Anti-αvβ8 antibodies, compositions and uses thereof

Abstract

The present invention relates to antibodies and antigen-binding fragments thereof that specifically bind to αvβ8 integrin. The present invention includes uses of the antibodies and related methods of use.

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Application Nos. 62 / 728,688 (filed September 7, 2018) and 62 / 890,945 (filed August 23, 2019), the contents of each of which are incorporated herein in their entirety. Sequence Listing This specification further contains a sequence listing submitted on September 5, 2019. In accordance with 37 CFR § 1.52(e)(5), the sequence listing is a 184,211 byte text file named PC72413A_SequenceListing_ST25.txt, created on September 3, 2019. The sequence listing submitted electronically does not exceed the scope of the specification and does not contain any new matter. Parties involved in the collaborative research The presently claimed invention was made by or on behalf of the following parties under a Joint Research Agreement, which was in effect on or before the date the claimed invention was made, and which claimed invention was made as a result of activities within the scope of the Joint Research Agreement. The parties to the Joint Research Agreement are the Regents, representing the University of California, San Francisco, and Pfizer, Inc.

[0002] Technical Field The present invention relates to antibodies and antigen-binding fragments thereof that specifically bind to αvβ8 integrin, as well as compositions, methods and uses thereof. [Background technology]

[0003] Transforming growth factor-β (TGFβ) is a potent suppressor of adaptive and innate immunity and a key mediator of immunosuppression by regulatory T cells. TGFβ is required for the induction of Th17 cells, which promote tumor progression by inducing granulocytic inflammation, promotes the epithelial-to-stromal transformation of tumor cells, and promotes the secretion and accumulation of fibrous tumor stroma, which may contribute to the clearance of immune cells from some solid tumors. For this reason, TGFβ inhibition has been explored as an adjuvant immunotherapy, particularly for so-called “immune-excluded” tumors (Gorelik et al. Nat. Med. 7:1118-1122, 2001; Tauriello et al. Nature 554:538-543, 2018; Mariathasan et al. Nature 554:544-548, 2018; Dodagatta et al. J Immunother Cancer. 7: 62, 2019; US Patent No. 10,167,334). However, because TGFβ plays a crucial role in homeostasis, targeting TGFβ signaling systemically poses many challenges due to unwanted side effects (Hata and Akhurst Nat. Rev. Drug Dev. 11, 791-811, 2012; Akhurst et al. Cold Spring Harbor Perspectives. 10, 2017; Flavell et al. Nat. Rev. Immunol. 10:554-567, 2010).

[0004] Previous studies have shown that inhibition of TGFβ signaling in combination with checkpoint blockade can enhance responses to radiation therapy or vaccine therapy (Vanpouille-Box et al. Cancer Res. 75:2232-2242, 2015; Terabe et al. OncoImmunology 6(5):e1308616, 2017). In vivo TGFβ activity is regulated through several mechanisms. For example, TGFβ is secreted as an inactive or latent complex in which a cleaved latency-associated peptide (LAP) domain encases the active TGFβ mature peptide. Latent TGFβ can be covalently bound to the extracellular matrix via latent TGFβ-binding protein (LTBP) or displayed on the cell surface by Glycoprotein-A Repetitions Predominant Protein (GARP). Early in vitro data indicated that the latent complex of TGFβ can be activated by high temperature, acidity, and various proteases (Annes et al. J Cell Sci. 116:217-24, 2003), but the in vivo significance of these mechanisms remains to be determined.

[0005] The role of the αv integrin family, particularly αvβ1, αvβ6, and αvβ8, in the activation of latent TGFβ has been demonstrated. Integrin αvβ8 is a transmembrane, noncovalently linked heterodimer composed of ITGαV and ITGβ8 subunits. Expression of αvβ8 is unique among αv integrins, and its expression in immune cells such as dendritic cells, regulatory T cells, and tumor-associated macrophages has led to its identification as an activator of TGFβ in regulating active immune responses. Expression of αvβ8 in dendritic cells (DCs) functions as a mediator of TGFβ production during T cell stimulation and potently influences the differentiation and maturation of Treg and Th17 cells at the expense of Th1 differentiation during immune responses. In mice in which Itgb8 is knocked out in DCs or all leukocytes, TGFβ-dependent induction of antigen-specific Th17 cells is dramatically impaired, leading to organ dysfunction in certain preclinical models of autoimmunity, such as multiple sclerosis (experimental autoimmune encephalomyelitis) and allergic asthma (Travis et al. Nature. 449(7160):361-5, 2007; Melton et al. J Clin. Invest. 120(12):4436-44, 2010).

[0006] TGFβ plays a role in both the differentiation and recruitment of immunosuppressive cells to tumors and as a tumor-intrinsic factor that contributes to an immunosuppressive tumor microenvironment. In some cancers, TGFβ may promote tumor growth by influencing many aspects of the tumor microenvironment, including angiogenesis, metastasis, epithelial-mesenchymal transition, and, perhaps most importantly, suppression of infiltrating immune cells.

[0007] Therefore, given the prominent role of TGFβ in the tumor microenvironment and the many challenges associated with targeting TGFβ signaling systemically (Hata and Akhurst Nat. Rev. Drug Dev. 11, 791-811, 2012; Akhurst et al. Cold Spring Harbor Perspectives 10, 2017; Flavell et al. Nat. Rev. Immunol. 10:554-567, 2010), strategies for selective inhibition of αvβ8-dependent latent TGFβ activation must be developed. Summary of the Invention

[0008] Disclosed herein are antibodies (e.g., humanized and chimeric antibodies) and antigen-binding fragments thereof that specifically bind to αvβ8 integrin (also referred to herein as "AVB8," "αvβ8," or "avb8") (e.g., human, mouse, cynomolgus monkey, and / or rat αvβ8 integrin). In some embodiments, the antibodies and antigen-binding fragments thereof bind to αvβ8 integrin and ultimately reduce TGFβ (e.g., TGFβ1 and TGFβ3) signaling, for example, in a tumor or tumor microenvironment.

[0009] Mature TGFβ exists in an inactive or latent form as a complex with a latency-associated peptide (LAP) domain. Binding of αvβ8 integrin to LAP releases active TGFβ (e.g., TGFβ1 and TGFβ3). Reducing the binding of αvβ8 integrin to LAP can prevent the release of active TGFβ, thereby reducing TGFβ signaling. TGFβ is known to have immunosuppressive effects, for example, in the tumor microenvironment; therefore, reduction of TGFβ activity and / or signaling by the antibodies of the present invention may result in activation of an immune response, for example, an anti-tumor response in vivo.

[0010] Due to the limited expression of αvβ8 integrin in immune cells (e.g., dendritic cells, regulatory T cells, tumor-associated macrophages) and tumor cells, the antibodies of the present invention may result in a more targeted, non-systemic reduction of TGFβ signaling. Thus, the antibodies and antigen-binding fragments thereof of the present invention enable more selective antagonism of TGFβ activity in the immune system and / or tumor microenvironment, thereby enhancing anti-tumor immune responses in subjects. In certain embodiments described herein, antibodies against αvβ8 integrin have been shown to cause growth suppression and / or complete tumor regression in animal models of several cancers, including, for example, squamous cell carcinoma, breast cancer, and / or colon cancer, either alone or in combination with immunomodulators such as other checkpoint inhibitor modulators (e.g., inhibitors of PD-1, PD-L1, CTLA-4, 4-1BB agonists) or anti-cancer therapies (e.g., radiation therapy).

[0011] Thus, in certain aspects, the present specification discloses antibodies and antigen-binding fragments thereof that bind to αvβ8 integrin with high affinity and specificity, as well as nucleic acids, expression vectors, and host cells encoding the antibodies and antigen-binding fragments, and methods for producing the same. In certain aspects, the antibodies and antigen-binding fragments thereof have altered effector functions (e.g., decreased antibody-dependent cellular cytotoxicity (ADCC) and / or decreased complement-dependent cytotoxicity (CDC)). In certain aspects, the anti-αvβ8 integrin antibodies and antigen-binding fragments thereof have enhanced binding affinity for αvβ8 integrin compared to the murine hybridoma antibodies and antigen-binding fragments thereof from which they are derived. The humanized anti-αvβ8 integrin antibodies and antigen-binding fragments thereof of the present invention can be used alone or in combination with other drugs or therapeutic methods (e.g., immunomodulators or anti-cancer therapies) to treat, prevent, and / or diagnose disorders, such as cancerous disorders (e.g., solid tumors and soft tissue tumors). Accordingly, compositions and methods for detecting αvβ8 integrin, as well as methods for treating various disorders, including cancer, using anti-αvβ8 integrin antibodies and antigen-binding fragments thereof, are disclosed.

[0012] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be included in embodiment (E) below.

[0013] An isolated antibody or antigen-binding fragment thereof that specifically binds to E1 αvβ8 integrin, wherein the antibody or antigen-binding fragment thereof has at least one of the following characteristics i. to xix.: i. a binding affinity (KD) for human αvβ8 integrin that is less than the KD of the murine antibody ADWA11 described in U.S. Patent No. 9,969,804, which is incorporated herein in its entirety and identified, e.g., for the amino acid sequences set forth in SEQ ID NOS:20-33 and 71-76 herein, e.g., less than about 536 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 510, 520, 530, 531, 532, 533, 534, or 535 pM); ii. a KD for human αvβ8 integrin, e.g., purified human αvβ8 integrin, of 200 pM or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 180, 190, or 200 pM); iii KD against purified human αvβ8 integrin that is ≤100 pM; iv. a KD for mouse αvβ8 integrin that is less than the KD of mouse antibody ADWA11, e.g., less than about 489 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 460, 470, 480, 485, 486, 487, or 488 pM); v. KD against purified mouse αvβ8 integrin, which was 70.8 ± 19.9 pM; vi. a KD for cynomolgus monkey αvβ8 integrin that is less than the KD of mouse antibody ADWA11, e.g., less than 507 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 501, 502, 503, 504, 505, or 506 pM); vii. KD for purified cynomolgus monkey αvβ8 integrin of 100 pM or less; viii. KD for rat αvβ8 integrin, which is approximately 160 pM; ix. Approximately equivalent affinity for at least two, three, or all of human, cynomolgus monkey, mouse, and rat αvβ8 integrins, e.g., a KD of less than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 98 pM), as determined, e.g., by a Biacore affinity assay; x. an IC50 for inhibition of TGFβ transactivation that is less than that of murine antibody ADWA11, e.g., less than 183 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 175, 180, 181, or 182 pM); xi. IC50 for inhibiting TGFβ transactivation in U251 cells is approximately 199±93.6 pM; xii. an IC50 for inhibiting TGFβ transactivation of about 100 pM to about 300 pM; xiii. an EC50 against U251 cells of about 126±34 pM (e.g., about 50, 60, 70, 80, 90, 100, 110, 115, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 150, 160, 170, 180, or 190 pM); xiv. an EC50 against U251 cells of approximately 256±115 pM (e.g., approximately 120, 140, 160, 180, 200, 220, 240, 260, 280, 290, 300, 320, 340, 360, 380, 400 pM); xv. EC50 against U251 cells of about 80 pM to about 400 pM; xvi. EC50 against C8-S cells of approximately 115 pM; xvii. EC50 against C8-S cells of approximately 145±23.7 pM; xviii. EC50 against C8-S cells of about 110 pM to about 180 pM; xix. Predicted value of at least one human pharmacokinetic (PK) parameter selected from the following a to i: a Clearance (CL) from the central compartment, which is approximately 0.12–0.15 mL / h / kg; b Intercompartmental distribution clearance (CLF) which is approximately 0.15–0.51 mL / h / kg; c Volume of distribution of the central compartment (V1), which is approximately 36–39 mL / kg; d a volume of distribution (V2) in the peripheral compartment that is approximately 21–33 mL / kg; and / or e half-life (t 1 / 2 ); f Half-life (t 1 / 2 ); or i. Absence of detectable binding to human Fcγ receptors or C1q; An isolated antibody or antigen-binding fragment thereof, having the following structure: E2 The isolated antibody or antigen-binding fragment thereof of aspect E1, wherein the KD for human αvβ8 integrin is less than the KD of murine antibody ADWA11, e.g., less than 536 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 510, 520, 530, 531, 532, 533, 534, or 535 pM). E3 The isolated antibody or antigen-binding fragment thereof of aspect E1 or E2, wherein the KD for the human αvβ8 integrin, e.g., purified human αvβ8 integrin, is 100 pM or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pM). E4 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the KD for mouse αvβ8 integrin is less than the KD of mouse antibody ADWA11, e.g., less than 489 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 460, 470, 480, 485, 486, 487, or 488 pM). E5 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the KD for mouse αvβ8 integrin is about 70.8±19.9 pM. E6 An isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, wherein the KD for the cynomolgus monkey αvβ8 integrin is less than the KD of the mouse antibody ADWA11, e.g., less than 507 pM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 370, 400, 450, 500, 501, 502, 503, 504, 505 or 506 pM). E7 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the KD for the cynomolgus αvβ8 integrin is less than 100 pM. E8 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the KD for rat αvβ8 integrin is about 160 pM. E9. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the isolated antibody or antigen-binding fragment thereof exhibits substantially equivalent affinity for at least two, three, or all of human, cynomolgus monkey, mouse, and rat αββ integrins, e.g., a KD of less than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95 pM), e.g., as determined by a Biacore affinity assay. E10 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the isolated antibody or antigen-binding fragment thereof exhibits approximately equal affinity for at least two, three, or all of human, cynomolgus monkey, mouse, and rat αvβ8 integrins, e.g., a KD of less than 100 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 98 pM), e.g., as determined by a Biacore affinity assay.

[0014] E11 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the IC50 of inhibiting TGFβ transactivation is lower than that of murine antibody ADWA11, e.g., less than 183 pM (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 175, 180, 181, or 182 pM). E12 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the IC50 for inhibition of TGFβ transactivation in U251 cells is about 199±93.6 pM. E13. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the IC50 for inhibiting TGFβ transactivation is between about 100 pM and about 300 pM. E14 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the EC50 against U251 cells is 126 pM (± 34 pM, standard deviation). E15 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the EC50 against U251 cells is 256 pM (± 115 pM, standard deviation). E16 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the EC50 against U251 cells is about 100 pM to about 400 pM. E17 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the EC50 against C8-S cells is about 115 pM. E18 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the EC50 against C8-S cells is about 145±23.7 pM. E19. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the EC50 on C8-S cells is about 110 pM to about 180 pM. E20 Predicted value of at least one human pharmacokinetic (PK) parameter selected from the group consisting of (i) to (v) below (i) clearance from the central compartment (CL), which is approximately 0.12–0.15 mL / h / kg; (ii) intercompartmental distribution clearance (CLF) of approximately 0.15–0.51 mL / h / kg; (iii) volume of distribution of the central compartment (V1), which is approximately 36–39 mL / kg; (iv) a volume of distribution (V2) in the peripheral compartment that is approximately 21 to 33 mL / kg; and / or (v) A half-life (t 1 / 2 ) 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having:

[0015] E21 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the isolated antibody or antigen-binding fragment thereof does not exhibit detectable binding to human Fcγ receptors or C1q. E22 The antibody or antigen-binding fragment thereof further has at least one of the following characteristics (i) to (xvii): (i) specifically binds to αvβ8 integrin (e.g., human, mouse, cynomolgus monkey, and / or rat αvβ8 integrin); (ii) reducing the interaction of αvβ8 integrin with latency-associated peptide (LAP); (iii) reducing TGF-β signaling; (iv) effectively block TGFβ activation by αvβ8 integrin with an IC50 of 10 nM or less; (v) have a comparable Kd (within 5-fold) to the nonhuman primate (NHP) ortholog; (vi) selectively binds to human αvβ8, but does not detectably bind to αvβ8 homologs (e.g., αvβ1, αvβ3, αvβ5, and αvβ6); (vii) alone or in combination with an immunomodulator (e.g., a modulator of a checkpoint inhibitor such as an inhibitor of PD-1, PD-L1, or CTLA-4, or an agonist of a stimulatory molecule such as 4-1BB), causes growth inhibition and / or complete tumor regression in an animal model of cancer; (viii) in combination with anti-cancer treatments such as radiation therapy, causing growth inhibition and / or complete tumor regression in animal models of cancer; (ix) reduces tumor growth by at least 60% in a syngeneic tumor xenograft model when administered alone or in combination with an immunomodulator (e.g., blockade of PD-1, PD-L1, or CTLA-4), e.g., at a dose of 10 mg / kg or less; (x) when administered to a subject, increases an anti-tumor response in the presence of one or more immunomodulatory agents (e.g., a checkpoint inhibitor antagonist, such as a PD-1, PD-L1, or CTLA-4 antagonist, or an activator of the immune response, such as a 4-1BB agonist); (xi) effective regardless of αvβ8 integrin expression in tumor models; (xii) increasing CD8+GzmB+ T cells in the tumor microenvironment; (xiii) reduces tumor growth, e.g., by at least 80%, when used in combination with a checkpoint inhibitor antagonist (e.g., an anti-PD-1 or anti-PD-L1 antibody), e.g., in syngeneic models of squamous cell carcinoma, breast cancer, and / or colon cancer; (xiv) demonstrates a statistically significant improvement in overall survival of subjects by Kaplan-Meier analysis; (xv) excellent thermal stability; (xvi) little aggregation at high concentrations; and (xvii) capable of demonstrating reproducible expression and purity under large-scale manufacturing conditions; 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having: E23 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, (i) CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 8 or 14; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 9 or 15; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 10 or 16; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 11 or 17; CDR-L2 comprising the amino acid sequence shown in SEQ ID NO: 12 or 18, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 13 or 19, or (ii) CDR-H1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 8 or 14, but no more than two, three, or four changes; CDR-H2, which has at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 9 or 15, but not more than two, three, or four changes; a CDR-H3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) but not more than two, three, or four changes compared to the amino acid sequence set forth in SEQ ID NO: 10 or 16; CDR-L1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 11 or 17, but not more than two, three, or four changes; CDR-L2, which has at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 12 or 18, but not more than two, three, or four changes; a CDR-L3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 13 or 19, but no more than two, three, or four changes; (Optionally, any of said CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 or CDR-L3 (a) SEQ ID NOs: 22, 23, 24, 25, 26 and 27, respectively; (b) SEQ ID NOs: 28, 29, 30, 31, 32 and 33, respectively; (c) SEQ ID NOs: 22, 23, 24, 71, 72, and 73, respectively; or (d) SEQ ID NOs: 28, 29, 30, 74, 75 and 76, respectively. (does not include the amino acid sequence shown in An isolated antibody or antigen-binding fragment thereof comprising one, two, or three CDRs of a heavy chain variable region (e.g., H1, H2, or H3) and / or one, two, or three CDRs of a light chain variable region (e.g., L1, L2, or L3) selected from:

[0016] The antibody or antigen-binding fragment thereof has one or more of the following properties, characteristics and embodiments, optionally in combination with any of the embodiments described herein (eg, E1-E23).

[0017] E24 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, (i) CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 8; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 9; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 10; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 11; CDR-L2 comprising the amino acid sequence shown in SEQ ID NO: 12, and CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO: 13, or (ii) CDR-H1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 8, but no more than two, three, or four changes; CDR-H2, which has at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 9, but not more than two, three, or four changes; a CDR-H3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 10, but no more than two, three, or four changes; a CDR-L1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) but not more than two, three, or four changes compared to the amino acid sequence set forth in SEQ ID NO: 11; a CDR-L2 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 12, but not more than two, three, or four changes; a CDR-L3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 13, but no more than two, three, or four changes; (Optionally, any of said CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 or CDR-L3 (a) SEQ ID NOs: 22, 23, 24, 25, 26 and 27, respectively; or (b) SEQ ID NOs: 22, 23, 24, 71, 72 and 73, respectively. (does not include the amino acid sequence shown in An isolated antibody or antigen-binding fragment thereof comprising one, two, or three CDRs of a heavy chain variable region (e.g., H1, H2, or H3) and / or one, two, or three CDRs of a light chain variable region (e.g., L1, L2, or L3) selected from: E25 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 9; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 11; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 12, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 13 An isolated antibody or antigen-binding fragment thereof comprising one, two, or three complementarity-determining regions (CDRs) of a heavy chain variable region (e.g., H1, H2, or H3) selected from the group consisting of: E26 CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 8; CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO: 9, and CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 10 The isolated antibody or antigen-binding fragment thereof of aspect E24 or E25, comprising: E27 CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 11; CDR-L2 comprising the amino acid sequence shown in SEQ ID NO: 12, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 13 The isolated antibody or antigen-binding fragment thereof of any one of aspects E24 to E26, comprising: E28 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 8; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 9; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 10; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 11; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 12, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 13 1. An isolated antibody or antigen-binding fragment thereof comprising: E29 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence DYYMN (SEQ ID NO: 8); CDR-H2 comprising the amino acid sequence WIDPDX1GNTIYX2PKFQG (X1 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q, and X2 is an amino acid, an amino acid other than D, a conservative substitution for D, or either D or E) (SEQ ID NO: 131); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 10); CDR-L1 comprising the amino acid sequence RSTKSLX3HFNGNTYLF (X3 is either an amino acid, an amino acid other than L, a conservative substitution for L, L, or S) (SEQ ID NO: 132); a CDR-L2 comprising the amino acid sequence YYMSX4LAS (wherein X4 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or S) (SEQ ID NO: 133); and / or CDR-L3 comprising the amino acid sequence X5QSLEYPFT (X5 is an amino acid, an amino acid other than M, a conservative substitution for M, M, or Q) (SEQ ID NO: 134); (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 22, 23, 24, 25, 26, and 27, respectively, or SEQ ID NOs: 22, 23, 24, 71, 72, and 73, respectively.) An isolated antibody or antigen-binding fragment thereof comprising one, two, or three complementarity-determining regions (CDRs) of a heavy chain variable region (e.g., H1, H2, or H3) selected from the group consisting of: E30 The isolated antibody or antigen-binding fragment thereof of embodiment E29, wherein X1 is Q and X2 is E.

[0018] E31 The isolated antibody or antigen-binding fragment thereof of aspect E29 or E30, wherein X3 is S. E32 The isolated antibody or antigen-binding fragment thereof of any one of aspects E29 to E31, wherein X4 is S. E33 The isolated antibody or antigen-binding fragment thereof of any one of aspects E29 to E32, wherein X5 is Q. E34 The isolated antibody or antigen-binding fragment thereof of aspect E29, wherein X1 is Q, X2 is E, X3 is S, and X5 is Q. E35 The isolated antibody or antigen-binding fragment thereof of aspect E29, wherein X1 is Q, X2 is E, and X3 is S. E36 The isolated antibody or antigen-binding fragment thereof of aspect E29, wherein X1 is Q, X2 is E, X3 is S, X4 is S, and X5 is Q. E37 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence DYYMN (SEQ ID NO: 8); a CDR-H2 comprising the amino acid sequence WIDPDX1GX2TIYX3X4X5X6X7G (X1 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q; X2 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q; X3 is an amino acid, an amino acid other than D, a conservative substitution for D, or either D or E; X4 is an amino acid, an amino acid other than P, a conservative substitution for P, or either P, Q, D, or A; X5 is an amino acid, an amino acid other than K, a conservative substitution for K, or either K, S, or A; X6 is an amino acid, an amino acid other than F, a conservative substitution for F, or either F or V; and X7 is an amino acid, an amino acid other than Q, a conservative substitution for Q, or either Q or K) (SEQ ID NO: 167); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 10); Amino acid sequence RSTKSX8X9HFNGNX 10 YLF (X8 is an amino acid, an amino acid other than L, a conservative substitution of L, or either L or I; X9 is an amino acid, an amino acid other than L, a conservative substitution of L, or either L or S; X 10 is an amino acid, an amino acid other than T, a conservative substitution of T, or either T or S) (SEQ ID NO: 168); Amino acid sequence YX 11 X 12 SX13 LX 14 S(X 11 represents an amino acid, an amino acid other than Y, a conservative substitution of Y, either Y or A, X 12 is an amino acid, an amino acid other than M, a conservative substitution of M, either M or A, X 13 is an amino acid, an amino acid other than N, a conservative substitution of N, either N or S, X 14 is an amino acid, an amino acid other than A, a conservative substitution of A, or either A or Q (SEQ ID NO: 169); and / or Amino acid sequence X 15 QSX 16 X 17 X 18 PX 19 T(X 15 is an amino acid, an amino acid other than M, a conservative substitution of M, either M or Q, X 16 is an amino acid, an amino acid other than L, a conservative substitution of L, either L or Y, X 17 is an amino acid, an amino acid other than E, a conservative substitution of E, either E or S, X 18 represents an amino acid, an amino acid other than Y, a conservative substitution of Y, either Y or T, X 19 is an amino acid, an amino acid other than F, a conservative substitution of F, F, L, or W) (SEQ ID NO: 170); (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 22, 23, 24, 25, 26, and 27, or SEQ ID NOs: 22, 23, 24, 71, 72, and 73, respectively, and optionally X1 is Q, X2 is N, X3 is E, X4 is P, X5 is K, X6 is F and X7 is Q, X8 is L, X9 is S and X 10 is T, X 11 is Y, X 12 is M, X 13 is S and X 14 is A, and / or X 15 Q, X 16 is L, X 17 is E, X18 is Y and X 19 is F) An isolated antibody or antigen-binding fragment thereof comprising one, two, or three complementarity-determining regions (CDRs) of a heavy chain variable region (e.g., H1, H2, or H3) selected from the group consisting of: E38 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence DYYMN (SEQ ID NO: 8); CDR-H2 comprising the amino acid sequence WIDPDX1GNTIYX2PKX3QG (X1 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q; X2 is an amino acid, an amino acid other than D, a conservative substitution for D, or either D or E; and X3 is an amino acid, an amino acid other than F, a conservative substitution for F, or either F or V) (SEQ ID NO: 171); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 10); CDR-L1 comprising the amino acid sequence RSTKSLX4HFNGNTYLF (X4 is either an amino acid, an amino acid other than L, a conservative substitution of L, L, or S) (SEQ ID NO: 172); a CDR-L2 comprising the amino acid sequence YYX5SX6LAS (wherein X5 is an amino acid, an amino acid other than M, a conservative substitution for M, or either M or A, and X6 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or S) (SEQ ID NO: 173); and / or CDR-L3 comprising the amino acid sequence X7QSX8EYPFT (X7 is an amino acid, an amino acid other than M, a conservative substitution for M, or either M or Q, and X8 is an amino acid, an amino acid other than L, a conservative substitution for L, or either L or Y) (SEQ ID NO: 174); (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 22, 23, 24, 25, 26, and 27, or SEQ ID NOs: 22, 23, 24, 71, 72, and 73, respectively, and optionally X1 is Q, X2 is E and X3 is F, X4 is S, X5 is M and X6 is S; and / or X7 is Q and X8 is L) An isolated antibody or antigen-binding fragment thereof comprising one, two, or three complementarity-determining regions (CDRs) of a heavy chain variable region (e.g., H1, H2, or H3) selected from the group consisting of: E39 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences as defined by Kabat in a VH region comprising the amino acid sequence set forth in SEQ ID NO:6. E40 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to Kabat's definition of a VL region comprising the amino acid sequence set forth in SEQ ID NO:7.

