, tissue, grain or plant that has not been modified according to the present invention. The wild type cell, tissue or plant may be used as a control to compare the expression level of an exogenous nucleic acid or the degree and nature of a trait modification by a cell, tissue, grain or plant modified as described herein.

[0208] As used herein, the term "corresponding wild type" rice or grain, or similar phrases, refers to rice or grain that comprises at least 50%, more preferably at least 75%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, and even more preferably at least 99.5% of the genotype of the rice or grain of the present invention, but does not include one or more genetic variations (e.g., introduced genetic variations) that reduce the activity of the ROS1a gene in the plant or grain, and / or in the thickened aleurone, respectively. In one embodiment, the rice grain or plant of the present invention is homogeneous to the wild type rice grain or plant, except for one or more genetic variations (such as introduced genetic variations). Preferably, the corresponding wild type plant or grain is of / derived from the same cultivar or variety as the ancestor of the plant / grain of the present invention, or is a sibling plant line that lacks one or more genetic modifications and / or does not have thickened aleurone, often referred to as a "segregant". In one embodiment, the rice or grain of the present invention has a genotype that has less than 50% identity to the genotype of rice cultivar Zhonghua 11 (ZH11), which has been commercially available since 1986.

[0209] A transgenic plant as defined in the context of the present invention includes the progeny of a rice plant that has been genetically modified using recombinant techniques, where the progeny contains a transgene of interest. Such progeny can be obtained by self-fertilization of a primary transgenic plant or by crossing such a plant with another rice plant. This generally involves modulating the production of at least one protein as defined herein in a desired plant or plant organ. Parts of a transgenic plant include all parts and cells of said plant that contain the transgene, such as, for example, cultured tissue, callus and protoplasts.

[0210] As used herein, the term "rice" refers to any species of the genus Oryza, including its ancestors as well as its progeny produced by crossing with other species. Preferably, the plant is a commercially cultivated Oryza species, such as, for example, a line or cultivar or variety of Oryza sativa, or a grain suitable for commercial production.

[0211] As used herein, "brown rice" means the whole kernel of rice including the bran layer and germ, but not the hull, which is usually removed during harvesting. That is, brown rice has not been polished to remove the aleurone and germ. "Brown" means the presence of brown or tan pigments in the bran layer. Brown rice is considered the whole kernel. As used herein, "white rice" (polished rice) means rice kernels from which the bran and germ have been removed, that is, essentially the starchy endosperm of the whole rice kernel. Both of these classes of rice kernels can occur in short, medium or long grain form. Compared to white rice, brown rice has a higher content of protein, minerals and vitamins, and a higher lysine content in its protein content.

[0212] As used herein, "pigmented rice" includes black rice and red rice, each of which contains pigments such as proanthocyanidins (tannins) in the aleurone layer. Pigmented rice has a higher riboflavin content than non-pigmented rice, but similar thymine content. "Black rice" has a black or nearly black bran layer due to anthocyanins, which may turn deep purple when cooked. "Purple rice" (also called "purple black rice") is a short-grain variety of black rice and is included in black rice as defined herein. When uncooked, it is purple in color, and when cooked, it is deep purple. "Red rice" contains various anthocyanins that give the bran a red / maroon color, including cyanidin-3-glucoside (chrysanthemin) and peonidin-3-glucoside (oxycoccicy-anin).

[0213] These types of rice grains can be treated, for example, by cooking (boiling) or dry heat, to prevent sprouting. White rice is typically cooked for 12-18 minutes, whereas brown and pigmented rice is typically cooked for 20-40 minutes depending on the desired texture. Cooking or heating reduces the levels of antinutritional factors (but not the phytic acid content) in the rice grain, such as trypsin inhibitors, oryzacystatin, and hemagglutinin (lectin), by denaturing these proteins. The rice grains may be soaked in water before cooking or may be slow cooked for an extended period of time, as known in the art. The rice grains may also be milled, parboiled or heat stabilized. Rice bran can be steam treated, for example, at 100° C. for about 6 minutes, to stabilize it.

[0214] In one embodiment, the grain of the present invention has delayed grain maturation when compared to corresponding wild type wheat grain. Delayed maturation can be determined by using the seed set rate (%) which involves calculating the percentage of the plant's florets that are filled with seeds by the mature kernel stage.

[0215] In one embodiment, the grain of the present invention has a reduced ability to germinate when compared to the corresponding wild type grain. For example, the grain has about 70% to about 80%, or about 75%, preferably 70% to 100% of the germination ability of the corresponding wild type grain when cultured in a growth chamber at 28° C. with no humidity control and a 12 hour light / 12 hour dark cycle. As used herein, the term "germination" is defined as when the root becomes visible through the seed coat.

[0216] In one embodiment, the plant of the present invention has one or more or all of normal plant height, fertility (male and female), grain size and 1000 grain weight relative to a wild-type parent variety (such as an isogenic plant comprising a ROS1a polypeptide having the sequence of amino acids provided as SEQ ID NO:2). In one embodiment, the grain of the present invention can produce rice having one or more or all of normal plant height, fertility (male and female), grain size and 1000 grain weight relative to a wild-type parent variety. As used herein, the term "normal" can be determined by measuring the same trait in a wild-type parent variety grown under the same conditions as the plant of the present invention. In one embodiment, the normality of the plant of the present invention has a level / value etc. of a defined characteristic of + / -10%, more preferably + / -5%, more preferably + / -2.5%, even more preferably + / -1% compared to the wild-type parent variety.

[0217] Transgenic plants, as defined in the context of the present invention, include plants (as well as parts and cells of said plants) and their progeny that have been genetically modified using recombinant techniques to cause the production of at least one polypeptide of the present invention in the desired plant or plant organ. Transgenic plants can be produced using techniques known in the art, for example, as described in A. Slater et al., Plant Biotechnology: Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).

[0218] In a preferred embodiment, the transgenic plant is homozygous for each introduced gene or nucleic acid construct (transgene), making its progeny non-segregating for the desired phenotype. The transgenic plant can also be heterozygous for the introduced transgene (e.g., F1 progeny propagated from hybrid seeds). Such plants can provide advantages such as hybrid vigor, as is well known in the art.

[0219] In one embodiment, the method of selecting rice of the present invention further comprises analyzing the DNA sample for at least one "other genetic marker" from the plant. As used herein, "other genetic marker" can be any molecule associated with a desired trait of the plant. Such markers are well known to those skilled in the art and include molecular markers for genes that determine traits such as disease resistance, yield, plant morphology, grain quality, dormancy traits, grain color, gibberellic acid content in seeds, plant height, flour color, and the like. An example of such a gene is the Rht gene that determines a semi-dwarf growth habit and thus lodging resistance.

[0220] Four general methods have been described for delivering genes directly into cells: (1) chemical methods (Graham et al., 1973); (2) physical methods such as microinjection (Capecchi, 1980); electroporation (see, e.g., WO 87 / 06614, US 5,472,869, 5,384,253, WO 92 / 09696 and WO 93 / 21335); and gene guns (see, e.g., US 4,945,050 and US 5,141,131); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988); and (4) receptor-mediated mechanisms (Curiel et al., 1992; Wagner et al., 1992).

[0221] Acceleration methods that can be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method is reviewed by Yang et al., Particle Bombardment Techniques for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) can be coated with nucleic acid and delivered to cells by a propelling force. Exemplary particles include tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to being an effective means of reproducibly transforming monocotyledonous plants, is that it does not require isolation of protoplasts or susceptibility to infection with Agrobacterium. A particle delivery system suitable for use in the present invention is the helium-accelerated PDS-1000 / He gun available from Bio-Rad Laboratories. For bombardment, immature embryos or induced target cells such as scutella or callus from immature embryos can be placed on solid medium.

[0222] In another alternative embodiment, plastids can be stably transformed. Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting the DNA into the plastid genome by homologous recombination (US 5,451,513, US 5,545,818, US 5,877,402, US 5,932479 and WO 99 / 05265).

[0223] Agrobacterium-mediated transfer is a broadly applicable system for introducing genes into plant cells because DNA can be introduced into whole plant tissues, avoiding the need to regenerate intact plants from protoplasts. The use of Agrobacterium-mediated plant incorporating vectors to introduce DNA into plant cells is well known in the art (see, e.g., US 5,177,010, US 5,104,310, US 5,004,863, US 5,159,135). Furthermore, integration of T-DNA is a relatively precise process, with little rearrangement occurring. The region of DNA to be transferred is defined by border sequences, and the intervening DNA is usually inserted into the plant genome.

[0224] Transgenic plants generated using Agrobacterium transformation methods typically contain a single locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene. More preferred are transgenic plants that are homozygous for the added structural gene, i.e., transgenic plants that contain two added genes, one gene at the same locus on each chromosome of a chromosome pair. Homozygous transgenic plants can be obtained by sexually crossing (self-pollinating) independent segregating transgenic plants containing a single added gene, germinating some of the seeds produced, and analyzing the resulting plants for the gene of interest.

[0225] Other methods of cell transformation can also be used, including, but not limited to, introducing DNA into a plant by transferring the DNA directly into pollen, by directly injecting DNA into the reproductive organs of a plant, or by directly injecting DNA into the cells of an immature embryo followed by rehydration of the desiccated embryo.

[0226] The regeneration, development and cultivation of plants from single plant protoplast transformants or various transformed explants is well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process typically involves the step of selection of transformed cells, which is culturing the individualized cells through the normal stages of embryo development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rootstocks are then planted in a suitable plant growth medium, such as soil.

[0227] The development or regeneration of plants containing foreign, exogenous genes is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Alternatively, pollen obtained from the regenerated plants is crossed with seed-cultivated plants of agriculturally important lines. Conversely, pollen from plants of these important lines is used to pollinate the regenerated plants. Transgenic plants of the invention containing the desired exogenous nucleic acid are cultured using methods well known to those of skill in the art.

[0228] To confirm the presence of the transgene in transgenic cells and plants, polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those of skill in the art. The expression product of the transgene can be detected in any of a variety of ways depending on the nature of the product, including Western blot and enzyme assays. One particularly useful method for quantifying protein expression and detecting replication in different plant tissues is to use a reporter gene such as GUS. Once transgenic plants are obtained, they can be grown to produce plant tissues or parts with the desired phenotype. The plant tissues or plant parts may be harvested and / or seeds may be collected. The seeds can serve as a source for cultivating additional plants with tissues or parts with the desired characteristics.

[0229] Marker Support Selection Marker-assisted selection is a well-known method to select heterozygous plants required for backcrossing with the revertant parent in classical breeding programs. A population of plants in each backcross generation can be heterozygous for the gene of interest that is usually present in a 1:1 ratio in the backcross population, and molecular markers can be used to distinguish the two alleles of the gene. For example, early selection of plants for further backcrossing is performed by extracting DNA from young leaves and detecting it with a specific marker for the desired trait that has been introgressed, so that energy and resources are concentrated on fewer plants. To further speed up the backcrossing program, embryos from immature seeds (25 days after flowering) can be excised and grown on nutrient medium under sterile conditions, rather than allowing complete seed maturation. This process, called "embryo rescue," combined with DNA extraction at the three leaf stage and analysis of at least one genetic mutation that alters ROS1a activity, can be used to rapidly select plants with the desired trait by increasing aleurone thickness in the plants, which can then be grown to maturity in a greenhouse or in the field and then further backcrossed to the backcross parent.

[0230] Any molecular biology technique known in the art can be used in the methods of the invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with appropriately labeled probes, single strand conformation analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage, or combinations thereof (see, e.g., Lemieux, 2000; Langridge et al., 2001). The invention also includes the use of molecular marker techniques to detect polymorphisms associated with (for example) alleles of the ROS1a gene that alter ROS1a activity and increase aleurone thickness in plants. Such methods include detection or analysis of restriction fragment length polymorphisms (RFLPs), RAPDs, amplified fragment length polymorphisms (AFLPs), and microsatellite (simple sequence repeat, SSR) polymorphisms. Closely linked markers can be readily obtained by methods well known in the art, for example Bulked Segregant Analysis as reviewed by Langridge et al. (2001).

