Systems for detecting the presence, location and / or amount of amyloid deposits in the heart, systems for determining the effectiveness of removal of amyloid deposits in the heart and systems for monitoring disease progression of amyloid deposits in the heart - Patents.com

Abstract

To provide systems for detection of amyloid deposits in the heart.SOLUTION: Methods and diagnostic compositions for detection of amyloid deposits using a chimeric (e.g., mouse-human) antibody or antigen-binding fragment thereof linked to a detectable label are disclosed.SELECTED DRAWING: None

Description

[Technical field]

[0001] [Reference to sequence listing submitted via EFS-WEB] The contents of the ASCII file of the Sequence Listing entitled "8441-0018-1-ST25" submitted electronically with this application via EFS-Web was created on January 22, 2019, is 16.9 kb in size, and is incorporated herein by reference in its entirety.

[0002] [Priority claim] This application claims priority to U.S. Provisional Patent Application No. 62 / 753,410, filed October 31, 2018, the entire contents of which are incorporated herein by reference.

[0003] The present invention relates to humanized and chimeric (eg, mouse-human) antibodies and antigen-binding fragments thereof linked or conjugated with detectable molecules, and methods of using them to detect and image amyloid deposits. [Background technology]

[0004] The following discussion is provided merely to aid the reader in understanding the present invention and is not admitted to describing or constituting prior art.

[0005] Natural antibodies are usually heterotetrameric glycoproteins of about 150,000 daltons composed of two identical light chains and two identical heavy chains. Each light chain is linked to a heavy chain by one disulfide bond. The number of additional disulfide bonds between the heavy chains varies among the various antibody isotypes. The simplest isotype is IgG, which contains only two light chains and two heavy chains, with the two heavy chains linked by two disulfide bonds. Each heavy chain contains a variable domain (V) at one end. H ) and several adjacent constant domains. Each light chain has a variable domain (V L) at one end and a constant domain at the other end. Each variable domain of an antibody's light and heavy chains contains three segments called complementarity determining regions ("CDRs") or hypervariable regions. Each CDR of a light chain, together with the corresponding CDR of an adjacent heavy chain, forms the antigen-binding site of an antibody. There are two main types of light chains, kappa and lambda, depending on their constant region. Both kappa and lambda light chains can bind to any of a variety of heavy chain types.

[0006] Amyloid light chain amyloidosis (AL amyloidosis, AL or ALA), also called primary amyloidosis, is the most common form of systemic amyloidosis in the United States. The term "amyloidosis" refers to a cluster of diseases that share a common feature: extracellular deposition of pathological insoluble fibrillar proteins in organs and tissues (Rodney et al., NEJM, 25:898). Amyloidosis is caused by the malfunction of a person's antibody-producing cells, leading to the production of abnormal protein fibrils that aggregate to form insoluble amyloid deposits in organs and tissues. The type of amyloidosis is determined by the nature of the precursor protein that forms the fibrillar deposits. In primary amyloidosis, the fibrils contain fragments of immunoglobulin light chains, and in secondary amyloidosis, the fibrils contain amyloid A protein. The modern classification of amyloidosis is based on the nature of the precursor plasma protein that forms the fibrillar deposits.

[0007] The precursor plasma proteins are diverse and unrelated to each other. Nevertheless, all precursor deposits give rise to amyloid deposits that share a common typical β-pleated sheet structure that is responsible for the typical staining properties of fibrillar deposits. The final stage in the development of amyloidosis is the deposition of amyloid fibrils in the patient's organs. Mortality from amyloidosis is high, with the current 5-year survival rate being approximately 28%.

[0008] So far, treatment of AL has been directed at reducing the synthesis of amyloidogenic precursor light chains by attacking dysfunctional cells through conventional or high-dose cytotoxic chemotherapy. However, despite improved prognosis with elimination of the offending plasma cell clone, mortality remains high due to multiorgan failure caused by persistent deposition of insoluble amyloid fibrils. This treatment has two drawbacks. First, fibrillar deposits are often asymptomatic until substantial deposition has occurred; therefore, treatment is unlikely to occur before substantial deposits have developed. Second, this treatment is at best only effective in halting the production of precursor abnormal proteins, but is ineffective in removing existing deposits, and the prognosis of AL patients remains very poor due to the persistence (or progression) of pathological deposits (Solomon et al., Int. J. Exp. Clin. Invest., 2:269). Summary of the Invention [Problem to be solved by the invention]

[0009] As such, therapeutic targeting and removal of amyloid deposits is an area of ​​great medical interest. Concomitantly, there is also great interest in detecting the presence and location of amyloid deposits and monitoring their removal as an adjunct to the above-mentioned targeting and removal. The compositions and methods described herein fulfill this need for detecting such presence and location. [Means for solving the problem]

[0010] Described herein are compositions and methods for detecting the presence, location and amount of amyloid deposits, including those resulting from primary (AL) amyloidosis. The compositions described herein comprise a humanized or chimeric antibody or fragment thereof ("antigen-binding fragment") that specifically binds to amyloid deposits (e.g., amyloid light chain fibrils) and is linked to a detectable molecule. The methods described herein comprise administering the above-described composition to a subject suspected of having amyloid deposits, and detecting the presence, amount and / or location of the amyloid deposits by detection of the detectable molecule by diagnostic imaging.

[0011] The method also includes a method of stratifying a patient for treatment with a humanized or chimeric antibody described herein based on the affinity of the diagnostic composition for amyloid deposits. The method also includes a step of determining an appropriate dosage of a humanized or chimeric antibody for treatment described herein based on the affinity of the diagnostic composition for amyloid deposits. That is, an appropriate dosage for a patient can be determined based on the detected affinity (uptake) of the labeled antibody or antibody fragment. A patient exhibiting a strong affinity for the labeled antibody or antigen-binding antibody fragment may require a smaller amount of the therapeutic antibody or antigen-binding antibody fragment than a patient exhibiting a weak affinity for the labeled antibody or antigen-binding antibody fragment. Thus, the present invention provides a method for determining an appropriate dosage of a humanized or chimeric antibody for treatment described herein, comprising administering to a patient a labeled antibody or antibody fragment described herein, determining the affinity of the labeled antibody or antibody fragment for amyloid deposits, and administering a dose or series of doses of the chimeric or humanized antibody or antibody fragment based on the strength of the affinity.

[0012] In some embodiments, the antibody described herein comprised in the diagnostic composition comprises a V K region and V comprising SEQ ID NO:48 HIn some embodiments, the antibody has a constant region derived from human IgG1. In some embodiments, the antibody binds to amyloid fibrils with higher affinity than the mouse equivalent. In some embodiments, the antibody has a constant region derived from V of SEQ ID NO: 36. K Region and V of SEQ ID NO:35 H The antibody binds to an epitope expressed by the β-pleated sheet structure of amyloid fibrils with higher affinity than a mouse antibody having the region and, in some embodiments, the antibody binds to kappa and lambda amyloid fibrils in vivo.

[0013] In another aspect, the invention provides a composition comprising a humanized or chimeric antibody described herein linked to a detectable label or molecule, and a pharma- ceutically acceptable carrier.

[0014] Chimeric antibodies useful in the present methods and compositions may be produced by co-transfection of vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200 in mammalian cells, or by transfection of supervector construct pG1KD200-11-1F4 in mammalian cells. In some embodiments, co-transfection of vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200 or transfection of supervector construct pG1KD200-11-1F4 occurs in COS cells. The antibodies produced in this manner are referred to as "chimeric 11-1F4 antibodies." Fragments of chimeric 11-1F4 antibodies are also useful in the present methods and compositions, as described elsewhere herein.

[0015] In some embodiments, the detected amyloid deposits are due to primary amyloidosis. In some embodiments, the primary amyloidosis involves at least one organ or tissue selected from the group consisting of the heart, kidney, liver, lung, gastrointestinal tract, nervous system, musculoskeletal system, soft tissue and skin, and the deposits are detected in one or more of these organs.

[0016] In one aspect, the invention provides a method for detecting or imaging amyloid deposits, comprising administering to a patient diagnosed with or suspected of having an amyloid deposition disease a diagnostically effective amount of a humanized or chimeric antibody or antigen-binding fragment thereof linked to a detectable label or marker, and detecting the presence, location and / or amount of the detectable label bound to amyloid deposits in the patient by diagnostic imaging. In this aspect, the antibody or antigen-binding fragment comprises a variable heavy chain (VH) having a complementarity determining region (CDR) H1 comprising SEQ ID NO:52, a CDRH2 comprising SEQ ID NO:53, and a CDRH3 comprising SEQ ID NO:54. H ) and a variable light chain (V) having CDRL1 comprising SEQ ID NO:49, CDRL2 comprising SEQ ID NO:50, and CDRL3 comprising SEQ ID NO:51. K In another aspect, the invention provides a composition comprising the antibody or antibody fragment described above linked to a detectable molecule and a pharma- ceutically acceptable carrier.

[0017] In some embodiments of the above aspects, the antibody or antigen-binding fragment thereof may be a humanized antibody, while in other embodiments the antibody or antigen-binding fragment thereof may be a chimeric antibody.