[0019] E41 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences as defined by Kabat in a VH region comprising the amino acid sequence set forth in SEQ ID NO: 6, and one, two, or three CDR-L1 sequences as defined by Kabat in a VL region comprising the amino acid sequence set forth in SEQ ID NO: 7. E42 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Kabat definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 189, 190, or 191. E43 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Kabat definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 185 or 186. E44 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two or three of the CDR sequences according to the Kabat definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 189, 190 or 191, and one, two or three of the CDR sequences according to the Kabat definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 185 or 186. E45 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, (i) CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 14; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 15; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 16; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 17; CDR-L2 comprising the amino acid sequence shown in SEQ ID NO: 18, and CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO: 19; or (ii) CDR-H1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 14, but no more than two, three, or four changes; CDR-H2, which has at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 15, but not more than two, three, or four changes; a CDR-H3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) but not more than two, three, or four changes compared to the amino acid sequence set forth in SEQ ID NO: 16; a CDR-L1 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 17, but not more than two, three, or four changes; a CDR-L2 that has at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) but no more than two, three, or four changes compared to the amino acid sequence set forth in SEQ ID NO: 18; or a CDR-L3 having at least one amino acid change (e.g., substitution, deletion, or addition, e.g., conservative substitution) compared to the amino acid sequence set forth in SEQ ID NO: 19, but no more than two, three, or four changes; (Optionally, any of the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 (a) SEQ ID NOs: 28, 29, 30, 31, 32 and 33, respectively; or (b) SEQ ID NOs: 28, 29, 30, 74, 75 and 76, respectively (does not include the amino acid sequence shown in An isolated antibody or antigen-binding fragment thereof comprising one, two or three complementarity determining regions (CDRs) selected from: E46 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, a complementarity-determining region (CDR)-H2 comprising the amino acid sequence set forth in SEQ ID NO: 15; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 17, and CDR-L2 comprising the amino acid sequence shown in SEQ ID NO: 18 An isolated antibody or antigen-binding fragment thereof comprising one, two or three CDRs selected from: E47 CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 14, CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO: 15, and CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 16 The isolated antibody or antigen-binding fragment thereof of aspect E45 or E46, comprising: E48 CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 17; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 18, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 19 The isolated antibody or antigen-binding fragment thereof of any one of aspects E45 to E47, comprising: E49 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 14; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 15; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 16; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 17; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 18, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 19 1. An isolated antibody or antigen-binding fragment thereof comprising: E50 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence GFNIKDYYMN (SEQ ID NO: 14); CDR-H2 comprising the amino acid sequence WIDPDX1GN (X1 is any of an amino acid, an amino acid other than N, a conservative substitution of N, N, or Q) (SEQ ID NO: 135); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 16); CDR-L1 comprising the amino acid sequence STKSLX2HFNGNTYL (X2 is either an amino acid, an amino acid other than L, a conservative substitution for L, L, or S) (SEQ ID NO: 136); CDR-L2 comprising the amino acid sequence YYMSX3 (X3 is either an amino acid, an amino acid other than N, a conservative substitution for N, N, or S) (SEQ ID NO: 137); and CDR-L3 comprising the amino acid sequence QSLEYPFT (SEQ ID NO: 19); (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 28, 29, 30, 31, 32, and 33, respectively, or SEQ ID NOs: 28, 29, 30, 74, 75, and 76, respectively.) 1. An isolated antibody or antigen-binding fragment thereof comprising:

[0020] E51 The isolated antibody or antigen-binding fragment thereof according to aspect E50, wherein X1 is Q, X2 is S, and X3 is S. E52 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence GFNIX1DYYMN (X1 is any of an amino acid, an amino acid other than K, a conservative substitution of K, K, or A) (SEQ ID NO: 175); CDR-H2 comprising the amino acid sequence WIDPDX2GX3 (X2 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q, and X3 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or Q) (SEQ ID NO: 176); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 16); CDR-L1 comprising the amino acid sequence STKSX4X5HFNGNX6YL (X4 is an amino acid, an amino acid other than L, a conservative substitution for L, or either L or I; X5 is an amino acid, an amino acid other than L, a conservative substitution for L, or either L or S; and X6 is an amino acid, an amino acid other than T, a conservative substitution for T, or either T or S) (SEQ ID NO: 177); CDR-L2 comprising the amino acid sequence YX7X8SX9 (X7 is an amino acid, an amino acid other than Y, a conservative substitution for Y, or either Y or A; X8 is an amino acid, an amino acid other than M, a conservative substitution for M, or either M or A; and X9 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or S) (SEQ ID NO: 178); and Amino acid sequence QSX 10 X 11 X 12 PX 13 T(X 10 is an amino acid, an amino acid other than L, a conservative substitution of L, either L or Y, X 11 is an amino acid, an amino acid other than E, a conservative substitution of E, either E or S, X 12 represents an amino acid, an amino acid other than Y, a conservative substitution of Y, either Y or T, X 13is an amino acid, an amino acid other than F, a conservative substitution of F, F, L, or W) (SEQ ID NO: 197); (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 28, 29, 30, 31, 32, and 33, respectively, or SEQ ID NOs: 28, 29, 30, 74, 75, and 76, respectively, and optionally X1 is Q, X2 is N, X3 is E, X4 is P, X5 is K, X6 is F and X7 is Q, X8 is L, X9 is S and X 10 is T, X 11 is Y, X 12 is M, X 13 is S and X 14 is A, and / or X 15 Q, X 16 is L, X 17 is E, X 18 is Y and X 19 is F) An isolated antibody or antigen-binding fragment thereof. E53 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence GFNIKDYYMN (SEQ ID NO: 14); CDR-H2 comprising the amino acid sequence WIDPDX1GN (X1 is any of an amino acid, an amino acid other than N, a conservative substitution of N, N, or Q) (SEQ ID NO: 135); CDR-H3 comprising the amino acid sequence RLLMDY (SEQ ID NO: 16); CDR-L1 comprising the amino acid sequence STKSLX2HFNGNTYL (X2 is either an amino acid, an amino acid other than L, a conservative substitution for L, L, or S) (SEQ ID NO: 136); CDR-L2 comprising the amino acid sequence YYX3SX4 (X3 is an amino acid, an amino acid other than M, a conservative substitution for M, or either M or A, and X4 is an amino acid, an amino acid other than N, a conservative substitution for N, or either N or S) (SEQ ID NO: 179); and CDR-L3 comprising the amino acid sequence QSX5EYPFT (X5 is either an amino acid, an amino acid other than L, a conservative substitution for L, L, or Y) (SEQ ID NO: 180) (For example, the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not contain the amino acid sequences shown in SEQ ID NOs: 28, 29, 30, 31, 32, and 33, respectively, or SEQ ID NOs: 28, 29, 30, 74, 75, and 76, respectively, and optionally X1 is Q, X2 is S, X3 is M and X4 is S, and / or X5 is L) An isolated antibody or antigen-binding fragment thereof. E54 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to Chothia's definition of a VH region comprising the amino acid sequence set forth in SEQ ID NO:6. E55 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to Chothia's definition of a VL region comprising the amino acid sequence set forth in SEQ ID NO:7. E56 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Chothia definition in a VH region comprising the amino acid sequence shown in SEQ ID NO: 6, and one, two, or three CDR-L1 sequences according to the Chothia definition in a VL region comprising the amino acid sequence shown in SEQ ID NO: 7. E57 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Chothia definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 189, 190, or 191. E58 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Chothia definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 185 or 186. E59 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one, two, or three CDR sequences according to the Chothia definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 189, 190, or 191, and one, two, or three CDR sequences according to the Chothia definition of a polypeptide encoded by the nucleic acid sequence set forth in SEQ ID NO: 185 or 186.

[0021] E60 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VH framework region of a VH region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93. E61 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VL framework region of a VL region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47 to 69, or 92. E62 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48. E63 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11. E64 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions in the VH framework region of the VH region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93. E65 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions in the VH framework region of the VH region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47 to 69, or 92. E66. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence that comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions in the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48. E67 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence that comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 substitutions in the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11.

[0023] The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising an Fc region of murine IgG1 comprising one or more substitutions (e.g., E233P, E318A, K320A, and R322A) at positions E233, E318, K320, and R322 according to E68 EU numbering (see, e.g., U.S. Pat. No. 5,624,821), e.g., an Fc region of murine IgG1 comprising one or more E233P, E318A, K320A, and R322A substitutions. E69 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, comprising an Fc region of human IgG1 comprising one or more substitutions at positions L234, L235, and G237 according to EU numbering (e.g., L234A, L235A, and G237A), such as an Fc region of human IgG1 comprising one or more L234A, L235A, and G237A substitutions. E70 The antibody further comprises a VH region comprising a variant of the germline VH amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48, wherein the VH region comprises one or more substitutions at positions T28, F29, A49, R72, N74, A75, and / or L79, numbered according to the amino acid sequence set forth in SEQ ID NO: 127 (e.g., one or more substitutions selected from T28N, F29I, A49G, R72A, N74T, A75S, and L79A), and optionally the VH region comprises: (i) T28N and F29I; (ii) T28N, F29I and R72A; (iii) T28N, F29I, R72A, A49G, and L79A; (iv) T28N, F29I, R72A, N74T, and A75S; or (v) T28N, F29I, R72A, A49G, L79A, N74T and A75S, (i) to (v) are numbered according to the amino acid sequence set forth in SEQ ID NO: 127), and optionally the VH region comprises the following substitutions, as numbered according to the amino acid sequence set forth in SEQ ID NO: 127: T28N, F29I, R72A, A49G, L79A, N74T, and A75S.

[0022] E71 The antibody comprises, as numbered according to the amino acid sequence set forth in SEQ ID NO: 127: (a) 28th place Asn; (b) Ile, 29th place; (c) Gly at position 49; (d) Ala, ranked 72nd; (e) Thr at position 74; (f) Ser at position 75, and (g) 79th place Ala and optionally the VH region further comprises one or more (e.g., 2, 3, 4, 5, 6, or all) of the following amino acid sequences, numbered according to the amino acid sequence set forth in SEQ ID NO: 127: (i) Asn at position 28 and Ile at position 29; (ii) Asn at position 28, Ile at position 29, and Ala at position 72; (iii) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, and Ala at position 79; (iv) Asn at position 28, Ile at position 29, Ala at position 72, Thr at position 74, and Ser at position 75, or (v) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75 Including, in some cases,

[0023] The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the VH region comprises, in numbering according to the amino acid sequence set forth in SEQ ID NO: 127, Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75. E72 The antibody further comprises a VL region comprising a variant of the germline VL amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11, wherein the VH region comprises one or more substitutions at positions Y36 and / or L46 (e.g., Y36F and / or L46R) numbered according to the amino acid sequence set forth in SEQ ID NO: 128; Optionally, the VL region comprises: (i) L46R or (ii) L46R and Y36F

[0029] 1. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the VL region comprises a L46R substitution, as numbered in the amino acid sequence set forth in SEQ ID NO: 128: E73 The antibody comprises, as numbered according to the amino acid sequence set forth in SEQ ID NO: 128: (a) Tyr at 36th place; (b) Leu, ranked 46th and optionally the VL region comprises one or both of: (i) Leu at position 46, or (ii) Leu at position 46 and Tyr at position 36 Including, in some cases, 12. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the VL region comprises Leu at position 46, numbering according to the amino acid sequence set forth in SEQ ID NO: 128. E74 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising one or more CDRs according to any one of the preceding aspects, wherein the one or more CDRs have at least one amino acid alteration (e.g., substitution, deletion, or addition, e.g., conservative substitution), but no more than two, three, or four changes, and wherein the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 do not comprise the amino acid sequences set forth in SEQ ID NOs: 22, 23, 24, 25, 26, and 27, respectively; SEQ ID NOs: 22, 23, 24, 71, 72, and 73, respectively; SEQ ID NOs: 28, 29, 30, 31, 32, and 33, respectively; or SEQ ID NOs: 28, 29, 30, 74, 75, and 76, respectively. E75. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, further comprising a VH region comprising an amino acid sequence as set forth in Table 1. E76. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, further comprising a VL region comprising an amino acid sequence as set forth in Table 1. E77 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising a VH region comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the amino acid sequences set forth in SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93. E78 The isolated antibody or antigen-binding fragment thereof of aspect E77, comprising a VH region comprising the amino acid sequence set forth in SEQ ID NO:6. E79 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising a VL region comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the amino acid sequences set forth in SEQ ID NOs: 7, 47 to 69, or 92. E80 The isolated antibody or antigen-binding fragment thereof of aspect E79, comprising a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:7.

[0023] E81 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a VH region comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the amino acid sequences set forth in SEQ ID NOs: 6, 34 to 46, 88 to 91 or 93. E82 The isolated antibody or antigen-binding fragment thereof of aspect E81, comprising a VH region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:6. E83 The isolated antibody or antigen-binding fragment thereof of aspect E81 or E82, comprising a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:7. E84 The isolated antibody or antigen-binding fragment thereof of aspect E81, comprising a VH region comprising the amino acid sequence set forth in SEQ ID NO:6. E85 The isolated antibody or antigen-binding fragment thereof of aspect E84, comprising a VL region comprising the amino acid sequence set forth in SEQ ID NO:7. E86 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a VL region comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the amino acid sequences set forth in SEQ ID NOs: 7, 47 to 69 or 92. E87 The isolated antibody or antigen-binding fragment thereof of aspect E86, comprising a VL region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:7. E88 The isolated antibody or antigen-binding fragment thereof of aspect E86 or E87, comprising a VH region having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:6. E89 The isolated antibody or antigen-binding fragment thereof of aspect E86, comprising a VL region comprising an amino acid sequence selected from SEQ ID NOs: 7, 47-69, or 92. E90 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a VH region comprising the amino acid sequence set forth in SEQ ID NO: 39, wherein one or more amino acid residues in the amino acid sequence set forth in SEQ ID NO: 39 contain one or more amino acid substitutions selected from K30A, N55Q, N57Q, D61E, P62A, K63A, and F64V.

[0024] E91 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, wherein the antibody or antigen-binding fragment is selected from the group consisting of: (a) Ala, ranked 30th (b) Gln at position 55 (c) Gln at position 57 (d) Glu at position 61 (e) Ala, ranked 62nd (f) Ala at position 63, and (g) Val, ranked 64th An isolated antibody or antigen-binding fragment thereof, comprising a VH region comprising at least one of: E92 The amino acid sequence represented by SEQ ID NO: 39 is (i) N55Q and D61E, or (ii) N55Q, D61E and F64V and optionally said amino acid sequence as set forth in SEQ ID NO: 39 comprises N55Q and D61E substitutions. E93 The VH region is numbered according to the amino acid sequence shown in SEQ ID NO: 39. (i) Gln at position 55 and Glu at position 61, or (ii) Gln at position 55, Glu at position 61, and Val at position 64 and optionally said VH region comprises a Gln at position 55 and a Glu at position 61, numbered according to the amino acid sequence set forth in SEQ ID NO: 39. E94 The isolated antibody or antigen-binding fragment thereof according to aspect E90 or E92, further comprising a VL region comprising the amino acid sequence set forth in SEQ ID NO: 47, wherein one or more amino acid residues of said amino acid sequence set forth in SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, Y55A, M56A, N58S, A60Q, M94Q, L97Y, F101L, F101W, and Q105G, and optionally wherein one or more amino acid residues of said amino acid sequence set forth in SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, M56A, N58S, M94Q, L97Y, and Q105G. E95 Numbering according to the amino acid sequence shown in SEQ ID NO: 47: (a) Ser at position 30; (b) Ala, ranked 55th; (c) Ala, ranked 56th; (d) Ser at position 58; (e) Gln at position 60; (f) Gln at position 94; (g) Tyr, 97th; (h) Leu, 101st place; (i) Trp at position 101, and (j) Gly at position 105; and optionally the VL region comprises at least one of: (a) Ser at position 30; (b) Ala at position 56; (c) Ser at position 58; (d) Gln at position 94; (e) Tyr at position 97, and (f) Gly at position 105; The isolated antibody or antigen-binding fragment thereof of aspect E91 or E93, comprising at least one of: E96 The isolated antibody or antigen-binding fragment thereof of aspect E94, wherein said amino acid sequence set forth in SEQ ID NO: 47 comprises L30S, M56A, N58S, M94Q, L97Y and / or Q105G substitutions. E97 The isolated antibody or antigen-binding fragment thereof according to aspect E95, wherein the VL region comprises Ser at position 30, Ala at position 56, Ser at position 58, Gln at position 94, Tyr at position 97, and / or Gly at position 105, numbered according to the amino acid sequence set forth in SEQ ID NO:47. E98 The isolated antibody or antigen-binding fragment thereof of aspect E94, wherein said amino acid sequence set forth in SEQ ID NO:47 comprises a L30S, a N58S, a M94Q, and / or a Q105G substitution, optionally wherein said amino acid sequence set forth in SEQ ID NO:47 comprises all of the L30S, N58S, M94Q, and Q105G substitutions. E99 The isolated antibody or antigen-binding fragment thereof according to aspect E95, wherein the VL region comprises Ser at position 30, Ser at position 58, Gln at position 94, and / or Gly at position 105, numbered according to the amino acid sequence of SEQ ID NO: 47, and optionally the VL region comprises all of Ser at position 30, Ser at position 58, Gln at position 94, and Gly at position 105. E100 The isolated antibody or antigen-binding fragment thereof according to aspect E94, wherein said amino acid sequence set forth in SEQ ID NO: 39 comprises N55Q and D61E substitutions, and wherein said amino acid sequence set forth in SEQ ID NO: 39 comprises L30S, N58S, M94Q, and Q105G substitutions.

[0025] E101 The isolated antibody or antigen-binding fragment thereof according to aspect E95, wherein the VH region comprises a Gln at position 55 and a Glu at position 61, numbered according to the amino acid sequence set forth in SEQ ID NO: 39, and the VH region comprises a Ser at position 30, a Ser at position 58, a Gln at position 94, and a Gly at position 105, numbered according to the amino acid sequence set forth in SEQ ID NO: 47. E102 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a VL region comprising the amino acid sequence of SEQ ID NO: 47, wherein one or more amino acid residues in the amino acid sequence of SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, Y55A, M56A, N58S, A60Q, M94Q, L97Y, F101L, F101W, and Q105G, or a combination thereof (e.g., all of L30S, M56A, N58S, M94Q, L97Y, and Q105G), and optionally, wherein one or more amino acid residues in the amino acid sequence of SEQ ID NO: 47 comprise one or more amino acid substitutions selected from L30S, M56A, N58S, M94Q, L97Y, and Q105G. E103 The isolated antibody or antigen-binding fragment thereof of aspect E102, wherein said amino acid sequence set forth in SEQ ID NO: 47 comprises L30S, N58S, M94Q and / or Q105G substitutions. E104 The isolated antibody or antigen-binding fragment thereof according to aspect E102, further comprising a VH region comprising the amino acid sequence set forth in SEQ ID NO: 39, wherein said amino acid sequence set forth in SEQ ID NO: 39 comprises one or more amino acid substitutions selected from the group consisting of K30A, N55Q, N57Q, D61E, P62A, K63A and F64V, or a combination thereof. E105. The isolated antibody or antigen-binding fragment thereof of aspect E104, wherein said amino acid sequence set forth in SEQ ID NO: 39 comprises N55Q and D61E substitutions. E106 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising a heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of the amino acid sequences set forth in SEQ ID NO: 2 or 3. E107 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, further comprising a light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO:5. E108 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:6 and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:7. E109 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising the amino acid sequence shown in SEQ ID NO: 2 or 3, and a light chain comprising the amino acid sequence shown in SEQ ID NO: 5. E110 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, (a) a light chain comprising the amino acid sequence set forth in SEQ ID NO: 5, and (b) a heavy chain comprising the amino acid sequence shown in SEQ ID NO: 3, with or without a lysine residue at the C-terminus 1. An isolated antibody or antigen-binding fragment thereof comprising:

[0026] E111 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising the amino acid sequence encoded by an insert in a plasmid deposited with the ATCC under accession number PTA-124917, and a light chain comprising the amino acid sequence encoded by an insert in a plasmid deposited with the ATCC under accession number PTA-124918, or both. E112 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:2 or 3, optionally wherein the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:2. E113 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (e.g., 100%) sequence identity to the amino acid sequence set forth in SEQ ID NO:5, optionally wherein the light chain comprises the amino acid sequence set forth in SEQ ID NO:5, and optionally wherein the isolated antibody or antigen-binding fragment thereof further comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:2. E114 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising the amino acid sequence shown in SEQ ID NO:2 and a light chain comprising the amino acid sequence shown in SEQ ID NO:5. E115 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising a heavy chain comprising the amino acid sequence shown in SEQ ID NO:3 and a light chain comprising the amino acid sequence shown in SEQ ID NO:5. E116 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, further comprising a VH framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VH framework region (e.g., one, two, three, or all four of FR1, FR2, FR3, or FR4) of a VH region comprising the amino acid sequence of any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93, or an amino acid sequence having at least one but fewer than 20 amino acid changes, e.g., amino acid substitutions or deletions, in the amino acid sequence of the entire VH framework region (including FR1, FR2, FR3, and FR4). E117 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, further comprising a VL framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VL framework region (e.g., FR1, FR2, FR3, or FR4) of a VL region comprising the amino acid sequence of any one of SEQ ID NOs: 7, 47 to 69, or 92, or an amino acid sequence having at least one, two, three, four, five, six, seven, ten, or fifteen, but fewer than 20, amino acid changes, e.g., amino acid substitutions or deletions, in the amino acid sequence of the entire VL framework region (including FR1, FR2, FR3, and FR4). E118 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, comprising a VH framework region comprising an amino acid sequence that has at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the VH framework region (e.g., FR1, FR2, FR3 or FR4) of the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69 or IGHV3-48, or an amino acid sequence that has at least one, two, three, four, five, six, seven, ten, fifteen but fewer than twenty amino acid changes, e.g., amino acid substitutions or deletions, in the amino acid sequence of the entire VH framework region (including FR1, FR2, FR3 and FR4). E119 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, the antibody comprises a VH region comprising a variant of the germline VH amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48; the VH region comprises one or more substitutions at positions T28, F29, A49, R71, N73, A74, and / or L78 (e.g., one or more substitutions selected from T28N, F29I, A49G, R72A, N74T, A75S, and L79A) numbered according to the amino acid sequence set forth in SEQ ID NO: 127, and optionally the VH region comprises: (i) T28N and F29I; (ii) T28N, F29I and R72A; (iii) T28N, F29I, R72A, A49G, and L79A; (iv) T28N, F29I, R72A, N74T, and A75S; or (v) T28N, F29I, R72A, A49G, L79A, N74T, and A75S (wherein (i) to (v) are numbered according to the amino acid sequence set forth in SEQ ID NO: 127), and optionally the VH region comprises the following substitutions as numbered according to the amino acid sequence set forth in SEQ ID NO: 127: T28N, F29I, R72A, A49G, L79A, N74T, and A75S. E120 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody has the amino acid sequence shown in SEQ ID NO: 127, numbering of which follows: (a) 28th place Asn; (b) Ile, 29th place; (c) Gly at position 49; (d) Ala, ranked 72nd; (e) 74th place Thr (f) Ser at position 75, and (g) 79th place Ala and optionally, the VH region further comprises one or more (e.g., 2, 3, 4, 5, 6, or all) of the following amino acid sequences numbered according to the amino acid sequence set forth in SEQ ID NO: 127: (i) Asn at position 28 and Ile at position 29; (ii) Asn at position 28, Ile at position 29, and Ala at position 72; (iii) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, and Ala at position 79; (iv) Asn at position 28, Ile at position 29, Ala at position 72, Thr at position 74, and Ser at position 75, or (v) Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75 and optionally the VH region comprises Asn at position 28, Ile at position 29, Ala at position 72, Gly at position 49, Ala at position 79, Thr at position 74, and Ser at position 75, numbered according to the amino acid sequence of SEQ ID NO: 127.

[0027] E121 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, comprising a VL framework region (e.g., FR1, FR2, FR3, or FR4) that comprises an amino acid sequence that has at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11, or an amino acid sequence that has at least one, two, three, four, five, six, seven, ten, fifteen, but fewer than twenty, amino acid substitutions or deletions in the amino acid sequence of the entire VL framework region (including FR1, FR2, FR3, and FR4). E122 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibodies comprise a VL region comprising a variant of the germline VL amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11, wherein the VL region comprises one or more substitutions at positions Y36 and / or L46 (e.g., Y36F and / or L46R), numbered according to the amino acid sequence set forth in SEQ ID NO: 128; and optionally, the VH region comprises: (i) L46R, or (ii) L46R and Y36F (wherein (i) and (ii) are numbered according to the amino acid sequence set forth in SEQ ID NO: 128), and optionally the VH region is numbered according to the amino acid sequence set forth in SEQ ID NO: 128 and comprises the substitution L46R. E123 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, The antibody has the amino acid sequence shown in SEQ ID NO: 128, numbering of which is: (a) Tyr at position 36 and (b) Leu, ranked 46th and optionally the VL region comprises a VL region comprising one or both of: (i) Leu at position 46, or (ii) Leu at position 46 and Tyr at position 36 and optionally the VL region comprises Leu at position 46 numbering according to the amino acid sequence set forth in SEQ ID NO: 128. E124 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, An isolated antibody or antigen-binding fragment thereof, further comprising a mouse IgG1 Fc region containing one or more substitutions (e.g., E233P, E318A, K320A, and R322A) at positions E233, E318, K320, and R322 according to EU numbering (e.g., corresponding to the Fc region of human IgG1 shown in Table 1). E125. The isolated antibody or antigen-binding fragment thereof according to aspect E124, wherein the murine IgG1 Fc region comprises E233P, E318A, K320A, and R322A substitutions according to Eu numbering (e.g., corresponding to human IgG1 Fc shown in Table 1). E126 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 25; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 26, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 27 Including, An isolated antibody or antigen-binding fragment thereof, further comprising a human IgG1 Fc region comprising one or more substitutions (e.g., L234A, L235A, and G237A) at positions L234, L235, and G237 according to EU numbering (e.g., corresponding to the Fc region of human IgG1 shown in Table 1). E127 The isolated antibody or antigen-binding fragment thereof according to aspect E126, wherein said human IgG1 Fc region comprises the L234A, L235A, and G237A substitutions according to Eu numbering (e.g., corresponding to human IgG1 Fc shown in Table 1). E128 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, The antibody is an isolated antibody or an antigen-binding fragment thereof, further comprising a VH framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) of a VH region comprising the amino acid sequence of any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93. E129 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, The antibody is an isolated antibody or an antigen-binding fragment thereof, further comprising a VL framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) of a VL region comprising the amino acid sequence of any one of SEQ ID NOs: 7, 47 to 69, or 92. E130 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, wherein the antibody further comprises a VH framework region comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to a VH framework region (e.g., one, two, three or four of FR1, FR2, FR3 or FR4) of the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69 or IGHV3-48.

[0028] E131 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, further comprising a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11. E132 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, An isolated antibody or antigen-binding fragment thereof, further comprising a mouse IgG1 Fc region containing one or more substitutions (e.g., E233P, E318A, K320A, and R322A) at positions E233, E318, K320, and R322 according to EU numbering (e.g., corresponding to the Fc region of human IgG1 shown in Table 1). E133. The isolated antibody or antigen-binding fragment thereof according to aspect E132, wherein said murine IgG1 Fc region comprises E233P, E318A, K320A and R322A substitutions according to Eu numbering (e.g., corresponding to human IgG1 Fc shown in Table 1). E134 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 24; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 71; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 72, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 73 Including, comprising a human IgG1 Fc region containing L234A, L235A, and G237A substitutions according to EU numbering (e.g., corresponding to the Fc region of human IgG1 shown in Table 1); An isolated antibody or antigen-binding fragment thereof. E135 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 31; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 32, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 33 Including, The antibody is an isolated antibody or an antigen-binding fragment thereof, further comprising a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VH framework region of a VH region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93. E136 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 74; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 75, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 76 Including, The antibody is an isolated antibody or an antigen-binding fragment thereof, further comprising a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity to a VH framework region of a VH region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, or 93. E137 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 31; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 32, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 33 Including, The antibody is an isolated antibody or an antigen-binding fragment thereof, further comprising a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity with the VL framework region of a VL region comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47 to 69, or 92. E138 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 31; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 32, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 33 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, further comprising a VH framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the germline amino acid sequence of IGHV3-07, IGHV1-46, IGHV3-23, IGHV3-30, IGHV1-69, or IGHV3-48. E139 An isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 31; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 32, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 33 Including, The antibody is an isolated antibody or antigen-binding fragment thereof, further comprising a VL framework region (e.g., one, two, three, or four of FR1, FR2, FR3, or FR4) comprising an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the germline amino acid sequence of IGKV1-39, IGKV2-28, IGKV2-30, IGKV4-1, or IGKV3-11. E140 An isolated antibody or antigen-binding fragment thereof, CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 28; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 29; CDR-H3 comprising the amino acid sequence shown in SEQ ID NO: 30; CDR-L1 comprising the amino acid sequence shown in SEQ ID NO: 31; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 32, and CDR-L3 comprising the amino acid sequence shown in SEQ ID NO: 33 Including, An isolated antibody or antigen-binding fragment thereof comprising a human IgG1 Fc region containing one or more substitutions (e.g., L234A, L235A, and G237A) at positions L234, L235, and G237 according to EU numbering (e.g., corresponding to the Fc region of human IgG1 shown in Table 1).