[0231] In one embodiment, relevant loci for marker assisted selection are within at least 1 cM, or 0.5 cM, or 0.1 cM, or 0.01 cM of a gene encoding a polypeptide of the invention.

[0232] "Polymerase chain reaction" ("PCR") is a reaction in which replicate copies are made from a target polynucleotide using a "primer pair" or "primer set" consisting of an "upstream" and a "downstream" primer, and a catalyst for polymerization, such as DNA polymerase, and typically a heat-stable polymerase enzyme. Methods for PCR are known in the art and are taught, for example, in "PCR" (MJ McPherson and SG Moller (editors), BIOS Scientific Publishers Ltd, Oxford, (2000)). PCR can be performed on cDNA obtained by reverse transcribing mRNA isolated from plant cells expressing the ROS1a gene or allele that increased plant aleurone thickness. However, it is generally easier to perform PCR on genomic DNA isolated from plants.

[0233] A primer is an oligonucleotide sequence that can hybridize in a sequence-specific manner to a target sequence and be extended during PCR. An amplicon or PCR product or PCR fragment or amplification product is an extension product that contains the primer and the newly synthesized copy of the target sequence. A multiplex PCR system contains multiple primer sets that result in the simultaneous production of one or more amplicons. The primers may match the target sequence perfectly or may contain internal mismatched bases that may result in the introduction of a restriction enzyme or catalytic nucleic acid recognition / cleavage site in a particular target sequence. Primers may also contain additional sequences and / or modified or labeled nucleotides to facilitate capture or detection of the amplicon. Repeated cycles of thermal denaturation of DNA, annealing of primers to their complementary sequences, and extension of the annealed primers by a polymerase result in exponential amplification of the target sequence. The term target or target sequence or template refers to the nucleic acid sequence that is being amplified.

[0234] Methods for direct sequencing of nucleotide sequences are well known to those of skill in the art and can be found, for example, in Ausubel et al., supra, and Sambrook et al., supra. Sequencing can be performed by any suitable method, such as dideoxy sequencing, chemical sequencing, or variations thereof. Direct sequencing has the advantage of determining mutations in any base pair of a particular sequence.

[0235] TILLING Plants of the invention can be produced using a process known as TILLING (Targeting Induced Local Lesions IN Genomes). In a first step, an introduced mutation, such as a novel single base pair change, is induced in a population of plants by treating seeds (or pollen) with a chemical mutagen and then updating the plants to a generation in which the mutation is stably inherited. DNA is extracted and seeds are stored from all members of the population, creating a resource that can be repeatedly accessed over time.

[0236] For TILLING analysis, PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important when the target is a member of a gene family or part of a polyploid genome. Dye-labeled primers can then be used to amplify PCR products from the pooled DNA of multiple individuals. These PCR products are denatured and reannealed to allow for the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., some plants from a population are likely to have the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to show the mutation). After heteroduplex formation, the use of endonucleases that recognize and cleave mismatched DNA, such as CeI, is key to discovering novel SNPs within TILLING populations.

[0237] Using this approach, thousands of plants can be screened to identify individuals with single base changes as well as small insertions or deletions (1-30 bp) in any gene or specific region of the genome. The genomic fragments analyzed can range in size from 0.3 to 1.6 kb. With 8-fold pooling, 1.4 kb fragments (truncating the ends of fragments where SNP detection is problematic due to noise) and 96 lanes per analysis, this combination makes it possible to screen up to 1 million base pairs of genomic DNA per analysis making TILLING a high-throughput technology.

[0238] TILLING is further described in Slade and Knauf (2005) and Henikoff et al. (2004).

[0239] In addition to allowing efficient detection of mutations, the high-throughput TILLING technology is ideal for detecting natural polymorphisms. Thus, by interrogating unknown homologous DNA by heteroduplexing to known sequences, the number and location of polymorphic sites are revealed. Both nucleotide changes and small insertions and deletions, including at least some repeat number polymorphisms, are identified. This is called Ecotilling (Comai et al., 2004).

[0240] Each SNP is recorded with its approximate location within a few nucleotides. Thus, each haplotype can be archived based on its mobility. Sequence data can be obtained with relatively little incremental effort using the same aliquot of amplified DNA used for mismatch cleavage analysis. Left and right sequencing primers for a single reaction are selected for their proximity to the polymorphism. The sequencer software identifies the gel bands in each case, performs multiple alignments, and detects the base change.

[0241] Ecotilling can be performed more cheaply than the full sequencing methods currently used for most SNP discovery. Plates containing arrayed ecotype DNA can be screened rather than pools of DNA from mutagenized plants. Because detection is on a gel with near base pair resolution and the background pattern is uniform across lanes, bands of the same size can be matched, and thus SNPs can be discovered and genotyped in one step. In this way, the final sequencing of SNPs is simpler and more efficient due to the fact that an aliquot of the same PCR product used for screening can be subjected to DNA sequencing.

[0242] Grain Processing Due to the thickened aleurone, the rice grain of the invention, and flour and bran therefrom, have an improved nutritional composition. Isolated aleurone tissue should contain low levels of starch and pericarp, and represent the majority of the grain's physiologically useful material for human nutrition. For example, the grain of the invention and / or flour produced therefrom, when compared to the corresponding wild-type grain and / or flour produced therefrom, contains one or more or all of the following, respectively, on a weight basis: i) a higher mineral content, e.g., at least 20% or at least 25% higher, preferably the mineral content being one or more or all of zinc (e.g., at least about 10% or at least about 15% higher), iron (e.g., at least about 10% or at least about 15% higher), potassium (e.g., at least about 20% or at least about 25% higher), magnesium (e.g., at least about 18% or at least about 22% higher), phosphorus (e.g., at least about 17% or at least about 21% higher), and sulfur (e.g., at least about 5% or at least about 8% higher); ii) a higher antioxidant content, e.g., at least about 25%, or at least about 35%, more phenolic compounds, and / or at least about 60%, or at least about 70%, more hydrophilic antioxidants; iii) a higher phytate content, such as at least about 10% or at least about 15% higher; iv) a higher content of one or more or all of vitamins B3, B6 and B9; v) higher dietary fiber and / or insoluble fiber content (e.g., at least about 150% or at least about 180% higher total fiber); vi) a starch content that is about 90% to about 100% by weight relative to the starch content of the corresponding wild-type grain; vii) high sucrose content; viii) higher monosaccharide content (e.g., arabinose, xylose, galactose, glucose content), such as at least about 1.5-fold or at least about 2-fold higher; ix) a higher fat content, such as at least about 20%, at least about 30% or at least about 50%, or about 50% higher; and x) Similar nitrogen levels.

[0243] Each of these nutritional components of grain can be determined using routine techniques such as those outlined in Examples 1 and 5.

[0244] In one embodiment, the rice grain and / or flour produced therefrom of the present invention comprises one or more or all of the following, each by weight; i) at least about 20%, at least about 30%, or at least about 50%, or about 50% more fat when compared to the corresponding wild-type grain / flour; ii) at least about 11 mg / g or at least about 12 mg / g total phytate; iii) at least about 20% or at least about 25% greater mineral content in the flour obtained from the grain when compared to flour from the corresponding wild type grain; iv) at least about 14 mg / kg or at least about 15 mg / kg total zinc; v) at least about 13 mg / kg or at least about 13.5 mg / kg total iron; vi) at least about 150%, or at least about 180% more total fiber when compared to the corresponding wild-type grain / flour; vii) a starch content that is about 90% to about 100% by weight relative to the starch content of the corresponding wild-type grain / flour; viii) at least about 1.5-fold or at least about 2-fold higher monosaccharide content (e.g., arabinose, xylose, galactose, glucose content) when compared to the corresponding wild-type grain / flour; and ix) at least about 25%, or at least about 35% more phenolic compounds, and / or at least about 60%, or at least about 70% more hydrophilic antioxidants when compared to the corresponding wild-type grain / flour.

[0245] In one embodiment, the grain has an increased proportion of amylose in the total starch content compared to the corresponding wild type grain. Methods for producing such grain are described, for example, in WO 2002 / 037955, WO 2003 / 094600, WO 2005 / 040381, WO 2005 / 001098, WO 2011 / 011833 and WO 2012 / 103594.

[0246] In one embodiment, the grain of the invention comprises an increased proportion of oleic acid and / or a decreased proportion of palmitic acid in its total fat content compared to the corresponding wild-type grain. Methods for producing such grains are described, for example, in WO 2008 / 006171 and WO 2013 / 159149.

[0247] The grain / seed of the present invention, or other plant parts of the present invention, may be processed to produce food ingredients, food or non-food products using any technique known in the art.

[0248] As used herein, the term "other food or beverage ingredient" refers to any substance suitable for animal consumption, preferably any substance suitable for human consumption, when provided as part of a food or beverage. Examples include, but are not limited to, grains from other plant species, sugars, etc., but do not include water.

[0249] In one embodiment, the product is a whole grain flour, such as, for example, a superfinely milled whole grain flour, or a flour made from about 100% of the grain. The whole grain flour includes refined flour components (refined flour or refined flour) and a coarse fraction (superfinely milled coarse fraction).

[0250] The refined flour may be a flour prepared, for example, by grinding and bolting washed grains. The grain size of the refined flour is described as a flour that passes 98% or more through a cloth with openings no larger than the openings of a woven wire cloth designated "212 micrometers (USA Wire 70)". The coarse fraction includes at least one of bran and germ. For example, the germ is the embryo of the plant that is within the kernel of the grain. The germ includes lipids, fiber, vitamins, proteins, minerals, and phytonutrients (such as flavonoids). The bran includes several cell layers and has significant amounts of phytonutrients such as lipids, fiber, vitamins, proteins, minerals, and flavonoids. Additionally, the coarse fraction may include the aleurone layer, which also includes lipids, fiber, vitamins, proteins, minerals, and phytonutrients such as flavonoids. Although the aleurone layer is technically considered part of the endosperm, it typically is removed along with the bran and germ during the milling process because it exhibits many of the same characteristics as the bran. The aleurone layer contains proteins, vitamins and phytonutrients such as ferulic acid.

[0251] Furthermore, the coarse fraction can be mixed with refined flour. The coarse fraction can be mixed with refined flour to form whole grain flour, thus providing whole grain flour with improved nutritional value, fiber content and antioxidant capacity compared to refined flour. For example, the coarse fraction or whole grain flour can be used in various amounts to replace refined or whole grain flour in baked products, snack products, and food products. The whole grain flour of the present invention (i.e., ultrafine milled whole grain flour) may be sold directly to consumers for use in their homemade baked products. In an exemplary embodiment, the granulation profile of the whole grain flour is such that 98% of the particles by weight of the whole grain flour are less than 212 micrometers.

[0252] In a further embodiment, the enzymes found in the bran and germ of the whole grain flour and / or the coarse fraction are inactivated to stabilize the whole grain flour and / or the coarse fraction. Stabilization is the process of inactivating the enzymes found in the bran and germ layers using steam, heat, radiation, or other treatments. The stabilized flour retains its cooking properties and has a long shelf life.

[0253] In further embodiments, the whole grain flour, coarse fraction, or refined flour may be a component of a food product or may be used to produce a food product. For example, food products include bagels, biscuits, breads, buns, croissants, dumplings, English muffins, muffins, pita breads, quick breads, frozen / frozen dough products, dough, baked beans, burritos, chili, tacos, tamales, tortillas, pot pies, ready to eat cereal, ready to eat meal, stuffings, microwave meals, brownies, cakes, cheesecakes, coffee cakes, cookies, desserts, pastries, sweet rolls, candy bars, pie crusts, pie fillings, baby foods, baking mixes, batters, bread crumbs, gravy mixes, meat extenders, and the like. extender), meat substitute, seasoning mix, soup mix, gravy, roux, salad dressing, soup, sour cream, noodles, pasta, ramen, chow mein noodles, lo mein noodles, ice cream inclusions, ice cream bars, ice cream cones, ice cream sandwiches, crackers, croutons, donuts, egg rolls, extruded snacks, fruit and grain bars, microwaveable snack products, nutritional bars, pancakes, par baked bakery products, pretzels, puddings, granola based products, snack chips, snack foods, snack mixes, waffles, pizza crusts, animal foods, or pet foods.