[0018] In some embodiments of the above aspects, the V K The region may comprise SEQ ID NO: 47, H The region may comprise SEQ ID NO:48.

[0019] In some embodiments of the above aspects, the antibody or antigen-binding fragment may have a constant region derived from human IgG1. In some embodiments, the antibody may be a chimeric 11-1F4 antibody.

[0020] In another aspect, the invention provides a method for detecting an amyloid deposition disease in a patient suspected of having the disease by administering a labeled antibody or antigen-binding fragment thereof and detecting the presence of the label in the patient by imaging.

[0021] In some embodiments of this aspect, the humanized or chimeric 11-1F4 antibody has a constant region derived from human IgG1.

[0022] In another aspect, the invention provides a method for detecting the presence, location and / or amount of amyloid deposits in vivo in a patient suspected of having amyloid deposits, the method comprising administering to the patient an antibody or antigen-binding fragment linked to a detectable molecule, wherein the antibody or antigen-binding fragment has a variable heavy chain (VH) having a complementarity determining region (CDR) H1 comprising SEQ ID NO:53, a CDRH2 comprising SEQ ID NO:53, and a CDRH3 comprising SEQ ID NO:54. H ) and a variable light chain (V) having CDRL1 comprising SEQ ID NO:49, CDRL2 comprising SEQ ID NO:50, and CDRL3 comprising SEQ ID NO:51. K The method also includes detecting the presence, location and / or amount of amyloid deposits by detection of a detectable label bound to the amyloid deposits by imaging.

[0023] In another embodiment, the invention provides a method for detecting the presence, location and / or amount of amyloid deposits in vivo in a patient suspected of having amyloid deposits, comprising administering to the patient an antibody or antigen-binding fragment linked to a detectable molecule, wherein the antibody or antigen-binding fragment comprises a V sequence comprising SEQ ID NO:47. K and V comprising SEQ ID NO:48 H and a region. The method also includes detecting the presence, location and / or amount of amyloid deposits bound to the amyloid deposits by detection of the detectable label by imaging.

[0024] In one embodiment of any of the above methods, the invention provides the above methods, wherein the method of detection is positron emission tomography (PET). In embodiments where the method of detection is PET, the detectable label is 124 I, 89 In another embodiment of the above method, the antibody is selected from chimeric or humanized 11-1F4, an antigen-binding fragment thereof, and antibody CAEL-101. In yet another embodiment of the above method, the amyloid deposits occur in the heart.

[0025] In another embodiment, the invention provides a composition for detecting the presence of amyloid deposits in a subject, comprising an antibody or antigen-binding fragment linked to a detectable molecule, wherein the antibody or antigen-binding fragment has a variable heavy chain (VH) having a complementarity determining region (CDR) H1 comprising SEQ ID NO:53, a CDRH2 comprising SEQ ID NO:53, and a CDRH3 comprising SEQ ID NO:54. H ) and a variable light chain (V) having CDRL1 comprising SEQ ID NO:49, CDRL2 comprising SEQ ID NO:50, and CDRL3 comprising SEQ ID NO:51. K ) and.

[0026] In another embodiment, the present invention provides a composition for detecting the presence of amyloid deposits in a subject comprising an antibody or antigen-binding fragment linked to a detectable molecule, wherein the antibody or antigen-binding fragment is a V comprising SEQ ID NO:47. K and V comprising SEQ ID NO:48 H The region has:

[0027] In one embodiment of the above-described composition, the detectable molecule is 124 I and 89 In another embodiment of the above-mentioned composition, the antibody is selected from chimeric or humanized 11-1F4 or an antigen-binding fragment thereof and antibody CAEL-101. In yet another embodiment of the above-mentioned composition, the amyloid deposits occur in the heart.

[0028] In another aspect, the present invention provides a method of monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits, comprising the steps of: (a) administering to the patient a composition as described above and performing imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, (b) treating the patient with a therapy designed to remove the amyloid deposits, (c) administering to the patient a composition as described above, (d) performing imaging on the patient to detect the amount of detectable molecule bound to the amyloid deposits, and (e) comparing the amount of detectable molecule detected in step (d) with the amount of detectable molecule detected in step (a).

[0029] In step (b) of the above method, the patient may be treated with an antibody selected from humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof and antibody CAEL-101. In the above method, the composition may be any of the above compositions. In another embodiment, the method of detection may be PET. In another embodiment, when the method of detection is PET, the detectable label is 124 I and 89 In another embodiment of the above method, the antibody is selected from humanized or chimeric 11-1F4 or an antigen-binding fragment thereof and CAEL-101. In another embodiment of the above method, the amyloid deposits occur in the heart.

[0030] In another embodiment, the present invention provides a method for determining the efficacy of a treatment for removing amyloid deposits in a patient, comprising the steps of (a) treating the patient with a therapeutically effective dose of a humanized or chimeric 11-F4 antibody or antibody fragment thereof, (b) administering to the patient a diagnostically effective amount of one of the compositions described above, and (c) measuring by imaging the amount of a molecule detectable from the diagnostic composition in a lymph node of the patient, wherein the greater the amount of detectable molecule detected in the lymph node, the more effective the treatment. In one aspect of this embodiment, the amyloid deposits occur in the heart.

[0031] In some embodiments of the invention, the chimeric 11-1F4 antibody is CAEL-101, and the antibody is produced by CHO cells deposited with the ATCC under ACC number PTA-125146.

[0032] In some embodiments, the primary amyloidosis consists of λ light chain fibrillar aggregate deposits, in other embodiments the primary amyloidosis consists of κ light chain fibrillar aggregate deposits, and in yet other embodiments the primary amyloidosis consists of κ and λ light chain fibrillar aggregate deposits.

[0033] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the invention. [Brief description of the drawings]

[0034] [Figure 1] FIG. 1 outlines the strategy used to clone mouse VH and VK genes from hybridoma cell lines. [Diagram 2] 1 is a listing of the DNA and amino acid sequences of the mouse 11-1F4 antibody VH region gene (SEQ ID NO:39 and SEQ ID NO:35, respectively). [Diagram 3] 1 is a listing of the DNA and amino acid sequences of the mouse 11-1F4 antibody VK region gene (SEQ ID NO:40 and SEQ ID NO:36, respectively). [Figure 4]1 is a map of the immunoglobulin kappa light chain expression vector pKN100. It consists of a pSV2 vector fragment and contains the SV40 early and incomplete SV40 late promoters, the SV40 origin of replication and the Co1E1 origin of replication. It also contains the ampicillin resistance gene and the neo gene. The incomplete SV40 late promoter drives the neo gene. It also contains the HCMVi promoter, a multiple cloning site (containing BamHI and HindIII restriction sites) for inserting immunoglobulin variable region genes, and the cDNA of the human kappa constant region gene terminated by the spaC2 termination signal sequence ("Arnie") in the same orientation as the kappa light chain expression cassette. [Diagram 5] This is a map of the immunoglobulin gamma 1 heavy chain expression vector pG1D200. It consists of the pSV2dhfr vector fragment, and contains the SV40 early and incomplete SV40 late promoters, the SV40 origin of replication, and the Co1E1 origin of replication. It also contains the ampicillin resistance gene and the dhfr gene. The incomplete SV40 late promoter drives the dhfr gene. As a result, expression is low. This allows the use of relatively low levels of methotrexate to select for multigene / high expression level clones. It also contains the HCMVi promoter fragment, multiple cloning sites, the cDNA for the human gamma 1 constant region gene (intron (-)), followed by the spaC2 termination signal sequence ("Arnie"). [Figure 6] 1 is a listing of the DNA and amino acid sequences of the modified murine 11-1F4 antibody VK region gene (SEQ ID NO:42 and SEQ ID NO:47, respectively) and the sequences of the oligonucleotide primers used to modify the VK gene (SEQ ID NO:41 and SEQ ID NO:43, respectively). [Figure 7] A listing of the DNA and amino acid sequences of the modified murine 11-1F4 antibody VH region gene (SEQ ID NO:45 and SEQ ID NO:48, respectively) and the sequences of the oligonucleotide primers used to modify the VH gene (SEQ ID NO:44 and SEQ ID NO:46, respectively). [Figure 8]1 is a graph showing the results of an amyloid fibril binding ELISA assay. Cos cell supernatants containing chimeric 11-1F4 antibody were tested separately on the same ELISA plate along with purified mouse 11-1F4 antibody. Absorbance was read at OD405. New sv=pG1KD200-11-1F4. New cotransfection=11-1F4VHpG1D200+11-1F4VK.pKN100. [Figure 9] This is a PET image of a mouse implanted with a human cardiac amyloidoma and injected with [124I]CAEL-101, taken four days after injection. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] According to the present invention, compositions are provided that include humanized antibodies, chimeric antibodies (e.g., mouse-human antibodies) or antigen-binding fragments thereof, each linked to a detectable molecule, which are useful for detecting the presence, location and amount of amyloid deposits in vivo. These compositions allow for detection, localization and / or quantification of amyloid deposits with little or no human anti-mouse antibody (HAMA) reaction. The present invention provides compositions that include at least one antibody or antibody fragment linked to a detectable marker and a pharma- ceutically acceptable carrier, and methods for detecting the location and amount of amyloid deposits by administering to a patient an effective amount of the marker-linked antibody or antibody fragment effective for detecting amyloid deposits when present, and detecting the presence, amount and / or location of the detectable marker bound to the amyloid deposits by imaging.