[0029] E141 The isolated antibody or antigen-binding fragment thereof according to aspect E140, wherein said human IgG1 Fc region comprises L234A, L235A, and G237A substitutions according to Eu numbering (e.g., corresponding to human IgG1 Fc shown in Table 1). E142 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the antibody is a multispecific antibody (e.g., a bispecific antibody). E143 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, wherein the antibody is a multivalent antibody (e.g., a bivalent antibody). E144 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, wherein said antibody is a humanized antibody, a human antibody, a murine antibody, a chimeric antibody or a camelid antibody. E145 An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, comprising a VH domain and a VL domain, The VH region and the VL region are (i) the amino acid sequences set forth in SEQ ID NOs: 6 and 7, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (ii) an amino acid sequence set forth in SEQ ID NOs: 34 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (iii) an amino acid sequence set forth in SEQ ID NOs: 34 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (iv) an amino acid sequence set forth in SEQ ID NOs: 34 and 66, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (v) an amino acid sequence set forth in SEQ ID NOs: 34 and 63, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (vi) an amino acid sequence set forth in SEQ ID NOs: 34 and 64, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; (vii) an amino acid sequence set forth in SEQ ID NOs: 37 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (viii) an amino acid sequence set forth in SEQ ID NOs: 37 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (ix) an amino acid sequence set forth in SEQ ID NOs: 37 and 66, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (x) an amino acid sequence set forth in SEQ ID NOs: 37 and 63, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xi) an amino acid sequence set forth in SEQ ID NOs: 37 and 64, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xii) an amino acid sequence set forth in SEQ ID NOs: 36 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xiii) an amino acid sequence set forth in SEQ ID NOs: 36 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xiv) an amino acid sequence set forth in SEQ ID NOs: 36 and 66, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xv) an amino acid sequence set forth in SEQ ID NOs: 36 and 63, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xvi) an amino acid sequence set forth in SEQ ID NOs: 36 and 64, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xvii) an amino acid sequence set forth in SEQ ID NOs: 35 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xviii) an amino acid sequence set forth in SEQ ID NOs: 35 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xix) an amino acid sequence set forth in SEQ ID NOs: 35 and 66, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xx) an amino acid sequence set forth in SEQ ID NOs: 35 and 63, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxi) an amino acid sequence set forth in SEQ ID NOs: 35 and 64, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxii) an amino acid sequence set forth in SEQ ID NOs: 38 and 65, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxiii) an amino acid sequence set forth in SEQ ID NOs: 38 and 62, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxiv) an amino acid sequence set forth in SEQ ID NOs: 38 and 66, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxv) an amino acid sequence set forth in SEQ ID NOs: 38 and 63, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxvi) an amino acid sequence set forth in SEQ ID NOs: 38 and 64, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxvii) an amino acid sequence set forth in SEQ ID NOs: 20 and 21, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxviii) an amino acid sequence set forth in SEQ ID NOs: 88 and 47, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxix) an amino acid sequence set forth in SEQ ID NOs: 89 and 47, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxx) an amino acid sequence set forth in SEQ ID NOs: 90 and 47, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxi) an amino acid sequence set forth in SEQ ID NOs: 90 and 92, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxii) an amino acid sequence set forth in SEQ ID NOs: 39 and 47, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxiii) an amino acid sequence set forth in SEQ ID NOs: 6 and 67, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxiv) an amino acid sequence set forth in SEQ ID NOs: 6 and 68, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxv) an amino acid sequence set forth in SEQ ID NOs: 6 and 69, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxvi) an amino acid sequence set forth in SEQ ID NOs: 93 and 67, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxvii) an amino acid sequence set forth in SEQ ID NOs: 93 and 68, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto; (xxxviii) an amino acid sequence set forth in SEQ ID NOs: 93 and 69, respectively, or an amino acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or preferably 100% sequence identity thereto; or (xxxix) The amino acid sequences set forth in SEQ ID NOs: 93 and 7, respectively, or amino acid sequences having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% sequence identity thereto. and optionally the VH and VL regions comprise (i) SEQ ID NOs: 6 and 7, respectively; (ii) SEQ ID NOs: 34 and 65, respectively; (iii) SEQ ID NOs: 34 and 62, respectively; (iv) SEQ ID NOs: 34 and 66, respectively; (v) SEQ ID NOs: 34 and 63, respectively; (vi) SEQ ID NOs: 34 and 64, respectively; (vii) SEQ ID NOs: 37 and 65, respectively; (viii) SEQ ID NOs: 37 and 62, respectively; (ix) SEQ ID NOs: 37 and 66, respectively; (x) SEQ ID NOs: 37 and 63, respectively; (xi) SEQ ID NOs: 37 and 64, respectively; (xii) SEQ ID NOs: 36 and 65, respectively; (xiii) SEQ ID NOs: 36 and 62, respectively; (xiv) SEQ ID NOs: 36 and 66, respectively; (xv) SEQ ID NOs: 36 and 63, respectively; (xvi) SEQ ID NOs: 36 and 64, respectively; (xvii) SEQ ID NOs: 35 and 65, respectively; (xviii) SEQ ID NOs: 35 and 62, respectively; (xix) SEQ ID NOs: 35 and 66, respectively; (xx) SEQ ID NOs: 35 and 63, respectively; (xxi) SEQ ID NOs: 35 and 64, respectively; (xxii) SEQ ID NOs: 38 and 65, respectively; (xxiii) SEQ ID NOs: 38 and 62, respectively; (xxiv) SEQ ID NOs: 38 and 66, respectively; (xxv) SEQ ID NOs: 38 and 63, respectively; (xxvi) SEQ ID NOs: 38 and 64, respectively; (xxvii) SEQ ID NOs: 20 and 21, respectively; (xxviii) SEQ ID NOs: 88 and 47, respectively; (xxix) SEQ ID NOs: 89 and 47, respectively; (xxx) SEQ ID NOs: 90 and 47, respectively; (xxxi) SEQ ID NOs: 90 and 92, respectively; (xxxii) SEQ ID NOs: 39 and 47, respectively; (xxxiii) SEQ ID NOs: 6 and 67, respectively; (xxxiv) SEQ ID NOs: 6 and 68, respectively; (xxxv) SEQ ID NOs: 6 and 69, respectively; (xxxvi) SEQ ID NOs: 93 and 67, respectively; (xxxvii) SEQ ID NOs: 93 and 68, respectively; (xxxviii) SEQ ID NOs: 93 and 69, respectively; or (xxxix) SEQ ID NOs: 93 and 7, respectively An isolated antibody or antigen-binding fragment thereof comprising the amino acid sequence shown below. E146 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, comprising or having a heavy chain constant region (Fc) chosen from, e.g., the heavy chain constant region of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE. E147 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, wherein said antibody belongs to an isotype selected from IgG1, IgG2, IgG3, IgG4 or variants thereof. E148 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody comprises a heavy chain constant region of IgG1 or IgG2 (e.g., human IgG1 or human IgG2). E149 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, wherein the antibody or antigen-binding fragment comprises or has a heavy chain constant region of human IgG1. E150. The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, comprising or having a light chain constant region chosen from, e.g., a kappa or lambda light chain constant region.

[0030] E151 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising or having a kappa light chain (e.g., human kappa light chain) constant region. E152 The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, comprising an Fc region of a heavy chain having a modified hinge region to reduce effector cell function. E153 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, having reduced antibody-dependent cellular cytotoxicity (ADCC) activity and / or complement-dependent cytotoxicity (CDC) activity. E154. The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, comprising a hinge region with a substitution at least one of positions L234, L235 or G237 according to EU numbering, e.g., relative to human IgG1. E155 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising a human IgG1 Fc region having at least one substitution selected from L234A, L235A, and G237A according to EU numbering. E156 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having a hinge region comprising the amino acid sequence EPKSCDKTHTCPPCPAPEAAGAP (SEQ ID NO: 126). E157 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody or antigen-binding fragment has been modified to remove immunogenic T-cell epitopes. E158 The isolated antibody or antigen-binding fragment thereof according to aspect E157, comprising a VL comprising at least one substitution selected from the group consisting of L30S, N58S, M56A, M94Q, L97Y, and Q105G, numbered according to the amino acid sequence set forth in SEQ ID NO: 47. E159 The antibody or antigen-binding fragment thereof has at least one of the following characteristics (i) to (xii): (i) a binding affinity (KD) for human αvβ8 integrin that is less than that of the murine antibody ADWA11, e.g., a KD of less than about 536 pM; (ii) a KD for purified human αvβ8 integrin that is ≤100 pM; (iii) KD for mouse αvβ8 integrin that is less than 100 pM; (iv) KD for cynomolgus monkey αvβ8 integrin that is less than 100 pM; (v) KD for rat αvβ8 integrin, which is approximately 160 pM; (vi) approximately equivalent affinity for at least two, three, or all of the human, cynomolgus monkey, mouse, and rat αββ integrins, e.g., a KD of less than 100 pM as determined by a Biacore affinity assay; (vii) an IC50 for inhibiting TGFβ transactivation that is less than 183 pM; (viii) IC50 for inhibition of TGFβ transactivation in U251 cells of about 100 pM to about 300 pM; (ix) an EC50 against U251 cells of about 100 pM to about 400 pM; (x) EC50 against C8-S cells of about 110 pM to about 180 pM; (xi) Predicted value of at least one human pharmacokinetic (PK) parameter selected from the following a to e: a Chestnut clearance from the central compartment (CL) which is approximately 0.12–0.15 mL / h / kg; b Intercompartmental distribution clearance (CLF) which is approximately 0.15–0.51 mL / h / kg; c Volume of distribution of the central compartment (V1), which is approximately 36–39 mL / kg; d a volume of distribution (V2) in the peripheral compartment that is approximately 21–33 mL / kg; and / or e Half-life (t) of approximately 12 to 17 days 1 / 2 ); and (xii) Absence of detectable binding to human Fcγ receptors or C1q 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having: E160 The antibody or antigen-binding fragment thereof has at least one of the following characteristics: (i) It specifically binds to αvβ8 integrin but not to other integrins; (ii) reducing the interaction of αvβ8 integrin with latency-associated peptide (LAP); (iii) reducing TGF-β signaling; (iv) effectively block TGFβ activation by αvβ8 integrin with an IC50 of 10 nM or less; (v) have a comparable Kd (within 5-fold) to the nonhuman primate (NHP) ortholog; (vi) selectively binds to human αvβ8, but does not detectably bind to αvβ8 homologs (e.g., αvβ1, αvβ3, αvβ5, and αvβ6); (vii) alone or in combination with an immunomodulator (e.g., a modulator of a checkpoint inhibitor such as an inhibitor of PD-1, PD-L1, or CTLA-4, or an agonist of a stimulatory molecule such as 4-1BB), causes growth inhibition and / or complete tumor regression in humans or animal models of cancer selected from, for example, squamous cell carcinoma, breast cancer, and colon cancer; (i) in combination with anti-cancer treatments such as radiation therapy, induce growth inhibition and / or complete tumor regression in animal models of cancer; (ii) reduces tumor growth by at least 60% in a syngeneic tumor xenograft model when administered alone or in combination with an immunomodulator (e.g., blockade of PD-1, PD-L1, or CTLA-4), e.g., at a dose of 10 mg / kg or less; (iii) when administered to a subject (e.g., a mouse or a human), increases an anti-tumor response in the presence of one or more immunomodulatory agents (e.g., an antagonist of a checkpoint inhibitor or an agonist of a checkpoint activator, such as an antagonist of PD-1, PD-L1, or CTLA-4, or an activator of the immune response, such as a 4-1BB agonist); (iv) effective regardless of αvβ8 integrin expression in tumor models; (v) It can increase CD8+GzmB+ T cells in the tumor microenvironment, for example, alone; (vi) reduces tumor growth, e.g., by at least 80%, when used in combination with a checkpoint inhibitor antagonist (e.g., an anti-PD-1 or anti-PD-L1 antibody), e.g., in syngeneic models of squamous cell carcinoma, breast cancer, and / or colon cancer; (i) Demonstrate a statistically significant improvement in overall survival of subjects by Kaplan-Meier analysis; (ii) good thermal stability; (iii) little aggregation at high concentrations; and (iv) able to demonstrate reproducible expression and purity under large-scale manufacturing conditions; 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having:

[0031] E161 The antibody or antigen-binding fragment thereof has at least one of the following characteristics (i) to (xvi): (i) a binding affinity (KD) for human αvβ8 integrin that is less than the KD of the murine antibody ADWA11, e.g., a KD of less than about 536 pM; (ii) a KD for purified human αvβ8 integrin that is ≤100 pM; (iii) KD for mouse αvβ8 integrin that is less than 100 pM; (iv) KD for cynomolgus monkey αvβ8 integrin that is less than 100 pM; (v) KD for rat αvβ8 integrin, which is approximately 160 pM; (vi) approximately equivalent affinity for at least two, three, or all of the human, cynomolgus monkey, mouse, and rat αββ integrins, e.g., a KD of less than 100 pM as determined by a Biacore affinity assay; (vii) an IC50 for inhibiting TGFβ transactivation that is less than 183 pM; (viii) IC50 for inhibition of TGFβ transactivation in U251 cells of about 100 pM to about 300 pM; (ix) EC50 against U251 cells, which is approximately 126 pM (± 34 pM, standard deviation); (x) EC50 against U251 cells, which is approximately 256 pM (± 115 pM, standard deviation); (xi) EC50 against U251 cells, which is about 80 pM to about 400 pM; (xii) EC50 against C8-S cells, which is approximately 115 pM; (xiii) EC50 against C8-S cells, which is approximately 145 pM (±23.7 pM, standard deviation); (xiv) EC50 against C8-S cells of approximately 110 pM to approximately 180 pM, standard deviation); (xv) Predicted value of at least one human pharmacokinetic (PK) parameter selected from the following a to e: a Clearance (CL) from the central compartment, which is approximately 0.12–0.15 mL / h / kg; b Intercompartmental distribution clearance (CLF) which is approximately 0.15–0.51 mL / h / kg; c Volume of distribution of the central compartment (V1), which is approximately 36–39 mL / kg; d a volume of distribution (V2) in the peripheral compartment that is approximately 21–33 mL / kg; and / or e Half-life (t) of approximately 12 to 17 days 1 / 2 ); and (xvi) Absence of detectable binding to human Fcγ receptors or C1q 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, having: E162 Purified human αvβ8 integrin has a K of 100 pM or lessD 10. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, which binds to human αvβ8 integrin at E163 K<536 pM for human αvβ8 integrin D 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody or antigen-binding fragment thereof binds to E164 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, which inhibits activation of TGFβ with an IC50 of less than 183 pM. E165 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, which inhibits activation of TGFβ with an IC50 of between 100 pM and about 300 pM. 2. The isolated antibody or antigen-binding fragment thereof of any one of the preceding embodiments, which inhibits activation of TGFβ with an IC50 of 199±93.6 pM in E166 U251 cells. E167 A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of the preceding aspects and a pharmaceutically acceptable carrier or excipient. E168. A nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of aspects E1 to E166. E169 (i) a nucleic acid sequence encoding a heavy chain having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1, 183, 189 or 191; (ii) a nucleic acid sequence encoding a heavy chain variable region having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 190; (iii) a nucleic acid sequence encoding a heavy chain constant region having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 192; or (iv) A nucleic acid comprising a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence of the insert of the plasmid deposited with the American Type Culture Collection (ATCC) having accession number PTA-124917. E170 (i) a nucleic acid sequence encoding a light chain having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4 or 185; (ii) a nucleic acid sequence encoding a light chain variable region having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 186; (iii) a nucleic acid sequence encoding a light chain constant region having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98%, or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 194; or (iv) A nucleic acid comprising a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in the nucleic acid sequence of the insert of the plasmid deposited with the American Type Culture Collection (ATCC) having accession number PTA-124918.

[0032] E171 A nucleic acid comprising a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1 or 183, and a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4. E172 A nucleic acid comprising a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 189 or 191, and a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 185. E173 A vector comprising the nucleic acid of any one of aspects E168 to E172. E174. A host cell comprising a nucleic acid according to any one of aspects E168 to E172 or a vector according to aspect E173. E175 The host cell of aspect E174, wherein said host cell is a mammalian cell, eg, a human cell. E176. The host cell according to aspect E175, wherein said host cell is a CHO cell, a COS cell, a HEK293 cell, an NSO cell, a PER.C6® cell or an Sp2.0 cell. E177 A method for producing an isolated antibody or antigen-binding fragment thereof that specifically binds to human αvβ8 integrin, comprising culturing a host cell according to any one of aspects E174 to E176 under conditions such that the host cell expresses the antibody or antigen-binding fragment. E178 The method of aspect E177, further comprising isolating said antibody or antigen-binding fragment thereof. E179 A method of reducing TGFβ signaling in a subject in need thereof, said method comprising administering to a subject in need thereof a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166 or the pharmaceutical composition according to aspect E167. E180 A method of reducing the activity of αvβ8 integrin in a subject in need thereof, said method comprising administering to a subject in need thereof a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166 or the pharmaceutical composition according to aspect E167.

[0033] E181 A method for treating a disease, disorder or condition associated with or mediated by aberrant (e.g. increased) TGFβ signaling, the method comprising administering to a subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166, or a pharmaceutical composition according to aspect E167. E182 A method of inducing an anti-tumor response in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166 or a pharmaceutical composition according to aspect E167, optionally wherein said antibody or antigen-binding fragment thereof is administered in combination with a second treatment, optionally wherein administration of said antibody or antigen-binding fragment thereof and said second treatment are administered simultaneously, sequentially or separately, and optionally wherein (i) the antibody or antigen-binding fragment thereof is administered before the second treatment; or (ii) the antibody or antigen-binding fragment thereof is administered after the second treatment. E183 The antibody or antigen-binding fragment thereof of any one of aspects E1 to E166 or the pharmaceutical composition of aspect E167 for use in reducing the activity of αvβ8 integrin in a subject. E184 A method of treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166, or the pharmaceutical composition according to aspect E167. E185 The antibody or antigen-binding fragment thereof has at least one of the following characteristics (i) to (xvii): (i) specifically binds to αvβ8 integrin (e.g., human, mouse, cynomolgus monkey, and / or rat αvβ8 integrin); (ii) reducing the interaction of αvβ8 integrin with latency-associated peptide (LAP); (iii) reducing TGF-β signaling; (iv) inhibit TGFβ activation by αvβ8 integrin with an IC50 of 10 nM or less; (v) have a comparable Kd (within 5-fold) to the nonhuman primate (NHP) ortholog; (vi) selectively binds to human αvβ8, but does not detectably bind to αvβ8 homologs (e.g., αvβ1, αvβ3, αvβ5, and αvβ6); (vii) alone or in combination with an immunomodulator (e.g., a modulator of a checkpoint inhibitor such as an inhibitor of PD-1, CTLA-4, or an agonist of a stimulatory molecule such as 4-1BB), causes growth inhibition and / or complete tumor regression in an animal model of cancer selected from, for example, squamous cell carcinoma, breast cancer, and colon cancer; (viii) in combination with anti-cancer treatments such as radiation therapy, causing growth inhibition and / or complete tumor regression in animal models of cancer; (ix) reduces tumor growth by at least 60% in a syngeneic tumor xenograft model, e.g., when administered at 10 mg / kg or less; (x) when administered to a subject (e.g., a mouse or a human), increases an anti-tumor response in the presence of one or more immunomodulatory agents (e.g., a checkpoint inhibitor antagonist, such as a PD-1 or CTLA-4 antagonist, or an activator of the immune response, such as a 4-1BB agonist); (xi) effective regardless of αvβ8 integrin expression in tumor models; (xii) is sufficient, e.g., alone, to increase CD8+GzmB+ T cells in the tumor microenvironment; (xiii) reduces tumor growth by at least 80% when used in combination with a checkpoint inhibitor antagonist (e.g., an anti-PD-1 or anti-PD-L1 antibody), e.g., in syngeneic models of squamous cell carcinoma, breast cancer, and / or colon cancer; (xiv) demonstrates a statistically significant improvement in overall survival of a subject (e.g., human or mouse) by Kaplan-Meier analysis; (xv) excellent thermal stability; (xvi) little aggregation at high concentrations; and (xvii) capable of demonstrating reproducible expression and purity under large-scale manufacturing conditions; The method of embodiment E184, having the following structure: E186 The antibody or antigen-binding fragment thereof has at least one of the following characteristics (i) to (xvii): (i) a binding affinity (KD) for human αvβ8 integrin that is less than the KD of the murine antibody ADWA11, e.g., a KD of less than about 536 pM; (ii) a KD for purified human αvβ8 integrin that is ≤100 pM; (iii) KD for mouse αvβ8 integrin that is less than 100 pM; (iv) KD for cynomolgus monkey αvβ8 integrin that is less than 100 pM; (v) KD for rat αvβ8 integrin, which is approximately 160 pM; (vi) approximately equivalent affinity for at least two, three, or all of the human, cynomolgus monkey, mouse, and rat αββ integrins, e.g., a KD of less than 100 pM as determined by a Biacore affinity assay; (vii) an IC50 for inhibiting TGFβ transactivation that is less than 183 pM; (viii) IC50 for inhibition of TGFβ transactivation in U251 cells, which is approximately 199±93.6pM; (ix) an IC50 for inhibiting TGFβ transactivation of about 100 pM to about 300 pM; (x) EC50 against U251 cells, which is approximately 126 pM (± 34 pM, standard deviation); (xi) EC50 against U251 cells, which is approximately 256 pM (±115 pM, standard deviation); (xii) an EC50 against U251 cells of about 80 pM to about 400 pM; (xiii) EC50 against C8-S cells, which is approximately 115 pM; (xiv) EC50 against C8-S cells, which is approximately 145 pM (±23.7 pM, standard deviation); (xv) EC50 against C8-S cells of approximately 110 pM to approximately 180 pM, standard deviation); (xvi) Predicted value of at least one human pharmacokinetic (PK) parameter selected from the following a. to e. a. Clearance from the central compartment (CL) of approximately 0.12–0.15 mL / h / kg; b. Intercompartmental distribution clearance (CLF) of approximately 0.15–0.51 mL / h / kg; c. Volume of distribution of the central compartment (V1) which is approximately 36-39 mL / kg; d. A volume of distribution (V2) in the peripheral compartment of approximately 21-33 mL / kg; and / or e. Half-life (t) of approximately 15-17 days 1 / 2 );and (xvii) absence of detectable binding to human Fcγ receptors or C1q; The method of embodiment E184 or E185, comprising: E187 The method of any one of aspects E184 to E186, wherein the antibody or antigen-binding fragment thereof is of any one of aspects E1 to E166. E188 The method of any one of aspects E184 to E187, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase infiltration of CD45+ cells, CD3+ T cells, CD4+ T cells, CD8+ T cells and / or granzyme B-expressing cells. E189 The method of any one of aspects E184 to E188, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase infiltration of CD8+ T cells. E190 The method of any one of aspects E184 to E189, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase expression of Granzyme B in CD8+ T cells.

[0034] E191 The method of any one of aspects E184 to E190, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to increase accumulation of inflammatory macrophages with elevated expression of Ly6G. E192 The antibody or antigen-binding fragment thereof is CD45+CD11b+CD11c-Ly6G-Ly6C 高 CD206 低 The method of any one of aspects E184 to E191, wherein the compound is administered in an amount sufficient to increase accumulation of inflammatory macrophages. E193 The method of any one of aspects E184 to E192, wherein the antibody or antigen-binding fragment thereof is administered in an amount sufficient to enhance the response to the second treatment. E194 The method of any one of aspects E184 to E193, wherein the efficacy of the antibody or antigen-binding fragment thereof when administered to an animal tumor model is independent of expression of αvβ8 integrin in the tumor model. E195 The method of any one of aspects E184 to E194, wherein the administration of the antibody or antigen-binding fragment thereof is in combination with a second treatment. E196 The method of aspect E195, wherein said second treatment comprises an anti-cancer therapy, eg, a cytotoxic or cytostatic agent such as a chemotherapeutic agent, a hormone therapy, a vaccine, and / or an immunotherapy. E197 The method of aspect E195 or E196, wherein said second treatment is or comprises surgery, radiation therapy, cryosurgery and / or thermotherapy. E198 The method of any one of aspects E195 to E197, wherein said second treatment comprises a modulator (e.g., inhibitor or agonist) of an immune checkpoint molecule, and optionally said second treatment is, or comprises, a modulator of an immune checkpoint molecule selected from the group consisting of PD-1, PD-L1, 4-1BB, OX40, CTLA-4, PD-L2, TIM-3, LAG-3, VISTA, CD160, BTLA, TIGIT, 2B4, TGFβ, LAIR1, and combinations thereof. E199. The method of aspect E198, wherein said inhibitor of an immune checkpoint molecule is an inhibitor of PD-1, PD-L1, CTLA-4, PD-L2, TIM-3, LAG-3, VISTA, BTLA, TIGIT, 2B4, TGFβ, or LAIR1. E200 The method of embodiment E199, wherein said inhibitor of an immune checkpoint molecule is an inhibitor of PD-1, eg, an antibody against PD-1.

[0035] E201 The method of aspect E199, wherein the inhibitor of an immune checkpoint molecule is an inhibitor of CTLA-4, eg, an antibody to CTLA-4 or a soluble CTLA-4 fusion. E202 The method of any one of aspects E195 to E201, wherein said second treatment comprises an agonist of a costimulatory molecule. E203. The method of aspect E202, wherein said costimulatory molecule is selected from at least one of 4-1BB (CD137), OX40, CD2, CD27, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), GITR, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, or B7-H3. E204 The method of embodiment E202, wherein said agonist of a costimulatory molecule is an agonist of 4-1BB. E205 The method of any one of aspects E195 to E204, wherein said second treatment comprises an inhibitor of PARP1 (e.g., olaparib, rucaparib, niraparib, veliparib, iniparib, talazoparib, 3-aminobenzamide, CEP 9722, E7016, BSI-201, KU-0059436, AG014699, MK-4827, or BGB-290). E206 The method according to any one of aspects E184 to E205, wherein said cancer is selected from the group consisting of solid tumors, hematological cancers (e.g., leukemia, lymphoma, myeloma such as multiple myeloma), and metastatic lesions. E207 The method of embodiment E206, wherein said cancer is a solid tumor. E208 The method according to aspect E206 or E207, wherein the cancer is a solid tumor and is selected from malignant tumors, e.g., sarcomas and carcinomas, e.g., adenocarcinomas of various organs, such as those affecting the lung (e.g., non-small cell lung cancer (NSCLC)), breast, ovarian, lymphoid, gastrointestinal (e.g., colon), anal, genital and genitourinary tract (e.g., kidney, urinary tract, bladder, prostate), pharynx, CNS (e.g., brain, neural or glial cells), head and neck (e.g., squamous cell carcinoma of the head and neck (HNSCC)), skin (e.g., melanoma, such as advanced melanoma), pancreas, colon, rectum, kidney (e.g., renal cell carcinoma), liver, small intestine and esophageal cancer, gastroesophageal cancer, thyroid cancer, and cervical cancer. E209 The method of any one of aspects E184 to E208, wherein the cancer is a lymphoproliferative disorder (e.g., post-transplant lymphoproliferative disorder), a hematological cancer, T-cell lymphoma, B-cell lymphoma, non-Hodgkin's lymphoma, or leukemia (e.g., myeloid leukemia or lymphocytic leukemia). E210 The method of any one of aspects E184 to E209, wherein said cancer is early stage, intermediate stage, late stage, or metastatic cancer.