[0254] In another embodiment, the whole grain flour, refined powder, or crude fraction may be a component of a dietary supplement. For example, a dietary supplement may be a product that is added to food that contains one or more additional ingredients, typically including vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics, and fiber. The whole grain flour, refined powder, or crude fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber. For example, the crude fraction includes high concentrations of dietary fiber as well as essential nutrients such as B-vitamins, selenium, chromium, manganese, magnesium, antioxidants, etc., that are essential to a healthy diet. For example, 22 g of the crude fraction of the present invention provides 33% of an individual's recommended daily fiber consumption. Dietary supplements may include known nutritional ingredients that aid in the overall health of an individual, examples of which include, but are not limited to, vitamins, minerals, other fiber ingredients, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and / or other nutritional ingredients. The supplements may be provided in the following forms, but are not limited to: instant drink mixes, ready-to-drink beverages, nutritional bars, wafers, cookies, crackers, gel shots, capsules, chews, chewable tablets, and pills. One embodiment provides a fiber supplement in the form of a flavored shake or malt type beverage, which may be particularly attractive as a fiber supplement for children.

[0255] In further embodiments, the milling process can be used to create multi-grain flours or coarse fractions of multiple grains. For example, the bran and germ from one type of grain can be milled and blended with milled endosperm or whole grain flour of another type of grain. Alternatively, the bran and germ from one type of grain can be milled and blended with milled endosperm or whole grain flour of another type of grain. The invention is intended to encompass blending any combination of one or more bran, germ, endosperm, and whole grain flour of one or more grains. This multi-grain approach can create customized flours and utilize the qualities and nutritional content of multiple types of grains to create one flour.

[0256] It is contemplated that the whole grain flour, coarse fraction and / or grain product of the present invention may be produced by any grinding method known in the art. An exemplary embodiment includes grinding the grain in a single stream without separating the endosperm, bran and germ of the grain into separate streams. The washed and tempered grain is conveyed to a first pass grinder, such as a hammer mill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, and the like. After grinding, the grain is discharged and conveyed to a sifter. Additionally, it is contemplated that the whole grain flour, coarse fraction and / or grain product of the present invention may be modified or enhanced by numerous other processes, such as fermentation, instantization, extrusion, encapsulation, toasting, roasting, or the like. EXAMPLES

[0257] Example 1. General Materials and Methods

[0258] Observation of aleurone by staining with Sudan Red solution A staining solution was prepared by adding 1 g of Sudan Red IV to 50 ml of polyethylene glycol solution (average molecular weight 400, Sigma, Cat. No. 202398) incubated at 90°C for 1 h and mixing with an equal volume of 90% glycerol. After removing the pericarp (inner and outer lemma) of each kernel, the mature rice kernels were incubated in distilled water for 5 h and then sectioned transversely or longitudinally using a razor blade. The sections were stained with Sudan Red solution for 24–72 h at room temperature. The sections were then counterstained with Lugol's staining solution (Sigma, 32922) for 20 min at room temperature and observed under a dissecting microscope (Sreenivasulu, 2010).

[0259] Staining of aleurone with Evans Blue Evans blue staining solution was prepared by dissolving 0.1 g of Evans blue (Sigma, E2129) in 100 ml of distilled water. After removing the pericarp (inner and outer lemma) of each kernel, mature rice kernels were cut transversely with a razor blade. The sections were incubated in distilled water for 30 min at room temperature, stain was added, and left at room temperature for 2 min. The staining solution was then discarded and the sections were washed twice with distilled water and observed under a dissecting microscope.

[0260] Optical microscopy of rice endosperm Rice kernels were fixed in formalin-acetic-alcohol (FAA) solution (60% ethanol, 5% glacial acetic acid and 2% formaldehyde), degassed for 1 h, dehydrated in a series of alcohol solutions containing 70%, 80%, 95% and 100% ethanol, infiltrated with LR white resin (Electron Microscopy Sciences, 14380) and polymerized at 60°C for 24 h. Microtome sectioning was performed using a Leica UC7 microtome. Sections were stained with 0.1% Toluidine Blue solution (Sigma, T3260) for 2 min at room temperature, then washed twice with distilled water and examined under a light microscope. Alternatively, sections were stained in 0.01% Calcofluor White solution (Sigma, 18909) for 2 min at room temperature and examined under a light microscope.

[0261] Staining with PAS and Commassie blue Fixed sections on slides were incubated in pre-heated 0.4% periodic acid (Sigma, 375810) for 30 min at 57 °C and then rinsed three times with distilled water. Schiff's reagent (Sigma, 3952016) was applied and slides were incubated at room temperature for 15 min and then rinsed three times with distilled water. Sections were then incubated in 1% Coomassie Blue (R-250, ThermoScientific, 20278) for 2 min at room temperature and rinsed three times with distilled water. Dehydration of sections was accomplished using a series of alcohol solutions with 30%, 50%, 60%, 75%, 85%, 95% to 100% ethanol, followed by clearing each slide in 50% xylene and 100% xylene solutions (Sigma, 534056) for 2 min each. The coverslips were then mounted with Eukitt® quick hardening mounting medium (Fluka, 03989) and the sections were observed under a light microscope.

[0262] DNA extraction and PCR conditions Two methods, modified from Huang (2009), were used for DNA extraction from plant leaf samples: the rapid DNA extraction method, which provides low-purity DNA samples, and the extensive DNA extraction method, which is for high-purity DNA. In the first method, four glass beads (Sigma, 273627) with a diameter of 2 mm, 1–2 mg of rice leaf tissue, and 150 μl of extraction buffer (10 mM Tris, pH 9.5, 0.5 mM EDTA, 100 mM KCl) were added to each well of a 96-well PCR plate. The plate was sealed, and the mixture was homogenized for 1 min using a Mini-Beadbeater-96 mixer (GlenMills, 1001). After centrifugation at 3000 rpm for 5 min, the supernatant containing the extracted DNA was used for the PCR reaction.

[0263] In the second method, two glass beads with a diameter of 2 mm and 0.2 g of leaves were placed in a 1.5 ml Eppendorf tube and cooled in liquid nitrogen for 10 min. The samples were then homogenized in a Mini-Beadbeater-96 for 1 min, then 600 μl of DNA extraction buffer (2% SDS, 0.4 M NaCl, 2 mM EDTA, 10 mM Tris-HCl, pH 8.0) was added to each tube, and the mixture was incubated at 65° C. for 1 h. After the mixture was cooled, 450 μl of 6 M NaCl was added, mixed, and centrifuged at 12000 rpm for 20 min. Each supernatant was transferred to a new tube, and DNA was precipitated with an equal volume of 2-propanol at −20° C. for 1 h. DNA was recovered by centrifugation at 2400 rpm at 4° C. for 20 min, and the pellet was washed twice with 75% ethanol. The pellets were air-dried at room temperature and resuspended in 600 μl of distilled water containing 10 ng / μl RNAse (ThermoScientific, EN0201) each and used in PCR reactions.

[0264] PCR reactions were performed using 5 μl of 2xPCR buffer containing Taq polymerase (ThermoScientific, K0171), 5' and 3' oligonucleotide primers, and 1 μl of DNA sample in a total volume of 10 μl. Amplification was performed using 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s. Amplification products were analyzed by gel electrophoresis using 3% agarose gels. Control PCR reactions used DNA preparations from homozygous Zhonghua11 (ZH11) (wild-type japonica rice), homozygous NJ6 (wild-type indica rice), and a mixture of ZH11 and NJ6.

[0265] For genetic mapping of the ta2 allele, PCR amplification of the genetic marker used the following primer pairs (5'-3' sequences): INDEL 127 (position 6,343,260 on chromosome 1), forward primer TGAGTAGTTGCGTTGTTCT (SEQ ID NO: 15), reverse primer TCTTAGTGAGCCGTTTCT (SEQ ID NO: 16); INDEL 129 (position 6,560,681 on chromosome 1), forward primer CCTTCTGTGCTATGGGTT (SEQ ID NO: 17), reverse primer CATGCCAAGACACCACTT (SEQ ID NO: 18); INDEL 128 (position 6,470,027 on chromosome 1), forward primer TGGCTTTGGAAACGGTAG (SEQ ID NO: 19), reverse primer TTTAGAGGGATGTGCGTCA (SEQ ID NO: 20); INDEL 149 (position 6,427,144 on chromosome 1), forward primer AAACAACGATCCAGCAAA (SEQ ID NO:21), and reverse primer TTGGCACCGTATTACTTTC (SEQ ID NO:22).

[0266] TILLING analysis The primers used in the TILLING analysis had the following nucleotide sequences: TA2-1F: ACGCATTCTTCATTGACTGTATGT (SEQ ID NO: 23) TA2-1R: GCCCTTTCAATACAATGACTAGGT (SEQ ID NO: 24) TA2-2F: GAACATTTGAATCATGTTCCTCAC (SEQ ID NO: 25) TA2-2R: ACTATCCTTTGATGCAAGTTCTCC (SEQ ID NO: 26) TA2-3F: GTTGGAAGAGCAGTTAAAGCAAAT (SEQ ID NO: 27) TA2-3R: CTTCGGCAGTGAAATTTAGTAACA (SEQ ID NO: 28) TA2-4F: TACAGAACTTCTACGAATGCAGGA (SEQ ID NO: 29) TA2-4R: GCAACATGAATTGCTAAAGATGAG (SEQ ID NO: 30).

[0267] PCR amplification with ExTaq was performed under the following reaction conditions: 95° C. for 2 min; 8 cycles of 94° C. for 20 s, 68° C. for 30 s (1° C. decrement per cycle), and 72° C. for 60 s per 1 kb of amplicon length, followed by 35 cycles of 94° C. for 20 s, 60° C. for 30 s, and 72° C. for 60 s per 1 kb of amplicon length, and a final extension of 5 min at 72° C. PCR products from wild-type and test samples were mixed and subjected to a complete denaturation-slow annealing program to form heteroduplexes under the following conditions: denaturation at 99° C. for 10 min, followed by 70 cycles of decrements at 70° C. for 20 s with a decrement of 0.3° C. per cycle, followed by a hold at 15° C. to allow reannealing of the denatured PCR products to form heteroduplexes. CelI digestion of the annealed PCR products was carried out at 45°C for 15 min in a 15 μL reaction mixture containing CelI buffer (10 mM HEPES, pH 7.5, 10 mM KCl, 10 mM MgSO4, 0.002% Triton X-100, and 0.2 μg / mL bovine serum albumin (BSA), 4 μL of PCR product, and 1 unit of CelI (10 units / μL) if the PCR product was polymerized by Ex Taq or 20 units of CelI if the PCR product was polymerized by KOD), followed by addition of 3 μL of 0.5 M EDTA (pH 8.0) to stop the reaction. Alternatively, digestion was carried out in a 15 μL reaction mixture containing 4 μL of PCR product and 2 units of mung bean nuclease (MBN, 10 units / μL, Cat. No. M0250S; New England Biolabs, USA) in MBN buffer (20 mM Bis-Tris, pH 6.5, 10 mM MgSO4, 0.2 mM ZnSO4, 0.002% Triton X-100, and 0.2 μg / mL BSA) at 60° C. for 30 min, followed by addition of 2 μL of 0.2% SDS solution to stop the reaction.

[0268] The CeI digested PCR products in a 96-well PCR plate were diluted to 100 μL with deionized water and capillary electrophoresis was performed on an AdvanCE™ FS96 instrument (Advanced Analytical Technologies, USA) at 9 kV with a 30 s pre-run, 15 s injection of 1 ng / μL molecular weight markers 75 and 15 kb or 50 and 3 kb dsDNA (Fermentas, Canada), 45 s sample injection, and 40 min sample separation. Gel images were collected and analyzed using PROSize software for capillary electrophoresis (Advanced Analytical Technologies, USA).