[0036] Further in accordance with the present invention, a method is provided for monitoring or determining the effectiveness of a treatment for an amyloid deposition disease. A method for monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits comprises: (a) administering to a patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody, or antigen-binding fragment thereof, linked to a detectable molecule, and detecting the amount of the detectable molecule bound to amyloid deposits; (b) treating the patient with a therapy designed to remove amyloid deposits, such as a humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof; (c) administering to the patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody, or antigen-binding fragment thereof, linked to a detectable molecule, and detecting the amount of the detectable molecule bound to amyloid deposits; (d) comparing the amount of detectable molecule detected in step (c) with the amount of detectable molecule detected in step (a); Includes.

[0037] In this embodiment, the invention aims to measure the degree of change in the amount of amyloid deposits (if present) in a patient by administering to the patient an antibody or antibody fragment linked to a marker as described herein both before and after treatment intended to remove amyloid deposits, and measuring the difference between the size and extent of amyloid deposits detected after treatment and the size and extent measured before treatment.

[0038] Further provided is a method of detecting amyloid deposits in a subject in vivo, comprising: (a) administering to the subject a composition comprising one or more of the antibodies or antigen-binding fragments thereof described herein linked to a detectable molecule; and (b) detecting by imaging a detectable agent linked to the antibody or antigen-binding fragment thereof bound to the amyloid deposit.

[0039] In the above-mentioned method, the step of detection (step (b)) may be performed using PET (positron emission tomography), SPECT (single photon emission computed tomography), MRI, fluorescence imaging or other suitable imaging method. PET is the preferred imaging method. The use of PET to image tumors and other deposits with detectable molecules is well known. The preparation of this imaging agent and its use in PET is described, for example, in the descriptions by Bailly et al. (Int. J. Mol. Sci. 2017, 18, 57), Boerman et al. (J Nucl Med, 2011; 52: 1171-1172), and Mayer et al. (J Nucl Med, 2017; 58: 538-546), the entire contents of which are incorporated herein by reference. Although these references are primarily directed to the detection of cancerous tumors, the materials and methods described therein are similarly useful for detecting amyloid deposits.

[0040] The in vivo imaging step in the above-mentioned methods may be whole body imaging for diagnostic purposes or quantitative and localized imaging of specific sites such as the heart, kidneys, spleen, nervous system or gastrointestinal system to assess disease progression or patient response to a therapeutic regimen. 11 C. 13 N, 15 O. 18 F, 64 Cu, 62 Cu, 124 I, 76 Br, 82 Rb, 89 Zr or 68 Positron Emission Tomography (PET), an isotope such as Ga, and a detectable agent depending on the specific application. 99m Tc, 111 In, 123 I, 201 Tl or 133The imaging technique may be any imaging technique, including, but not limited to, single photon emission computed tomography (SPECT), where the detectable agent is a radiotracer such as Xe, and magnetic resonance imaging (MRI), where the detectable agent is, for example, gadolinium, iron oxide nanoparticles, and carbon-coated iron-cobalt nanoparticles. 124 I or 89 Labeled with Zr.

[0041] The detectable molecules described herein (sometimes referred to herein as "labels", "markers" or "agents") may be linked (sometimes referred to herein as "conjugated") to an antibody or fragment thereof via any suitable method known in the art. For example, but not limited to, a detectable agent may be linked to an antibody or antibody fragment via a covalent bond or ionic interaction. Linkage may be achieved via chemical cross-linking reactions or via fusion using recombinant DNA methodology combined with any peptide expression system, such as bacterial, yeast or mammalian cell-based systems. Methods for linking an antibody or fragment thereof to a detectable agent are well known to those of skill in the art, as set forth in the references cited above.

[0042] Further provided herein is a method for determining an appropriate dosage of a humanized or chimeric antibody described herein for treatment based on the affinity of a diagnostic composition for amyloid deposits as determined by uptake of the diagnostic composition by the patient's amyloid deposits. That is, the dosage of the patient can be determined based on the detected uptake of the labeled antibody or antibody fragment. A patient showing high uptake of the labeled antibody or antibody fragment may require a lower amount of therapeutic antibody or antibody fragment than a patient showing low uptake of the labeled antibody or antibody fragment. Thus, the present invention provides a method for determining an appropriate dosage of a humanized or chimeric antibody described herein for treatment. The method includes administering to a patient a labeled antibody or antibody fragment described herein, determining the uptake of the labeled antibody or antibody fragment by the amyloid deposits, and administering a dose or series of doses of the chimeric or humanized antibody or antibody fragment based on the detected amount of uptake.

[0043] Further provided herein is a method for determining the efficacy of a therapy for removing amyloid deposits using a chimeric or humanized antibody or antibody fragment described herein, comprising the steps of (a) treating a patient with a therapeutically effective dose of a therapy intended to remove amyloid deposits, such as a chimeric or humanized antibody or antibody fragment described herein, (b) administering to the patient a diagnostically effective amount of a diagnostic composition described herein, and (c) measuring the amount of a molecule detectable from the diagnostic composition in a lymph node of the patient, where the greater the amount of detectable molecule detected in the lymph node, the more effective the therapy.

[0044] [Definition] It is to be understood that the method is not limited to the specific embodiments described herein, but may vary. It is also to be understood that the terminology used herein is used to describe only the specific embodiments, and is not intended to be limiting. The scope of the technology is limited only by the appended claims.

[0045] Certain terms used herein may have the following defined meanings. As used in the specification and claims, the singular forms "a," "an," and "the" include singular and plural references unless the context clearly indicates otherwise. For example, the term "a cell" includes a single cell as well as a plurality of cells, including mixtures thereof.

[0046] The term "comprising" as used herein is intended to mean that the compositions and methods include the recited elements but do not exclude other elements. "Consisting essentially of," when used to define compositions and methods, means excluding other elements that are essential to the composition or method. "Consisting of" means excluding more than trace elements of other ingredients in the compositions and substantial method steps defined in the claims. Embodiments defined by each of these transition terms are within the scope of the present invention. Thus, it is intended that the methods and compositions can include (comprising) additional steps and ingredients, or can include (consisting essentially of) non-essential steps and compositions, or can consist only of (consisting of) the method steps or compositions described herein.

[0047] As used herein, "about" means plus or minus 10% from the value.

[0048] As used in this specification, "optional" means that the event or circumstance described below may or may not occur, and the description includes cases where the event or circumstance occurs and cases where it does not occur.

[0049] As used herein, the terms "individual," "patient," or "subject" may refer to an individual organism, a vertebrate, a mammal (e.g., a cow, a dog, a cat, or a horse), or a human. In a preferred embodiment, the individual, patient, or subject is a human.

[0050] The term "isolated antibody" as used herein is intended to refer to an antibody that is substantially free of other antibodies having different antigen specificities (e.g., an isolated antibody that specifically binds to amyloid fibrils is substantially free of antibodies that do not bind to amyloid fibrils). However, an isolated antibody that specifically binds to an epitope of an amyloid light chain fibril (e.g., κ and / or λ fibril) may have cross-reactivity to other proteins, such as amyloid A fibrils. However, the antibody preferably always binds to human amyloid light chain fibrils. Also, an isolated antibody is typically substantially free of other cellular material and / or chemicals.

[0051] The term "diagnostically effective amount" as used herein refers to an amount of antibody or antibody fragment linked to a detectable marker that, when administered to a patient or subject, can detect, locate and / or quantify amyloid deposits in the patient or subject in vivo by imaging diagnostics if amyloid deposits are present.It is emphasized that a diagnostically effective amount is not necessarily effective for detecting amyloid deposits, even if the amount is considered to be a diagnostically effective amount by those skilled in the art.A diagnostically effective amount may vary based on the route of administration and dosage form, the age and weight of the subject, and / or the condition of the subject, such as the type and stage of amyloidosis at the time of starting diagnosis, as well as other factors.

[0052] The term "humanized antibody" as used herein refers to an antibody having CDRs of an antibody derived from a mammal other than a human, and framework regions (FRs) and constant regions of a humanized antibody. Humanized antibodies are useful as elements in diagnostic compositions according to the invention because of the reduced antigenicity of humanized antibodies in the human body.

[0053] The term "antibody fragment" as used herein refers to a portion of an antibody that is designed to remove part of the structure of an intact antibody while still containing the CDRs of the antibody. The design of antibody fragments is well known in the art and is described (for example) by Holliger et al., Nature Biotechnology: 23(9), 1126-1135 (2005), the entire contents of which are incorporated herein by reference. As used herein, "antigen-binding fragment" refers to an antibody fragment that binds to amyloid deposits.

[0054] As used herein, the term "pharmaceutical-acceptable carrier" refers to a material for miscibility with a pharmaceutical or therapeutic compound (e.g., a chimeric antibody linked to a detectable molecule) for administration to a patient, e.g., as described in Ansel's Pharmaceutical Dosage Forms and Delivery Systems, 10th Edition (2014).