[0036] E211 The method of any one of aspects E184 to E210, wherein said cancer is selected from the group consisting of renal cell carcinoma, ovarian cancer, and squamous cell carcinoma of the head and neck. E212 The method of embodiment E211, further comprising administering an inhibitor of a checkpoint molecule, eg, an inhibitor of PD-1, PD-L1, or CTLA-4. E213 The method of embodiment E212, wherein said inhibitor of PD-1 is not avelumab. E214 The method of embodiment E211 or E212, wherein said cancer is a kidney cancer, such as renal cell carcinoma (RCC). E215 The method of aspect E214, wherein said cancer is a kidney cancer selected from the group consisting of metastatic RCC, clear cell renal cell carcinoma (ccRCC), non-clear cell renal cell carcinoma (ncRCC), and high-risk renal cell carcinoma. E216 The method of aspect E215, wherein the antibody or antigen-binding fragment thereof is administered as a first or second line treatment. E217 The method of any one of aspects E184 to E216, wherein the antibody or antigen-binding fragment thereof is administered as a first line treatment. E218 The method of any one of aspects E184 to E216, wherein the antibody or antigen-binding fragment thereof is administered as a second line treatment. E219 The method of any one of aspects E184 to E212, wherein said cancer is ovarian cancer. E220 The method of aspect E219, wherein said second-line treatment is an inhibitor of PARP1 (e.g., olaparib, rucaparib, niraparib, veliparib, iniparib, talazoparib, 3-aminobenzamide, CEP 9722, E7016, BSI-201, KU-0059436, AG014699, MK-4827, or BGB-290).

[0037] E221 The method of aspect E219, wherein the antibody or antigen-binding fragment thereof is administered as a second line treatment, and optionally, the subject is platinum resistant. E222 The method of aspect E219, wherein the antibody or antigen-binding fragment thereof is administered as a second line treatment. E223 The method of any one of aspects E184 to E222, wherein said cancer is squamous cell carcinoma of the head and neck. E224 The method of embodiment E223, wherein said method further comprises radiation therapy. E225 The method of aspect E223 or E224, wherein said cancer is platinum-resistant and / or relapsed cancer. E226 The method according to any one of aspects E179 to E225, wherein the subject is a human. E227 The method according to any one of aspects E179 to E226, wherein the antibody or antigen-binding fragment thereof or pharmaceutical composition is administered intravenously. E228 The method according to any one of aspects E179 to E227, wherein the antibody or antigen-binding fragment thereof or pharmaceutical composition is administered subcutaneously. E229 The method of any one of aspects E179 to E228, wherein the antibody or antigen-binding fragment thereof, or pharmaceutical composition is administered approximately twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, or once every twelve months. E230 The method of any one of aspects E179 to E229, wherein the antibody or antigen-binding fragment thereof is administered every two weeks, for example, up to 12 times (eg, up to 10, 8, 6, 5, 4, or 3 times).

[0038] E231 The method of aspect E230, wherein each administration comprises 5-10 mg / kg (e.g., 5, 6, 7, 8, 9, or 10 mg / kg) of the antibody or antigen-binding fragment thereof. E232 The method of embodiment E231, wherein each administration comprises about 7 mg / kg. E233 The method of any one of aspects E179 to E229, wherein the antibody or antigen-binding fragment thereof is administered every four weeks, for example, up to six times (eg, up to 6, 5, 4, 3, 2, or 1 time). E234 The method of aspect E233, wherein each administration comprises 10-15 mg / kg (e.g., 10, 11, 12, 13, 14, or 15 mg / kg) of the antibody or antigen-binding fragment thereof. E235 The method of embodiment E234, wherein each administration comprises about 12 mg / kg. E236 A method for detecting αvβ8 integrin (e.g., human αvβ8 integrin) in a sample, tissue, or cell using an antibody, comprising contacting the sample, tissue, or cell with an antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166, or a pharmaceutical composition according to aspect E167, and detecting the antibody. E237 A kit comprising the antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166 or the pharmaceutical composition according to aspect E167. E238 An antibody or antigen-binding fragment thereof according to any one of aspects E1 to E166 or a pharmaceutical composition according to aspect E167 for use as a medicament, eg in an aspect of a method described herein. E239 An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, said antibody or fragment comprising: (a) an antibody or antigen-binding fragment thereof comprising: a light chain complementarity-determining region 1 (CDR-L1) comprising the amino acid sequence set forth in SEQ ID NO: 11; a CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 12; a CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO: 13; a heavy chain CDR1 (CDR-H1) comprising the amino acid sequence set forth in SEQ ID NO: 8; a CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO: 9; and a CDR-H3 comprising the amino acid sequence set forth in SEQ ID NO: 10; (b) an antibody or antigen-binding fragment thereof comprising: CDR-L1 comprising the amino acid sequence set forth in SEQ ID NO: 17; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO: 18; CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO: 19; CDR-H1 comprising the amino acid sequence set forth in SEQ ID NO: 14; CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO: 15; and CDR-H3 comprising the amino acid sequence set forth in SEQ ID NO: 16; (c) an antibody or antigen-binding fragment thereof comprising a variable light chain (VL) region comprising the amino acid sequence encoded by the insert of a plasmid deposited with the American Type Culture Collection (ATCC) having accession number PTA-124918, and a variable heavy chain (VH) region comprising the amino acid sequence encoded by the insert of a plasmid deposited with the American Type Culture Collection (ATCC) having accession number PTA-124917; (d) an antibody or antigen-binding fragment thereof comprising a VL region comprising the amino acid sequence shown in SEQ ID NO: 7 and a VH region comprising the amino acid sequence shown in SEQ ID NO: 6; (e) an antibody or antigen-binding fragment thereof comprising a VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 62 to 66, and a VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 34 to 38; (f) an antibody or antigen-binding fragment thereof comprising a VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 47 and 92, and a VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 39 and 88 to 91; (g) an antibody or antigen-binding fragment thereof comprising a VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7 and 67 to 69, and a VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 6 and 93; (h) an antibody or antigen-binding fragment thereof comprising a VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 47 to 69, and 92, and a VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93; (i) an antibody or antigen-binding fragment thereof comprising a light chain (LC) region comprising the amino acid sequence set forth in SEQ ID NO: 5 and a heavy chain (HC) region comprising the amino acid sequence set forth in SEQ ID NO: 2; (j) an antibody or antigen-binding fragment thereof comprising an LC region comprising the amino acid sequence shown in SEQ ID NO: 5 and an HC region comprising the amino acid sequence shown in SEQ ID NO: 3; (k) an antibody or antigen-binding fragment thereof comprising an LC region comprising the amino acid sequence set forth in SEQ ID NO: 123 and an HC region comprising the amino acid sequence set forth in SEQ ID NO: 124 or 182; (l) an antibody or antigen-binding fragment thereof comprising a VL region encoded by the nucleic acid sequence set forth in SEQ ID NO: 186 and a VH region encoded by the nucleic acid sequence set forth in SEQ ID NO: 190; and (m) an antibody or antigen-binding fragment thereof comprising an LC region encoded by the nucleic acid sequence set forth in SEQ ID NO: 185 and an HC region encoded by the nucleic acid sequence set forth in SEQ ID NO: 189 or 191; 1. An isolated antibody or antigen-binding fragment thereof, wherein the antibody or fragment is at least one antibody or fragment selected from the group consisting of: E240 The isolated antibody or antigen-binding fragment thereof of aspect E239, comprising a VL region comprising the amino acid sequence set forth in SEQ ID NO:7, and a VH region comprising the amino acid sequence set forth in SEQ ID NO:6.

[0039] E241 The isolated antibody or antigen-binding fragment thereof of aspect E239 or E240, comprising a VL region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO:7, and a VH region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO:6. E242 The isolated antibody or antigen-binding fragment thereof of aspect E239, comprising an LC region comprising the amino acid sequence set forth in SEQ ID NO:5 and an HC region comprising the amino acid sequence set forth in SEQ ID NO:2 or 3. E243. The isolated antibody or antigen-binding fragment thereof of aspect E239 or E242, comprising an LC region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 5, and an HC region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 2 or 3. E244 An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein the antibody or fragment thereof comprises a VH region comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93, and / or a VL region comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 47 to 69, and 92. E245 An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, said antibody or fragment thereof comprising: (i) an antibody HC region comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or 3; and / or (ii) comprising an antibody LC region comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 5; An isolated antibody or antigen-binding fragment thereof. E246 An isolated antibody that specifically binds to αvβ8 integrin, comprising an LC consisting of the amino acid sequence shown in SEQ ID NO: 5, and an HC consisting of the amino acid sequence shown in SEQ ID NO: 2 or 3. E247 An isolated antibody that specifically binds to αvβ8 integrin, A VL region of an antibody comprising CDR-L1, CDR-L2, and CDR-L3 of the VL region comprising the amino acid sequence set forth in SEQ ID NO: 7; and The VL region of an antibody comprising CDR-H1, CDR-H2, and CDR-H3 of a VH region comprising the amino acid sequence shown in SEQ ID NO: 6, Isolated antibodies. E248 The isolated antibody of aspect E247, comprising an antibody heavy chain constant region comprising the amino acid sequence set forth in SEQ ID NO: 181 or 184 and an antibody light chain constant region comprising the amino acid sequence set forth in SEQ ID NO: 83. E249 An isolated antibody that specifically binds to αvβ8 integrin, a) an antibody VL region comprising the first, second, and third CDRs of the VL region comprising the amino acid sequence set forth in SEQ ID NO: 7; a VH region of an antibody comprising the first, second, and third CDRs of the VH region comprising the amino acid sequence set forth in SEQ ID NO: 6; An antibody light chain constant (CL) region comprising the amino acid sequence set forth in SEQ ID NO: 83; and an antibody heavy chain constant (CH) region comprising the amino acid sequence set forth in SEQ ID NO: 181 or 184; b) an antibody VL region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 7, and an antibody VH region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence set forth in SEQ ID NO: 6; or c) an LC region of an antibody comprising an amino acid sequence at least 95% identical to the amino acid sequence shown in SEQ ID NO: 5, and an HC region of an antibody comprising an amino acid sequence at least 95% identical to the amino acid sequence shown in SEQ ID NO: 2 or 3; An antibody comprising: An isolated antibody or antigen-binding fragment thereof that specifically binds to E250 αvβ8 integrin, comprising a VH of the antibody comprising the amino acid sequence encoded by an insert deposited with the ATCC under accession number PTA-124917, and a VL of the antibody comprising the amino acid sequence encoded by an insert deposited with the ATCC under accession number PTA-124918.

[0040] E251 An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, wherein said antibody or fragment has at least one of the following characteristics: a. a binding affinity (KD) for human αvβ8 integrin that is less than the KD of murine antibody ADWA11, e.g., less than about 536 pM; b. KD for human αvβ8 integrin of about 100 pM or less; c. a KD for mouse αvβ8 integrin that is less than the KD of mouse antibody ADWA11, e.g., less than about 489 pM; d. KD for mouse αvβ8 integrin that is less than about 100 pM; e. a KD for cynomolgus monkey αvβ8 integrin that is less than the KD of mouse antibody ADWA11, e.g., less than about 507 pM; f. KD for cynomolgus monkey αvβ8 integrin of about 100 pM or less; g. KD for rat αvβ8 integrin, which is approximately 160 pM; h. Approximately equivalent affinity for at least two, three, or all of the human, cynomolgus monkey, mouse, and rat αββ integrins, e.g., a KD of less than about 100 pM as determined by a Biacore affinity assay; i. an IC50 for inhibition of TGFβ transactivation of about 100 pM to about 300 pM; j. EC30 of about 100 pM to about 400 pM against U251 cells; k. an EC50 against C8-S cells of about 110 pM to about 180 pM; and l. Predicted value of at least one human pharmacokinetic (PK) parameter selected from the following i. to iv. i. Clearance from the central compartment (CL) of approximately 0.12 mL / h / kg; ii. an intercompartmental clearance (CLF) of approximately 0.51 mL / h / kg; iii. Volume of distribution of the central compartment (V1) which is approximately 36 mL / kg; iv. Volume of distribution in the peripheral compartment (V2) which is approximately 33 mL / kg; v. Half-life (t) of approximately 15-17 days 1 / 2 ); and vi. Absence of detectable binding to human Fcγ receptors or C1q An antibody or antigen-binding fragment thereof, comprising:

[0023] E252 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, comprising a human IgG1 Fc region comprising one or more substitutions at positions L234, L235, and G237 according to Kabat Eu numbering (e.g., one or more of L234A, L235A, and G237A). E253 The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein said antibody is a humanized antibody, a human antibody, a murine antibody, a chimeric antibody or a camelid antibody. E254 The isolated antibody or antigen-binding fragment thereof according to any one of the preceding aspects, wherein the antibody heavy chain isotype is selected from IgG1, IgG2, IgG3, IgG4 or a variant thereof, and / or the light chain constant region is selected from a kappa chain or a lambda chain. E255. The isolated antibody or antigen-binding fragment thereof of any one of the preceding aspects, wherein the antibody heavy chain isotype is IgG1 and / or the light chain constant region is a kappa light chain. E256 An antibody or antigen-binding fragment thereof that competes for binding to αvβ8 integrin with the antibody or antigen-binding fragment thereof of embodiment E242. E257 A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of the preceding aspects and a pharmaceutically acceptable carrier or excipient. E258 The pharmaceutical composition according to aspect E257, comprising i) an antibody or antigen-binding fragment thereof comprising an antibody heavy chain encoded by the amino acid sequence shown in SEQ ID NO: 2 and an antibody light chain encoded by the amino acid sequence shown in SEQ ID NO: 5, ii) an antibody or antigen-binding fragment thereof comprising an antibody heavy chain encoded by the amino acid sequence shown in SEQ ID NO: 3 and an antibody light chain encoded by the amino acid sequence shown in SEQ ID NO: 5, or iii) both of these. E259. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of aspects E239 to E256. E260 The isolated nucleic acid of aspect E259, wherein said isolated nucleic acid encodes the VH region, the VL region, or both, of said antibody or antigen-binding fragment thereof, said nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 190, the nucleic acid sequence set forth in SEQ ID NO: 186, or both.

[0041] E261 The isolated nucleic acid of aspect E259, wherein said isolated nucleic acid encodes a heavy chain constant region, a light chain constant region, or both, of said antibody or antigen-binding fragment thereof, said nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 192 or 193, the nucleic acid sequence set forth in SEQ ID NO: 194, or both. E262 The isolated nucleic acid according to aspect E259, wherein said isolated nucleic acid encodes the HC, LC, or both, of said antibody or antigen-binding fragment thereof, said nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 189 or 190, the nucleic acid sequence set forth in SEQ ID NO: 185, or both. E263 The isolated nucleic acid of aspect E259, wherein the isolated nucleic acid comprises the nucleic acid sequence of the insert of the plasmid deposited with the ATCC under accession number PTA-124917, the nucleic acid sequence of the insert of the plasmid deposited with the ATCC under accession number PTA-124918, or both. E264 The isolated nucleic acid according to aspect E259, wherein said isolated nucleic acid comprises a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to SEQ ID NO: 189 or SEQ ID NO: 191, a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to SEQ ID NO: 185, or both. E265. A vector comprising the nucleic acid of any one of aspects E259 to E264. E266 A host cell comprising a nucleic acid according to any one of aspects E259 to E264 or a vector according to aspect E265. E267 The host cell according to aspect E265, wherein said host cell is a mammalian cell selected from the group consisting of a CHO cell, a COS cell, a HEK293 cell, an NSO cell, a PER.C6® cell and an Sp2.0 cell. E268. A method of producing an isolated antibody or antigen-binding fragment thereof, comprising culturing a host cell according to aspect E266 under conditions wherein said host cell expresses the antibody or fragment, and isolating said antibody or fragment. E269 A method of reducing the activity of αvβ8 integrin in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof of any one of aspects E239 to E256 or the pharmaceutical composition of aspect E257 or E258. E270 A method of treating cancer, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 or the pharmaceutical composition according to aspect E257 or E258.

[0042] E271 The method of aspect E270, further comprising administering a cytotoxic agent, a cytostatic agent, a chemotherapeutic agent, hormone therapy, a vaccine, immunotherapy, surgery, radiation, cryosurgery, hyperthermia, or a combination thereof. E272 The method of aspect E271, wherein said applying is simultaneous, sequential, or separate administration of a therapeutically effective amount of said antibody or antigen-binding fragment thereof or said pharmaceutical combination. E273 The method of aspect E271, wherein the immunotherapy comprises a modulator of an immune checkpoint molecule selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, a soluble CTLA-4 fusion protein, and combinations thereof, wherein the anti-PD-L1 antibody is not avelumab. E274 The method according to any one of aspects E270 to E273, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck, clear cell or papillary renal cell carcinoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, cancer of the gastroesophageal junction, esophageal cancer, squamous cell carcinoma of the lung, pancreatic ductal adenocarcinoma, bile duct carcinoma, uterine cancer, melanoma, urothelial carcinoma, and combinations thereof. E275 A method for detecting αvβ8 integrin in a sample, tissue or cell using the antibody or antigen-binding fragment thereof, comprising contacting said sample, tissue or cell with the antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 and detecting said antibody or antigen-binding fragment thereof. E276 A kit comprising an antibody or fragment according to any one of aspects E239 to E256 or a pharmaceutical composition according to E257 or E258, and optionally a modulator according to aspect E273. E277 The antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 or the pharmaceutical composition according to aspect E257 or E258 for use in reducing the activity of αvβ8 integrin in a subject in need thereof for the treatment of cancer. E278 The antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 or the pharmaceutical composition according to aspect E257 or E258 for use in the treatment of cancer, optionally wherein the antibody or antigen-binding fragment thereof or the pharmaceutical composition is administered simultaneously, sequentially or separately in combination with immunotherapy, wherein the combination optionally provides a synergistic therapeutic effect. E279 The antibody or antigen-binding fragment thereof or pharmaceutical composition for use according to aspect E278, wherein said cancer is selected from the group consisting of squamous cell carcinoma of the head and neck, clear cell or papillary renal cell carcinoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, cancer of the gastroesophageal junction, esophageal cancer, squamous cell carcinoma of the lung, pancreatic ductal adenocarcinoma, bile duct carcinoma, uterine cancer, melanoma, urothelial carcinoma and combinations thereof, and optionally the antibody or antigen-binding fragment thereof, or pharmaceutical composition or pharmaceutical combination is administered together with immunotherapy or radiotherapy. E280 Use of the antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 or the pharmaceutical composition according to aspect E257 or E258 for the treatment of cancer.

[0043] E281 Use of an antibody or antigen-binding fragment thereof according to any one of aspects E239 to E256 or a pharmaceutical composition according to aspect E257 or E258 in the manufacture of a medicament for treating cancer. E282 A method for treating cancer, comprising administering to a subject in need thereof therapeutically effective amounts of (i) an antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, and (ii) a modulator of an anti-PD-1, anti-PD-L1, or anti-PD-L2 immune checkpoint molecule. E283 The method of embodiment E282, wherein said cancer is squamous cell carcinoma. E284 The method of aspect E282, wherein said cancer is breast cancer or colon cancer. E285. The method of any one of aspects E282 to E284, wherein the modulator is selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody.

[0044] BRIEF DESCRIPTION OF THE DRAWINGS The foregoing summary and the following detailed description can be best understood when read in conjunction with the accompanying drawings. DETAILED DESCRIPTION OF THE DRAWINGS

[0013] There are shown in the following drawings certain illustrative aspects of the invention; however, it being understood that the invention is not limited to the precise arrangements and instrumentalities shown. [Brief explanation of the drawings]