[0269] DNA glycosylase (DME) enzyme analysis Demeter (DME) is a bifunctional DNA glycosylase / lyase with activity towards 5-methylcytosine substrates. Plants have 5-methylcytosine in three sequence contexts: CpG, CpNpG, and CpNpN, and DME has activity towards 5-methylcytosine in each of these sequence contexts. In an enzymatic assay performed in vitro, cleavage of the phosphodiester bond 5' to the methylated cytosine was detected, resulting in a delta-elimination product. Treatment of the DNA reaction products with a strong base (NaOH) prior to gel electrophoresis confirmed the delta-elimination process at the predicted position.

[0270] Synthetic oligonucleotides used as substrates in the enzyme assays were synthesized as follows, with the nucleotide modifications indicated in brackets: MEA-1.6F, 5'-CTATACCTCCTCAACTCCGGTCACCGTCTCCGGCG (SEQ ID NO:31) MEA-1.6F18meC, 5'-CTATACCTCCTCAACTC(5-meC)GGTCACCGTCTCCGGCG (SEQ ID NO:32) MEA-1.6F17meC, 5'-CTATACCTCCTCAACT(5-meC)CGGTCACCGTCTCCGGCG (SEQ ID NO:33) MEA-1.6F22meC, 5'-CTATACCTCCTCAACTCCGGT(5-meC)ACCGTCTCCGGCG (SEQ ID NO:34) MEA-1.6F18AP, 5'-CTATACCTCCTCAACTC(abstract)GGTCACCGTCTCCGGCG (SEQ ID NO:35) MEA-1.6F17AP, 5'-CTATACCTCCTCAACT(abstract)CGGTCACCGTCTCCGGCG (SEQ ID NO:36) MEA-1.6F15AP, 5'-CTATACCTCCTCAA(abstract)TCCGGTCACCGTCTCCGGCG (SEQ ID NO:37) MEA-1; 6F12AP, 5'-CTATACCTCCT(abstract)AACTCCGGTCACCGTCTCCGGCG (SEQ ID NO:38) MEA-1.6F18T, 5'-CTATACCTCCTCAACTCTGGTCACCGTCTCCGGCG (SEQ ID NO:39) MEA-1.6R, 5'-CGCCGGAGACGGTGACCGGAGTTGAGGAGGTATAG (SEQ ID NO: 40) MEA-1.6R17meC, 5'-CGCCGGAGACGGTGAC(5-meC)GGAGTTGAGGAGGTATAG (SEQ ID NO:41).

[0271] 20 pmol of each oligonucleotide was end-labelled in a 50 μL reaction at 37° C. for 1 min using 20 units of T4 polynucleotide kinase in the presence of 30 μCi of (γ-32P)-ATP (6000 Ci / mmol, Perkin Elmer Life Sciences). Each labelled oligonucleotide was purified using a Qiaquick Nucleotide Removal Kit (Qiagen) according to the manufacturer's instructions. The labelled oligonucleotide was annealed to the appropriate complementary oligonucleotide in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA and 0.1 M NaCl. Each mixture was heated at 100° C. for 10 min and then slowly cooled to room temperature overnight. Annealing efficiency was determined using MspI or HpaII restriction endonuclease digestion followed by gel electrophoresis. Only substrates that were greater than 90% double-stranded were used in glycosylase activity analysis.

[0272] 5'-labeled oligonucleotide substrate (13.3 nM) was incubated with DME protein (250 nM) and 200 mg / ml BSA in a 15 ml reaction containing 40 mM HEPES-KOH (pH 8.0), 0.1 M KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol, and 200 mg / ml KCl for 1 h at 37°C. The reaction was stopped with 15 ml of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF, and boiled for 5 min. To induce removal, NaOH was added to a final concentration of 0.1 M, and the reaction was boiled for 7 min. Products were fractionated on a 15% polyacrylamide gel containing 7.5 M urea and 1x TBE. Electrophoresis was performed at 1000 V for 4 h using a Hoefer SQ3 gel apparatus. Gels were exposed to Kodak BioMax MR film at -80°C.

[0273] Analysis method Proximate and other major components in grains, food ingredients and food samples were determined using standard methods, e.g. as follows:

[0274] Grain moisture content was measured according to the Association of Official Analytical Chemists (AOAC) method 925.10. Briefly, grain samples (~2 g) were dried in an oven at 130 °C for approximately 1 h to constant weight.

[0275] Ash content was determined according to AOAC method 923.03. Samples used for moisture determination were ashed in a muffle furnace at 520°C for 15 hours.

[0276] Protein content of grains, food ingredients and food samples Protein content was measured according to AOAC method 992.23. Briefly, total nitrogen was analyzed by the Dumas combustion method using an automated nitrogen analyzer (Elementar Rapid N cube, Elementar Analysensysteme GmbH, Hanau, Germany). The protein content of grain or food samples (g / 100g) was estimated by multiplying the nitrogen content by 6.25.

[0277] Sugars, starches and other polysaccharides Total starch content was determined according to AOAC method 996.11 using the enzymatic method of McCleary et al. (1997).

[0278] The amount of sugars was measured according to AOAC Method 982.14. Briefly, monosaccharides were quantified by extraction of simple sugars with aqueous ethanol (80% ethanol) and HPLC using a polyamine-bonded polymer gel column with acetonitrile:water (75:25 v / v) as the mobile phase and an evaporative light scattering detector.

[0279] Total neutral non-starch polysaccharides (NNSPs) were determined by the gas chromatographic procedure of Theander et al. (1995) with minor modifications, including hydrolysis with 1 M sulfuric acid for 2 h followed by centrifugation.

[0280] Fructan (fructooligosaccharides) were analyzed as detailed in AOAC method 999.03. Briefly, fructooligosaccharides were extracted in water and subsequently digested with a sucrase / maltase / invertase mixture. The resulting liberated sugars were then reduced with sodium borohydride and digested to fructose / glucose with fructanase. The released fructose / glucose was measured using p-hydroxybenzioic acid hydrazine (PAHBAH).

[0281] Fiber Content Total dietary fiber (TDF) was measured according to AOAC Methods 985.29 and 991.43, and soluble and insoluble dietary fiber (SIF) was measured according to AOAC Method 991.43. Briefly, TDF was determined gravimetrically by Prosky et al. (1985) as detailed in AOAC Method 985.29, and SIF was determined gravimetrically as described in AOAC Method 991.43.

[0282] Total Fat 5 g of powdered sample was incubated with 1% Clarase 40000 (Southern Biological, MC23.31) for 1 hour at 45°C. Lipids were extracted from the sample by multiple extractions into chloroform / methanol. After centrifugation to separate the phases, the chloroform / methanol fraction was removed and dried at 101°C for 30 minutes to recover lipids. The bulk of the residue represents the total lipids in the sample (AOAC method 983.23).

[0283] Lipid fatty acid profile Lipids were extracted from the ground powder into chloroform according to AOAC method 983.23. After adding an aliquot of heptadecanoic acid as an internal standard, a portion of the chloroform fraction containing lipids was evaporated under a stream of nitrogen. The residue was suspended in dry methanol, 1% sulfuric acid, and the mixture was heated at 50°C for 16 h. The mixture was diluted with water and extracted twice with hexane. The combined hexane solution was loaded onto a small column of Florisil, the column was washed with hexane, and the fatty acid methyl esters were then eluted with 10% ether in hexane. The eluate was evaporated to dryness and the residue was dissolved in isooctane and injected into the GC. The fatty acid methyl esters were quantified against a mixture of standard fatty acids. GC conditions: Column SGE BPX70 30m x 0.32mm x 0.25um; injection 0.5μL; injector 250°C; 15:1 split; flow rate 1.723ml / min constant flow; oven 150°C 0.5min, 10°C / min to 180°C, 1.5°C / min to 220°C, 30°C / min to 260°C (total run time 33min); detector FID 280°C.

[0284] Antioxidant activity (ORAC-H) Hydrophilic antioxidant activity (ORAC-H) was determined according to the method of Huang (2002a and 2002b) with modifications as described in Wolbang et al. (2010). Samples were extracted for lipophilic antioxidants followed by hydrophilic antioxidant extraction as follows: 100 mg of sample was weighed in triplicate into 2 mL microtubes. Then 1 mL hexane:dichloromethane (50:50) was added, mixed vigorously for 2 min, and centrifuged at 13,000 rpm at 10 °C for 2 min. The supernatant was transferred to a glass vial and the pellet was re-extracted with an additional 2 mL of hexane:dichloromethane mixture. The mixing and centrifugation steps were then repeated and the supernatant transferred to the same glass vial. Residual solvent from the pellet was evaporated under a gentle stream of nitrogen. 1 mL of acetone:water:acetic acid mixture (70:29.5:0.5) was added followed by vigorously mixing for 2 min. The mixtures were then centrifuged as described above and the supernatants were used for ORAC-H plate analysis. Samples were diluted as necessary with phosphate buffer. Areas under the curve (AUC) were calculated and compared to the AUC values ​​of Trolox standards. ORAC values ​​are reported as uM Trolox equivalents / g of sample.

[0285] Phenols Total phenolic content as well as free, conjugated and bound phenolic content were extracted and measured according to a slightly modified method described by Li et al. (2008). Briefly, free phenols were measured in 100 mg samples after extraction in 2 mL of 80% methanol with 10 min of sonication in glass vials (8 mL volume). The supernatant was transferred to a second glass vial and the extraction of the residue was repeated. The combined supernatants were evaporated to dryness under nitrogen. The pH was adjusted to approximately 2 by adding 2 mL of acetic acid (2%), and then 3 mL of ethyl acetate was added to extract the phenols with shaking for 2 min. The vials were centrifuged at 2000×g for 5 min at 10°C. The supernatant was transferred to a clean glass vial and the extraction was repeated two more times. The combined supernatants were evaporated under nitrogen at 37°C. The residue was dissolved in 2 mL of 80% methanol and refrigerated.

[0286] The conjugated phenol samples were treated similarly to the free phenol analysis for the initial 80% methanol extraction. At this point, 2.5 mL (2M) sodium hydroxide and a magnetic bar were added to the evaporated supernatant in a glass vial, which was then flushed with nitrogen and tightly capped. The vial was mixed and heated at 110°C with stirring for 1 hour. The sample was cooled on ice and then extracted with 3 ml ethyl acetate and shaken for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10°C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12M HCl. Phenols were extracted with 3 x 3 mL aliquots of ethyl acetate as described for free phenols. The supernatants were combined and evaporated to dryness under nitrogen at 37°C, and the residue was dissolved in 2 mL 80% methanol and refrigerated.

[0287] Bound phenols were measured from the residue after methanol extraction of free phenols. To the residue was added 2.5mL (2M) sodium hydroxide and a magnetic bar, the vial was flushed with nitrogen and sealed. The vial was mixed and heated at 110°C with stirring for 1 hour. The sample was cooled on ice and extracted with 3mL ethyl acetate, then shaken for 2 minutes. The vial was centrifuged at 2000xg for 5 minutes at 10°C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12M HCl. Phenols were extracted with 3x3mL aliquots of ethyl acetate as described for free phenols. The supernatants were combined and evaporated to dryness under nitrogen at 37°C, and the residue was dissolved in 2mL 80% methanol and refrigerated.

[0288] Total phenolics were measured using 100 mg samples by adding 200 μL of 80% methanol to wet the sample prior to hydrolysis. 2.5 mL (2 M) sodium hydroxide and a magnetic bar were added and the vial was flushed with nitrogen and tightly capped. The vial was mixed and heated at 110° C. for 1 hour with stirring. The sample was cooled on ice and extracted with 3 mL of ethyl acetate followed by shaking for 2 minutes. The vial was centrifuged at 2000×g for 5 minutes at 10° C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12 M HCl. Phenols were extracted with 3×3 mL aliquots of ethyl acetate as described for free phenol. The supernatants were combined and evaporated to dryness under nitrogen at 37° C. and the residue was dissolved in 4 mL of 80% methanol and refrigerated.