[0055] As used herein, the synonymous terms "detectable molecule," "detectable marker," "detectable agent," and "detectable label" refer to a substance that may be detected in vivo by diagnostic imaging techniques, including but not limited to PET, SPECT, and MRI.

[0056] As used herein, the term "diagnostic imaging" or "imaging" refers to a method of imaging a detectable molecule in a patient or subject in vivo to determine the presence, location and / or amount of tissue or material (such as amyloid deposits) in a patient or subject having the detectable molecule localized by linking to an antibody or antibody fragment that binds to the tissue or material to be detected.

[0057] [Anti-AL antibody] [[Mouse Antigen Fibrin Antibody]] Recent animal studies have shown that administration of the murine 11-1F4 antibody and other murine anti-human light chain specific antibodies directed against epitopes common to the β-pleated sheet structure present in AL fibrils results in complete degradation of human ALκ and ALλ amyloid deposits. Some of these murine antibodies are described in U.S. Patent No. 8,105,594 (the "'594 Patent"), the entire contents of which are incorporated herein by reference.

[0058] Mouse antibodies are generally not suitable for administration to other animal species (such as humans) because the recipient species recognizes the mouse antibody as an antigen and produces antibodies against it. Antigenicity when an antibody from one species is injected into another species is usually caused by a portion of the constant domain. Such antigenic reactions inhibit or prevent the desired therapeutic effect of the mouse antibody. In humans, this antigenic reaction is called human anti-mouse antibody (HAMA). The antibodies described in the '594 patent can be highly immunogenic in humans through a human anti-mouse antibody (HAMA) response. Since the HAMA reaction usually results in rapid clearance of the mouse antibody from the human recipient, HAMA greatly limits the benefits that mouse antibodies can bring to human therapy and diagnosis. As such, these mouse antibodies are not suitable for administration to patients to detect amyloid fibril deposits in the patient. Thus, the present invention provides compositions for detecting and / or monitoring amyloid deposition diseases that are unlikely to produce an immunogenic HAMA reaction in the patient after administration.

[0059] [[Humanized and chimeric antigen-fiber antibodies]] The present invention provides compositions comprising humanized and chimeric antibodies or antigen-binding fragments thereof linked to a detectable molecule. The compositions described herein are useful for imaging the location and amount of amyloid deposits in a subject. Typically, an antibody consists of four polypeptides, including two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain contains two N-terminal variable (V H ) domain and three C-terminal constant (CH1, CH2 and CH3) domains, and each light chain has one N-terminal variable (V L or V K ) region and one C-terminal constant (CL) region. Each variable domain of the light and heavy chains of an antibody also contains three segments called complementarity determining regions ("CDRs") or hypervariable regions. Each CDR in a light chain, together with the corresponding CDR in the adjacent heavy chain, forms the antigen-binding site of the antibody. The variable regions of each pair of light and heavy chains form the antigen-binding site of the antibody, while the constant regions provide structural support and regulate the immune response initiated by antigen binding.

[0060] Chimeric antibodies combine the variable regions of a non-human antibody with the constant regions of a humanized antibody. For example, a chimeric 11-1F4 antibody may be produced by expressing mouse variable regions in the Fc region of a humanized antibody, such as human IgG1.

[0061] Humanized forms of non-human (e.g., murine) antibodies can be obtained that contain minimal sequences derived from non-human immunoglobulin. Generally, humanized antibodies may have one or more variable domains. The variable regions are derived from non-human immunoglobulin, and the framework regions (FR) correspond to human immunoglobulin sequences. Thus, in some embodiments, a humanized anti-AL antibody has a humanized antibody framework region. Such antibodies can be prepared by known techniques.

[0062] The murine 11-1F4 monoclonal antibody is an anti-AL antibody produced by SP2 / 0 hybridoma cells deposited at Dr. Alan Solomon, MD (University of Tennessee Medical Science Center, Knoxville, Tennessee, USA). The hybridoma cell line is available from the American Type Culture Collection (ATCC deposit PTA-105). Table 1 below lists the V- and V-specific binding profiles of the 11-1F4 antibody. K Region (SEQ ID NO: 36) and V H The region (SEQ ID NO: 35) is shown. Table 2 shows the CDR sequences of the heavy and light chains.

[0063] [Table 1]

[0064] [Table 2]

[0065] Using known human antibody sequences, the V H and V K The gene of the region can be cloned to generate the chimeric 11-1F4 antibody, which binds to an epitope expressed by the beta-pleated sheet structure of amyloid, just like its mouse counterpart. Surprisingly, as shown in Example 6 below, this chimeric antibody binds to AL amyloid fibrils with higher affinity than the 11-1F4 mouse antibody from which it is derived.

[0066] Known human antibody sequences can also be used to generate humanized versions of the antibodies by cloning the genes of the CDR regions. Similar to the chimeric version of the 11-1F4 antibody, the humanized version can have a higher binding affinity to amyloid fibrils than the corresponding mouse antibody.

[0067] Those skilled in the art will understand that the humanized and chimeric antibodies described herein can utilize any type of human constant region and / or framework region. For example, the humanized and chimeric antibodies described herein may have human IgG (including IgG1, IgG2, IgG3 and IgG4), IgA, IgE, IgH, or IgM constant region and / or framework region. In a preferred embodiment, the humanized or chimeric 11-1F4 antibody described herein has a human IgG1 constant region.

[0068] In some embodiments, the antibodies described herein may contain one or more substitutions, insertions, or deletions, so long as the antibody maintains its ability to bind to amyloid fibrils (e.g., κ and / or λ light chain fibrils). For example, in some embodiments, a chimeric 11-1F4 antibody of the invention may have heavy and light chains that have about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding heavy and light chain sequences described herein, so long as the antibody maintains its ability to bind to amyloid fibrils. In some embodiments, the humanized 11-1F4 antibodies of the invention may have CDRs that are about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the corresponding CDR sequences described herein, so long as the antibody maintains the ability to bind to amyloid fibrils.

[0069] [Abbreviation] Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), ribonucleic acid (RNA), messenger RNA (mRNA), deoxyribonucleic acid (DNA), copy DNA (cDNA), polymerase chain reaction (PCR), minutes (min), seconds (sec), Tris-borate buffer (TBE).

[0070] Amino acids are represented by their IUPAC abbreviations as follows: alanine (Ala), arginine (Arg), asparagine (Asn), aspartic acid (Asp), cysteine ​​(Cys), glutamine (Gln), glutamic acid (Glu), glycine (Gly), histidine (His), isoleucine (Ile), leucine (Leu), lysine (Lys), methionine (Met), phenylalanine (Phe), proline (Pro), serine (Ser), threonine (Thr), tryptophan (Trp), tyrosine (Tyr), and valine (Val). Nucleotides are similarly represented as follows: adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), adenine or guanine (R), cytosine or thymine (Y), guanine or cytosine (S), adenine or thymine (W), guanine or thymine (K), adenine or cytosine (M), cytosine or guanine or thymine (B), adenine or guanine or thymine (D), adenine or cytosine or thymine (H), adenine or cytosine or guanine (V), and any base (N).

[0071] [Humanized or chimeric antibodies] To produce the chimeric antibody of the present invention, the murine 11-1F4 monoclonal antibody heavy and kappa light chain variable region genes described in U.S. Pat. No. 8,105,594 were PCR modified to facilitate the expression of the chimeric 11-1F4 antibody in mammalian cells. A detailed sequence analysis of the modified variable region genes was performed. The modified variable region genes were cloned into appropriate mammalian expression vectors to generate constructs 11-1F4VHpG1D200 and 11-1F4VK.pKN100. A single super vector construct pG1KD200-11-1F4 was generated from the 11-1F4VHpG1D200 and 11-1F4VK.pKN100 constructs by EcoRI restriction enzyme digestion and ligation. Finally, the chimeric 11-1F4 antibody was transiently expressed in COS cells by both co-transfection and single super vector transfection. For convenience, COS cells were selected for co-transfection or transfection, but those skilled in the art will recognize that other mammalian cell lines can be used. The binding ability of chimeric 11-1F4 antibody to amyloid fibrils was characterized by direct binding ELISA. Unexpectedly and beneficially, chimeric 11-1F4 antibody bound to amyloid fibrils with higher affinity than mouse 11-1F4 antibody.

[0072] Typically, an antibody consists of four polypeptides, including two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain contains one N-terminal variable (V H ) domain and three C-terminal constant (CH1, CH2 and CH3) domains, and each light chain has one N-terminal variable (V L or V K The variable regions of each pair of light and heavy chains form the antigen-binding site of an antibody.