[0045] [Figure 1A] 1A shows a sequence alignment comparing the amino acid sequences of the heavy chain variable regions of the murine hybridoma antibody ADWA11 (mADWA11, ADWA11, or hybridoma mouse ADWA11; SEQ ID NO: 20), the humanized ADWA11 VH05-2 / VK01(2.4) antibody (huADWA11-2.4, ADWA11 2.4, or humanized ADWA11-2.4; SEQ ID NO: 6), and the IGHV3-07 germline sequence (IMGT or DP-54; SEQ ID NO: 195). The underlined amino acid residues are the CDR sequences according to Kabat. [Figure 1B] Figure 1B shows a sequence alignment comparing the amino acid sequences of the light chain variable regions of murine hybridoma antibody ADWA11 (mADWA11, ADWA11, or hybridoma mouse ADWA11; SEQ ID NO: 21), humanized ADWA11 VH05-2 / VK01(2.4) antibody (huADWA11-2.4, ADWA11 2.4, or humanized ADWA11-2.4; SEQ ID NO: 7), and the IGKV1-39 germline sequence (IMGT or DPK-9; SEQ ID NO: 196). The underlined amino acid residues are the CDR sequences according to Kabat. [Figure 2] Figure 2 is a representative graph comparing the binding specificity of murine hybridoma antibodies ADWA2 and ADWA11 to human integrins αvβ3 (AVB3) and αvβ6 (AVB6) by ELISA. ADWA2 and ADWA11 did not bind to integrins αvβ3 (AVB3) and αvβ6 (AVB6), whereas a control αV-binding antibody ("AlphaV mAb") bound to αvβ3 and αvβ6. [Figure 3A] FIG. 3A is a representative diagram showing that the mouse hybridoma ADWA11 antibody bound to human αvβ8 by ELISA. [Figure 3B] FIG. 3B is a representative graph showing that humanized antibody ADWA11 VH05 / VK01(2.4) bound to human αvβ8 by ELISA. [Figure 4A] Figure 4A is a representative graph showing the binding affinity of ADWA11 VH05 / VK01 Fabs with K30A, N55Q, N57Q, D61E, P62A, or K63A amino acid substitutions in the heavy chain variable region to human αvβ8, compared to the original humanized ADWA11_VH05 / VK01 (ADWAVH_1.5 and ADWAVL_1.1) antibodies by ELISA. Fabs with K30A, N55Q, N57Q, D61E, P62A, or K63A amino acid substitutions in the heavy chain variable region retained binding affinity to human αvβ8. [Figure 4B]Figure 4B is a representative graph showing the binding affinity of ADWA11 VH05-2 / VK01 Fabs with amino acid substitutions in either the heavy chain variable region (e.g., F64V) or light chain variable region (e.g., L30S, Y55A, A60Q, M94Q, L97Y, F101L, F101W, or Q105G) to human αvβ8 by ELISA, compared to the original ADWA11 VH05-2 / VK01 antibody. Fabs with the Y55A, A60Q, F101L, or F101W amino acid substitution in the light chain variable region exhibited reduced binding affinity to human αvβ8 compared to the humanized ADWA11 VH05-2 / VK01 antibody. The other Fabs tested retained binding affinity to human αvβ8. [Figure 4C] Figure 4C is a representative graph showing the binding affinity of ADWA11 VH05-2 / VK01 Fab (VH05-2 / VK01(2.1) (ADWA11 2.1), VH05-2 / VK01(2.2) (ADWA 2.2), VH05-2 / VK01(2.3) (ADWA 2.3), VH05-2 / VK01(2.4) (ADWA 2.4), VH05-2(F64V) / VK01(2.1), VH05-2(F64V) / VK01(2.3), and VH05-2(F64V) / VK01(2.4)) with the combinations of amino acid substitutions shown in Table 5 compared to the original antibody (original VH05-2_VK01) by ELISA to human αvβ8. Each of the Fabs measured retained binding affinity for human αvβ8. [Figure 5] Figure 5 is a representative graph comparing the binding specificity of mouse hybridoma ADWA11 (MsADWA11 or mADWA11), humanized ADWA11 VH05-1 / VK01 (ADWA11 5-1_1), and ADWA11 VH05-2 / VK01 (ADWA11 5-2_1) for human integrins αvβ3 (avb3) and αvβ6 (avb6) by Biacore analysis. The ADWA11 antibody did not bind to integrins αvβ3 (avb3) and αvβ6 (avb6), whereas a control αV-binding antibody (anti-av) bound to both αvβ3 and αvβ6. [Figure 6-1]Figure 6A shows the Biacore binding trace of hybridoma ADWA11 (MsADWA11) Fab to human αvβ8. Figure 6B shows the Biacore binding trace of humanized ADWA11_5-2 2.4 Fab (ADWA11 VH05-2 / VK01(2.4) Fab or ADWA11 2.4 Fab) to human αvβ8. [Figure 6-2] Figure 6C shows a table demonstrating, by Biacore, that the humanized ADWA11 Fab (ADWA11 is also referred to herein as ADWA11 5-2 2.4, ADWA11 2.4, and ADWA11 VH05-2 / VK01(2.4)) retains affinity and cross-species reactivity for human αvβ8 compared to the Fab of the original murine antibody (MsADWA11). ADWA11 5-2 2.4 exhibited comparable affinity for human, cynomolgus monkey, mouse, and rat αvβ8, with KDs of less than 200 pM. The original murine antibody exhibited comparable affinity for human, cynomolgus monkey, and mouse αvβ8, with KDs of 489-536 pM. [Figure 7A] Figure 7A is a representative graph comparing U251 cell binding data for ADWA11 VH05-2 / VK01 (original) Fabs (ADWA11) with single amino acid substitutions in either the heavy chain variable region (e.g., F64V) or light chain variable region (e.g., L30S, M94Q, L97Y, F101L, or Q105G). The Fab with the F101L substitution in the light chain variable region exhibited reduced binding to U251 cells (human αvβ8) compared to the original antibody. The other Fabs tested retained binding to U251 cells (human αvβ8). [Figure 7B] Figure 7B is a representative graph comparing U251 cell binding data for ADWA11 VH05-2 / VK01 (parent) Fabs (ADWA11) with single amino acid substitutions in the light chain variable region (e.g., M56A or N58S). The M56A and N58S Fabs retained binding to U251 cells (human αvβ8). [Figure 7C]Figure 7C is a representative graph showing U251 cell binding data for ADWA11 VH05-2 / VK01 Fab (ADWA11) with combinations of amino acid substitutions designated 2.1, 2.2, 2.3, 2.4, 2.1(F64V), 2.3(F64V), and 2.4(F64V) as shown in Table 5, compared to the parent antibody. Each Fab tested retained binding to immobilized U251 cells. [Figure 8] FIG. 8 is a representative graph comparing the binding affinities of antibodies ADWA11mIgG_4mut and ADWA11 VH05 / VK01 to U251 cells. [Figure 9A] Figure 9A is a representative diagram showing the binding of ADWA11 VH05-2 / VK01, ADWA11_VH05-2 / VK01(2.1), and ADWA11_VH05-2 / VK01(2.4) to U251 (human glioblastoma) or C8-S (mouse astrocytes). The ADWA11 VH05-2 / VK01(2.1) and ADWA11 VH05-2 / VK01(2.4) antibodies retained binding to U251 (human avb8) and C8-S (mouse avb8). [Figure 9B-1] Figure 9B is a representative diagram showing the binding of integrin-specific antibodies such as ADWA11 VH05-2 / VK01(2.4) to HEK cells expressing αvβ3, αvβ5, αvβ6, and αvβ8. ADWA11 VH05-2 / VK01(2.4) exhibits saturable binding to HEK cells expressing αvβ8, but does not bind to cells expressing αvβ3, αvβ5, or αvβ6. These results demonstrate the specific binding of ADWA11 VH05-2 / VK01(2.4) to human αvβ8. [Figure 9B-2] Same as above. [Figure 9B-3] Same as above. [Figure 10A]Figure 10A is a representative graph comparing the effects of mouse hybridoma ADWA11 (mFab) and humanized ADWA11 Fabs: ADWA11 VH01 / VK01, ADWA11 VH02 / VK01, ADWA11 VH02 / VK02, ADWA11 VH05 / VK02, and ADWA11 VH05 / VK01, on TGFβ transactivation in U251 cells. Compared to ADWA11 Fab (mFab), VH01 / VK01, VH02 / VK01, and VH02 / VK02 Fabs showed reduced activity, VH05 / VK01 retained activity, and VH05 / VK02 showed improved activity in blocking TGFβ activation in the U251 transactivation assay. [Figure 10B] Figure 10B is a representative graph comparing the effect of ADWA11 VH05-2 / VK01 Fabs with amino acid substitutions in either the heavy chain variable region (e.g., F64V) or light chain variable region (e.g., L30S, M94Q, L97Y, F101L, F101W, or Q105G) on TGFβ transactivation in U251 cells. Fabs with a single amino acid substitution of F101L or F101W in the light chain variable region exhibited reduced efficacy on TGFβ transactivation compared to the original humanized ADWA11 VH05-2 / VK01 Fab. Other Fabs tested retained activity in the TGFβ transactivation assay. [Figure 10C] Figure 10C is a representative graph comparing the effects of ADWA11 VH05-2 / VK01 Fabs with amino acid substitutions, including the combinations of amino acid substitutions designated 2.1, 2.2, 2.3, 2.4, 2.1(F64V), 2.3(F64V), and 2.4(F64V) in Table 5. VH02-2 / VK01(2.3) and VH05-2(F64V) / VK01(2.3) Fabs exhibited reduced effects on TGFβ transactivation compared to the original ADWA11 VH05-2 / VK01 Fab. The other Fabs tested retained activity in the TGFβ transactivation assay. [Figure 10D]Figure 10D is a representative graph comparing the effects of ADWA11 VH05-2 / VK01 Fab (original antibody) with the indicated amino acid substitutions in the heavy chain variable region (e.g., F64V) or light chain variable region (e.g., L30S, M94Q, L97Y, Q105G, M56A, or N58S). The tested Fabs retained activity in the TGFβ transactivation assay compared to the original ADWA11 VH05-2 / VK01 Fab. [Figure 10E] Figure 10E is a representative graph showing the effect of humanized ADWA11 VH05 / VK01, VH05 / VK01-D61E (VH05-1 / VK01), and VH05 / VK01-N55Q-D61E (VH05-2 / VK01) IgG on TGFβ transactivation in U251 cells. The antibodies tested retained activity in the TGFβ transactivation assay. [Figure 10F] Figure 10F is a representative diagram showing the effect of ADWA11_VH05-2_VK01(2.4) on TGFβ transactivation in U251 cells (left) and C8-S cells (right) compared to an isotype control antibody. Additional experiments demonstrated that the IC50 of ADWA11 VH05-2 / VK01(2.4) in the TGFβ transactivation assay using U251 cells was 199 ± 93.6 pM (mean ± standard deviation). [Figure 11] Figure 11 is a representative diagram showing the percentage of responders (immunogenicity) for various ADWA11 VH05-2VK01 CDR peptides compared to the positive control peptides shown in Table 1. The immunogenicity scores of the peptides were used to select CDR sequences with potentially reduced risk of immunogenicity. [Figure 12A]Figure 12A is a representative diagram showing the efficacy of the combination of anti-αvβ8 treatment (ADWA11), anti-PD-1 antibody treatment (PD-1, RMP1-14), mIgG1_4mut isotype treatment (2B8), and rat IgG2a isotype treatment (2A3) in an EMT6 breast cancer model. Tumor growth was measured three times weekly using digital calipers and calculated as tumor volume (length x width x width x 0.5). The mean tumor volume ± SEM for each treatment group was plotted until fewer than 8 / 10 mice remained in each group. Survival was defined as the time to reach 1000 mm3. The combination of anti-PD-1 and ADWA11 inhibited tumor growth and significantly improved overall survival compared to other combinations tested. [Figure 12B] The top panel of Figure 12B is a representative graph showing the efficacy of anti-αvβ8 antibody (ADWA11) and isotype control (mIgG1_4mut isotype (2B8)) at 1, 3, 10, and 20 mg / kg as monotherapy in the EMT6 breast cancer model. Also shown is the combination of anti-αvβ8 antibody ADWA11 at 1, 3, 10, and 20 mg / kg with anti-PD-1 antibody (RMP1-14, 10 mg / kg) and rat IgG2a isotype (2A3) in the EMT6 breast cancer model. Mice were treated with antibodies on days 0, 4, and 8 of the experiment, and tumor growth was measured three times a week using digital calipers and calculated as tumor volume (length × width × width × 0.5). [Figure 13] Figure 13 is a representative diagram showing the efficacy of treatment combinations of anti-αvβ8 (ADWA11), anti-4-1BB (MAB9371), anti-CTL4 (9D9), mIgG1_4mut isotype (2B8), and rat IgG2a isotype (2A3) in the EMT6 tumor model. Tumor growth was measured three times weekly using digital calipers and calculated as tumor volume (length × width × width × 0.5). The mean tumor volume ± SEM for each treatment group was plotted until fewer than 8 / 10 mice remained in each group. Survival was defined as the time to reach 1000 mm3. Treatment with the combination of anti-4-1BB and ADWA11 or anti-CLTA4 and ADWA11 suppressed tumor growth and significantly improved overall survival compared to the other combinations tested. [Figure 14A-1]Figure 14A is a representative diagram showing that the combination of anti-αvβ8 antibody and radiation treatment (ADWA11 + 5 Gy radiation group) suppressed tumor growth and significantly improved overall survival in the CT26 tumor model compared with the combination of isotype control and radiation treatment (mIgG4mut(2B8) + 5 Gy radiation group). Tumor growth was measured three times a week using digital calipers and calculated as tumor volume (length x width x width x 0.5). The mean tumor volume ± SEM for each treatment group was plotted, and survival was defined as the time to reach 1000 mm3. *p<0.05 (vs. no treatment), **P<0.05 (vs. radiation + 2B8). [Figure 14A-2] Same as above. [Figure 14A-3] Same as above. [Figure 14B] Figure 14B (top) shows the density of cells expressing CD45, CD8, and granzyme B in CT26 tumor tissue harvested on day 12 from mice treated with 10 mg / kg of an isotype control (Control) or ADWA11 antibody (Anti-ITGαVβ8) on days 0, 4, and 8, n=6; p=P-value. (bottom) shows the expression of CD45, CD8, granzyme B, and IFNγ genes in tumor tissue harvested 12 days after the initial 10 mg / kg administration of an isotype control (Isotype), ADWA11 antibody (Anti-ITGαVβ8), isotype combined with 5 Gy of tumor-targeted radiation, or ADWA11 antibody combined with 5 Gy of tumor-targeted radiation. The antibodies were administered intravenously on days 1, 4, and 8 of the experiment, and radiation was administered on day 5 of the experiment. Each treatment group contained five mice; the mean and standard deviation are also shown on the graph. [Figure 15] Figure 15 is a representative diagram showing IHC analysis of the density of CD45 (total lymphocytes and myeloid cells), CD3 (total T cells), CD4 T cells, CD8 T cells, and Granzyme B (activated CD8 and NK cells) in the EMT6 tumor model. Treatment with ADWA11(2.4) (ADWA11 VH05-2 / VK01(2.4)) increased the density of all cell types analyzed. n = 10 per group, p values ​​from a two-tailed T-test are shown in the figure. [Figure 16]Figure 16A shows the treatment regimen for the CCK168 tumor model. The schedules for tumor cell implantation and intraperitoneal (ip) antibody injection for the four treatment groups are shown. Figure 16B shows representative Kaplan-Meier survival curves for the CCK168 tumor model, with a tumor volume of 2000 mm3 as the survival cutoff. n = 10 per group. **p < 0.01 (log-rank Mantel-Cox test). Figure 16C shows representative graphs showing tumor growth curves for the tumors shown in Figure 16B. Mice were euthanized before the 45-day endpoint if tumors exceeded 2000 mm3 or extensive ulceration was observed. The combination of anti-PD-1 antibody and ADWA11 treatment synergistically suppressed tumor growth and significantly improved overall survival compared with treatment with anti-PD-1 antibody, ADWA11, or isotype control alone, or the simple summation of their individual effects. Data shown are representative of three independent experiments. [Figure 17A] Figure 17A shows the gating strategy for identifying tumor-infiltrating monocytes, macrophages, and dendritic cells. Single live cells were first gated with a dump gate containing Ly6G, SiglecF, CD90, and B220 to exclude neutrophils, eosinophils, lymphocytes, and B cells. Negatively stained cells were then analyzed by flow cytometry and gated. Macrophages were identified as CD45+, CD11b+, CD64high, and F4 / 80high, while dendritic cells were identified as CD45+, CD11b+, F4 / 80-, CD64-, MHCIIhigh, and CD11chigh. Within the macrophage population, immunostimulatory macrophages were identified as Ly6Chigh and CD206low, and immunosuppressive macrophages were identified as Ly6Clow and CD206high. Dump channels were Ly6G+, SiglecF+, CD90.2+, and B220+. [Figure 17B-1] Figure 17B is a representative image showing cell surface staining of integrin αvβ8 analyzed as part of a multicolor flow cytometry panel in the non-aggregating tumors described in Figure 17A. Representative flow cytometry showing FMO (fluorescence minus one) control staining and ADWA11 antibody staining in a CCK168 tumor model. N=4 tumors. [Figure 17B-2] Same as above. [Figure 18] Figure 18A is a representative image showing ADWA11 staining on CD45-negative cells isolated from CCK168. Single live cells were analyzed for the presence of CD45. In the CCK168 tumor model, 4% of CD45-negative cells were positive for αvβ8 expression using the ADWA11 antibody. Figure 18B shows the expression of αvβ8 in CCK168, CT26, and EMT6 cell lines. Single live cells were analyzed for αvβ8 expression by flow cytometry using an isotype antibody and an anti-αvβ8 (ADWA11) staining antibody. αvβ8 expression was detected in CCK168 and EMT6 cell lines, but not in the CT26 cell line. [Figure 19A-1] Figure 19A is a representative graph showing the total number of intratumoral CD8+ T cells in CCK168 tumor-bearing mice treated with a control antibody, anti-PD-1, ADWA11, or a combination of anti-PD-1 and ADWA11. Representative flow cytometry analysis of CD4 and CD8 expression on total CD45+ cells is shown, along with the number of CD8+ cells and the percentage of CD45+ cells for each mouse in each group. [Figure 19A-2] Same as above. [Figure 19A-3] Same as above. [Figure 19B] Figure 19B shows representative immunofluorescence micrographs of CCK168 tumor sections taken from mice in each treatment group, stained with anti-CD8 and DAPI. Scale bar: 50 μm. [Figure 19C-1] FIG. 19C shows representative flow cytometry showing intracellular staining of granzyme B in cells gated on CD8 expression, along with the percentage of CD8+ cells expressing detectable granzyme B for each mouse in each group. [Figure 19C-2] Same as above. [Figure 19C-3] Same as above. [Figure 19D-1]Figure 19D shows a representative flow cytometry analysis demonstrating immunostimulatory macrophages (Ly6c high, CD206 high) and immunosuppressive macrophages (CD206 high, Ly6c low) from cells gated on CD45+Ly6G-CD11b+CD64 high F4 / 80 high. Within the macrophage population, immunostimulatory macrophages were identified as Ly6C high CD206 low, and immunosuppressive macrophages were identified as Ly6C low CD206 high. Data shown are mean ± SEM, n = 10 per group. *p < 0.05, **p < 0.01, ***p < 0.001 by one-way ANOVA. [Figure 19D-2] Same as above. [Figure 19D-3] Same as above. [Figure 20-1] Figure 20 is a representative image showing ADWA11 staining of CD4+ and CD8+ T cells in the CCK168 tumor microenvironment. Single live CD45+ cells were gated on CD4 and CD8 and stained with ADWA11. Representative plots from mice from each of the four treatment groups are shown. [Figure 20-2] Same as above. [Figure 20-3] Same as above. [Figure 20-4] Same as above. [Figure 20-5] Same as above. [Figure 20-6] Same as above. [Figure 21A] Figure 21A is a representative image showing immunodepletion of CD8+ T cells. Photomicrographs show DAPI and anti-CD8 counterstaining in isolated CCK168 tumors after combined anti-PD-1 / ADWA11 treatment with or without pretreatment with anti-CD8 depleting or isotype control antibodies. [Figure 21B] Figure 21B is a representative graph showing mean tumor growth curves of CCK168 tumors pretreated with anti-CD8 depleting antibody or isotype control antibody 24 hours prior to ADWA11 / anti-PD-1 combination treatment. [Figure 21C]Figure 21C is a representative graph showing survival of CCK168 tumor-bearing mice after ADWA11 / anti-PD-1 combination treatment, pretreated one day prior with either an anti-CD8-depleting antibody or an isotype control antibody. Data are reported as survival rate, n=10 per group. **p<0.01 (log-rank Mantel-Cox test). [Figure 22A] Figure 22A shows a representative image of CCK168 tumors from mice treated with ADWA-11 or control antibody and stained with antibodies against CD8 to detect macrophages, F4 / 80, and phospho-SMAD3 to detect TGFβ signaling (pS3). A low-power merged image and an image showing only pSMAD3 are shown on the left, and a magnified merged image and images of each single antibody in the boxed areas are shown on the right. [Figure 22B] Figure 22B is a representative image showing quantification of pSmad3 (pS3) staining density in control and ADWA11-treated mice. ADWA11 treatment reduced pSmad3 density in CCK168 tumors. [Figure 23A] Figure 23A is a representative diagram showing data from TCGA (The Cancer Genome Atlas) on integrin-β8 mRNA expression in 30 human cancers. Each dot represents an individual tumor sample. The results shown in this figure are based on data generated by the TCGA Research Network. [Figure 23B-1] Figure 23B is a representative diagram showing flow cytometry data from disaggregated fresh, anonymized ovarian and renal cell carcinoma cells gated on mature monocytes (CD16+ monocytes), tumor-associated macrophages (CD14+ macrophages), monocytes derived from two types of dendritic cells (BCDA1+ moDCs and BCDA3+ moDCs), or eosinophils, and stained for αvβ8 expression. Normal tonsil tissue was also analyzed as a control. The gating strategy is shown in Figure 23C; n = 2 per tumor type. [Figure 23B-2] Same as above. [Figure 23B-3] Same as above. [Figure 23B-4] Same as above. [Figure 23B-5] Same as above. [Figure 23B-6] Same as above. [Figure 23C-1] Figure 23C is a representative diagram showing the gating strategy for human tumor biopsy samples. Single CD45+ live cells were gated on SSC-A(hi) to exclude granulocytes. SSC-A(lo) was gated on HLA-DR+CD3- and stained with CD14 and CD16. CD14+CD16+ cells were identified as CD16+ monocytes. CD16- cells were further stained with CD11c. CD14+CD11c+ cells were further stained with CD1c and CD141. CD1c+CD141- cells were identified as CD1c+ MoDCs. CD141+CD1c- cells were identified as CD141+ MoDCs. CD1c-CD141- cells were further stained with CD64, and the CD64+ population was identified as CD14+ TAMs. [Figure 23C-2] Same as above. [Figure 24A] Figure 24A is a representative image showing the results of a TMLC cell co-culture bioassay performed with ADWA11 concentrations ranging from 0.01 to 10 mg / ml. TGFβ activity is reported as relative luciferase units based on PAI-1 luciferase reporter activity. n=3 per ADWA11 dose, 3 experiments performed in triplicate. [Figure 24B] Figure 24B is a representative image showing the results of a cell adhesion assay performed on Petri dishes coated with TGFβ1 latent-associated peptide (LAP) in the presence of 0.001-10 mg / ml ADWA-11. Adherent cells were stained with crystal violet, and adhesion was expressed as absorbance at 595 nm. n = 3 per ADWA11 dose, three experiments performed. [Figure 24C] Figure 24C is a representative diagram showing that antibodies against integrins αvβ3, αvβ5, αvβ6, and αvβ8 were used for flow cytometry of wild-type colon cancer cells, SW-480, which do not express these integrins, or SW-480 cells transfected to express β3 (SW-itgb3), β6 (SW-itgb6), or β8 (SW-itgb8). Representative flow cytometry plots are shown for each antibody and cell type tested. [Figure 25A] Figure 25A is a representative diagram showing a two-compartment nonlinear pharmacokinetic model for ADWA11(2.4) administered intravenously at 0.1, 0.3, and 3 mg / kg in TG32 mice. Circles: observed values. Line: fit to the model. [Figure 25B] Figure 25B is a representative diagram showing a two-compartment pharmacokinetic model for ADWA11 2.4 administered intravenously at 3 mg / kg in TG32 mice. Circles: observed values. Line: fit to the model. [Figure 26] Figure 26 is a representative diagram showing the two-compartment pharmacokinetics of ADWA11 2.4 in cynomolgus monkeys after a single intravenous bolus dose of 4, 40, and 100 mg / kg, respectively. Circles: observed values. Line: fit to model. [Figure 27A] Figures 27A and 27B are representative graphs showing predicted pharmacokinetics of human ADWA112.4 at 12 mg / kg every 28 days for a total of three doses and 7 mg / kg every 14 days for a total of three doses. CP is predicted plasma concentration; CAVG is Cavg or mean plasma concentration; Rodent NOAEL is rodent no observed adverse effect level Cavg; NHP NOAEL is non-human primate no observed adverse effect level Cavg. [Figure 27B] Same as above. [Figure 28] Figure 28 is a representative graph showing Kaplan-Meier survival curves in the CCK168 tumor model, with a tumor volume of 2000 mm3 as the survival cutoff. Treatment groups included isotype control, anti-PD-1 antibody, ADWA11_4mut and anti-PD-1 antibody, and the combination of ADWA11_4mut. The combination of anti-PD-1 antibody and ADWA11_4mut treatment synergistically improved overall survival to a greater extent than the expected additive effect of treatment with anti-PD-1 antibody, ADWA11_4mut, or isotype control alone, or the combined treatment. [Figure 29]Figure 29A shows a representative graph showing survival curves for mice subcutaneously implanted with CT26 cells and treated with an isotype control antibody, anti-PD-1, ADWA11_4mut, or a combination of anti-PD-1 and ADWA11_4mut, followed by 5 Gy of radiation on day 5. Figure 29B shows a representative graph showing tumor growth curves. A group of mice treated with an isotype control antibody was not irradiated. Data are reported as survival rates, n = 10 per group. ***p < 0.001, ****p < 0.0001 (log-rank Mantel-Cox test). Figure 29C shows a representative graph showing tumor rechallenge in mice that survived 50 days after the start of treatment. Fifty-one days after the start of immunization combined with radiation, mice that had recovered from CT26 were implanted with CT26 cells in the flank opposite the original tumor implantation site. Control mice were not irradiated and had not previously been exposed to tumor cells. Rechallenged mice were followed for 30 days. Control, n=10; RT and anti-PD-1, n=3; RT and ADWA11_mut, n=5; RT and ADWA11_mut and anti-PD-1, n=7. [Figure 30-1] Figure 30A shows a representative graph showing survival curves and Figure 30B shows a representative graph showing proliferation curves for mice orthotopically implanted with EMT6 cells after treatment with an isotype control antibody, ADWA11_4mut, 4-1BB, anti-CTLA-4, anti-PD-1, or a combination of ADWA-11_4mut and 4-1BB, anti-CTLA-4, or anti-PD-1. Data are reported as percent survival, n=10 per group. ****p<0.0001 (log-rank Mantel-Cox test). Figure 30C shows a representative graph showing survival curves for mice treated with anti-CTLA-4 or 4-1BB activators. [Figure 30-2]Figure 30D is a representative diagram showing growth curves of mice treated with anti-CTLA-4 or 4-1BB activators. Figure 30E is a representative diagram showing the results of tumor rechallenge in mice that survived for 50 days with complete tumor regression after treatment with the synergistic combination of ADWA-11_4mut and anti-CTLA-4, or ADWA-11_4mut and 4-1BB activators. Control mice were not previously exposed to tumors. Rechallenged mice were followed for 30 days. Control, n=5; ADWA-11_4mut and anti-CTLA-4, n=6; ADWA-11_4mut and 4-1BB, n=5. [Figure 31A] Figure 31A shows mRNA expression analysis in MC38 tumor tissue using CD8a-specific Taqman probes and granzyme B-specific Taqman probes. Tumor tissue was obtained 12 days after the first administration of isotype control or ADWA11 2.4 antibody at each dose. Administration was intravenous on days 1, 5, and 9 of the experiment, and each treatment group included 5 mice. *=p-value<0.05. [Figure 31B] Figure 31B shows representative graphs showing tumor growth rates in the MC38 tumor model in mice treated with isotype (10 mg / kg), ADWA11 2.4 (10 mg / kg), anti-PD-1 antibody (RMP1-14, 10 mg / kg), and a combination of ADWA11 2.4 (10 mg / kg) and anti-PD-1 antibody (RMP1-14, 10 mg / kg). Also shown are representative graphs showing tumor growth rates of MC38 tumors in mice treated with doses of 0.03, 0.3, 3, and 30 mg / kg of ADWA11 antibody (anti-ITGAVB8 (ADWA11_mIgG_4mut)) in combination with 10 mg / kg of anti-PD-1 antibody (RMP1-14). For all figures, antibodies were administered on days 1, 5, and 9 of the experiment. Detailed Description

[0046] Disclosed herein are antibodies and antigen-binding fragments thereof that specifically bind to αvβ8 integrin (e.g., human αvβ8 integrin), as well as antibodies that antagonize αvβ8 integrin activity (e.g., activating TGFβ, mediating TGFβ production, regulating regulatory T cells and Th17 cells), its interaction with TGFβ1 and TGFβ3, or the release of active TGFβ. Methods for producing anti-αvβ8 integrin antibodies, compositions comprising anti-αvβ8 integrin antibodies, and methods for using anti-αvβ8 integrin antibodies are provided. In some embodiments, recombinant, e.g., humanized, antibodies that bind to αvβ8 integrin (e.g., human αvβ8 integrin) are provided. In some embodiments, humanized antibody heavy and light chains capable of forming antibodies that bind to αvβ8 integrin are also provided. In some embodiments, humanized antibody heavy and light chains comprising one or more specific complementarity-determining regions (CDRs) are provided. In some embodiments, the humanized anti-αvβ8 integrin antibodies have altered effector functions. In one aspect, the antibodies of the invention have reduced antibody-dependent cellular cytotoxicity (ADCC) activity and / or complement-dependent cytotoxicity (CDC) activity only.

[0047] Polynucleotides encoding antibodies or antigen-binding fragments thereof that bind to αvβ8 integrin (e.g., human αvβ8 integrin) are provided. Polynucleotides encoding the heavy or light chains of the antibodies are also provided. Host cells expressing anti-αvβ8 integrin antibodies, including humanized antibodies, are provided. Therapeutic methods using anti-αvβ8 integrin antibodies, including humanized antibodies, are provided.

[0048] Anti-αvβ8 integrin antibodies and antigen-binding fragments thereof, including humanized antibodies, can be used to prevent, treat, and / or ameliorate diseases, disorders, or conditions caused by and / or associated with aberrant (e.g., increased) TGFβ signaling, including cancer (e.g., control of cancer cell proliferation due to aberrant (e.g., increased) TGFβ signaling).

[0049] Without wishing to be bound by any particular theory, mature TGFβ exists in an inactive or latent form as a complex with a latency-associated peptide (LAP) domain. When αvβ8 integrin binds to LAP, active TGFβ (e.g., TGFβ1 and TGFβ3) is released. Reducing the binding of αvβ8 integrin to LAP can prevent the release of active TGFβ, thereby reducing TGFβ signaling. TGFβ is known to have immunosuppressive effects, for example, in the tumor microenvironment. Therefore, reducing TGFβ activity and / or signaling by the antibodies of the present invention may result in the activation of immune responses, for example, anti-tumor responses in vivo. Thus, the antibodies and antigen-binding fragments thereof of the present invention enable selective antagonism of TGFβ activity in the immune system and / or tumor microenvironment, thereby enhancing anti-tumor immune responses in subjects. In some embodiments described in the Examples herein, antibodies and antigen-binding fragments thereof against αvβ8 integrin have been shown to cause growth suppression and / or complete tumor regression in animal models of several cancers, including squamous cell carcinoma, breast cancer, and colon cancer, either alone or in combination with immunomodulators such as other checkpoint inhibitor modulators (e.g., inhibitors of PD-1, PD-L1, CTLA-4, agonists of 4-1BB) or anti-cancer therapies (e.g., radiation therapy). Thus, anti-αvβ8 integrin antibodies and antigen-binding fragments thereof, including humanized antibodies, can be used, alone or in combination with a second therapy, in the prevention, treatment, and / or amelioration of cancer, such as solid tumors selected from renal cell carcinoma (RCC), ovarian cancer, or squamous cell carcinoma of the head and neck (SCCHN).

[0050] The section headings used in this specification are for ease of understanding and should not be construed as limiting the subject matter described.

[0051] All references cited herein, including patent applications, patents, and Genbank accession numbers, are incorporated herein as if each individual reference were specifically and individually indicated to be incorporated in its entirety.

[0052] The techniques and methods described or cited herein are generally well understood and can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel, et al. eds., (2003)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988); ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R.I. Freshney, ed. (1987)); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology ...); Biology, Humana Press;Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press;Animal Cell Culture (RI Freshney), ed., 1987);Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press;Cell and Tissue Culture Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., 1993-8) J. Wiley and Sons;Handbook of Experimental Immunology (DMWeir and CC Blackwell, eds.);Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987);PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994);Current Protocols in Immunology (JE Coligan et al., eds., 1991);Short Protocols in Molecular Biology (Wiley and Sons, 1999);Immunobiology (CA Janeway and P. Travers, 1997);Antibodies (P. Finch, 1997);Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989);Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000);Using Antibodies: A Laboratory Manual Conventional methods by those skilled in the art, such as those widely used in E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J.D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JB Lippincott Company, 1993), and the latest editions thereof, are generally applicable.

[0053] I. Definition The present invention may be understood more readily by reference to the detailed description and examples of exemplary embodiments of the invention.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In case of conflict, the definitions in this specification shall prevail.

[0055] Further, unless otherwise required or expressly stated by context, singular terms shall include pluralities and plural terms shall include the singular.

[0056] Aspects and embodiments of the invention described herein are understood to include aspects and embodiments "consisting of" and / or "consisting essentially of." As used herein, the singular forms "a," "an," and "the" include plural forms unless expressly stated otherwise.

[0057] In this application, "or" means "and / or" unless expressly stated or understood by one skilled in the art. In a multiple dependent claim, "or" refers to one or more of the preceding independent or dependent claims.

[0058] "About" or "approximately" refers to measurable values ​​between the stated value and the experimental error of the stated value (e.g., a 95% confidence interval around the mean) or within 10% of the stated value, whichever is greater. Numerical ranges are inclusive of the numbers defining the range.

[0059] Notwithstanding that the numerical ranges and parameters herein are approximations, the numerical values ​​set forth in the specific examples are reported as precisely as possible. However, numerical values ​​inherently contain errors resulting from standard deviations based on their respective actual measurements. Furthermore, all ranges described herein are to be understood to encompass all subranges subsumed therein. For example, a range referenced "1 to 10" should be considered to include all subranges between (and including) a minimum value of 1 and a maximum value of 10; that is, all subranges beginning with a minimum value of 1 or greater (e.g., 1 to 6.1) and ending with a maximum value of 10 or less (e.g., 5.5 to 10).