[0289] For the determination of phenols, Folin Ciocalteu analysis was used to determine the amount of phenols in the treated / extracted samples. A standard curve was generated using gallic acid standards of 0, 1.56, 3.13, 6.25, 12.5 and 25 μg / mL. 1 mL of the standard was added to a 4 mL glass tube. For the test samples, a 100 μL aliquot of the thoroughly mixed sample was added to 900 μL of water in a 4 mL glass tube. 100 mL of Folin Ciocalteu reagent was then added to each tube, which was immediately vortexed. 700 μL of sodium bicarbonate solution (1 M) was added after 2 minutes and then mixed by vortexing. Each solution was incubated at room temperature in the dark for 1 hour, and then the absorbance was read at 765 nm. Results were expressed as μg gallic acid equivalents / g sample.

[0290] Phytic Acid Measurement of the phytic acid content of powder samples was based on the method of Harland and Oberleas, as described in the AOAC Official Methods of Analysis (1990). Briefly, 0.5 g of powder sample was weighed and extracted with 2.4% HCl using a rotating wheel (30 rpm) for 1 h at room temperature. The mixture was then centrifuged at 2000×g for 10 min, and the supernatant was extracted and diluted 20-fold with milli-Q water. An anion exchange column (500 mg Agilent Technologies) was placed on a vacuum manifold and conditioned according to the manufacturer's instructions for use. The diluted supernatant was then loaded onto the column, and non-phytate species were removed by washing with 0.05 M HCl. Phytic acid was then eluted with 2 M HCl. The collected eluate was digested using a heating block. The sample was cooled and the volume was made up to 10 mL with milli-Q water. Phosphorus levels were measured spectrophotometrically using a molybdate, sulfonic acid color method with absorbance measurements at 640 nm. Phytic acid was calculated using the following formula:

[0291] Phytic acid (mg / g) = P conc*V1*V2 / (1000*sample weight*0.282) (In the formula, Pcon is the phosphorus concentration (μg / mL) measured spectrophotometrically, V1 is the volume of the final solution, V2 is the volume of the extracted phytic acid solution, and 0.282 is the conversion ratio of phosphorus to phytic acid.

[0292] Total Mineral Content Measurement The total mineral content of the samples was determined by ash analysis using AOAC methods 923.03 and 930.22. Approximately 2 g of powder was heated at 540°C for 15 h and then the mass of ash was weighed. 0.5 g of the total powder sample was digested at 140°C for 8 h using a tube block digestion with 8M nitric acid. Zinc, iron, potassium, magnesium, phosphorus and sulfur contents were analyzed using inductively coupled plasma atomic emission spectrometry (ICP-AES) according to the method described by Zarcinas (1983a and 1983b).

[0293] Minerals were analysed at CSIRO, Urbrae, Adelaide, South Australia, by Waite Analytical Service (University of Adelaide, Waite, South Australia) and Dairy Technical Services (DTS, North Melbourne, Victoria). Elements were measured by inductively coupled plasma atomic emission spectrometry (ICP-OES) after digestion with nitric acid solution (CSIRO) or dilute nitric acid and hydrogen peroxide (DTS), or by inductively coupled plasma atomic emission spectrometry (ICP-AES) after digestion with nitric acid / perchloric acid solution.

[0294] Vitamins Vitamin B1 (niacin), B3 (pyridoxine) and total folate analyses were performed by DTS and the National Measurement Institute (NMI). Niacin was measured by AOAC method 13th edition (1980) 43.045 according to Lahey et al. (1999). Pyridoxine was measured according to Mann et al. (2001). This method incorporated pre-column conversion of phosphorylated and free vitamin B6 forms to pyridoxine (pyridoxalol). Acid phosphatase hydrolysis was followed by dephosphorylation and subsequent Fe 2+ Pyridoxamine was converted to pyridoxal by deamination with glyoxylic acid in the presence of 1,2-dichlorophenyl ether, which was then reduced to pyridoxine by sodium borohydride.

[0295] Folate was measured using the VitaFast folate kit according to the manufacturer's instructions or according to AOAC method 2004.05.

[0296] Example 2. Isolation and characterization of thickened aleurone (ta) mutants

[0297] Establishment and cultivation of mutant rice populations Approximately 8000 kernels (referred to as M0 kernels) from the wild-type rice cultivar Zhonghua11 (ZH11) were mutagenized by treatment with 60 mM ethyl methanesulfonate (EMS) using standard conditions. The mutagenized kernels were sown in the field and the resulting plants were cultivated to produce M1 kernels. The M1 kernels were harvested and sown in the field to generate M1 plants. 8925 solid panicles were harvested from 1327 solid M1 plants. From these plants, 36,420 M2 kernels were screened, and at least four kernels were obtained from each panicle.

[0298] Mutation screening by staining half kernels The pericarp (inner and outer lemma) of M2 rice kernels was removed. Each of the 36,420 kernels was bisected transversely. The half containing the embryo was kept in a 96-well plate for subsequent germination, and each half kernel without the embryo was stained with Evans Blue and observed under a dissecting microscope to detect mutant kernels with thickened aleurone relative to the wild type. This staining follows the principle that Evans Blue can only penetrate and stain non-viable cells, such as cells of the starchy endosperm, and no color change is observed in the viable aleurone layer. From the initial Evans Blue staining and histological analysis, individual kernels showing a significant increase in aleurone thickness were observed, as well as kernels showing a significant thickening in the aleurone on the ventral side of the seed. Other kernels showed an increase in aleurone thickness, but to a lesser extent. The unstained area on the ventral side of each seed was examined, especially for the thickness of the aleurone layer. Mutants with an increase in the thickness of the aleurone layer on the dorsal side of the kernel were also observed. Only mutants that had significantly increased aleurone layer thickness across the entire cross section were selected for further analysis.

[0299] Half kernels with thicker non-stained areas by Evans blue were selected compared to wild-type half kernels. Of the 36,420 kernels examined, 219 kernels (0.60%) were identified and selected that had differences in aleurone thickness. These were obtained from 162 ears derived from 140 solid M1 plants, the majority of which were independent mutants. One mutant kernel in particular was identified and further characterized as described below, carrying a mutation designated thick-aleurone 2 (ta2). The corresponding wild-type gene was therefore designated Ta2; that designation will be used herein.

[0300] To maintain the putative mutant lines, each corresponding embryonic half-kernel was germinated on medium solidified with 1% Bacto agar (Bacto, 214030) containing half-strength MS salts medium (Murashige and Skoog, 1962) and cultured at 25°C under light intensity of 1500-2000 Lux and a 16-h light / 8-h dark cycle. Plantlets were transferred to soil at the 2-3 leaflet stage and the resulting plants were grown to maturity. Upon germination and culture of the corresponding embryonic half-kernels, 115 seeds (52.5% viable) were cultivated to obtain mature and fruit-bearing plants.

[0301] Candidate mutant plants that showed little or no defects in general agronomic characters such as normal plant height, fruit set (fertility of stamens and pistils), kernel size and 1000 kernel weight relative to the wild-type parental cultivar, as well as stable inheritance of thickened aleurone character, were identified, selected and further analyzed. Among them, a mutant named ta2, which showed a more extreme multiple aleurone phenotype of 6-7 cell layers, was selected and analyzed in detail. Wild-type grains showed one cell layer of aleurone as expected.

[0302] Histological analysis of ta2 mutant kernels The development of grains from wild-type ZH11 and ta2 mutant plants was investigated and compared for morphological changes from 1 to 30 days after pollination (DAP). The ripening stage of rice grains can be described as having three stages: milk grain stage, dough grain stage, and mature grain stage. During the dough grain stage, grains from wild-type ears begin to change from green to yellow as the vesicular tissue connecting the stem and caryopsis is gradually destroyed. Grains from ta2 ears showed a delayed color change. Microscopic examination of rice grain cross sections also showed an increase in the chalkiness (opacity) of ta2 mutant grains. The structure of starch granule tissue in the middle part of the starchy endosperm was then investigated using scanning electron microscopy (SEM). In wild-type kernels, the starch granules were tightly packed, exhibiting a smooth surface and regular shape, whereas in ta2 kernels, irregularly shaped starch granules were observed to be loosely packed. In summary, at least three changes were observed in plants and kernels carrying the ta2 mutation: delayed grain maturation, grain milkiness, and increased starch granule structure.

[0303] Developing mutant and wild-type grains at 6, 7, 8, 9, 10, 12, 15, 18, 21, 24, 27, and 30 DAP were stained with Evans blue and the aleurone layer was examined by light microscopy. No significant difference was observed in the thickness of the developing aleurone layer between the wild type and the ta2 mutant up to 10 DAP. After 10 DAP, the aleurone layer of the ta2 mutant was thicker than that of the wild-type grains, and the difference reached a maximum at approximately 20 DAP. These results were consistent with those by Sudan Red staining.

[0304] Wild-type and ta2 mutant grains (30 DAP) were further examined for histological differences by sectioning (1 μm), staining, and light microscopy. After staining with 0.1% toluidine blue, which stains nucleic acids blue and polysaccharides purple, a single layer of large, regularly oriented, oblong cells was observed in wild-type grains. In contrast, sections of ta2 mutant grains had an aleurone layer of 6-8 cell layers, whose cells also had various sizes and irregular orientations. These observations indicated that the thickened aleurone in ta2 grains was caused primarily by an increase in cell number rather than an increase in individual aleurone cells.

[0305] Further staining with 0.01% Calcoflour White, a fluorescent cell wall stain, showed no difference in cell wall thickness between wild-type and ta2 mutant kernels: the cell walls of the aleurone cells were thicker than those of the starchy endosperm for both wild-type and ta2 kernels.

[0306] Analysis of agronomic traits of ta2 mutant plants and grains After backcrossing to wild-type (ZH11) plants for three generations in the field to obtain the BC3F3 generation, thereby eliminating additional, unrelated mutations that may have arisen from the mutagenesis treatment, the ta2 mutant plants were analyzed for several agronomic traits. The ta2 mutant and grains were not significantly different in plant height, 1000 kernel weight, kernel size (length, width and thickness) and caryopsis morphology compared to the wild-type plants and grains (Table 2). In contrast, the wild-type plants showed a seed set rate of 98.9%, while the ta2 mutant plants showed reduced seed set rate at 73.4%. Seed set rate was calculated as the percentage of the plant's florets filled with seeds at the mature kernel stage. Furthermore, when cultured at 28°C in a growth chamber with a 12-h light / 12-h dark cycle and no humidity control, ta2 mutant kernels showed a reduced germination capacity of 75.1%, compared to 97.3% for wild-type kernels (germination was defined as when the root became visible through the seed coat).

[0307] Example 3. Genetic analysis of ta2 mutants

[0308] To determine whether the thick aleurone phenotype was maternally determined based on the origin of the aleurone and endosperm tissue material in the developing plant, two genetic experiments were performed. First, test crosses were performed between maternal ta2 (mutant) plants and paternal wild-type plants to obtain F2 progeny grains. Of the F2 grains, 49.4% (n = 634) exhibited a thickened aleurone phenotype, which deviated significantly from the 3:1 (wild-type:mutant) ratio predicted for Mendelian inheritance of dominant genes in the F2 population. Second, reciprocal crosses were performed between ta2 and wild-type plants. All F1 seeds (100%; n = 589) exhibited a thickened aleurone phenotype, whereas in reciprocal crosses with wild-type as the maternal line, all F1 seeds (n = 197) produced the wild-type phenotype. These crosses indicated that the aleurone phenotype was determined by the maternal plant genotype.