[0073] The antibody useful in the compositions and methods of the invention is V of SEQ ID NO:47. K Region and V of SEQ ID NO:48 HThe antibody may be a chimeric mouse-human monoclonal antibody having the CDR region of SEQ ID NO: 49 to 54, or a humanized monoclonal antibody comprising the CDR sequences of SEQ ID NO: 49 to 54. These antibodies bind to an epitope expressed by the β-pleated sheet structure of amyloid fibrils. Moreover, surprisingly, these antibodies bind to the V K Region and V of SEQ ID NO:35 H The antibodies of the present invention bind to this epitope with higher affinity than the 11-1F4 mouse antibody from which they are derived, which has a region. The present invention includes a method for detecting amyloid deposits in a human patient. The method includes administering to the patient a diagnostically effective dose of one of the above-mentioned antibodies linked to a detectable molecule in a pharmaceutically acceptable carrier. The antibody composition may be administered by any conventional route of administration, although parenteral administration (such as intravenous) is preferred. Pharmaceutically acceptable carriers are well known in the art and an appropriate one can be selected by one skilled in the medical field.

[0074] Chimeric antibodies and antigen-binding fragments thereof useful in the compositions and methods described and claimed herein (as well as methods of making chimeric antibodies) are described in commonly owned Patent Cooperation Treaty application PCT / US18 / 399805, filed June 28, 2018 (attorney docket no. 8441-0004WO), which has priority from U.S. patent application Ser. No. 62 / 526,835, filed June 29, 2017, and commonly owned Patent Cooperation Treaty application PCT / US2018 / 043374, filed July 24, 2018 (attorney docket no. 8441-0009WO), the entire contents of which are incorporated herein by reference. Materials useful for producing this antibody include vector constructs selected from the group consisting of 11-1F4VK.pKN100 and 11-F4VH.pG1D200, shown in Figures 5 and 6, respectively, as well as the superconstruct pG.1KD20011-1F4 made from the two vector constructs described above. Other useful materials include the modified murine 11-1F4 antibody V K Region gene (SEQ ID NO: 42) and modified 11-1F4 antibody V Hregion gene (SEQ ID NO: 45) and respective primers SEQ ID NO: 41, 43, 44 and 46. The antibody may be produced by co-transfection of the vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200 or the superconstruct pG.1KD20011-1F4 into a suitable mammalian host cell, such as COS (Chinese Hamster Ovary) cells.

[0075] Methods for making, testing and using humanized or chimeric 11-1F4 antibodies are described in further detail in the Examples section below. [Diagnostic method] Diagnostic compositions suitable for the methods described herein can include a humanized or chimeric 11-1F4 antibody, humanized antibody or antigen-binding antibody fragment described herein, each linked to a detectable marker, and a pharma- ceutically acceptable carrier or diluent.

[0076] The compositions may be formulated for intravenous, subcutaneous, intraperitoneal or intramuscular administration, although intravenous administration is preferred.

[0077] The pharmacologically acceptable carrier for various dosage forms is known in the art.For example, the solvent, solubilizer, suspending agent, isotonic agent, buffer and soothing agent for liquid preparation are known.In some embodiments, pharmaceutical composition comprises additional components such as one or more preservatives, antioxidants, stabilizers, etc.

[0078] Sterile injectable solutions can be prepared by incorporating the required amount of marker-linked antibody or antibody fragment in an appropriate solvent with one or more combinations of ingredients as required above, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the diagnostic composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. [Diagnostic and monitoring methods] In general, amyloidosis is caused by the accumulation of abnormal proteins called amyloids. Amyloids are produced in the bone marrow and can be deposited in any tissue or organ. The specific cause depends on the type of amyloidosis.

[0079] There are several types of amyloidosis or amyloid disease, including AL amyloidosis, AA amyloidosis, and hereditary amyloidosis.

[0080] AL amyloidosis (immunoglobulin light chain amyloidosis) is the most common type and affects the heart, kidneys, skin, nerves and liver. Formerly known as primary amyloidosis, AL amyloidosis occurs when the bone marrow produces abnormal antibodies that it cannot break down. The antibodies are deposited in various tissues as amyloid plaques and prevent the normal functioning of the tissue or organ.

[0081] Formerly known as secondary amyloidosis, AA amyloidosis commonly affects the kidneys, but may also affect the gastrointestinal tract, liver or heart. It often occurs in association with chronic infectious or inflammatory diseases such as rheumatoid arthritis or inflammatory bowel disease.

[0082] Hereditary amyloidosis (familial amyloidosis) is a genetic disorder that usually affects the liver, nerves, heart and / or kidneys. Many different types of genetic abnormalities present at birth are associated with an increased risk of amyloid disease or hereditary amyloidosis. The type and location of the amyloid genetic abnormality influences the risk of certain complications, the age at which symptoms first appear and the progression of the disease over time.

[0083] When amyloid diseases affect the heart, they can cause many types of complications. Amyloid deposits or plaques reduce the heart's ability to fill with blood between beats. Less blood is pumped with each beat, causing shortness of breath. Amyloid deposits and plaques in or around the heart can also cause arrhythmias and organ damage, such as congestive heart failure.

[0084] When amyloid diseases affect the kidneys, their filtering ability is impaired, leading to increased leakage of protein from the blood into the urine (i.e., proteinuria), and the kidneys' ability to remove waste products from the body is reduced, which can eventually lead to kidney failure.

[0085] Provided herein is a method for detecting, localizing, and / or quantifying amyloid deposits in a patient suffering from or suspected of suffering from an amyloid deposition disease, such as primary (AL) amyloidosis, comprising administering to a patient (e.g., a human patient) a humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof linked to a detectable marker and a pharma- ceutically acceptable carrier in an amount effective to detect, localize, and / or quantify amyloid deposits, if present, and then detecting the detectable molecule bound to amyloid deposits in the patient by imaging to determine the extent, location, and / or amount, if present, of amyloid deposits.

[0086] Also provided herein is a method for monitoring disease progression in a patient diagnosed with an amyloid deposition disease and having amyloid deposits, the method comprising: (a) administering to a patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody, or antigen-binding fragment thereof, linked to a detectable molecule, and performing imaging on the patient to detect the amount of the detectable molecule bound to amyloid deposits; (b) treating the patient with a therapy designed to remove amyloid deposits, such as a humanized or chimeric 11-1F4 antibody or antigen-binding fragment thereof; (c) administering to the patient a diagnostically effective amount of a humanized or chimeric 11-1F4 antibody, or antigen-binding fragment thereof, linked to a detectable molecule and performing imaging on the patient to detect the amount of the detectable molecule bound to amyloid deposits; (d) comparing the amount of detectable molecule detected in step (c) with the amount of detectable molecule detected in step (a).

[0087] The above-described monitoring methods can be performed before the initiation of any treatment or can be used during a treatment regimen, i.e., step (a) above can determine a baseline amount of amyloid deposits in a patient prior to any treatment, or step (a) above can be performed after one or more courses of treatment to determine the effectiveness of a subsequent course of treatment.

[0088] In some embodiments, the amyloid deposition disease (e.g., primary amyloidosis) involves involvement of at least one organ or tissue selected from the group consisting of the heart, kidney, liver, lungs, gastrointestinal tract, nervous system, musculoskeletal system, soft tissue, and skin.

[0089] In some embodiments, the methods described herein include treating a patient suffering from relapsed or refractory ALA. In some embodiments, the patient may have κ ALA. In some embodiments, the patient may have λ ALA.

[0090] Exemplary diagnostic amounts may vary depending on the size and health of the individual being treated. In some embodiments, a diagnostically effective amount of radiolabeled humanized or chimeric 11-1F4 antibody for PET is about 1-10 mCi. However, in some situations and other imaging modalities, the dosage may be higher or lower. A person skilled in the art of imaging will know how to select an appropriate amount of labeled antibody or antibody fragment, as described (for example) in the references cited above.

[0091] The following examples are provided to illustrate the present invention. However, it should be noted that the present invention is not limited to the specific conditions or details described in these examples. All publications referenced herein are incorporated herein by reference. EXAMPLES

[0092] [PCR cloning and DNA sequencing of mouse 11-1F4 antibody] The heavy and light chain variable region genes of mouse 11-1F4 monoclonal antibody were PCR cloned, and detailed sequence analysis of all isolated variable region genes (pseudo and functional) was performed. Detailed DNA and amino acid sequences of the heavy and light chain variable region genes of mouse 11-1F4 antibody were obtained.

[0093] [material] Media components and all other tissue culture materials were obtained from Life Technologies (UK). RNA solution kit was obtained from Stratagene (USA) and first strand cDNA synthesis kit was purchased from Pharmacia (UK). All components and equipment for RCR reaction including AmpliTaq® DNA polymerase were purchased from PerkinElmer (USA). TOPO TA Cloning® kit was obtained from Invitrogen (USA). Agarose (UltraPure™) was obtained from Life Technologies (UK). ABI PRISM® Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit Premixed Cycle Sequencing Kit and ABI PRISM® 310 Sequencing Machine were both purchased from PE Applied Biosystems (USA). All other molecular biology products were obtained from New England Biolabs (USA) and Promega (USA).

[0094] [method] Figure 1 shows the mouse V-cell line produced from the hybridoma cell line producing the mouse monoclonal antibody 11-1F4. H and VK FIG. 1 outlines the strategy used for PCR cloning genes.