[0060] In this specification and claims, the word "comprise" or variations thereof, such as comprises or compris- ing, is meant to include the stated integer or group thereof but not to exclude other integers or groups. Unless otherwise required by context, singular terms shall also include the plural and plural terms shall also include the singular. Examples provided following the terms "eg" or "for example" are not exhaustive or limiting.

[0061] Where embodiments are described herein with the term "comprising," it is understood that similar embodiments described with the terms "consisting of" and / or "consisting essentially of" are also provided.

[0062] Where aspects or embodiments of the invention are described in terms of Markush or alternative groups, the invention encompasses not only the entire group listed as a whole, but also each member of the group individually, and all possible subgroups of the main group, as well as the main group in the absence of one or more group members. The invention also envisions the explicit exclusion of any one or more of the group members in the claimed invention.

[0063] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. In this specification and the claims, reference will be made to a number of terms that shall be defined to have the following meanings:

[0064] The term "isolated molecule" (when the molecule is, for example, a polypeptide, polynucleotide, or antibody or fragment thereof) refers to a molecule that, by virtue of its origin or source of derivation, (1) is not associated with naturally associated components that accompany it in nature; (2) is substantially free from other molecules of the same species; (3) is expressed in cells of a different species; or (4) does not occur in nature. Thus, a molecule that is chemically synthesized or expressed in a cellular system different from the cell from which it naturally originates is "isolated" from its naturally associated components. A molecule can be rendered substantially free of naturally associated components by isolation using purification techniques well known in the art. The purity or homogeneity of a molecule can be analyzed by means well known in the art. For example, the purity of a polypeptide sample can be analyzed by polyacrylamide gel electrophoresis and staining of the gel, and the polypeptide can be visualized using techniques well known in the art. For certain purposes, high resolution can be achieved by HPLC or other means of purification well known in the art.

[0065] As used herein, "substantially pure" means that the target species is the predominant species present (i.e., on a molar basis, it is more abundant than other individual species in the composition), and preferably, a substantially purified fraction is a composition in which the target species (e.g., an antibody or glycoprotein, including a receptor) comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition comprises greater than about 80%, more preferably greater than about 85%, 90%, 95%, and 99% of all macromolecular species present in the composition. Most preferably, the target species is purified to essential homogeneity (conventional detection methods are unable to detect contaminant species in the composition), such that the composition consists essentially of a single macromolecular species. In certain embodiments, a substantially pure material is at least 50% pure (i.e., free from contaminants), more preferably at least 90% pure, more preferably at least 95% pure, even more preferably at least 98% pure, and most preferably at least 99% pure.

[0066] As known in the art, the term "identity" refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between sequences of polypeptides or nucleic acid molecules, as the case may be, as determined by the match between strings of nucleotide or amino acid sequences. "Identity" determines the percentage of exact matches between two or more sequences, with gap alignments accommodated by a particular mathematical model (i.e., algorithm) in a computer program.

[0067] The term "similarity," in contrast to "identity," although related in concept to identity, refers to a measure of similarity that includes both exact matches and matches with conservative substitutions. Because conservative substitutions apply to polypeptides, not nucleic acid molecules, similarity only deals with comparisons of polypeptide sequences. If two polypeptide sequences, for example, have 10 identical amino acids of 20 identical and the remainder are all non-conservative substitutions, then the percent identity and similarity would both be 50%. In the same example, if there are five conservative substitutions, the identity would remain 50%, but the similarity would be 75% (15 out of 20). Thus, when conservative substitutions are present, the similarity between two polypeptide sequences is higher than the percent identity between those sequences.

[0068] "Fragments" or "portions" of the polypeptides or antibodies of the invention may be prepared by truncation, e.g., removal of one or more amino acids from the N-terminus and / or C-terminus of the polypeptide. Up to 10, up to 20, up to 30, up to 40 or more amino acids can be removed from the N-terminus and / or C-terminus in this manner. Fragments may also be prepared by one or more internal deletions.

[0069] Variant antibodies may include substitutions and / or deletions and / or additions of 1, 2, 3, 4, 5, up to 10, up to 20, up to 30, or more amino acids from the above-mentioned specific sequences and fragments. "Deletion" variants may include deletions of individual amino acids, deletions of small groups of amino acids, such as 2, 3, 4, or 5 amino acids, or deletions of larger amino acid regions, such as deletions of specific amino acid domains or other features. "Insertion" variants may include insertions of individual amino acids, insertions of small groups of amino acids, such as 2, 3, 4, or 5 amino acids, or insertions of larger amino acid regions, such as insertions of specific amino acid domains or other features. "Substitution" variants preferably involve the replacement of one or more amino acids with the same number of amino acids, making conservative amino acid substitutions. For example, amino acids may be substituted with alternative amino acids having similar properties, such as another basic amino acid, another acidic amino acid, another neutral amino acid, another charged amino acid, another hydrophilic amino acid, another hydrophobic amino acid, another polar amino acid, another aromatic amino acid, or another aliphatic amino acid.

[0070] Substitutional variants involve removing at least one amino acid residue in an antibody molecule and inserting another residue in its place. The sites of greatest interest for substitutional mutagenesis include the hypervariable regions, although framework modifications are also contemplated. Conservative substitutions are listed below under the heading "Conservative Substitutions." If such substitutions alter biological activity, more substantial changes, termed "exemplary substitutions," may be introduced and the products screened, as shown below or further described below for classes of amino acids.

[0071] [Table A]

[0072] Substantial alteration of the biological properties of the antibody is achieved by selecting substitutions that differ significantly in their effect on (a) the structure of the polypeptide backbone in the region of the substitution, e.g., as a beta-sheet or helical structure, (b) the charge or hydrophobicity of the molecule at the target site, or (c) maintaining the bulk of the side chain. Naturally occurring residues are divided into the following groups based on common side chain properties: Nonpolar: Norleucine, Met, Ala, Val, Leu, Ile; Uncharged polar: Cys, Ser, Thr, Asn, Gln; Acidic (negatively charged): Asp, Glu; Basic (positively charged): Lys, Arg; Residues that influence chain orientation: Gly, Pro; and Aromatic: Trp, Tyr, Phe, His.

[0073] Non-conservative substitutions are made by exchanging one amino acid from these groups for another.

[0074] For example, one substitution that may be made is to change one or more cysteines in an antibody that may be chemically reactive to another residue, such as, but not limited to, alanine or serine. For example, a non-canonical (e.g., unpreferred or uncommon) cysteine ​​substitution may be made. The substitution may be made in the CDR or framework regions of the variable domain or in the constant region of the antibody. In some embodiments, the cysteine ​​is canonical (e.g., preferred or most common). Cysteine ​​residues that are not involved in maintaining the proper conformation of the antibody may also be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine ​​bond(s) may be added to the antibody to improve its stability, particularly where the antibody is an antibody fragment such as an Fv fragment.

[0075] An "antibody" is an immunoglobulin molecule capable of specifically binding to a target, such as a carbohydrate, polynucleotide, lipid, or polypeptide, via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term includes not only intact polyclonal or monoclonal antibodies, but also, unless otherwise specified, antigen-binding fragments thereof that compete with the intact antibody for specific binding, fusion proteins containing antigen-binding fragments, and modified configurations of immunoglobulin molecules containing an antigen recognition site. Antigen-binding fragments include, for example, Fab, Fab', F(ab'), Fd, Fv, domain antibodies (dAbs, e.g., shark and camel antibodies), fragments containing complementarity-determining regions (CDRs), single-chain variable fragment antibodies (scFv), maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR, and bis-scFv, as well as polypeptides comprising at least a portion of an immunoglobulin sufficient to confer specific antigen binding to a polypeptide.

[0076] Antibodies include antibodies of any class, such as IgG, IgA, or IgM (or subclasses thereof), and antibodies do not have to be of a specific class. Depending on the amino acid sequence of the antibody's heavy chain (HC) constant region, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and some of these can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0077] The terms "antigen-binding portion" or "antigen-binding fragment" of an antibody (or simply "antibody portion"), when used interchangeably herein, refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., αβ integrin). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single antibody chain; (v) a dAb fragment consisting of the VH domain (Ward et al., (1989) Nature 341:544-546); and (vi) isolated complementarity-determining regions (CDRs), disulfide-linked Fvs (dsFvs), and anti-idiotypic (anti-Id) antibodies and intrabodies. Furthermore, although the two domains of an Fv fragment, VL and VH, are encoded by separate genes, they can be joined using recombinant techniques by a synthetic linker that allows them to be produced as a single protein chain in which the VL and VH regions pair to form a monovalent molecule (known as a single-chain Fv (scFv); see, e.g., Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)). Such single-chain antibodies are also intended to be encompassed by the term "antigen-binding fragment" of an antibody. Other forms of single-chain antibodies, such as diabodies, are also included.Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are on a single polypeptide chain, but the linker is too short to allow pairing between the two domains on the same chain, so the domains pair with complementary domains on another chain and form two antigen-binding sites (see, e.g., Holliger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993); Poljak et al., 1994, Structure 2:1121-1123).

[0078] The antibodies may be derived from any mammal, including humans, monkeys, pigs, horses, rabbits, dogs, cats, mice, etc., or other animals such as birds (e.g., chickens), fish (e.g., sharks), camels (e.g., llamas), etc.

[0079] The "variable region" of an antibody refers to the variable region of the antibody light chain (VL) or the variable region of the antibody heavy chain (VH), either alone or in combination. As is known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FR) connected by three "complementarity-determining regions (CDRs)," also known as hypervariable regions (HVRs), which contribute to the formation of the antigen-binding site of the antibody. When a variant of a variable region is desired, particularly for substitution of amino acid residues outside the CDR regions (i.e., within the framework regions), appropriate amino acid substitutions, preferably conservative amino acid substitutions, can be identified by comparing the variable region with the variable regions of other antibodies containing the same standard class CDR1 and CDR2 sequences as the variable region (Chothia and Lesk, J. Mol. Biol. 196(4): 901-917, 1987).

[0080] In certain embodiments, delineation of CDRs and identification of residues comprising the antibody binding site is achieved by solving the structure of the antibody and / or solving the structure of an antibody-ligand complex. In certain embodiments, this can be achieved by various techniques known to those of skill in the art, such as X-ray crystallography. In certain embodiments, various analytical methods can be used to identify or delineate CDR regions. Examples of such methods include, but are not limited to, the Kabat definition, the Chothia definition, the AbM definition, the contact definition, and the conformational definition.

[0081] There are several methods in the art for numbering the amino acid residues that form CDRs. The Kabat numbering system is a standard for numbering antibody residues and is commonly used to identify CDRs. See, e.g., Johnson & Wu, 2000, Nucleic Acids Res., 28: 214-8. The Chothia definition is similar to the Kabat definition, but takes into account the location of specific structural loop regions. See, e.g., Chothia et al., 1986, J. Mol. Biol., 196: 901-17; Chothia et al., 1989, Nature, 342: 877-83. The AbM definition uses an integrated tool of computer programs created by the Oxford Molecular Group to model antibody structure. See, e.g., Martin et al., 1989, Proc Natl Acad Sci (USA), 86:9268-9272; "AbM®, A Computer Program for Modeling Variable Regions of Antibodies," Oxford, UK; Oxford Molecular, Ltd. The AbM definition models the tertiary structure of an antibody from its primary sequence using a combination of knowledge-based and ab initio methods such as those described in Samudrala et al., 1999, "Ab Initio Protein Structure Prediction Using a Combined Hierarchical Approach," in PROTEINS, Structure, Function and Genetics Suppl., 3:194-198.

[0082] Contact definitions are based on the analysis of available complex crystal structures. See, e.g., MacCallum et al., 1996, J. Mol. Biol., 5:732-45. In another approach, referred to herein as "conformational definition" of CDRs, CDR positions may be identified as residues that contribute enthalpicly to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166. Yet another CDR boundary definition may not strictly follow one of the above approaches, but still overlap with at least a portion of the Kabat CDRs, although it may be shortened or extended in light of predictions or experimental results that certain residues or groups of residues do not significantly affect antigen binding. As used herein, CDRs may refer to CDRs defined by approaches known in the art, including a combination of approaches. The methods used herein may utilize CDRs defined according to these approaches. For any embodiment comprising multiple CDRs, the CDRs may be defined according to any of the Kabat, Chothia, extended, AbM, contact and / or conformation definitions.

[0083] As used herein, "contact residues" with respect to an antibody or the antigen to which it specifically binds refers to amino acid residues present in the antibody / antigen that contain at least one heavy atom that is within 4 Å of a heavy atom (i.e., other than hydrogen) of an amino acid residue present in the cognate antibody / antigen.

[0084] "Framework" (FR) residues are those antibody variable domain residues other than the CDR residues. A VH or VL domain framework has the following structure: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 The CDRs of the FR1, FR2, FR3, and FR4 are interspersed.

[0085] Residues in variable domains are typically numbered according to the Kabat method, which provides numbering for antibody heavy or light chain variable domains. See Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. Using this numbering, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to shortening or insertion of the FRs or CDRs of the variable domain. For example, a heavy chain variable domain may contain a single amino acid insertion after residue 52 of H2 (residue 52a according to Kabat) and may contain inserted residues after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c according to Kabat). The Kabat numbering of residues can be determined for a particular antibody by aligning the regions of homology between the antibody sequence and a "standard" Kabat-numbered sequence. Various algorithms are available for assigning Kabat numbering. Using the algorithm provided in Abysis version 2.3.3 (www.abysis.org), Kabat numbering can be assigned to the variable regions CDR-L1, CDR-L2, CDR-L3, CDR-H2 and CDR-H3, and the AbM definition can be used for CDR-H1.

[0086] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible minor naturally occurring mutations. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the character of the antibody as being obtainable from a substantially homogeneous antibody population and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies to be used in accordance with the present invention may be produced by the hybridoma method first described by Kohler and Milstein, 1975, Nature 256:495, or may be produced by recombinant DNA methods such as those described in U.S. Pat. No. 4,816,567. Monoclonal antibodies may also be isolated from phage libraries generated using, for example, the techniques described in McCafferty et al., 1990, Nature 348:552-554. As used herein, "humanized" antibodies refer to forms of non-human (e.g., murine) antibodies that are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Preferably, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from the recipient CDRs are replaced by residues from the CDRs of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. Humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences, but are included to further refine and optimize antibody performance.

[0087] The antibody or antigen-binding fragment thereof of the present invention may be affinity matured. For example, affinity matured antibodies can be prepared by procedures known in the art (Marks et al., 1992, Bio / Technology, 10:9-783; Barbas et al., 1994, Proc Nat. Acad. Sci. USA 91:3809-3813; Schier et al., 1995, Gene, 169:147-155; Yelton et al., 1995, J. Immunol., 155:1994-2004; Jackson et al., 1995, J. Immunol., 154(7):3310-9; Hawkins et al., 1992, J. Mol. Biol., 226:889-896, and WO 2004 / 058184).

[0088] A "human antibody" is an antibody having an amino acid sequence that corresponds to that of an antibody produced by a human and / or an antibody produced by techniques described herein for preparing human antibodies. This definition of human antibody excludes humanized antibodies that contain non-human antigen-binding residues.

[0089] The term "chimeric antibody" is intended to refer to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as when the variable region sequences are derived from a murine antibody and the constant region sequences are derived from a human antibody, or vice versa. The term also encompasses antibodies that contain V regions from one individual of a species (e.g., a first mouse) and constant regions from another individual of the same species (e.g., a second mouse).

[0090] The term "antigen (Ag)" refers to a molecule used to immunize an immunocompetent vertebrate to produce an antibody (Ab) that recognizes the Ag or to screen an expression library (e.g., a phage, yeast, or ribosome display library). As used herein, Ag is broader and generally intended to include the target molecule specifically recognized by an Ab, and thus includes fragments or mimetics of the molecule used in the immunization process to obtain Abs or in library screening to select Abs. Thus, with respect to the antibodies of the present invention that bind to αvβ8 integrin, monomers of full-length αvβ8 integrin from mammals (e.g., human, monkey, mouse, and rat αvβ8 integrin) and multimers thereof, such as dimers and trimers, as well as truncated forms and other variants of αvβ8 integrin, are referred to as antigens.

[0091] Generally, the term "epitope" refers to an area or region of an antigen (e.g., a protein, nucleic acid, carbohydrate, or lipid) to which an antibody specifically binds, i.e., an area or region that physically contacts the antibody. Thus, the term "epitope" refers to a portion of a molecule that can be recognized and bound by one or more antigen-binding regions of an antibody. Epitopes are typically defined in the context of intermolecular interactions between an "antibody or antigen-binding portion thereof" (Ab) and its corresponding antigen. Epitopes are often composed of surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics and specific charge characteristics. In some embodiments, an epitope can be a protein epitope. Protein epitopes can be linear or conformational. In a linear epitope, all interaction sites between a protein and an interacting molecule (e.g., an antibody) occur linearly along the primary amino acid sequence of the protein. A "nonlinear epitope" or "conformational epitope" includes non-contiguous polypeptides (or amino acids) within an antigen protein to which an epitope-specific antibody binds. The term "immunogenic epitope" is defined herein as a portion of an antigen to which an antibody can specifically bind, as determined by any method known in the art, e.g., conventional immunoassays. Alternatively, the generation and characterization of antibodies during the course of an invention may reveal information about the desired epitope. From this information, it is possible to competitively screen antibodies for binding to the same epitope. One approach to accomplish this is to perform competition and cross-competition experiments to find antibodies that compete or cross-compete with each other for binding to αvβ8 integrin, e.g., antibodies that compete for binding to the antigen.

[0092] An antibody that "preferentially binds" or "specifically binds" (used interchangeably herein) to an epitope is a term well understood in the art, and methods for determining such specific or preferential binding are also well known in the art. A molecule is said to exhibit "specific binding" or "preferential binding" if it reacts or associates more frequently, more rapidly, with a longer duration, and / or with a higher affinity with a particular cell or substance than with another cell or substance. An antibody "specifically binds" or "preferentially binds" a target if it binds with higher affinity, higher avidity, more readily, and / or with a longer duration than it binds to another substance. Also, an antibody "specifically binds" or "preferentially binds" a target if it binds with higher affinity, higher avidity, more readily, and / or with a longer duration than it binds to another substance in a sample. For example, an antibody that specifically or preferentially binds to an αvβ8 integrin epitope relative to other αvβ8 integrin epitopes or non-αvβ8 integrin epitopes is an antibody that binds to this epitope with higher affinity, higher avidity, more readily, and / or with longer duration. Reading this definition, it is understood that, for example, an antibody (or moiety or epitope) that specifically or preferentially binds to a first target may or may not specifically or preferentially bind to a second target. Thus, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. Generally, though not necessarily, reference to binding refers to preferential binding. "Specific binding" or "preferential binding" includes compounds, e.g., proteins, nucleic acids, antibodies, etc., that recognize and bind to a particular molecule but do not substantially recognize or bind to other molecules in a sample. For example, an antibody or peptide receptor that recognizes and binds to its cognate ligand or binding partner in a sample (e.g., an anti-αvβ8 integrin antibody that binds to αvβ8 integrin) but does not substantially recognize or bind other molecules in the sample will specifically bind to its cognate ligand or binding partner.Thus, under particular assay conditions, a designated binding moiety (e.g., an antibody or antigen-binding fragment thereof, or a receptor or ligand-binding portion thereof) will bind preferentially to a particular target molecule and will not bind in significant amounts to other components present in the sample.

[0093] A variety of assays can be performed to select antibodies or peptides that specifically bind to a molecule of interest. For example, solid-phase ELISA immunoassays, immunoprecipitation, Biacore® (GE Healthcare, Piscataway, NJ), KinExA, fluorescence-activated cell sorting (FACS), Octet® (ForteBio, Inc., Menlo Park, CA), and Western blot analysis are among the many assays that may be used to identify antibodies or antigen-binding fragments thereof that specifically react with an antigen, or receptors or ligand-binding portions thereof that specifically bind to their cognate ligand or binding partner. Typically, a specific or selective response will be at least twice the background signal or noise, more commonly 10 times or more background, even more commonly 50 times or more background, more commonly 100 times or more background, yet more commonly 500 times or more background, even more commonly 1000 times or more background, and even more commonly 10,000 times or more background. Furthermore, an antibody is said to "specifically bind" to an antigen when the equilibrium dissociation constant (KD) is 1 μM or less, preferably 100 nM or less, more preferably 10 nM or less, even more preferably 100 pM or less, yet more preferably 10 pM or less, and even more preferably 1 pM or less. In one embodiment, an antibody is said to "specifically bind" to an antigen when the equilibrium dissociation constant (KD) is 7 nM or less.

[0094] The term "binding affinity" is used herein as a measure of the strength of a non-covalent interaction between two molecules, such as an antibody or fragment thereof and an antigen. The term "binding affinity" is used to describe a monovalent interaction (intrinsic activity).

[0095] Furthermore, to measure the binding affinity of anti-αvβ8 integrin antibodies to αvβ8 integrin-expressing cells, cell binding experiments can be performed to determine the apparent affinity. The apparent affinity of an antibody binding to target-expressing cells can be determined by the EC of the equilibrium binding titration curve obtained by quantification of the geometric mean fluorescence intensity (gMFI) of the antigen-binding population by flow cytometry. 50 It can be calculated as:

[0096] The binding affinity between two molecules, e.g., an antibody or fragment thereof and an antigen, based on a monovalent interaction is determined by the dissociation constant (K D ) can be quantified by calculating K D can be determined by measuring the equilibrium constants for the association and dissociation of the complex, for example, by surface plasmon resonance (SPR) (Biacore). The rate constants corresponding to the association and dissociation of the monovalent complex are the association rate constant k a (or k on ) and dissociation rate constant k d (or k off ) is called K D teeth, Expression K D =k d / k a The dissociation constant can be determined directly by well-known methods, and even for complex mixtures, it can be calculated by the method described in, for example, Caceci et al. (1984, Byte 9: 340-362). For example, K DThe binding constant may be determined by the double-filter nitrocellulose filter binding assay described in Wong & Lohman (1993, Proc. Natl. Acad. Sci. USA 90: 5428-5432). Other standard assays for evaluating the binding ability of a ligand, such as an antibody, to a target antigen are known in the art and include, for example, ELISA, Western blot, RIA, and flow cytometry analysis, as well as other assays exemplified herein. The equilibrium constant and binding affinity of an antibody can also be evaluated by standard assays known in the art, such as surface plasmon resonance (SPR) using, for example, a Biacore® system or KinExA.

[0097] Competitive binding assays can be performed that compare the binding of an antibody to an antigen with the binding of the target by another ligand of that target, such as another antibody or a soluble receptor that binds to the target in some other way. The concentration that gives 50% inhibition is known as the K i Under ideal conditions, K i is K D is equal to K i The value of K is never D , so conveniently, K D To obtain an upper bound on K i can be replaced by a measurement of

[0098] According to the definition above, the binding affinity for interactions between different molecules, such as comparing the binding affinities of different antibodies to an antigen, can be calculated by comparing the K D This may be done by comparing the K D The value can be determined by methods well established in the art. D One method for determining Λ is by using surface plasmon resonance, typically using a biosensor system such as a Biacore® system.

[0099] Similarly, the specificity of an interaction is determined by the K of the interaction of interest, e.g., the specific interaction between an antibody and an antigen. D The K value is compared to the K of an interaction of no interest, for example, a control antibody known not to bind to αvβ8 integrin. D It can be evaluated by comparing it with the value.

[0100] An antibody that specifically binds to a target may bind to that target with high affinity, i.e., a small K, as discussed above. D and may bind with lower affinity to other non-target molecules. For example, an antibody may bind with a lower affinity than 1×10 -6 M or more, preferably 1×10 -5 M or more, preferably 1×10 -4 M or more, preferably 1×10 -3 M or more, and even more preferably 1×10 -2 K over M D Antibodies of the invention may bind to a target molecule with an affinity that is preferably at least 2-fold, 10-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1,000-fold, or 10,000-fold or more than their affinity for binding to another non-αvβ8 integrin molecule.

[0101] As used herein, the term "compete" with respect to antibodies means that a primary antibody binds to an epitope in a manner sufficiently similar to that of a secondary antibody such that binding of the primary antibody, or its antigen-binding fragment, to its cognate epitope is detectably reduced in the presence of the secondary antibody, compared to binding of the primary antibody in the absence of the secondary antibody or its antigen-binding fragment. It is possible, but not necessary, that binding of the secondary antibody to its epitope is also detectably reduced in the presence of the primary antibody. That is, a primary antibody can inhibit binding of a secondary antibody to its epitope without the secondary antibody inhibiting binding of the primary antibody to its epitope. However, if each antibody detectably inhibits binding of the other antibody to its cognate epitope or ligand, to varying degrees, the antibodies are said to "cross-compete" with each other for binding of their respective epitopes. Both competing and cross-competing antibodies are encompassed by the present invention. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or portion thereof), one of skill in the art will understand, based on the description herein, that such competing and / or cross-competing antibodies are encompassed and useful in the methods described herein.

[0102] Standard competition assays can be used to determine whether two antibodies compete with each other. One suitable assay for antibody competition involves the use of surface plasmon resonance (SPR) technology, typically Biacore technology, which can measure the degree of interaction using a biosensor system (e.g., a BIACORE® system). For example, SPR can be used in an in vitro competitive binding inhibition assay to determine the ability of one antibody to inhibit the binding of a second antibody. Another assay for measuring antibody competition is an ELISA-based method.

[0103] Furthermore, a high-throughput method for "binning" antibodies based on competition is described in WO 2003 / 48731. Competition exists when one antibody (or fragment) reduces the binding of another antibody (or fragment) to αvβ8 integrin. For example, a sequential binding competition assay can be performed by sequentially adding different antibodies. A primary antibody can be added to reach near-saturation binding. A secondary antibody is then added. Two antibodies are considered to compete with each other if binding of the secondary antibody to αvβ8 integrin is not detected or is significantly reduced (e.g., by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%) compared to a parallel assay in the absence of the primary antibody (this value is taken as 100%).

[0104] Furthermore, to examine potential epitopes of antibodies, a representative antibody epitope binning assay using domain swapping between human and mouse αβ integrin proteins is shown in Example 9. Those skilled in the art will understand, with reference to the present disclosure, that there are a wide variety of assays known in the art that can be used to mutually determine the binding of at least two antibodies to a target, and that such assays are encompassed herein.

[0105] Anti-αvβ8 integrin antibodies may be characterized by methods well known in the art. For example, one method is to identify the epitope to which they bind, i.e., "epitope mapping." Many methods are known in the art for mapping and characterizing the location of epitopes on proteins, including, for example, crystal structure elucidation of antibody-antigen complexes, competition assays, gene fragment expression assays, and synthetic peptide-based assays, as described in Chapter 11 of Harlow and Lane, "Using Antibodies," a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1999. Furthermore, for example, epitope mapping can be used to determine the sequence to which an anti-αvβ8 integrin antibody binds. Various methods for epitope mapping are commercially available, such as Pepscan Systems (Edelhertweg 15, 8219 PH Lelystad, The Netherlands). The epitope may be a linear epitope, i.e., contained in a single stretch of amino acids, or a conformational epitope formed by three-dimensional interactions of amino acids that are not necessarily contained in a single stretch. Peptides of various lengths (e.g., at least 4-6 amino acids in length) can be isolated or synthesized (e.g., recombinantly) and used in binding assays with anti-αvβ8 integrin antibodies.