[0309] Table 2. Comparison of wild type (ZH11) and ta2 mutant plants for agronomic traits. [Table 2]

[0310] To determine whether the maternal effect was determined by gametophytic or sporophytic genotype, heterozygous Ta2 / ta2 F1 plants, obtained from crosses between homozygous Ta2 / Ta2 and homozygous ta2 / ta2 plants, were used in reciprocal crosses with either ta2 homozygotes (ta2 / ta2) or wild-type plants. In reciprocal crosses between maternal heterozygotes and paternal wild-type, 47.3% (n = 188) of F1 kernels showed the ta2 mutant phenotype, whereas in reciprocal crosses between maternal ta2 plants and paternal heterozygotes, 99.3% (n = 425) of F1 individuals showed the ta2 mutant phenotype. From these results, it was concluded that the TA2 gene conferred the phenotype through a gametophytic, maternal mode of inheritance.

[0311] The above genetic analysis allows us to propose a model of ta2 inheritance according to the maternal inheritance pattern of gametophyticity. When the genotype of the maternal gametophyte is ta2, the endosperm phenotype is mutant ta2 (thickened aleurone), independent of the paternal genotype. Thus, the thick aleurone phenotype is determined solely by the genotype of the maternal gametophyte during triploid starchy endosperm and aleurone development, with maternal heterozygosity resulting in 50% of offspring with the thick aleurone phenotype, independent of the paternal genotype, and maternal ta2 / ta2 homozygosity resulting in 100% of offspring with the thick aleurone phenotype. Further experiments are needed to test whether the gametophytic maternal effect of TA2 is caused by the presence of an additional copy of the maternal gene in the triploid endosperm or by the effect of gene implicating by the maternal gamete, suppressing the expression of the paternal TA2 gene.

[0312] Example 4. Identification of the Ta2 gene by genetic mapping and sequence analysis

[0313] Identification and use of SSR and INDEL markers for genetic mapping For gene mapping, an F2 population of plants was generated from a genetic cross between plants containing the ta2 mutation in the genetic background of ZH11 (a japonica cultivar) and plants of the indica cultivar NJ6. To identify genetic markers that were polymorphic between ZH11 and NJ6 and could be used for gene mapping, a series of PCR experiments were performed on leaf DNA samples from homozygous ZH11 plants, homozygous NJ6 plants, and a 1:1 mixture of DNA. Analysis of the PCR products by gel electrophoresis allowed the comparison of products from ZH11, NJ6, and the mixture to identify polymorphic markers. Primer pairs were selected for gene mapping only if amplification with separate ZH11 and NJ6 DNA showed distinct amplification products and the mixed DNA showed a combination of both products. A total of 124 primer pairs were selected, including 54 insertion-deletion polymorphisms (INDELs) and 70 short sequence repeat (SSR) polymorphisms. These genetic markers were distributed at intervals of approximately 3–4 Mbp along the rice genome, providing good coverage for gene mapping.

[0314] For genetic mapping of the ta2 allele, 143 plants from the F2 population were scored with 124 polymorphic markers. Mapping of aleurone phenotypes Homozygosity of individual F2 plants in the population was carefully evaluated by the phenotype of F3 progeny grains obtained from each F2 plant. Leaf DNA was extracted as described in Example 1. PCR amplification was performed as described in Example 1, and products were separated by gel electrophoresis in 3% agarose. From the results, it was concluded that the ta2 locus is located between INDEL 127 and INDEL 129 markers on chromosome 1 from the rice genome sequence, which corresponds to a physical distance of approximately 217 kb (Figure 1, top line).

[0315] Another 5000 F2 plants were screened with this pair of markers. 362 individuals that showed recombination between INDEL 127 and INDEL 129 were identified and selected. When these recombinant plants were phenotyped, the ta2 locus was mapped to a 42.8 kb region located between the INDEL149 and INDEL128 markers (Figure 1, row 2).

[0316] To obtain the nucleotide sequence of this region in ta2 mutant plants and compare it to the wild type, thereby identifying the mutation corresponding to ta2, primers flanking the genomic region were designed and DNA sequencing was performed. Comparison of the genomic DNA sequences identified two single nucleotide polymorphisms (SNPs) within the sequenced region, both in the gene annotated as LOC_01g11900. The first was a single nucleotide G (wild type) to A (ta2) polymorphism at nucleotide position Chr1: 6451738, located in intron 14 between exon 14 and exon 15 of gene LOC_01g11900 on chromosome 1 (asterisk in Figure 1), referencing the rice genome sequence of the japonica variety. The second polymorphism was a G (wild type) to A (ta2) polymorphism at nucleotide position Chr1: 6452308, located in the intronic region between exon 15 and exon 16 (intron 15) of gene LOC_01g11900 on chromosome 1.

[0317] Upon RNA extraction, reverse transcription and sequencing of the cDNA corresponding to the ta2 allele, it was observed that the first G to A polymorphism at Chr1:6451738 was associated with an insertion of 21 bp (Figure 2) between exons 14 and 15, corresponding to an in-frame insertion of 7 amino acids in the predicted amino acid sequence (Figure 3). In contrast, there was no change in the cDNA sequence of the mutation between exons 15 and 16, corresponding to the second polymorphism at the Chr1:6452308 locus. From these data, it was concluded that the first polymorphism in intron 14 was responsible for the change, i.e., the ta2 mutation in the kernel. This conclusion was confirmed in the following examples. It was concluded that this mutation also results in an altered splicing pattern of the RNA transcript of the ta2 gene compared to the wild-type Ta2 gene, thereby causing the ta2 phenotype. From the ratio of the number of cDNAs with the 21-nucleotide insertion to the number of cDNAs lacking the insertion, we estimated that approximately 80% of the RNA transcripts derived from the ta2(mutant) gene were spliced ​​at the newly created splice site. Assuming that the mutant polypeptide with the 7-amino acid insertion was inactive, we concluded that the mutant ta2 gene retained approximately 20% of the activity relative to the wild type.

[0318] The gene at LOC_01g11900 on chromosome 1 of the rice genome has been annotated as the rice ROS1a gene (OsROS1a), a homolog of the Arabidopsis thaliana Demeter gene (AtDME), which encodes a bifunctional DNA glycosylase / lyase. The Arabidopsis DME enzyme acts as a DNA demethylase, reducing the methylation of C residues in DNA. Thus, the Ta2 gene is synonymous with the homolog of the OsROS1a gene and the Arabidopsis DME gene.

[0319] The nucleotide sequence of the rice ROS1a gene is shown in SEQ ID NO:9, which includes a promoter and 5-UTR (untranslated region) of 4726 nucleotides, a protein coding region from 4727 to 15869 nucleotides including 16 introns, and a 3'UTR of 615 nucleotides. The nucleotide positions of the 16 introns are shown in the legend to SEQ ID NO:9. SEQ ID NO:9 also includes a downstream region of 401 nucleotides at its 3' end that is not believed to be part of the OsROS1 gene. The nucleotide sequence of the cDNA corresponding to the wild-type OsROS1 gene is provided in SEQ ID NO:8, and the encoded polypeptide of 1952 amino acids is provided as SEQ ID NO:2.

[0320] Rice has four ROS1 genes that encode polypeptides named OsROS1a, OsROS1b (LOC_Os02g29230), OsROS1c (LOC_Os05g3735) and OsROS1d (LOC_Os05g37410). Rice also has two other Demeter homologs that are thought to encode DNA glycosylases, namely Demeter-like-2 (DML2) and Demeter-like-3 (DML3).

[0321] Elucidation of structural features of the wild-type rice TA2 polypeptide. After finding that the rice TA2 gene was identical to OsROS1a, the amino acid sequence of the OsTA2 (OsROS1) polypeptide was examined. Several typical DNA glycosylase structural features were identified. The glycosylase domain of the ROS1 protein has at least three identified motifs that are conserved enough to be recognizable: a helix-hairpin-helix (HhH) motif (e.g., represented by amino acids 1491-1515 in OsTA2), a glycine / proline-rich motif followed by a conserved aspartic acid (GPD), and four conserved cysteine ​​residues to hold the [4Fe-4S] cluster in place (e.g., in the region of amino acids 1582-1598). A lysine-rich domain (e.g., represented by amino acids 87-139 in OsTA2) was also present. Unlike other members of the HhH DNA glycosylase superfamily, members of the ROS1 family contain two additional conserved domains (domains A and B) adjacent to the central glycosylase domain (Mok et al., 2010). In the rice TA2 polypeptide (SEQ ID NO:2), domain A resides at amino acids 859-965, the glycosylase domain resides at amino acids 1403-1616, and domain B resides at amino acids 1659-1933. Domain A contains a repeated mixed charge cluster at amino acids 882-892. As shown by mutagenesis analysis (Mok et al., 2010), the conserved DNA glycosylase domain and the adjacent domains A and B of AtDME have been reported to be necessary and sufficient for DNA glycosylase / lyase enzymatic activity.

[0322] Example 5. Analysis of nutritional components in ta2 mutant grain

[0323] To determine the composition of the mutant kernels, especially those of nutritional importance, ZH11 and ta2 plants were grown in the field for the same time and under the same conditions. Whole kernel flour samples were prepared from the kernels harvested from the plants and used for compositional analysis. The results of the proximate analysis of the powders (means of duplicate measurements) are shown in Table 3.

[0324] Table 3. Compositional analysis of rice kernels (100g of kernels) [Table 3]

[0325] Proximate analysis showed an approximately 50% increase in total lipid content in the ta2 mutant flour. Total nitrogen analysis showed no significant differences in protein levels between the ta2 mutant and wild-type grains. Ash tests, which measured the amount of material left after combustion of dehumidified powder samples, showed a 26% increase in ta2 grains versus the wild type. Total fiber levels increased by approximately 200% in the ta2 grains. Starch content decreased by 8.6% in the ta2 grains versus the wild type. These data demonstrated that the increase in the thickness of the aleurone layer in the ta2 mutant increases the levels of aleurone-rich nutrients such as lipids, minerals, and fiber without altering the seed size. To understand these and other changes in more detail, a more extensive analysis was performed as follows.

[0326] mineral To measure mineral content, inductively coupled plasma (ICP) combined with atomic emission spectrometry (AES) techniques was used, ICP-AES, a standard method for measuring mineral content, allowing sensitive and high-throughput quantification of multiple elements in a single analysis. Data from the analysis showed that the mutant kernels had zinc and iron levels that were increased by approximately 15% by weight relative to wild-type kernels. Zinc levels increased from 13.9 mg / kg to 16.0 mg / kg, and iron increased from 12.4 mg / kg to 14.2 mg / kg.

[0327] Increases in potassium, magnesium, phosphorus and sulfur were also observed, increasing by approximately 28%, 23%, 22% and 9%, respectively. These results were consistent with the increase in ash content in the ta2 kernels, which mostly measure minerals.

[0328] antioxidants Antioxidants are biomolecules that can counteract the negative effects of oxidation in animal tissues to protect against oxidative stress-related diseases, such as inflammation, cardiovascular disease, cancer, and inflammation-related diseases (Huang, 2005).

[0329] The antioxidant capacity in flours obtained from ta mutant and wild-type rice kernels was measured by oxygen radical absorbance capacity (ORAC) analysis as described in Example 1. In the ORAC analysis, the antioxidant capacity is represented by the kinetics of competition between endogenous radical scavenging biomolecules and the oxidizable molecular fluorescent probe fluorescein against synthetic free radicals generated by AAPH (2,2'-azobis(2-amidino-propane) dihydrochloride). The capacity was calculated by comparing the area under the kinetic curve (AUC), which represents the fluorescence decomposition kinetics of the molecular probe fluorescein in the kernels, with the AUC generated by a Trolox standard (Prior, 2005). Another approach to quantify antioxidant capacity is through the use of the Folin-Ciocalteau reagent (FCR); it represents the antioxidant capacity by measuring the reduction capacity of the total phenolic compounds in the food sample. The FCR analysis is relatively simple, convenient and reproducible. However, the more time-consuming ORAC analysis measures a more biologically relevant activity. Because antioxidants include a wide range of polyphenols, reducing agents, and nucleophiles, measurements by both FCR and ORAC provide better coverage and a more comprehensive representation of the total antioxidant capacity. As reported by Prior (2005), the results of FCR analysis and ORAC measurements are generally consistent.