[0095] Two clones (B2C4 and B2D6) of the SP2 / 0 hybridoma cell line producing the α-human light chain monoclonal antibody 11-1F4 were kindly provided by Alan Solomon, MD (University of Tennessee Medical Science Center, Knoxville, TN, USA). The hybridoma cell line is available from the American Type Culture Collection (ATCC deposit PTA-105). The cell line was cultured using DMEM medium supplemented with 20% (v / v) FBS, penicillin / streptomycin and L-glutamine. 10 8 Cells were cultured until a total viable cell count of cells was reached.

[0096] Cells were harvested separately from each clone as follows: Mouse hybridoma cell lines were cultured in suspension in appropriate culture medium at approximately 10 8 The hybridoma cells were grown to a sufficient amount to provide a total viable cell count of 10 cells. The culture supernatant was harvested and the hybridoma cells were pelleted in a benchtop centrifuge (250g, 5 min). The cells were gently resuspended in 20 ml of PBS and a 100 μl aliquot was taken for viable cell counting. An aliquot of cells was pelleted again and 200 μl of PBS and 200 μl of trypan blue were added to the 100 μl of cells and mixed gently. 10 μl of this mixture was pipetted onto a disposable cell counting slide and the number of white blood cells in nine small squares was counted under a microscope. Blue cells (i.e., dead cells) were not counted. The counting process was repeated and the results averaged, resulting in an average result of 9 × 10 5 A viable cell count was obtained for cells in 20 ml of PBS. Once enough cells were harvested, they were resuspended in 10 ml of solution D for RNA isolation (using the Stratagene RNA isolation kit, see below).

[0097] Total RNA was then isolated from cells of each clone individually using Stratagene's RNA isolation kit according to the manufacturer's instructions. 1 ml of 2 M sodium acetate (pH 4.0) was added to the sample and the contents of the tube were thoroughly mixed by repeatedly inverting the tube. 10.0 ml of phenol (pH 5.3-5.7) was added to the tube and the contents were thoroughly mixed again by inversion. 2.0 ml of chloroform-isoamyl alcohol mixture was added to the mixture, the tube was capped and shaken vigorously for 10 seconds, and the tube was incubated in ice for 15 minutes. The sample was transferred to a 50 ml thick-walled round-bottom centrifuge tube that had been pre-chilled on ice, and the tube was spun in a centrifuge at 10,000 x g for 20 minutes at 4°C. After centrifugation, two phases were visible in the tube. The upper aqueous phase contained RNA, and the lower phenol phase and intermediate phase contained DNA and protein. The upper aqueous phase, which contained RNA, was transferred to a new centrifuge tube, and the lower phenol phase was discarded. An equal volume of isopropanol was added to the aqueous phase, the contents mixed by inversion, and the tube was then incubated at -20°C for 1 h to precipitate the RNA. The tube was spun in a centrifuge at 10,000 x g for 20 min at 4°C. After centrifugation, the pellet at the bottom of the tube containing the RNA was removed and the supernatant was discarded. The pellet was dissolved in 3.0 ml of solution D, 3.0 ml of isopropanol was added to the tube, and the contents were mixed well. After incubating the tube at -20°C for 1 h, it was spun again in a centrifuge at 10,000 x g for 10 min at 4°C, and the supernatant was removed from the tube and discarded. (Note: Up until this point, the RNA had been protected from ribonucleases by the presence of guanidine isothiocyanate, but it is no longer protected now.) The pellet was washed with 75% (v / v) ethanol (DEPC-treated water (25%)) and the pellet was dried under vacuum for 2-3 min. The RNA pellet was resuspended in 0.5–2 ml of DEPC-treated water.

[0098] Not Id(T) included in the Amersham Pharmacia Biotech First Strand cDNA Synthesis Kit 18Primers were used to generate single stranded DNA copies of 11-1F4 hybridoma mRNA according to the manufacturer's instructions. One reaction was performed for each of the two RNA samples isolated, as described below. Components used were bulk first strand cDNA reaction mix, cloning FPLCpure™ mouse reverse transcriptase, RNAguard™, BSA, dATP, dCTP, dGTP and dTTP, 200 mM DIT in water, Not Id(T) 18 Primer: 5'-d[AACTGGAAGAATTCGCGGCCGCAGGAA 18 ]-3', and DEPC-treated water.

[0099] Approximately 5 μg of total RNA in 20 μl of DEPC water was heated at 65° C. for 10 min and then cooled on ice. The bulk first strand cDNA reaction mixture was gently pipetted to obtain a uniform suspension, and the reaction was set up in a 0.5 ml microcentrifuge tube as follows: 20 μl of denatured RNA solution, 11 μl of bulk first strand cDNA reaction mixture, 1 μl of Not Id(T) for a total volume of 33 μl. 18 Primers and 1 μl of DTT solution. The reactions were mixed gently by pipetting and incubated at 37° C. for 1 hour.

[0100] Then, the mouse heavy chain and kappa light chain variable region genes (V H Genes and V K Genes) were PCR amplified from ssDNA templates using the method described by Jones and Bendig (Bio / Technology, 9:88).

[0101] The appropriate constant region primer (V H About MHC1 to MHC3 and V K An equimolar mixture of MKC for 10 min was used to generate a primer specific for the degenerate leader sequence (V H About MHV1-MHV12 and V K Separate PCR reactions were prepared for each of the MKVs (MKV1 to MKV11). Tables 1 and 2 show the V H and VK The primers used to amplify the region genes are detailed. In total, 12 heavy chain reactions and 11 kappa light chain reactions were performed. In all cases, AmpliTaq® DNA polymerase was used to amplify the template cDNA as described below.

[0102] The completed cDNA first strand synthesis reaction was heated to 90°C for 5 minutes to denature the RNA-cDNA duplex and inactivate the reverse transcriptase, and cooled on ice. Eleven GeneAmp™ PCR reaction tubes were labeled MKV1-11. For each tube, a 100 μl reaction mixture was prepared, with each reaction mixture containing 69.3 μl sterile water, 10 μl 10×PCR buffer II, 6 μl 25 mM MgCl2, 2 μl each of a 10 mM stock solution of dNTPs, 2.5 μl 10 mM MKC primer, 2.5 μl one of the 10 mM MKV primers, and 1 μl of the RNA-cDNA template mixture. Then, 0.7 μl of AmpliTaq® DNA polymerase was added to each of the tubes, and the completed reaction mixture was overlaid with 50 μl of mineral oil.

[0103] A similar series of reaction mixtures was prepared as described above to PCR clone mouse heavy chain variable region genes, except this time 12 reaction tubes were labeled and one of the 12 MHV primers and the appropriate MHC primer were added to each, i.e., MHC G1 primers were used to PCR amplify the variable domain gene of mouse γ1 heavy chain.

[0104] The reaction tubes were loaded into a DNA thermal cycler and cycled 25 times at 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min (after an initial melt at 94°C for 1.5 min). The last cycle was followed by a final extension step at 72°C for 10 min before cooling to 4°C. A 30 s ramp time was allowed between each step of the cycle, except between the annealing (50°C) and extension (72°C) steps, where an extended ramp time of 2.5 min was used. A 10 μl aliquot from each PCR reaction was run on a 1% (w / v) agarose / 1×TBE buffer gel containing 0.5 μg / ml ethidium bromide to determine which leader primer produced a PCR product. Positive PCR clones ranged in size from approximately 420 bp to 500 bp.

[0105] The PCR amplification steps described above were repeated two more times to select PCR reactions that appeared to amplify full-length variable domain genes. A 6 μl aliquot of each potential PCR product was directly cloned into the pCR™II vector provided by the TA Cloning® kit as described in the manufacturer's instructions. 10.0% (v / v), 1.0% (v / v) and 0.1% (v / v) aliquots of transformed E. coli cells were pipetted onto individual 90 mm diameter LB agar plates containing 50 μg / ml ampicillin, overlaid with 25 μl of X-Gal stock solution and 40 μl of IPTG stock solution, and incubated overnight at 37° C. Positive colonies were identified by PCR screening.

[0106] [Table 3]

[0107] [Table 4]

[0108] A 5 μl aliquot from each PCR reaction was run on a 1% agarose / TBE (pH 8.8) gel to determine which produced a PCR product of the correct size (approximately 450 bp). These putative positive PCR products thus identified were directly cloned into the pCR2.1 vector provided by the TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies containing plasmids with the correct size insert were identified by PCR screening colonies using 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson (Nucleic Acids Res., 17:4000). These putative positive clones thus identified were sequenced for double-stranded plasmid DNA using an ABI PRISM 310 Genetic Analyzer and ABI PRISM BigDye™ terminators. V from B2C4 hybridoma cell line clones were cloned directly into the pCR2.1 vector provided by the TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. H and V K Three positive clones each of the genes were sequenced, and the V from the B2D6 hybridoma cell line clone K Four positive clones of genes and V H Six of the genes were also sequenced.

[0109] [Table 5]

[0110] The results of 12 PCR reactions performed on each hybridoma clone (B2C4 and BCD6) to amplify the mouse 11-1F4 antibody heavy chain variable region gene are shown in Table 4(a).

[0111] The degenerate leader sequence primer MHV7, in combination with a mixture of MHCGI-3 constant region primers (Table 1), produced a PCR product of approximately 600 bp from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines. This band had an average V HSince this was larger than the expected size for the gene (450 bp), it was not investigated further. On the other hand, the degenerate leader sequence primer MHV6, in combination with the mixture of MHCGI-3 constant region primers (Table 1), generated V from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines. H A PCR product of the expected size (450 bp) for the gene was generated.