[0106] Furthermore, the epitope to which an anti-αvβ8 integrin antibody binds can be determined by systematic screening using overlapping peptides of the αvβ8 integrin sequence (e.g., human αvβ8 integrin sequence) to confirm antibody binding. In gene fragment expression assays, the open reading frame encoding αvβ8 integrin is fragmented randomly or by specific gene construction, and the reactivity of the antibody being tested with the fragments expressing αvβ8 integrin is confirmed. The gene fragments are generated, for example, by PCR, and then transcribed in vitro in the presence of radioactive amino acids and translated into protein. Antibody binding to the radiolabeled αvβ8 integrin fragments is then determined by immunoprecipitation and gel electrophoresis.

[0107] Specific epitopes can also be identified using large libraries of random peptide sequences displayed on the surface of phage particles (phage libraries) or yeast (yeast display). Alternatively, antibody binding can be tested by simple binding assays using libraries defined with overlapping peptide fragments. Antigen mutagenesis, domain swapping experiments, and alanine scanning mutagenesis, for example, can also be performed to identify residues required, sufficient, and / or essential for epitope binding. For example, alanine scanning mutagenesis experiments use mutant αvβ8 integrins in which various residues in the αvβ8 integrin polypeptide are replaced with alanine. By examining the binding of antibodies to mutant αvβ8 integrins, the importance of specific αvβ8 integrin residues for antibody binding can be assessed.

[0108] Yet another method that can be used to characterize an anti-αvβ8 integrin antibody is to determine if it binds to the same epitope as other antibodies by using a competition assay with other antibodies known to bind to the same antigen, i.e., various fragments of αvβ8 integrin. Competition assays are well known to those skilled in the art.

[0109] Furthermore, the epitope of a particular antibody-antigen binding pair can be defined and characterized at a detailed level by a variety of experimental and computational epitope mapping techniques. These experimental methods include mutagenesis, X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, hydrogen / deuterium exchange mass spectrometry (H / D-MS), and various competitive binding methods well known in the art. Because each method relies on its own principles, the description of an epitope is closely related to the method by which it was determined. Thus, the epitope of a given antibody-antigen pair will be defined differently depending on the epitope mapping technique used.

[0110] At the most detailed level, an epitope that interacts between an Ag and an Ab can be defined by the spatial coordinates of atomic contacts in the Ag-Ab interaction and their relative contributions to binding thermodynamics. At a less detailed level, an epitope can be characterized by the spatial coordinates of atomic contacts in the Ag-Ab interaction. At an even less detailed level, an epitope can be characterized by specific criteria for the amino acid residues involved, such as the distance between atoms (e.g., heavy, i.e., non-hydrogen atoms) in the Ab and Ag. At an even less detailed level, an epitope can be characterized by its function, such as competitive binding with other antibodies. An epitope can also be more generally identified as including amino acid residues whose substitution with another amino acid (e.g., alanine scanning) alters the characteristics of the Ab-Ag interaction.

[0111] The fact that epitope description and definition can be obtained at different levels depending on the epitope mapping method used allows comparison of epitopes recognized by different Abs on the same Ag at different levels.

[0112] Epitopes at the amino acid level, determined for example from X-ray structures, are said to be identical if they contain the same set of amino acid residues. Epitopes are said to overlap if they share at least one amino acid. Epitopes are said to be separate (unique) if they do not share any amino acid residues.

[0113] Epitopes characterized by competitive binding are said to overlap if the binding of the corresponding antibodies is mutually exclusive, i.e., binding by one antibody precludes simultaneous or sequential binding by the other. Epitopes are said to be separate (unique) if an antigen can be simultaneously bound by the two corresponding antibodies.

[0114] The definition of the term "paratope" is derived from the definition of "epitope" above by reversing the perspective. Thus, the term "paratope" refers to the area or region on an antibody that specifically binds to an antigen, i.e., the amino acid residues on an antibody that contact the antigen (αβ integrin, or a portion thereof) as "contacts" are defined herein.

[0115] The epitope and paratope of a given antibody-antigen pair may be identified by routine methods. For example, the general location of the epitope may be determined by assessing the ability of the antibody to bind to different fragments or variant αvβ8 integrin polypeptides. The specific amino acids in αvβ8 integrin that contact the antibody (epitope) and the specific amino acids in the antibody that contact αvβ8 integrin (paratope) may be determined by routine methods, as described in the Examples. For example, the antibody may be combined with a target molecule, and the antibody-antigen complex may be crystallized. The crystal structure of the complex may be determined to identify the site of interaction between the antibody and its target.

[0116] An antibody of the invention may bind to the same epitope or domain of αvβ8 integrin (e.g., human αvβ8 integrin) as an antibody specifically described herein. Assays and assays that can be used for such identification include assays that assess competition for αvβ8 integrin binding between the antibody of interest and the αvβ8 integrin receptor in the biological activity assays described in Examples 1-26.

[0117] An antibody or antigen-binding fragment thereof may be capable of competing or cross-competing with another antibody of the invention for binding to αvβ8 integrin (e.g., human αvβ8 integrin) as described herein. For example, an antibody of the invention may compete or cross-compete with an antibody described herein for binding to αvβ8 integrin, or a suitable fragment or variant of αvβ8 integrin that binds to an antibody described herein.

[0118] That is, if a primary antibody and a secondary antibody compete for binding to αvβ8 integrin but do not compete for the site where the secondary antibody initially binds to αvβ8 integrin, the antibody is considered to "compete" with the secondary antibody (also referred to as one-way competition). If an antibody competes with another antibody for binding to αvβ8 integrin, regardless of which antibody initially binds to αvβ8 integrin, the antibody "cross-competes" with the other antibody. Such competing or cross-competing antibodies can be identified based on their ability to compete / cross-compete with known antibodies of the present invention in standard binding assays. For example, SPR, ELISA assays, or flow cytometry using the Biacore® system may be used to demonstrate competition-cross-competition. Such competition-cross-competition may suggest that two antibodies bind to the same, overlapping, or similar epitopes.

[0119] Thus, antibodies of the present invention may be identified by methods including binding assays that examine whether a test antibody can compete / cross-compete with a reference antibody for a binding site on a target molecule. Methods for performing competitive binding assays are described herein and / or are well known in the art. For example, they can involve binding a reference antibody of the present invention to a target molecule under conditions that allow the antibody to bind to the target molecule. The antibody / target complex can then be exposed to a test / secondary antibody, and the extent to which the test antibody is able to displace the reference antibody of the present invention from the antibody / target complex can be assessed. Another method can involve contacting the test antibody with a target molecule under conditions that allow antibody binding, then adding a reference antibody of the present invention that is able to bind to that target molecule, and assessing the extent to which the reference antibody of the present invention is able to displace the test antibody from the antibody / target complex or simultaneously bind to the target (i.e., a non-competing antibody).

[0120] The ability of a test antibody to inhibit the binding of a reference antibody of the present invention to a target indicates that the test antibody may compete with the reference antibody of the present invention for binding to the target, and thus that the test antibody binds to the same, or substantially the same, epitope or region on the αvβ8 integrin protein as the reference antibody of the present invention. A test antibody identified as competing with a reference antibody of the present invention in such a manner is also an antibody of the present invention. The fact that a test antibody can bind to αvβ8 integrin at the same region as the reference antibody of the present invention and compete with the reference antibody of the present invention suggests that the test antibody may act as a ligand at the same binding site as the antibody of the present invention, and thus may mimic the action of the reference antibody, and is therefore an antibody of the present invention. This can be confirmed by comparing the activity of αvβ8 integrin in the presence of the test antibody with the activity of αvβ8 integrin in the presence of the reference antibody under the same conditions using the assays described in detail herein.

[0121] The reference antibody or antigen-binding fragment thereof of the present invention may be any antibody described herein, such as, for example, the antibodies set forth in Table 1, and variants thereof or fragments thereof, that retain the ability to bind to αvβ8 integrin.

[0122] As described herein, specific binding may be assessed by reference to binding of the antibody to a molecule that is not the target. This comparison may be made by comparing the ability of the antibody to bind to the target and another molecule. This comparison may be made by comparing the K D or K i The other molecule used in this comparison may be a molecule that is not the target molecule. Preferably, the other molecule is not identical to the target molecule. Preferably, the target molecule is not fragmented.

[0123] The other molecules used to determine specific binding may be unrelated in structure or function to the target, for example, they may be unrelated or accompanying materials in the environment.

[0124] The other molecule used to determine specific binding may be another molecule that is involved in the same in vivo pathway as the target molecule, such as αvβ8 integrin (e.g., human αvβ8 integrin). By ensuring that the antibodies of the invention have specificity for αvβ8 integrin rather than such other molecules, undesirable in vivo cross-reactivity may be avoided.

[0125] Antibodies of the present invention may retain the ability to bind to molecules related to the target molecule.

[0126] Alternatively, an antibody of the present invention may have specificity for a particular target molecule. For example, it may or may not bind to a target molecule described herein, or it may bind with significantly reduced affinity to a different target molecule described herein. For example, full-length mature human αvβ8 integrin may be used as a target, but an antibody that binds to that target may not be able to bind, or may bind with lower affinity, to αvβ8 integrin proteins from other species, e.g., other mammalian αvβ8 integrins. In some embodiments, the antibody binds to human and mouse αvβ8 integrin.

[0127] An "Fc fusion" protein is a protein in which one or more polypeptides are operably linked to an Fc polypeptide. An Fc fusion combines the Fc region of an immunoglobulin with a fusion partner.

[0128] A "native-sequence Fc region" comprises an amino acid sequence identical to that of a wild-type Fc region. A "variant Fc region" comprises an amino acid sequence that differs from that of a native-sequence Fc region by virtue of at least one amino acid modification, but which retains at least one effector function of the native-sequence Fc region. Preferably, the variant Fc region has at least one amino acid substitution, e.g., about one to about ten amino acid substitutions, and preferably about one to about five amino acid substitutions, relative to the native-sequence Fc region or the Fc region of the original polypeptide. Here, the variant Fc region preferably has at least about 80% sequence identity with the native-sequence Fc region and / or the Fc region of the original polypeptide, and most preferably at least about 90% sequence identity thereto, more preferably at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto.

[0129] As known in the art, a "constant region" of an antibody refers to the constant region of the antibody light chain or the constant region of the antibody heavy chain, either alone or in combination.

[0130] The terms "IgG Fc region," "Fc region," "Fc domain," and "Fc," used interchangeably herein, refer to a portion of an IgG molecule related to a crystallizable fragment obtainable by papain digestion of the IgG molecule. As used herein, these terms relate to the constant region of an antibody excluding the first constant region immunoglobulin domain, and also to portions of that region. Thus, Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains or portions thereof. In IgA and IgM, Fc may also include the J chain. In IgG, Fc includes immunoglobulin domains Cγ2 and Cγ3 and the hinge between Cγ1 and Cγ2. Although the boundaries of the Fc region can vary, the human IgG heavy chain Fc region is usually defined to include residues C226 or P230 at its C-terminus, according to the Eu index of Edelman et al., 1969, Proc. Natl. Acad. Sci. USA 63(1):78-85, as described in Kabat et al., 1991. Typically, the Fc domain comprises from about amino acid residue 236 to about amino acid residue 447 of the human IgG1 constant domain. The amino acid sequences of representative human wild-type IgG1 Fc domains are set forth in SEQ ID NO: 81 and SEQ ID NO: 82 (optionally including the terminal lysine (K) residue). Fc polypeptide may refer to this region alone, or to this region in the context of an antibody or antigen-binding fragment thereof, or an Fc fusion protein.

[0131] The heavy chain constant domain comprises the Fc region, and further comprises the CH1 domain and hinge of an IgG heavy chain, and the CH2 and CH3 (and optionally CH4 of IgA and IgE) domains.

[0132] A "functional Fc region" possesses at least one effector function of a native sequence Fc region. Exemplary "effector functions" include C1q binding, complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cellular cytotoxicity; phagocytosis; down-regulation of cell surface receptors (e.g., B cell receptors); and the like. Such effector functions generally require the association of an Fc region with a binding domain (e.g., an antibody variable domain or antigen-binding fragment thereof) and can be assessed using various assays known in the art to confirm antibody effector function.

[0133] A "native sequence Fc region" comprises an amino acid sequence identical to that of a wild-type Fc region. Native sequence human Fc regions include native sequence human IgG1 Fc regions (non-A and A allotypes); native sequence human IgG2 Fc regions; native sequence human IgG3 Fc regions; and native sequence human IgG4 Fc regions, as well as naturally occurring variants thereof.

[0134] A "variant Fc region" comprises an amino acid sequence that differs from that of a native sequence Fc region by virtue of the modification of at least one amino acid.

[0135] "Fc receptor" or "FcR" refers to a receptor that binds to the Fc region of an antibody. In one embodiment, an FcγR is a native human FcR. In one embodiment, an FcR binds an IgG antibody (γ receptor) and includes the receptor subclasses FcγRI, FcγRII, and FcγRIII, as well as their allelic variants and alternatively spliced ​​forms. FcγRII receptors include FcγRIIA (activating receptor) and FcγRIIB (inhibiting receptor), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. Activating receptor FcγRIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain, while inhibitory receptor FcγRIIB contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain (see, e.g., Daeron, Annu. Rev. Immunol. 15:203-234 (1997)). FcRs are reviewed, for example, in Ravetch and Kinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab. Clin. Med. 126:330-41 (1995). Other FcRs, including those identified in the future, are also encompassed by the term "FcR" herein.

[0136] The term "Fc receptor" or "FcR" also includes FcRn, a neonatal receptor involved in the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)) and in regulating immunoglobulin homeostasis. Methods for measuring binding to FcRn are known (see, e.g., Ghetie and Ward, Immunol. Today 18(12):592-598 (1997); Ghetie et al., Nature Biotechnology, 15(7):637-640 (1997); Hinton et al., J. Biol. Chem. 279(8):6213-6216 (2004); WO 2004 / 92219 (Hinton et al.)).

[0137] "Effector function" refers to a biological activity attributable to the Fc region of an antibody and varies depending on the antibody isotype. Examples of antibody effector functions include Clq binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cellular cytotoxicity (ADCC), phagocytosis, down-regulation of cell surface receptors (e.g., B cell receptors), and B cell activation.

[0138] "Human effector cells" are leukocytes that express one or more FcRs and perform effector function. In one embodiment, the cells express at least FcγRIII and perform ADCC effector function. Examples of human leukocytes that perform ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, macrophages, cytotoxic T cells, and neutrophils. Effector cells may be isolated from a native source, such as blood.

[0139] "Antibody-dependent cellular cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fc receptors (FcRs) present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) specifically binds to antigen-presenting target cells, enabling these cytotoxic effector cells to subsequently kill the target cells with cytotoxins. NK cells, the primary cells for ADCC, express only FcγRIII, whereas monocytes express FcγRI, FcγRII, and FcγRIII. FcR expression on hematopoietic cells is summarized in Table 3, page 46, of Ravetch and Kinet, Annu. Rev. Immunol 9:457-92 (1991). To confirm ADCC activity of a molecule of interest, an in vitro ADCC assay as described in U.S. Pat. Nos. 5,500,362, 5,821,337, or 6,737,056 (Presta) can be performed. Effector cells for which this assay is useful include PBMCs and NK cells. Alternatively, or additionally, ADCC activity of a molecule of interest may be confirmed in vivo, e.g., in an animal model such as that described in Clynes et al., Proc. Natl. Acad. Sci. (USA) 95:652-656 (1998). Antibodies with altered amino acid sequences in the Fc region to increase or decrease ADCC activity are described, e.g., in U.S. Patent Nos. 7,923,538 and 7,994,290.

[0140] An antibody with "enhanced ADCC activity" refers to an antibody that is more effective at exerting ADCC activity in vitro or in vivo compared to the original antibody, where such an antibody differs from the original antibody in at least one structural aspect when essentially the same amount of antibody and original antibody are used in the assay. In certain embodiments, the amino acid sequences of the antibody and the original antibody are identical, but the antibody is afucosylated and the original antibody is fucosylated. In certain embodiments, ADCC activity is measured by an in vitro ADCC assay described herein, although other assays or methods for measuring ADCC activity, for example, in animal models, are contemplated. In certain embodiments, an antibody with enhanced ADCC activity has enhanced affinity for FcγRIIIA.

[0141] An antibody with "altered" FcR binding affinity or ADCC activity is one that has enhanced or decreased FcR binding activity and / or ADCC activity compared to the original antibody, where the antibody and the original antibody differ in at least one structural aspect. An antibody that "exhibits increased binding" to an FcR binds to at least one FcR with greater affinity than the original antibody. An antibody that "exhibits reduced binding" to an FcR binds to at least one FcR with lower affinity than the original antibody. An antibody that exhibits reduced binding to an FcR may have little or no appreciable binding to an FcR, e.g., 0-20% binding to an FcR compared to a native-sequence IgG Fc region.

[0142] "Enhanced affinity for FcγRIIIA" refers to an antibody that has a higher affinity for FcγRIIIA (sometimes also called CD16a) than the original antibody, which differs in at least one structural aspect.

[0143] "Glycoform" refers to a complex oligosaccharide structure containing various linked carbohydrate units. Such structures are described, for example, in Essentials of Glycobiology, Varki et al., eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1999), and are also provided in standard glycobiology reviews. Such glycoforms include, but are not limited to, G2, G1, G0, G-1, and G-2 (see, e.g., WO 99 / 22764).

[0144] "Glycosylation pattern" is defined as the pattern of carbohydrate units (eg, glycoforms) that are covalently attached to a protein and the sites at which the glycoforms are covalently attached to the peptide backbone of the protein, more specifically to immunoglobulin proteins.

[0145] "Complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (Clq) to an antigen-bound antibody (of the appropriate subclass). To confirm complement activation, a CDC assay, e.g., as described in Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996), can be performed. Antibodies with altered amino acid sequences in the Fc region to increase or decrease Clq binding ability are described, e.g., in U.S. Patent Nos. 6,194,551, 7,923,538, 7,994,290, and WO 1999 / 51642. See also, e.g., Idusogie et al., J.

[0146] As used herein, the terms "wild-type amino acid," "wild-type IgG," "wild-type antibody," or "wild-type mAb" refer to an amino acid or nucleic acid sequence that occurs naturally within a certain population (e.g., human, mouse, rat, cell, etc.).

[0147] As used herein, the term "αvβ8 integrin" generally refers to a protein complex comprising an α integrin subunit (e.g., an integrin α-V subunit, such as ITGAV, comprising the amino acid sequence set forth in SEQ ID NO: 77) and a β integrin subunit (e.g., an integrin β8 subunit, such as ITGB8, comprising the amino acid sequence set forth in SEQ ID NO: 78). As used herein, "human αvβ8 integrin" generally refers to an αvβ8 integrin comprising, for example, a human ITGAV α subunit comprising the amino acid sequence set forth in SEQ ID NO: 77, and a human ITGB8 β subunit comprising, for example, the amino acid sequence set forth in SEQ ID NO: 78. As used herein, "mouse αvβ8 integrin" or "mouse αvβ8 integrin" generally refers to an αvβ8 integrin comprising, for example, a mouse ITGAV α subunit comprising the amino acid sequence set forth in SEQ ID NO: 79, and a mouse ITGB8 β subunit comprising, for example, the amino acid sequence set forth in SEQ ID NO: 80. The term αvβ8 integrin typically includes αvβ8 integrin homologs and orthologs, including, but not limited to, human, cynomolgus monkey, rat, rabbit, and mouse. As used herein, "αvβ8 integrin" typically refers to mammalian αvβ8 integrin, such as human, rat, mouse, non-human primate, bovine, ovine, or porcine αvβ8 integrin (e.g., comprising a human, rat, mouse, non-human primate, bovine, ovine, or porcine integrin α-V subunit and integrin β8 subunit). Non-limiting representative examples of integrin α-V subunits include human (e.g., see Genbank Accession No. P06756.2, SEQ ID NO: 77), cynomolgus monkey (e.g., see SEQ ID NO: 84), and mouse (e.g., see SEQ ID NO: 79) αvβ8 integrin. Non-limiting representative examples of integrin β8 subunits include human (e.g., see Genbank Accession No. P26012.1, SEQ ID NO: 78), cynomolgus monkey (e.g., see SEQ ID NO: 85), and mouse (e.g., see SEQ ID NO: 80) αvβ8 integrins.The term "αvβ8 integrin" also encompasses fragments, mutants, isoforms, and other homologs of such αvβ8 integrin subunit molecules. Mutant αvβ8 integrin molecules are generally characterized by having the same type of activity as naturally occurring αvβ8 integrin, e.g., the ability to bind to an αvβ8 integrin ligand described herein, the ability to induce receptor-mediated activity, and the ability to bind or not bind to an antibody or antigen-binding fragment thereof of the invention.

[0148] Representative amino acid and nucleotide sequences of TGFβ and LAP are known in the art. For example, a precursor polypeptide containing TGFβ1 and LAP (e.g., human sequence UniProt Accession No. P01137) is post-translationally processed to about amino acids 30-278 of UniProt Accession No. P01137, corresponding to LAP, and to about amino acids 279-390 of UniProt Accession No. P01137, corresponding to human TGFβ1. Similarly, a precursor polypeptide containing TGFβ3 and LAP (e.g., human sequence UniProt Accession No. P10600) is post-translationally processed to about amino acids 24-300 of UniProt Accession No. P10600, corresponding to LAP, and to about amino acids 301-412 of UniProt Accession No. P10600, corresponding to human TGFβ3.

[0149] The αvβ8 integrin may comprise 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 12 or more, or 15 or more accessible residues on its surface. The target molecule may comprise a known epitope of the αvβ8 integrin.

[0150] As outlined herein, certain positions of an antibody molecule can be altered. As used herein, "position" or "position..." refers to a location in the sequence of a protein. Positions can be numbered sequentially or according to established systems, such as the EU index and Kabat index, which can be used to number amino acid residues in antibodies. For example, position 297 is the position of the human antibody IgG1. Corresponding positions are generally determined by alignment with other sequences, as described above.

[0151] As used herein, the term "residue" refers to a position in a protein and the amino acid at that position. For example, asparagine 297 (Asn297, N297) is a residue in human antibody IgG1.

[0152] As known in the art, "polynucleotide" or "nucleic acid," used interchangeably herein, refer to a chain of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or substrates that can be incorporated into a chain by DNA or RNA polymerase. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modifications to the nucleotide structure may be imparted before or after joining the chain. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other forms of modification include, for example, "caps," substitution of one or more naturally occurring nucleotides with analogs, e.g., those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those containing intercalators (e.g., acridine, psoralens, etc.), those containing chelators (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, internucleotide modifications such as modified linkages (e.g., the α anomer of a nucleic acid, etc.), and unmodified forms of polynucleotides. Additionally, any of the hydroxyl groups normally present on the sugar may be substituted, e.g., with phosphonate or phosphate groups, protected with standard protecting groups, activated and coupled to another nucleotide, or coupled to a solid support. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping groups having 1 to 20 carbon atoms. Other hydroxyls may also be derivatized to standard protecting groups.Polynucleotides can contain analogous forms of ribose or deoxyribose, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, α- or β-anomers, epimers such as arabinose, xylose, or lyxose, pyranose, furanose, sedoheptulose, acyclic analogs, and abasic nucleoside analogs such as methyl riboside, as commonly known in the art. One or more phosphodiester linkages may be replaced by alternative linking groups. Alternative linking groups include, but are not limited to, embodiments in which the phosphate is replaced with P(O)S (thioate), P(S)S (dithioate), (O)NR2 (amidate), P(O)R, P(O)OR', CO, or CH2 (formacetal), where each R or R' is independently a hydrogen atom or a substituted or unsubstituted alkyl (C1-20) group, optionally including an ether (-O-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all linkages in a polynucleotide need be identical. This description applies to all polynucleotides referred to herein, including RNA and DNA.

[0153] As used herein, the term "vector" refers to a construct capable of delivering, and preferably expressing, one or more genes or sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors bound to cationic condensing agents, DNA or RNA expression vectors contained in liposomes, and certain eukaryotic cells such as producer cells.

[0154] A "host cell" includes an individual cell or cell culture that can be or has been the recipient of a vector for incorporating a polynucleotide insert. A host cell includes the progeny of a single host cell, which progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected and / or transformed in vivo with a polynucleotide of the invention.

[0155] Host cells may be prokaryotic or eukaryotic. Exemplary eukaryotic cells include mammalian cells, such as primate or non-primate animal cells, fungal cells, such as yeast, plant cells, and insect cells.

[0156] Any host cell amenable to cell culture and expression of a protein or polypeptide may be utilized in the present invention. In some embodiments, the host cell is mammalian. Mammalian cell lines available as expression hosts are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). Non-limiting representative mammalian cells include NS0 cells, HEK293, and Chinese hamster ovary (CHO) cells, as well as their derivatives, such as 293-6E and CHO DG44 cells, CHO DXB11, and Potelligent® CHOK1SV cells (BioWa / Lonza, Allendale, NJ). Mammalian host cells also include, but are not limited to, human cervical carcinoma cells (HeLa, ATCC CCL 2), baby hamster kidney cells (BHK, ATCC CCL 10), monkey kidney cells (COS), and human hepatocellular carcinoma cells (e.g., Hep G2).Other non-limiting examples of mammalian cells that may be used in the present invention include human retinoblastoma cells (PER.C6®; CruCell, Leiden, The Netherlands), SV40-transformed monkey kidney line CV1 (COS-7, ATCC CRL 1651), subcloned human embryonic kidney line 293 (HEK 293) or 293 cells grown in suspension culture (Graham et al., 1977, J. Gen Virol. 36:59); mouse Sertoli cells (TM4; Mather, 1980, Biol. Reprod. 23:243-251); monkey kidney cells (CV1 ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRL-1 587), dog kidney cells (MDCK, ATCC CCL 34), buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065), mouse mammary tumor (MMT 060562, ATCC CCL51), TR1 cells (Mather et al., 1982, Annals NY Acad. Sci. 383:44-68), MRC 5 cells, FS4 cells, a human hepatoma line (Hep G2), and a number of myeloma cell lines, including, but not limited to, BALB / c mouse myeloma line (NS0 / 1, ECACC No: 85110503), NS0 cells, and Sp2 / 0 cells.

[0157] Additionally, commercially and non-commercially available cell lines that express polypeptides or proteins can be utilized in the present invention. Those skilled in the art will recognize that different cell lines may have different nutritional requirements and / or may require different culture conditions for optimal growth and expression of the polypeptide or protein, and that these conditions can be modified as needed.

[0158] The present invention encompasses eukaryotic expression systems known in the art or described herein for producing proteins of interest, such as insect cell systems, yeast expression systems, or expression systems in mammalian cell systems, including but not limited to CHO cells.

[0159] As used herein, "expression control sequence" refers to a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or inducible promoter, or an enhancer. An expression control sequence is operably linked to the nucleic acid sequence to be transcribed.

[0160] The terms "leader peptide," "leader sequence," "leader signal sequence," and "signal sequence," as used interchangeably herein, refer to any nucleic acid sequence, or amino acid sequence encoded thereby, which may be present at or near the 5' end of a nucleic acid molecule and / or the N-terminus of a polypeptide and, when present, may effect transport of the polypeptide to an organelle, including, but not limited to, secretion of the polypeptide from a cell. Such leader sequences include, but are not limited to, nucleic acid sequences such as ATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGCGTGCACTCC (SEQ ID NO: 187) and amino acid sequences encoded thereby, such as MGWSCIILFLVATATGVHS (SEQ ID NO: 188). The present invention encompasses leader signals (nucleic acid and amino acid sequences) known in the art or to be identified that are capable of effecting transport of a polypeptide to a desired organelle, e.g., the endoplasmic reticulum, and / or secreting the polypeptide from a cell. Generally, signal peptides are removed from and / or absent from the mature polypeptide.