[0330] Both FCR and ORAC analyses showed increased antioxidant capacity of flours from the ta2 mutant whole grain flour versus wild type, ZH11 whole grain flour. FCR showed an increase of about 35% in total phenolic compounds in the ta2 mutant. The hydrophilic antioxidant content in flour from the ta2 mutant was also increased by 83%.

[0331] Phytic Acid When cultivated under conditions with adequate phosphorus, about 70% of the total phosphorus content in rice kernels is in the form of phytic acid or phytic acid (myo-inosthiol-1,2,3,4,5,6-hexakisphosphate). Dietary phytic acid may play a beneficial role in health as a powerful antioxidant (Schlemmer, 2009). Total phytic acid analysis showed that the phytic acid content of ta2 increased by about 19% compared to the wild type, from about 10.8 mg / g to about 12.7 mg / g.

[0332] B Vitamins The levels of vitamins B3, B6 and B9 in the ta2 flour were approximately 19%, 63% and 58% higher, respectively, than in the wild-type flour. When the analysis was repeated with four replicates, the average increase was approximately 20%, 33% and 38%, respectively. Aleurone is known to be richer in vitamins B3, B6 and B9 than endosperm (Calhoun, 1960), and therefore it was concluded that the increased thickness of aleurone in the ta mutant is responsible for the increased content of vitamins B3, B6 and B9.

[0333] Fiber Total dietary fiber, as measured, was observed to increase by approximately 70% as described in Example 1. Insoluble fiber was increased by approximately 55%.

[0334] carbohydrates Starch content in ta2 kernels was reduced by 9% by weight. In contrast, sucrose levels increased 2.5-fold in the mutant kernels, and monosaccharides (arabinose, xylose, galactose, and glucose) increased from 31% to 118% relative to the wild type.

[0335] conclusion Nutritional analysis showed that whole grain flour produced from field-grown ta2 grain was significantly increased over the wild type in most of the aleurone-rich nutrients, including macronutrients such as lipids and fiber, micronutrients such as minerals (iron, zinc, potassium, magnesium, phosphorus, sulfur), B vitamins such as B3, B6 and B9, antioxidants, and aleurone-associated biomolecules such as phenolic compounds and phytic acid. Free sucrose and monosaccharides were also significantly increased. In parallel with these increases in nutrients and micronutrients, the relative reduction in starch content in the ta2 mutant was small.

[0336] Example 6. Screening for additional mutant alleles in the Ta2 gene

[0337] Mutagenized populations of rice in the ZH11 genetic background (Example 2) were screened by TILLING analysis as described in Example 1 to identify additional polymorphisms in the Ta2 gene that could be tested for the thickened aleurone phenotype. The method used heteroduplexing of labeled wild-type and candidate mutant RNAs along with digestion with the endonuclease CeI essentially as described in Jiang et al. (2013). The 5' region of the TA2 gene was chosen to screen first, although any region of the gene could have been chosen.

[0338] A number of single nucleotide polymorphisms were identified in the 5' region of the Ta2 gene by TILLING analysis. Grains from plants carrying the polymorphisms were examined for thickened aleurone and other grain phenotypes, as were the initial ta2 mutants. Some grains showed thickened aleurone. Grains showing mutant phenotypes were selected, and progeny plants derived from them were selected. The nucleotide sequence of each Ta2 gene was determined to confirm the presence of the mutation. The altered nucleotide of the Ta2 gene in each mutant was identified. Three other thick aleurone mutants have also been sequenced. Other grains that contained the polymorphisms but did not show thickened aleurone were also identified and maintained for comparison. The identified mutants and other polymorphic lines, as well as their aleurone phenotypes, are summarized in Table 4. Mutants with thickened aleurone are represented as ++ significantly thickened aleurone; + weakly thickened aleurone; - unchanged aleurone phenotype. It was clear that a variety of mutations and resulting phenotypes were obtained.

[0339] Aleuron in wild-type ZH11 grains was one cell layer thick. In contrast to certain mutants, the aleuron of mutants containing the V441A mutation was thickened on the abaxial side containing about 5-6 cell layers. Aleuron in mutant S1357F grains was about 4-5 cell layers thick and the grains were shrunken, whereas aleuron in mutant R482K grains was 2-3 cell layers thick and the grains were not shrunken. Similar to mutants S156F and S1413N grains, aleuron in mutant S214F grains contained 2-4 cell layers and the grains were shrunken. In contrast, aleuron in K501S grains had 2-3 cell layers and the grains were not shrunken. Thus, various mutants and phenotypes were readily obtained in the Ta2 gene.

[0340] Table 4. Mutations identified in the rice Ta2 gene. [Table 4]

[0341] Of the 60 newly identified lines with polymorphisms in the TA2 gene, 19 had amino acid changes (substitutions) in the predicted polypeptide product. Of these, at least 7 lines showed thickened aleurone phenotypes. The S1413N and D1425N mutations are located within the glycosylase domain. The other identified mutations are outside the glycosidase domain. Apart from the first splice site variant, all of the identified mutations were amino acid substitutions. There were no deletions or stop codons, leading the inventors to conclude that null mutations in OsROS1 are likely lethal. It has been reported that in Arabidopsis, the maternal dme mutation disrupted seed development (Choi et al., 2002 and 2004). In rice, the presence of a maternal null allele caused early endosperm deficiency regardless of the paternal genotype (Ono et al., 2012).

[0342] The recovery of 10 new independent mutant alleles of the TA2 (OsROS1a) gene, each with a thickened aleurone layer in the grain, conclusively demonstrated that mutations in this gene caused the thick aleurone phenotype. Furthermore, these new mutations were all in different regions of the gene relative to the original ta2 mutation, indicating that the gene can be altered at various locations along the full-length gene to achieve the thick aleurone phenotype.

[0343] Several of the ta2 genes from mutants exhibiting thick aleurone were cloned, and the encoded polypeptides were expressed and tested for DNA glycosylase / lyase activity, confirming that the polypeptides have reduced DNA glycosylase / lyase activity compared to the wild-type polypeptide.

[0344] Example 7. Complementation analysis of ta2 mutants

[0345] To strengthen the conclusion that a mutation in the Ta2 (OsROS1a) gene is responsible for the thickened aleurone and related phenotypes, complementation experiments were performed by introducing a copy of the wild-type gene into the mutant line by transformation. To construct a transformation plasmid for complementation experiments, a 16,882 base pair DNA fragment (sequence shown in SEQ ID NO: 9) containing the Ta2 gene was isolated from the wild-type rice genome. This fragment contains, in order, 4726 bp upstream sequence considered to contain the promoter of the gene, the entire OsTA2 protein coding region including all of the introns, the 615 nucleotide 3'-UTR and a 401 bp downstream region. It was amplified from ZH11 genomic DNA using a series of oligonucleotide primers, assembled, and then digested with KpnI and SalI and ligated into the binary vector pCAMBIA1300, which also contained the hygromycin resistance gene as a selectable marker gene. The plasmids for transformation and the control plasmid (empty vector) were each introduced into Agrobacterium tumefaciens strain EHA105 and used to transform rice recipient cells using the method described by Nishimura et al. (2006). A total of 32 T0 transgenic plants were regenerated from transformation with the wild-type Ta2 gene. These plants were transferred to soil and grown to maturity in a growth chamber. When PCR was used to test for the presence of the hygromycin resistance gene, 20 transformed lines carrying the hygromycin gene were identified and selected. These were grown to maturity and grains (T1 seeds) were harvested from each plant. Each of these plants contained T-DNA from the vector containing the wild-type Ta2 gene as shown by PCR analysis.

[0346] Grains harvested from these plants were examined for their aleurone phenotype by staining with Evans blue. At least three lines of transformed plants produced normal aleurone like the wild type, indicating positive expression of the transgene and thus complementation of the ta2 mutation. This conclusively demonstrated that mutation in the Ta2 gene caused the mutant phenotype.

[0347] The Ta2 gene is hereafter referred to as ROS1a, and these terms are interchangeable.

[0348] Example 8. In vitro enzymatic activity analysis of recombinantly expressed TA2 and ta2 proteins

[0349] As described above in Example 4, the rice Ta2 gene was identical to the OsROS1a gene, which is a homolog of the Arabidopsis thaliana DNA demethylase / glycosylase named Demeter (DME; Gehring et al., 2006), which cleaves the phosphodiester bond 3' to 5-methylcytosine residues in hemimethylated DNA substrates.

[0350] Therefore, enzymatic activity from recombinantly expressed rice Ta2 and ta2 proteins was tested by measuring their activity on labeled hemimethylated DNA substrates, generating end-labeled DNA that migrates on denaturing polyacrylamide gels at the predicted position of the β-elimination product, as described by Gehring et al. (2006).

[0351] To recombinantly express and purify Ta2 and ta2 polypeptides, full-length ROS1a cDNA from wild-type and mutant ta2 plants is used as template in a PCR reaction with oligonucleotides JH021 (5'-TTAATCTAGAATGCAGAGCATTATGGACTCG-3'; SEQ ID NO:42) and JH017 (5'-CGGTCGACTTAGGTTTTGTTGTTCTTCAATTTGC-3'; SEQ ID NO:43), which add restriction enzyme sites for XbaI and SalI to the ends of the amplified DNA fragments, respectively. The PCR product is digested with XbaI and SalI and cloned into pMAL-c2x vector (NEB) to generate the c2x-ROS1a gene construct. The gene construct is transformed into E. coli Rosetta cells (Novagen). To produce the polypeptide, the transformed cells are grown at 28°C in LB supplemented with 0.2% glucose, 100 μg / mL ampicillin, and 50 μg / mL chloramphenicol until the OD600 reaches 0.4. Expression of the ROS1a-Mal fusion protein is induced with 10 μM IPTG for 1 h at 18°C. The culture is centrifuged at 6,500 rpm for 15 min at 4°C, and the pellet is resuspended in 30 mL of 4°C column buffer (20 mM Tris-HCl, pH 7.4, 200 mM NaCl, 1 mM EDTA). The cells are sonicated on ice for 2 min at an output power of 4 using a Branson Sonifier 250. The lysate is centrifuged at 9,000 rpm for 25 min at 4°C, and the supernatant is collected and subjected to gravity column purification. The ROS1a-Mal fusion protein is purified via amylose resin according to the manufacturer's protocol (New England Biolabs). The eluted proteins are dialyzed overnight in Slide-A-Lyzer dialysis cassettes (10,000 MWCO; Pierce) against 50% glycerol at 4° C. Protein concentrations were determined by the Bradford method using a protein analysis kit (Bio-Rad Laboratories), and proteins were stored at −20° C. until further use.

[0352] The ROS1a-Mal fusion protein is analyzed for DNA glycosylase activity on hemimethylated double-stranded DNA substrates as described in Example 1 (Gehring et al., 2006).

[0353] As controls, no lyase activity or covalent trapping is detected when ROS1a is incubated with unmethylated DNA oligonucleotides or when the hemimethylated DNA substrate is incubated in the absence of enzyme.

[0354] Example 9. Rice ROS1a gene homologue

[0355] Plant genes encoding DNA glycosylases that mediate DNA demethylation have been characterized primarily in Arabidopsis thaliana (Chan et al., 2005; Law and Jacobsen, 2010; Zhu, 2009), including Demeter (DME, Choi et al., 2002; Gehring et al., 2006), ROS1 (Gong et al., 2002; Agius et al., 2006), Demeter-like 2 (DML2), and Demeter-like 3 genes (DML3, Choi et al., 2002; Ortega-Galisteo et al., 2008). The largest of these genes (and encoded polypeptides), DME, is most strongly expressed in the homodiploid central cell of the female gametophyte before fertilization, where it promotes maternal allele-specific global hypomethylation and expression of imprinted genes, including the endosperm. In contrast, ROS1, DML2, and DML3 are expressed in vegetative tissues (Gong et al., 2002; Penterman et al., 2007). Compared to ROS1, the expression levels of the DML2 and DML3 genes were low (Mathieu et al., 2007). Furthermore, homozygous mutations in ros1, dml2, and dml3 did not result in obvious morphological phenotypes, whereas maternal dme mutations were seed, i.e. embryo, lethal and not transmitted to progeny (Choi et al., 2002 and 2004). Despite their low expression levels, the ROS1, DML2 and DML3 polypeptides still function as DNA glycosylases / lyases (Gong et al., 2002; Morales-Ruiz et al., 2006; Penterman et al., 2007). Based on this data, we did not expect that the ROS1 mutation would cause a thickened aleurone phenotype.