[0112] Table 4 shows the results of PCR amplification performed to clone the mouse 11-1F4 monoclonal antibody heavy chain variable region gene (a) and light chain variable region gene (b) from SP2 / 0 hybridoma cell lines B2C4 and B2D6. In the third column, the actual PCR results are recorded. When a band was observed for a particular combination of primers, the base pair size (bp) was recorded in the appropriate space.

[0113] [Table 6]

[0114] Sequence analysis of three clones from the PCR products derived from B2C4 and five clones from the PCR products derived from B2D6 revealed a single heavy chain variable region sequence (Figure 2).

[0115] The cloning strategy used (amplification of the entire variable region gene by using primers flanking this region, i.e. specific for the leader and constant region sequences) allowed the identification of the complete FR1 sequence: all eight sequenced clones had identical sequences in this region (Figure 2).

[0116] The results of 11 PCR reactions performed on each hybridoma clone (B2C4 and BCD6) to amplify the mouse 11-1F4 antibody kappa light chain variable region gene are shown in Table 4(b).

[0117] The degenerate leader sequence primer MKV6, in combination with the MKC constant region primers (Table 2), produced a PCR product of approximately 200 bp from template cDNA derived exclusively from the B2C4 hybridoma cell line. K As it was much smaller than the expected size for the gene (450 bp), it was not investigated further.

[0118] The degenerate leader sequence primer MKV2, in combination with the MKC constant region primers (Table 2), produced PCR products smaller than the expected band size of 450 bp (as viewed on an agarose gel) from template cDNA derived from both the B2C4 and B2D6 hybridoma cell lines. K Cloning revealed that the MKV2 primers amplify a known kappa light chain pseudogene, and therefore this product corresponds to the murine 11-1F4 antibody V K To confirm that they were pseudogenes rather than genes, sequence analysis of one clone from each PCR product was performed, which revealed that the PCR clones were indeed pseudogenes.

[0119] Finally, the degenerate leader sequence primer MKV1, in combination with the MKC constant region primers (Table 1), generated V K A PCR product of approximately the expected size for the gene (450 bp) was generated.

[0120] Sequence analysis of three clones of PCR products derived from B2C4 and four clones of PCR products derived from B2D6 revealed a single kappa light chain variable region sequence that could not be identified as a pseudogene.

[0121] Here, the 11-1F4 antibody heavy chain variable region gene was cloned from hybridoma mRNA (using constant region-specific and leader sequence-specific primers) and sequenced.

[0122] This sequence was translated to obtain the TVSS peptide sequence. H Genetic analysis revealed that 84% of these sequences contained the TVSS peptide sequence. H It was concluded that the gene was the correct 11-1F4 antibody gene sequence.

[0123] The variable region kappa light chain gene of the mouse 11-1F4 antibody also contains a non-functional V K As with the pseudogene, it was successfully cloned and sequenced. This pseudogene was first identified by Carroll et al. (Molecular Immunology (1988) 25:991). The sequence arises from an aberrant mRNA transcript present in all canonical fusion partners derived from the original MOPC-21 tumor (including SP2 / 0). As a result of the aberrant mRNA, the invariant cysteine ​​at position 23 is replaced by a tyrosine residue, the VJ joint is out of frame, and a stop codon occurs at position 105.

[0124] It is common for lymphoid and hybridoma cells to synthesize two or more rearranged light immunoglobulin mRNAs. These mRNAs usually contain functional V K They are non-productive due to the presence of stop codons or frameshifts not normally found in genes. These false messengers often cause major problems when cloning immunoglobulin genes from hybridomas because they are excellent substrates for V-region PCR, despite the fact that they do not code for functional polypeptides.

[0125] 11-1F4 antibody V KThe gene sequence was identified after detailed sequence analysis of seven separate PCR clones isolated from two different PCR products, resulting in SEQ ID NO: 36. Since all sequences were identical, this was accepted as the correct 11-1F4 antibody kappa light chain variable region sequence.

[0126] Cloned V H and V K The domain genes were used to generate the chimeric mouse-human 11-1F4 monoclonal antibody, which was then analyzed to confirm specific binding to AL fibrils. EXAMPLES

[0127] [Construction of chimeric mouse-human 11-1F4 (c11-1F4) antibody] The V of 11-1F4 described above in mammalian cells as part of a chimeric mouse-human antibody H and V K To allow for transient expression of the variable region genes, it was necessary to modify the 5' and 3' ends using specifically designed PCR primers (Table 5). K The gene was PCR modified to 11-1F4V using primers F39835 and F58933. H The gene was PCR modified. The reverse (BAK) primers F39836 and F39835 were used to PCR amplify V K and V H At the 5' end of the gene, a HindIII restriction site, a Kozak translation initiation site and an immunoglobulin leader sequence were introduced. The forward (FOR) oligonucleotide primer F39837 introduced the V K A splice donor site and a BamHI restriction site were introduced at the 3' end of the gene. The forward (FOR) oligonucleotide primer F58933 was H The first 22 base pairs of the γ-1CH1 gene, including an ApaI restriction site, were added to the 3′ end of the gene.

[0128] [Table 7]

[0129] The Kozak consensus sequence is essential for efficient translation of the variable region sequence (Kozak, J Mol Bio, 196:947). It defines the correct AUG codon at which the ribosome begins translation, with the most critical base being an adenine (or slightly more preferably a guanine) at position -3 upstream of the AUG start.

[0130] The immunoglobulin leader sequence ensures that the expressed antibody is secreted into the medium so that it can be easily harvested and purified. The leader sequence used in this example is V H and V K The V of mouse 11-1F4 cloned from hybridoma cDNA during the cloning process K and V H It was the leader sequence.

[0131] The splice donor sequence attaches the light chain variable region to the appropriate constant region in frame, forming a 130-bp V K :C K Important for splicing out introns. The heavy chain variable region was attached directly to its appropriate constant region gene via an Apal site, eliminating the need for a splice donor site.

[0132] The subcloning restriction sites HindIII and BamHI, and HindIII and Apal, respectively, represent the modified V K and V H The variable region genes are bracketed and various unique restriction sites are used to ensure directional subcloning into a suitable mammalian expression vector.

[0133] First, the 11-1F4 light chain variable region gene was carefully analyzed to identify unwanted splice donor sites, splice acceptor sites and Kozak sequences (see Table 6). Both the heavy and light chain variable region genes were analyzed for the presence of extraneous subcloning restriction sites that would later prevent subcloning and / or expression of functional whole antibody. None were found.

[0134] [Table 8]

[0135] For each variable region gene, a separate PCR reaction was set up as follows: Plasmid 11-1F4V, as described above H .pCR2.1 and 11-1F4V KpCR2.1 was used as template. 100 μl reaction mixture was prepared in each PCR tube. Each mixture contained up to 41 μl sterile water, 10 μl 10×PCR buffer I, 8 μl 10 mM stock solution of dNTPs, 1 μl 10 mM 5′ forward primer, 1 μl 10 mM 3′ reverse primer and 1 μl of 1 / 10 diluted template DNA. Finally, the completed reaction mixture was overlaid with 50 μl mineral oil after adding 0.5 μl AmpliTaq® DNA polymerase (2.5 units). The reaction tube was loaded into a DNA thermal cycler and cycled 25 times (after an initial melt at 94° C. for 1 min) at 94° C. for 30 s, 68° C. for 30 s and 72° C. for 50 s. The last cycle was followed by a final extension step at 72° C. for 7 min and cooling to 4° C. A 10 μl aliquot from each PCR reaction tube was run on a 1.2% (w / v) agarose / 1×TBE buffer gel containing 0.5 μg / ml ethidium bromide to determine the size and presence of the PCR product. The size of the positive PCR clone was approximately 420 bp. The putative positive PCR product thus identified was directly cloned into the pCR2.1 vector provided by the Topo TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies were PCR screened using 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson to identify colonies containing plasmids with the correct size insert. The putative positive clones described above were double-stranded plasmid DNA sequenced using an ABI PRISM 310 Genetic Analyzer and ABI PRISM BigDye™ terminators. The V cloned into Topo TA was cloned into the pCR2.1 vector provided by the Topo TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol ... colonies were PCR screened using 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson to identify colonies containing plasmids with the correct size insert. The putative positive clones described above were double-stranded plasmid DNA sequenced using an ABI PRISM 310 Genetic Analyzer and ABI PRISM BigDye™ terminators. H and V K Two positive clones of the gene were sequenced.