[0161] As used herein, "therapy" or "treatment" refers to an approach to obtain beneficial or desired clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of improved survival (reduced mortality), reduced inflammatory response in the disease, reduced tissue fibrosis, improved appearance of lesions, localized lesions, reduced extent of disease damage, reduced duration of disease, and / or reduced number, extent, or duration of symptoms associated with the disease. This term includes administration of a compound or agent of the invention to prevent or delay the onset of symptoms, complications, or biochemical manifestations of the disease, to alleviate symptoms, or to arrest or inhibit further development of the disease, condition, or disorder. Treatment may be prophylactic (to prevent or delay the onset of the disease or to prevent its clinical or subclinical manifestations) or therapeutic suppression or alleviation of symptoms after the disease has manifested. In certain embodiments, the disease, condition, or disorder is cancer.

[0162] As used herein, the term "cancer" is meant to include all cancerous growths or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasion. Examples of cancerous disorders include, but are not limited to, solid tumors, hematological cancers, soft tissue tumors, and metastatic lesions. Examples of solid tumors include malignant tumors of various organ systems, such as organs affecting the liver, lung, breast, lymphatic system, gastrointestinal (e.g., colon), genitourinary (e.g., kidney, urothelial cells), prostate, and pharynx, including sarcomas and carcinomas (including adenocarcinomas and squamous cell carcinomas). Adenocarcinomas include malignant tumors such as most colon cancers, rectal cancer, renal cell carcinoma, liver cancer, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus. Squamous cell carcinomas include malignant tumors of the lung, esophagus, skin, head and neck region, oral cavity, anus, and cervix. In some embodiments, the cancer is melanoma, e.g., advanced melanoma. Metastatic lesions of the aforementioned cancers can also be treated using the methods and compositions of the invention. Exemplary cancers whose growth can be treated, e.g., reduced, using the antibody molecules described herein include cancers that respond to immunotherapy.

[0163] "Ameliorating" means that one or more symptoms are alleviated or improved compared to when the anti-αvβ8 integrin antibody is not administered. "Ameliorating" also includes shortening or reducing the duration of the symptoms.

[0164] As used herein, an "effective dosage" or "effective amount" of a drug, compound, or pharmaceutical composition is an amount sufficient to affect one or more beneficial or desired results. In more particular aspects, an effective amount prevents, alleviates, or ameliorates symptoms of a disease, such as cancer, and / or prolongs the survival of the subject being treated. In the case of prophylactic use, beneficial or desired results include eliminating or reducing the risk, reducing the severity, or delaying the onset of a disease, including its biochemical, histological, and / or behavioral symptoms, its complications, and intermediate pathological phenotypes manifesting during disease development. In the case of therapeutic use, beneficial or desired results include clinical results such as alleviating one or more symptoms of an αvβ8 integrin-mediated disease, disorder, or condition, reducing the dosage of other drugs required to treat the disease, enhancing the effectiveness of another drug, and / or delaying disease progression. An effective dosage can be administered in one or more administrations. For purposes of this invention, an effective dosage of a drug, compound, or pharmaceutical composition is an amount sufficient to achieve prophylactic or therapeutic treatment, directly or indirectly. As understood in a clinical context, an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in combination with another drug, compound, or pharmaceutical composition. Thus, an "effective dosage" may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be administered in an effective amount if a desired result can or is achieved in combination with one or more other agents.

[0165] The antibody or antigen-binding fragment thereof can be administered in combination with one or more therapies (e.g., referred to herein as "second therapies"). "In combination" does not mean that the therapies or therapeutic agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods are within the scope described herein. The anti-αvβ8 integrin antibody or antigen-binding fragment thereof can be administered simultaneously with, before, or after the administration of one or more other additional therapies or therapeutic agents. The anti-αvβ8 integrin antibody or antigen-binding fragment thereof and the second therapy, e.g., other drugs or treatment methods, can be administered in any order. Generally, each drug is administered at a dose and / or schedule determined for that drug. It will be further understood that the additional therapeutic agents utilized in this combination can be administered together in a single composition or separately in different compositions. In some embodiments, the amount used in combination will be lower than the amount used individually.

[0166] A "synergistic combination" or a combination that acts "synergistically" is a combination that exhibits an unpredictable increased effect when compared to the merely additive effects of the individual treatments.

[0167] An "individual" or "subject" is a mammal, more preferably a human. Mammals include, but are not limited to, farm animals (e.g., cows, pigs, horses, chickens, etc.), sport animals, pets, primates, horses, dogs, cats, mice, and rats. In some embodiments, the individual is at risk for a disease, disorder, or condition mediated by or associated with αvβ8 integrin binding to its receptor and signaling mediated thereby. In some embodiments, the subject has a disorder or condition as described herein, e.g., cancer.

[0168] As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a material that, when combined with an active ingredient, allows the active ingredient to retain its biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, standard pharmaceutical carriers such as phosphate-buffered saline, water, emulsions such as oil-in-water emulsions, and various wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate-buffered saline (PBS) or normal (0.9%) saline. Compositions containing such carriers are prepared by conventional methods (see, e.g., Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990 and Remington, The Science and Practice of Pharmacy, 20th Ed., Mack Publishing, 2000).

[0169] Although representative methods and materials are described herein, methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. The materials, methods, and examples are illustrative only and are not intended to be limiting.

[0170] II. Anti-AvB8 integrin antibody The present invention relates to antibodies and antigen-binding fragments thereof that bind to αvβ8 integrin. Preferably, the antibodies specifically bind to αvβ8 integrin, i.e., they bind to αvβ8 integrin, but do not detectably bind, or bind with lower affinity, to other αv integrins (e.g., αvβ3 integrin, αvβ5 integrin, and αvβ6 integrin). The present invention further relates to anti-αvβ8 integrin antibodies with altered effector function. In some embodiments, the altered effector function is decreased ADCC. In some embodiments, the altered effector function is decreased CDC. The present invention also relates to compositions comprising such antibodies and uses of such antibodies, including therapeutic and pharmaceutical uses.

[0171] In one aspect, the present specification provides compositions (including pharmaceutical compositions) comprising an antibody having a light chain sequence or a fragment thereof, and a heavy chain or a fragment thereof, that are derived from, but not identical to, the murine hybridoma antibody ADWA-11 (also referred to as ADWA11, mADWA11, or mADWA-11), as disclosed in U.S. Pat. No. 9,969,804, which is incorporated herein in its entirety, and set forth in, for example, SEQ ID NOs: 20-33 and 71-76.

[0172] Antibodies useful in the present invention may include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heteroconjugate antibodies, single-chain (ScFv), variants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and other variants of immunoglobulin molecules containing an antigen recognition site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. Antibodies may be of murine, rat, human, or other origin (including chimeric or humanized antibodies). In some embodiments, the anti-αvβ8 integrin antibody is a monoclonal antibody. In some embodiments, the anti-αvβ8 integrin antibody is a human or humanized antibody. In some embodiments, the anti-αvβ8 integrin antibody is a chimeric antibody.

[0173] The anti-αvβ8 integrin antibodies of the present invention can be produced by methods known in the art. General techniques for producing human and murine antibodies are known in the art and / or described herein.

[0174] Following initial identification, the activity of a candidate anti-αvβ8 integrin antibody can be further confirmed and refined by bioassays known to assess the biological activity. In some embodiments, in vitro cellular assays are further performed to characterize the candidate anti-αvβ8 integrin antibody. For example, bioassays can be performed to directly screen the candidate. Several methods for identifying and characterizing anti-αvβ8 integrin antibodies are described in detail in the Examples.

[0175] Table 1 below summarizes the amino acid and nucleotide sequences of, for example, murine, chimeric, and humanized anti-αvβ8 integrin antibodies described herein. The amino acid and nucleotide sequences of the heavy and light chain CDRs, the amino acid and nucleotide sequences of the heavy and light chain variable regions, and the amino acid and nucleotide sequences of the heavy and light chains are provided in this table. Generally, unless otherwise specified, anti-αvβ8 integrin antibodies of the invention may comprise a combination of one or more Kabat CDRs and / or Chothia hypervariable loops as set forth in Table 1. In certain embodiments, anti-αvβ8 integrin antibodies of the invention may comprise a combination of one or more VH and / or VL sequences as set forth in Table 1. In certain embodiments, anti-αvβ8 integrin antibodies of the invention may comprise a combination of one or more framework regions (e.g., FR1, Fr2, FR3, and FR4) as set forth in Table 1. As shown in Table 1, VH and VL sequences are generally understood to comprise three CDRs and four FRs, usually in the following order from amino terminus to carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0176] In certain embodiments, if an anti-αvβ8 integrin antibody contains a lysine (K) residue at the C-terminus of the heavy chain (e.g., human IgG1 heavy chains contain a terminal lysine), one skilled in the art will understand that the lysine residue may be truncated, resulting in an antibody having a heavy chain lacking a C-terminal lysine residue. Furthermore, antibody heavy chains may be produced using nucleic acids that do not encode lysine. Thus, in certain embodiments, an anti-αvβ8 integrin antibody contains a heavy chain lacking the terminal lysine normally present.

[0177]

Table 1-1

[0178]

Table 1-2

[0179]

Table 1-3

[0180]

Table 1-4

[0181]

Table 1-5

[0182]

Table 1-6

[0183]

Table 1-7

[0184]

Table 1-8

[0185]

Table 1-9

[0186]

Table 1-10

[0187]

Table 1-11

[0188]

Table 1-12

[0189]

Table 1-13

[0190]

Table 1-14

[0191]

Table 1-15

[0192]

Table 1-16

[0193]

Table 1-17

[0194]

Table 1-18

[0195]

Table 1-19

[0196]

Table 1-20

[0197]

Table 1-21

[0198]

Table 1-22

[0199]

Table 1-23

[0200]

Table 1-24

[0201]

Table 1-25

[0202]

Table 1-26

[0203]

Table 1-27

[0204]

Table 1-28

[0205]

Table 14-1

[0206]

Table 14-2

[0207]

Table 15-1

[0208] [Table 15-2]

[0209] [Table 16-1]

[0210] [Table 16-2]

[0211] [Table 17-1]

[0212] [Table 17-2]

[0213] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in at least one of SEQ ID NOs: 11-13, 17-19, 25-27, 31-33, or 71-76.

[0214] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in at least one of SEQ ID NOs: 8-10, 14-16, 22-24, or 28-30.

[0215] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO:7, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO:6.

[0216] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO:7, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO:20.

[0217] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 7, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in at least one of SEQ ID NOs: 34 to 46, 88 to 91, or 93.

[0218] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO:21, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO:6.

[0219] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in at least one of SEQ ID NOs: 47 to 69 or 92, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 6.

[0220] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO:5, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO:2.

[0221] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO:5, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO:3.

[0222] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 5, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 124 or 182.

[0223] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 123, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 124 or 182.

[0224] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 123, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 2 or 3.

[0225] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC and having accession number PTA-124918.

[0226] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC and having accession number PTA-124917.

[0227] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1, CDR-L2, and CDR-L3 contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC under accession number PTA-124918, and CDR-H1, CDR-H2, and CDR-H3 contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC under accession number PTA-124917.

[0228] In one aspect, the antibody or antigen-binding fragment thereof comprises a light chain variable region contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC and assigned accession number PTA-124918.

[0229] In one aspect, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region contained in the amino acid sequence encoded by the insert of the plasmid deposited with the ATCC and assigned accession number PTA-124917.

[0230] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1 contained in the amino acid sequence set forth in SEQ ID NO: 11, CDR-L2 contained in the amino acid sequence set forth in SEQ ID NO: 12, CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 13, CDR-H1 contained in the amino acid sequence set forth in SEQ ID NO: 8, CDR-H2 contained in the amino acid sequence set forth in SEQ ID NO: 9, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 10.

[0231] In one aspect, the antibody or antigen-binding fragment thereof comprises CDR-L1 contained in the amino acid sequence set forth in SEQ ID NO: 17, CDR-L2 contained in the amino acid sequence set forth in SEQ ID NO: 18, CDR-L3 contained in the amino acid sequence set forth in SEQ ID NO: 19, CDR-H1 contained in the amino acid sequence set forth in SEQ ID NO: 14, CDR-H2 contained in the amino acid sequence set forth in SEQ ID NO: 15, and CDR-H3 contained in the amino acid sequence set forth in SEQ ID NO: 16.

[0232] In one aspect, the antibody or antigen-binding fragment thereof may comprise a VH comprised in an amino acid sequence at least 90% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93 (e.g., SEQ ID NO: 6). The VH may comprise an amino acid sequence at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93 (e.g., SEQ ID NO: 6). The VH may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93 (e.g., SEQ ID NO: 6).

[0233] In one aspect, the antibody or antigen-binding fragment thereof may comprise a VH comprised in an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 6. The VH may comprise an amino acid sequence at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 6. The VH may comprise the amino acid sequence set forth in SEQ ID NO: 6. In one embodiment, the antibody or antigen-binding fragment thereof comprises a VH comprised in the amino acid sequence set forth in SEQ ID NO: 6. In one embodiment, the antibody or antigen-binding fragment thereof comprises a VH consisting of the amino acid sequence set forth in SEQ ID NO: 6.

[0234] In one aspect, the antibody or antigen-binding fragment thereof may comprise a VL comprised in an amino acid sequence at least 90% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47-69, and 92 (e.g., SEQ ID NO: 7). The VL may comprise an amino acid sequence at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47-69, and 92 (e.g., SEQ ID NO: 7). The VL may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47-69, and 92 (e.g., SEQ ID NO: 7).

[0235] In some aspects, the antibody or antigen-binding fragment thereof may comprise a VL comprised in an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 7. The VL may comprise an amino acid sequence at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 7. The VL may comprise the amino acid sequence set forth in SEQ ID NO: 7. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VL comprised in the amino acid sequence set forth in SEQ ID NO: 7. In some embodiments, the antibody or antigen-binding fragment thereof comprises a VL consisting of the amino acid sequence set forth in SEQ ID NO: 7.

[0236] In one aspect, the antibody or antigen-binding fragment thereof comprises a VH contained in the amino acid sequence set forth in any one of SEQ ID NOs: 6, 34 to 46, 88 to 91, and 93 (e.g., SEQ ID NO: 6), and may further comprise a heavy chain containing an IgG1 constant domain (e.g., an IgG1 constant domain contained in the amino acid sequence set forth in any one of SEQ ID NOs: 81, 82, 181, or 184). In one aspect, the antibody or antigen-binding fragment or variant comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 conservative or non-conservative substitutions and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additions and / or deletions relative to the full length of the heavy chain. In a further aspect, the variant shares at least 65%, at least 75%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the full length of the heavy chain, and the antibody or antigen-binding fragment specifically binds to αvβ8 integrin.

[0237] In one embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain comprising a VH comprised in the amino acid sequence set forth in SEQ ID NO: 6, and further comprises an IgG1 constant domain comprised in the amino acid sequence set forth in SEQ ID NO: 181 or 184. In one embodiment, the antibody or antigen-binding fragment thereof comprises a VH consisting of the amino acid sequence set forth in SEQ ID NO: 6, and further comprises an IgG1 constant domain consisting of the amino acid sequence set forth in SEQ ID NO: 181 or 184. In one embodiment, the antibody does not have an effector function. In yet another embodiment, the antibody molecule comprises a heavy chain constant region selected from, e.g., the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE; particularly, for example, the (e.g., human) heavy chain constant regions of IgG1, IgG2, IgG3, and IgG4. In another embodiment, the antibody molecule comprises a light chain constant region selected from, for example, a kappa or lambda (e.g., human) light chain constant region (e.g., encoded by the amino acid sequence set forth in SEQ ID NO: 83). The constant region can be altered, e.g., mutated, to modify the properties of the antibody (e.g., to increase or decrease one or more of Fc receptor binding, antibody glycosylation, the number of cysteine ​​residues, effector cell function, and / or complement function). In some embodiments, the antibody has effector function and can fix complement. In other embodiments, the antibody does not recruit effector cells or fix complement. In other embodiments, the antibody has reduced or no ability to bind to Fc receptors. For example, it is an isotype, subtype, fragment, or other mutant that does not support binding to Fc receptors (e.g., the Fc receptor binding region is mutated or deleted).

[0238] Methods for altering the constant region of an antibody are known in the art. Antibodies with altered function, e.g., antibodies with altered affinity for effector ligands such as cellular FcR or the C1 component of complement, can be obtained by replacing at least one amino acid residue in the constant portion of the antibody with a different residue. (See, e.g., European Patent Application Publication No. 388151; U.S. Patent Nos. 5,624,821 and 5,648,260, the entire contents of which are incorporated herein.) Similar alterations that reduce or eliminate immunoglobulin function can be described when applied to mice or other species.

[0239] In one aspect, the antibody or antigen-binding fragment thereof comprises a VL comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 47 to 69, and 92 (e.g., SEQ ID NO: 7), and further comprises a light chain comprising a κ constant domain comprising the amino acid sequence set forth in SEQ ID NO: 83. In one aspect, the antibody or antigen-binding fragment thereof comprises a VL consisting of the amino acid sequence set forth in SEQ ID NO: 7, and further comprises a light chain comprising a κ constant domain consisting of the amino acid sequence set forth in SEQ ID NO: 83.

[0240] In some aspects, the antibody or antigen-binding fragment thereof comprises a heavy chain (HC) comprised in an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the antibody or antigen-binding fragment thereof comprises a HC comprised in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the antibody or antigen-binding fragment thereof comprises a HC consisting of the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the antibody has no effector function.

[0241] In some aspects, the antibody or antigen-binding fragment thereof comprises a heavy chain (HC) comprised in an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO:3. In some embodiments, the antibody or antigen-binding fragment thereof comprises a HC comprised in the amino acid sequence set forth in SEQ ID NO:3. In some embodiments, the antibody or antigen-binding fragment thereof comprises a HC consisting of the amino acid sequence set forth in SEQ ID NO:3. In some embodiments, the antibody does not have effector function. In some aspects, the antibody or antigen-binding fragment thereof comprises a light chain (LC) comprised in an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO:5. In some embodiments, the antibody or antigen-binding fragment thereof comprises a LC comprised in the amino acid sequence set forth in SEQ ID NO:5. In one embodiment, the antibody or antigen-binding fragment thereof comprises an LC consisting of the amino acid sequence set forth in SEQ ID NO: 5. In one embodiment, the antibody has no effector function.

[0242] Germline replacement In one aspect, the antibody or antigen-binding fragment thereof comprises: (i) the following heavy chain CDR sequences: CDR-H1 comprising the amino acid sequence set forth in SEQ ID NO: 22, CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO: 23, and CDR-H3 comprising the amino acid sequence set forth in SEQ ID NO: 24; and / or (ii) the following light chain CDR sequences: CDR-L1 comp...

Claims

1. 1. An isolated antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin, The antibody or antigen-binding fragment comprises: (a) a light chain complementarity determining region 1 (CDR-L1) comprising the amino acid sequence set forth in SEQ ID NO:11; a CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO:12; a CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO:13; a heavy chain CDR1 (CDR-H1) comprising the amino acid sequence set forth in SEQ ID NO:8; a CDR-H2 comprising the amino acid sequence set forth in SEQ ID NO:9; and a CDR-H3 comprising the amino acid sequence set forth in SEQ ID NO:10; or (b) CDR-L1 comprising the amino acid sequence set forth in SEQ ID NO:17; CDR-L2 comprising the amino acid sequence set forth in SEQ ID NO:18; CDR-L3 comprising the amino acid sequence set forth in SEQ ID NO:19; CDR-H1 comprising the amino acid sequence shown in SEQ ID NO: 14; CDR-H2 comprising the amino acid sequence shown in SEQ ID NO: 15; and CDR-H3 comprising the amino acid sequence shown in SEQ ID NO:

16. An isolated antibody or antigen-binding fragment thereof.

2. the antibody or antigen-binding fragment comprises a variable light (VL) region comprising an amino acid sequence encoded by an insert in a plasmid deposited with the American College of Cancer Research and has accession number PTA-124918, and a variable heavy (VH) region comprising an amino acid sequence encoded by an insert in a plasmid deposited with the American College of Cancer Research and has accession number PTA-124917; 2. The isolated antibody or antigen-binding fragment thereof of claim 1.

3. The antibody or antigen-binding fragment comprises a VL region comprising the amino acid sequence shown in SEQ ID NO:7, and a VH region comprising the amino acid sequence shown in SEQ ID NO:

6.

3. An isolated antibody or antigen-binding fragment thereof according to claim 1 or 2.

4. The antibody or antigen-binding fragment comprises an antibody heavy chain constant region comprising the amino acid sequence set forth in SEQ ID NO: 181 or 184 and an antibody light chain constant region comprising the amino acid sequence set forth in SEQ ID NO: 83; An isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 3.

5. The antibody or antigen-binding fragment comprises a light chain (LC) region comprising the amino acid sequence set forth in SEQ ID NO:5, and a heavy chain (HC) region comprising the amino acid sequence set forth in SEQ ID NO:

2. An isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

6. The antibody or antigen-binding fragment comprises a light chain (LC) region comprising the amino acid sequence set forth in SEQ ID NO:5, and a heavy chain (HC) region comprising the amino acid sequence set forth in SEQ ID NO:

3. An isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 5.

7. the antibody or antigen-binding fragment comprises a human IgG1 Fc region comprising one or more substitutions at positions L234, L235, and G237 according to the Eu numbering of Kabat; An isolated antibody or antigen-binding fragment thereof according to any one of claims 1 to 6.

8. the human IgG1 Fc region comprises L234A, L235A and G237A; 8. An isolated antibody or antigen-binding fragment thereof according to claim 7.

9. The isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 8, wherein the antibody is a humanized antibody, a murine antibody, a chimeric antibody or a camel antibody.

10. 10. The isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 9, wherein the heavy chain isotype of the antibody is selected from IgG1, IgG2, IgG3, IgG4 or a variant thereof, and / or the light chain constant region is selected from a κ chain or a λ chain.

11. The isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 10, wherein the heavy chain isotype of the antibody is IgG1 and / or the light chain constant region is a kappa light chain.

12. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 11 and a pharma- ceutically acceptable carrier or excipient.

13. The pharmaceutical composition according to claim 12, comprising: i) an antibody or an antigen-binding fragment thereof comprising an antibody heavy chain encoded by the amino acid sequence shown in SEQ ID NO:2 and an antibody light chain encoded by the amino acid sequence shown in SEQ ID NO:5; ii) an antibody or an antigen-binding fragment thereof comprising an antibody heavy chain encoded by the amino acid sequence shown in SEQ ID NO:3 and an antibody light chain encoded by the amino acid sequence shown in SEQ ID NO:5; or iii) both of these.

14. An isolated nucleic acid encoding the amino acid sequence of the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 11.

15. The isolated nucleic acid of claim 14, wherein the isolated nucleic acid encodes the VH region, the VL region, or both, of the antibody or antigen-binding fragment thereof, and the nucleic acid comprises the nucleic acid sequence set forth in SEQ ID NO: 190, the nucleic acid sequence set forth in SEQ ID NO: 186, or both.

16. 15. The isolated nucleic acid of claim 14, wherein the isolated nucleic acid encodes the heavy chain constant region, the light chain constant region, or both, of the antibody or antigen-binding fragment thereof, and the nucleic acid comprises the nucleic acid sequence set forth in SEQ ID NO: 192 or 193, the nucleic acid sequence set forth in SEQ ID NO: 194, or both.

17. The isolated nucleic acid of claim 14, wherein the isolated nucleic acid encodes the HC, LC, or both of the antibody or antigen-binding fragment thereof, and the nucleic acid comprises a nucleic acid sequence set forth in SEQ ID NO: 189 or 190, a nucleic acid sequence set forth in SEQ ID NO: 185, or both.

18. 15. The isolated nucleic acid of claim 14, wherein the isolated nucleic acid comprises the nucleic acid sequence of an insert of a plasmid deposited with the ATCC and having accession number PTA-124917, the nucleic acid sequence of an insert of a plasmid deposited with the ATCC and having accession number PTA-124918, or both.

19. 15. The isolated nucleic acid of claim 14, comprising a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to SEQ ID NO:189 or SEQ ID NO:191, a nucleic acid sequence having at least 80%, 85%, 87%, 90%, 92%, 93%, 95%, 97%, 98% or 100% sequence identity to SEQ ID NO:185, or both.

20. An expression vector comprising the isolated nucleic acid of any one of claims 14 to 19.

21. A host cell comprising the isolated nucleic acid of any one of claims 14 to 19 or the vector of claim 20.

22. 22. The host cell of claim 21, wherein the host cell is a mammalian cell selected from the group consisting of a CHO cell, a COS cell, a HEK293 cell, an NSO cell, a PER.C6® cell, and an Sp2.0 cell.

23. 22. A method for producing an isolated antibody or antigen-binding fragment thereof comprising culturing a host cell according to claim 21 under conditions in which the host cell expresses the antibody or fragment, and isolating the antibody or fragment.

24. 12. A method for detecting αvβ8 integrin in a sample, tissue or cell using the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 11, comprising contacting the sample, tissue or cell with the antibody or antigen-binding fragment thereof and detecting the antibody or antigen-binding fragment thereof.

25. A kit comprising the isolated antibody or antigen-binding fragment thereof of any one of claims 1 to 11 or the pharmaceutical composition of claim 12 or 13.

26. The pharmaceutical composition of claim 12 or 13, wherein the composition is for use in reducing the activity of αvβ8 integrin in a subject in need thereof, and a therapeutically effective amount of the composition is administered to the subject.

27. The pharmaceutical composition of claim 12 or 13, wherein the composition is for use in the treatment of cancer and a therapeutically effective amount of the composition is administered to a subject.

28. 28. The pharmaceutical composition of claim 27, wherein the composition is for use in further administering a cytotoxic agent, a cytostatic agent, a chemotherapeutic agent, a hormonal therapy, a vaccine, immunotherapy, surgery, radiation, cryosurgery, hyperthermia or a combination thereof.

29. 29. The pharmaceutical composition of claim 28, wherein said further application is simultaneous, sequential or separate from the administration of a therapeutically effective amount of said antibody or antigen-binding fragment thereof or said pharmaceutical combination.

30. 29. The pharmaceutical composition of claim 28, wherein the immunotherapy comprises a modulator of an immune checkpoint molecule selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, a soluble CTLA-4 fusion protein, and combinations thereof, wherein the anti-PD-L1 antibody is not avelumab.

31. 31. The pharmaceutical composition of any one of claims 27 to 30, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck, clear cell or papillary renal cell carcinoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, cancer of the gastroesophageal junction, esophageal cancer, squamous cell carcinoma of the lung, pancreatic ductal adenocarcinoma, bile duct carcinoma, uterine cancer, melanoma, urothelial carcinoma, and combinations thereof.

32. 14. The pharmaceutical composition of claim 12 or 13, wherein the composition is administered simultaneously, sequentially or separately in combination with an immunotherapy, the combination optionally providing a synergistic therapeutic effect.

33. 33. The pharmaceutical composition of claim 32, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck, clear cell or papillary renal cell carcinoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastric cancer, cancer of the gastroesophageal junction, esophageal cancer, squamous cell carcinoma of the lung, pancreatic ductal adenocarcinoma, bile duct carcinoma, uterine cancer, melanoma, urothelial carcinoma, and combinations thereof, and optionally wherein the antibody or antigen-binding fragment thereof or the pharmaceutical composition or pharmaceutical combination is used in conjunction with immunotherapy or radiation therapy.

34. 12. A pharmaceutical composition for treating cancer, comprising a therapeutically effective amount of (i) an antibody or antigen-binding fragment thereof that specifically binds to αvβ8 integrin according to any one of claims 1 to 11, and (ii) a modulator of an anti-PD1, anti-PD-L1 or anti-PD-L2 immune checkpoint molecule.

35. The pharmaceutical composition of claim 34, wherein the cancer is squamous cell carcinoma.

36. 35. The pharmaceutical composition of claim 34, wherein the cancer is breast cancer or colon cancer.

37. 35. The pharmaceutical composition of claim 34, wherein the modulator is selected from the group consisting of an anti-PD1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody.

Images