[0356] Phylogenetic analysis revealed that the rice genome encodes six putative DNA glycosylases for cytosine demethylation, including four that appear to be ROS1 orthologues (OsROS1a, OsROS1b, OsROS1c, OsROS1d) and two apparent DML3 orthologues (Zemach et al., 2010). Null mutations in OsROS1a were identified but were not transmitted to progeny from male or female plants containing the mutation, presumably because the ROS1a wild-type DNA glycosylase is essential in both male and female gametophyte development (Ono et al., 2012). We are not aware of any published reports of partial mutations in OsROS1a.

[0357] Three identified motifs of DNA glycosidase domains, namely helix-hairpin-helix (HhH) motif, conserved aspartic acid (GPD) followed by glycine / proline-rich motif, and four conserved cysteine ​​residues (Example 4), are present in each member of the Demeter family. The glycosylase domain structure was also found in human 8-oxoguanine DNA glycosylase (hOGG1), E. coli adenine DNA glycosylase (MutY), and endonuclease III (Endo III) (Bruner et al. 2000; Guan et al. 1998; Mok et al., 2010). Unlike other members of the HhH DNA glycosylase superfamily, DME family members contained two additional conserved domains (domain A and domain B) adjacent to the central glycosidase domain (Mok et al., 2010).

[0358] The nucleotide sequences of the protein coding regions of the homologous genes were aligned by ClustalW (www.ebi.ac.uk / Tools / msa / clustalw2 / ). The degree of sequence identity between the rice ROS1a protein coding region and the corresponding regions of the homologous genes of other species is shown in Table 5.

[0359] From these analyses, we conclude that rice has multiple ROS1 gene homologs but no DME gene. In rice, ROS1 was clearly distinct from its cognate homologs DML2 and DML3 in terms of the degree of sequence identity with respect to Arabidopsis.

[0360] Table 5. Nucleotide sequence identity to the coding region of rice OsROS1a or TaROS1a-5B. [Table 5]

[0361] Example 10. Expression of the rice ROS1a gene

[0362] Experiments were performed to analyze the expression of the TA2 gene in different rice tissues, including parts of the developing kernel. In a first experiment, TA2 mRNA was detected in rice tissue sections by in situ hybridization as described by Brewer et al. (2006). Briefly, different rice tissues were fixed with FAA fixative for 8 h at 4°C after vacuum infiltration, dehydrated using a graded ethanol series followed by a xylene series, and embedded in Paraplast Plus (Sigma-Aldrich). Microtome sections (8 μm) were mounted on Probe-On Plus microscope slides (Fisher).

[0363] From the hybridization signals it was concluded that TA2 is expressed in pericarp, seed coat, and aleurone tissues as well as in starchy endosperm, but not in vascular bundles.

[0364] Real-time reverse transcription polymerase chain reaction (RT-PCR) was used to analyze the relative expression levels in different plant tissues. Surprisingly, the results showed the highest relative expression in pollen, followed by anthers, young panicles and aleurone tissues (Figure 6). The specific expression of OsROS1a in anthers was thought to be involved in the suppression of transposons in male gametophytes. In Arabidopsis tricellular pollen, active DNA demethylation is important in maintaining the basal expression of transposons in vegetative cell nuclei to produce siRNAs to enhance RNA-dependent DNA methylation (RdDM) of transposons in male gametes, i.e., two sperm cells (Zhu, 2009; Zhu et al., 2007).

[0365] In developing seeds, expression of ROS1a increased 10 days after anthesis and then decreased. Strong expression was observed in both starchy endosperm and aleurone tissues. The expression pattern early in seed development was consistent with the formation of thickened aleurone prior to endosperm cellularization in developing seeds. We conclude that the decrease in expression of ROS1a from anthesis to 7 days after anthesis (pollination) (0-7 DAP) is important for the formation of thick aleurone.

[0366] Example 11. Gene methylation patterns in rice

[0367] To determine patterns of methylation of rice genes, collectively, in ta2 mutant plants compared to wild-type TA2 plants, DNA was isolated from endosperms and embryos, treated with bisulfite, which reacts with unmethylated cytosines, and subsequently subjected to Illumina sequencing. Endosperms were isolated at 10 DAP from developing rice kernels of ta2 and wild-type (ZH11) plants, and embryos were isolated from wild-type plants at the same stage of kernel development. For sequencing after bisulfite treatment, custom Illumina adapters were synthesized that replaced cytosines with 5-methylcytosines so that the adapters would survive bisulfite conversion. Paired-end (PE) adapters were synthesized that allowed each molecule to be sequenced from both ends, thereby facilitating subsequent alignment to the genomic scaffold sequence. Approximately 0.5–1 μg of genomic DNA was isolated from dissected endosperms from each of the wild-type and ta2 plants and wild-type embryos. The isolated DNA preparations were sheared by sonication into fragments of 100–500 bp. Adapters were ligated to the sheared fragments according to Illumina protocols. The DNA was then treated twice with sodium bisulfite, which converts unmethylated cytosines (C) to uridines (U) using the Qiagen EpiTect kit, and amplified in 18 cycles of PCR using PfuTurboCx DNA polymerase (Stratagene), a proofreading enzyme that tolerates uridines in the template strand. This PCR amplification resulted in a library of DNA fragments with different adapters at each end, so that the "forward" Illumina sequencing primer obtained the nucleotide sequence of the "original" genomic DNA-derived strand (where C corresponds to methylated C and T corresponds to unmethylated C, where C was present in the genomic sequence), and the "reverse" Illumina sequencing primer generated the nucleotide sequence from the complementary strand (where G corresponds to methylated C on the opposite strand and A corresponds to unmethylated C, where C was present in the genomic sequence).

[0368] The extent of CG and CHG methylation in DNA obtained from ta2 endosperm was greater than that in DNA obtained from the control ZH11 endosperm, indicating that the TA2(OsROS1a) mutation reduced the demethylation process in rice endosperm, whereas the extent of CHH methylation in ta2 endosperm was not significantly different from that in wild-type ZH11 endosperm.

[0369] Example 12. Further analysis of nutritional composition in ta2 mutant grain

[0370] Further analysis was carried out to determine the nutritional composition of the mutant grains compared to the corresponding wild type grains (ZH11) grown under the same conditions for the same time in the field. Whole grain flour samples were prepared using grain harvested from the plants and used for compositional analysis as described in Example 5. The results of the proximate analysis of the flours of the grains grown in Australia are presented in Table 6. The results of the grains grown in China are shown in Table 7.

[0371] Proximal analysis showed an approximately 50% increase in total lipid content in ta2 mutant flour. Total nitrogen analysis showed significant changes in protein levels between ta2 mutant and wild-type grains in China, but not in Australia, which may be due to different nitrogen fertilizer regimes. Total fiber levels increased by approximately 66% or 91% in ta2 grains. Starch content was reduced by 9% in ta2 grains compared to wild type. These data confirmed that the increase in aleurone layer thickness in the ta2 mutant significantly increased the levels of aleurone-rich nutrients such as lipids, minerals and fiber, without altering seed size. The relative increase in ta2 grains was reasonably consistent, even though the absolute numbers differed in the two growth environments.

[0372] Table 6. Composition of ros1a mutant rice kernels (Australia) compared to wild type. [Table 6]

[0373] Table 7. Composition of ros1a mutant rice kernels (China) compared with wild type [Table 7]

[0374] It will be appreciated by those skilled in the art that numerous variations and / or modifications may be made to the invention as illustrated in the specific embodiments without departing from the spirit or scope of the invention as broadly described, and the present embodiments are therefore to be considered in all respects as illustrative and not restrictive.

[0375] This application claims priority to AU 2015904754, filed November 18, 2015, the entire contents of which are incorporated herein by reference.

[0376] All publications discussed and / or referenced herein are incorporated herein in their entirety.

[0377] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. No admission is made that any or all of such matters form part of the prior art body or are general general knowledge in the art relevant to the present invention existing prior to the priority date of any claim in this application.

Claims

1. 1. A rice grain comprising (i) aleurone, (ii) starchy endosperm, and (iii) a mutant ROS1a polypeptide, the amino acid sequence of which is at least 95% identical to a wild-type ROS1a polypeptide represented by SEQ ID NO:2, and the ROS1a polypeptide comprises a single insertion or a single amino acid substitution, whereby the aleurone is thickened compared to aleurone from a corresponding wild-type grain.

2. 2. The grain of claim 1 comprising at least 2 layers, at least 3 layers, at least 4 layers or at least 5 layers of cells, 3 layers, 4 layers, 5 layers or 6 layers of cells, or 2 to 8, 2 to 7, 2 to 6 or 2 to 5 layers of cells.

3. 3. The grain of claim 1 or 2, which is homogenous for the ROS1a gene encoding the mutant ROS1a polypeptide.

4. 4. The grain of any one of claims 1 to 3, wherein the rice is borne with stamens and pistils.

5. The grain described in any one of claims 1 to 4, wherein the rice exhibits delayed grain maturity.

6. (a) the grain contains, by weight, one or more or all of the following when compared to a corresponding wild-type grain: i) higher mineral content of one or more or all of zinc, iron, potassium, magnesium, phosphorus and sulfur; ii) higher antioxidant content; iii) higher phytic acid content; iv) a higher content of one or more or all of vitamins B3, B6 and B9; v) higher dietary fiber and / or insoluble fiber content; vi) a starch content that is between 90% and 100% by weight relative to the starch content of the corresponding wild-type grain; vii) higher sucrose content; viii) higher monosaccharide content; ix) a lipid content of at least 90% or at least 100% relative to the lipid content of the corresponding wild-type grain; (b) the kernel contains an embryo; (c) the grain is a whole grain or a broken grain; (d) the grain has been treated so that it can no longer germinate; (e) the grain has a germination rate of between about 70% and about 100% relative to the germination rate of a corresponding wild-type grain; (f) the grain comprises an increased proportion of amylose in its total starch content compared to the corresponding wild-type grain; and (g) the grain comprises an increased proportion of oleic acid and / or a decreased proportion of palmitic acid in its total fatty acid content compared to a corresponding wild-type grain; The grain according to any one of claims 1 to 5, further characterized by one or more of the following features:

7. A grain described in any one of claims 1 to 6, comprising a ROS1a gene encoding a mutant ROS1a polypeptide having DNA glycosylase activity in one or more of the aleurone, seed coat and starchy endosperm of the grain.

8. A rice plant producing the grain according to any one of claims 1 to 7.

9. 9. A product produced from the grain of any one of claims 1 to 7, the rice of claim 8, or a part of said grain or rice, said product comprising said mutant ROS1a polypeptide.

10. 10. The product of claim 9, i) the food or beverage ingredient is selected from the group consisting of whole grain flour, flour, bran, starch, malt, and oil; ii) the food product is selected from the group consisting of food products including leavened or unleavened bread, pasta, noodles, livestock feed, breakfast cereals, snack foods, cakes, pastries and powder-based sauces; iii) the beverage product is a packaged beverage or a beverage containing ethanol; product.

11. A method for preparing a food or beverage ingredient, the method comprising: A) processing a grain according to any one of claims 1 to 7, or bran, flour, wholemeal, malt, starch or oil derived from said grain, to produce a food or beverage ingredient, or B) mixing the grain according to any one of claims 1 to 7, or the bran, flour, wholemeal, malt, starch or oil derived from said grain, with other food or beverage ingredients, A method comprising:

12. 10. Use of a grain or a part thereof according to any one of claims 1 to 7, or of rice or a part thereof according to claim 8, as an animal feed or food, or for producing a feed for animal consumption or a food for human consumption.

Images