[0136] Correctly modified 11-1F4V H and 11-1F4V KClones containing the genes were identified, and the modified V genes from these clones were subcloned into the respective expression vectors to facilitate expression of the chimeric heavy and kappa light chains in mammalian cells. K The gene was subcloned into the expression vector pKN100 as a HindIII-BamHI fragment (Figure 4). This vector contains the human kappa constant region gene (allotype Km(3 Ala153, Ser191)). The modified 11-1F4V H The genes were subcloned as HindIII-ApaI fragments into the expression vector pG1D200 (Figure 5). This vector contains the human gamma 1 constant region gene (allotype: G1m (-1 Glu377, Met38I, -2 Ala462, 3 Arg222, Ser229)). Both the kappa and gamma 1 constant region allotypes used are commonly found in the Caucasian population. The ligated expression constructs 11-1F4VK.pKN100 and 11-1F4VH.pG1D200 were then used to transform DH5α competent cells and positive clones were identified by the PCR screening method described above using the original PCR modified primers (Table 4). Expression vectors are readily available. EXAMPLES

[0137] [Construction of a single supervector for transient expression of chimeric 11-1F4 in COS cells] A single super vector expressing both immunoglobulin chains of the chimeric 11-1F4 antibody was constructed as follows: The 11-1F4 kappa light chain expression cassette (containing the HCMVi promoter, the 11-1F4 kappa light chain variable region gene and the kappa light chain constant region gene) was restriction enzyme digested (EcoRI at positions 1 and 2490) from the 11-1F4VK.pKN100 construct (Figure 4) and then ligated into the 11-1F4VHpG1D200 construct via a unique EcoRI (position 4297, Figure 5). This ligation created the super vector construct pG1KD200-11-1F4, which contains both the heavy and kappa light chains of the 11-1F4 chimeric antibody. EXAMPLES

[0138] [Transient expression of chimeric γ1 / κ.11-1F4 whole antibody in COS cells] The chimeric 11-1F4 antibody was transiently expressed in COS cells from the European Collection of Cell Cultures (ECACC) in two ways: (i) By cotransfection of 10 μg each of the vector constructs 11-1F4VK.pKN100 and 11-1F4VH.pG1D200. Cotransfections were performed in duplicate. (ii) by transfection of 13 μg of the single supervector construct pG1KD200-11-1F4. Supervector transfections were performed five times.

[0139] The transfection method used was as follows: COS cell lines were transfected at 150 cm with DMEM supplemented with 10% (v / v) FCS, 580 μg / ml L-glutamine, and 50 units / ml penicillin / 50 μg / ml streptomycin (hereafter referred to as "medium"). 2 The cells were grown to confluence in 150 cm flasks. The cells were trypsinized, spun down in a benchtop centrifuge (250 g for 5 min), and then resuspended in 6 ml of medium before being transferred to three 150 cm flasks each containing 25 ml of fresh prewarmed medium. 2 The cells were incubated overnight at 37°C in 5% CO2 and harvested the next day while exponentially growing. Each flask contained approximately 1 × 10 7 The cells were trypsinized again, pelleted as before, washed with 20 ml PBS, and then resuspended in 10 ml of PBS until the cell concentration was 1 x 10 7The cells were resuspended in sufficient PBS to give 1000 cells / ml. 700 μl of the washed COS cells were pipetted into a Gene Pulser® cuvette, to which 1 μl of both heavy chain and kappa light chain expression vector DNA (10 μg each) or 13 μg of the supervector construct was then added. A 1900V, 25 μF capacitance pulse was delivered to the mixture using a Bio-Rad Gene Pulser® instrument. The pulse was repeated for each experimental transfection and for the "no DNA" control (COS cells were electroporated in the absence of DNA). A positive control of previously expressed antibody was also performed to test the efficiency of the COS cells.

[0140] COS cells were allowed to recover for 10 min at room temperature and then gently pipetted into a 10 cm diameter tissue culture dish containing 8 ml pre-warmed DMEM supplemented with 10% (v / v) γ-globulin-free FBS, 580 μg / ml L-glutamine and 50 units / ml penicillin / 50 μg / ml streptomycin, and incubated at 5% CO2 and 37°C for 72 h before COS cell supernatants were harvested for analysis. After 72 h incubation, the medium was collected, spun to remove cell debris, and analyzed by ELISA for chimeric antibody production and antigen binding of the c11-1F4 antibody. EXAMPLES

[0141] Quantification of chimeric γ1 / κ11-1F4 antibodies via capture ELISA. After expression, total IgG molecules present in the COS cell supernatant were quantified using a capture ELISA assay. IgG molecules were captured on a Nunc-Immuno MaxiSorb™ plate via immobilized goat anti-human IgG, Fcγ fragment specific antibody and detected via anti-human kappa light chain peroxidase conjugated antibody. A standard curve was generated by capturing and detecting standard IgG antibodies of known concentrations on the same plate in the same manner as follows. Each well of a 96-well (hole) immunoplate was coated with a 100 μl aliquot of 0.4 μg / ml goat anti-human IgG antibody diluted in PBS and incubated overnight at 4° C. Excess coating solution was removed and the plate was washed three times with 200 μl / well of wash buffer (1×PBS, 0.1% TWEEN). 100 μl of SEC buffer was dispensed into all wells except wells in row B-G of column 2. A 1 μg / ml solution of human IgG1 / κ antibody in SEC buffer was prepared as a standard and 200 μl / well was pipetted into wells in rows B and C of column 2. The medium of the transfected cos cells was centrifuged (250 g, 5 min) and the supernatant was saved. A 200 μl aliquot of the supernatant from the "no DNA" control (COS cells were transfected in the absence of DNA) was pipetted into wells in row D of column 2 and 200 μl / well aliquots of the experimental supernatants were pipetted into wells in rows E, F and G of column 2. The 200 μl aliquots from wells in rows B through G of column 2 were mixed and then 100 μl was transferred from each well to the adjacent well in column 3. This process continued through column 11 with a series of two-fold dilutions of standards, controls and experimental samples, then all were incubated at 37°C for 1 hour, and all wells were rinsed six times with 200 μl aliquots of wash buffer. Goat anti-human kappa light chain peroxidase conjugate was diluted 5000-fold in SEC buffer, 100 μl of diluted conjugate was added to each well, and the incubation and rinsing steps were repeated. 150 μl of K-BLUE substrate was added to each well and incubated for 10 minutes at 25°C in the dark. 50 μl of RED STOP solution was added to each well to stop the reaction, and the optical density was read at 655 nm. EXAMPLES

[0142] [Binding analysis of chimeric 11-1F4 antibody] The chimeric 11-1F4 antibody was tested for binding to amyloid fibrils using a direct binding ELISA assay. Synthetic fibrils were formed from immunoglobulin light chain protein and used to monitor the reactivity of the antibody in a solid-phase ELISA-based assay using "low-binding" polystyrene plates (Costar, no. 3474). Immediately before coating the plates, 250 μg chunks of fibrils were diluted to 1 ml in coating buffer (0.1% bovine serum albumin in phosphate-buffered saline, pH 7.5). The sample was then sonicated for 20 seconds using the ultrasonic probe of a Tekmar Sonic Disruptor with the power set to 40% of maximum to obtain a solution of short fibrils, each consisting of up to 2-5 protofilaments. This solution was then diluted to 5 ml, mixed thoroughly by vortexing, and aliquoted into the wells of the plate. This step resulted in 50 μl of fibril solution at a concentration of 50 μg / ml in each well. The plates were then placed uncovered in a 37° C. incubator to dry overnight.

[0143] The ELISA assay was then performed within 48 hours of preparing the plates as follows: Wells were blocked by adding 100 μl of 1% BSA in PBS and incubated for 1 hour at room temperature on a shaker. Plates were washed 3 times with PBS, 0.05% Tween 20 (v / v). To each well of the plate, 50 μl of a solution of c11-1F4 (3 μg / ml antibody in 0.1% BSA / PBS) was added and the plate was incubated for 1 hour at room temperature on a shaker. Plates were washed 3 times (as before) and detection of bound antibody was performed using a biotinylated goat anti-mouse IgG antibody (Sigma no. B-8774, anti-heavy and light chain).

[0144] Successfully modified V H and V K Sequence analysis of the gene revealed that the correct sequence was present. Kand V H The detailed DNA and amino acid sequences of the gene are shown in Figures 3 and 4. K and V H The genes were successfully cloned into mammalian expression vectors pG1D200 and pKN100, respectively, and the resulting 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs were used for co-transfection of mammalian cells.

[0145] The 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs were then used to construct a single supervector (pG1KD200-11-1F4) expressing the chimeric 11-1F4 antibody in mammalian cells. The expression levels of the chimeric 11-1F4 antibody by co-transfection and supervector transfection of COS cells from ECACC were analyzed. The expression level observed from transfection of the pG1KD200-11-1F4 supervector (10326ng / ml) was 3.7-fold higher than that observed from the corresponding co-transfection of the 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs (2820ng / ml).

[0146] After expression and quantification, the chimeric 11-1F4 antibody was tested for binding to the target antigen (amyloid fibrils kindly provided by NCI) by direct binding ELISA. The results of the binding ELISA are shown in Figure 8. Supernatants from the two best individual pG1KD200-11-1F4 supervector transfections were analyzed in parallel with one supernatant from the corresponding cotransfection.

[0147] The results showed that the chimeric 11-1F4 antibody bound to amyloid fibrils with higher affinity than its murine counterpart. This result was surprising and unexpected, since chimeric antibodies are typically expected to have binding affinities comparable to the original murine antibody. While not intending to be bound by a particular mechanism, the inventors believe that the net effect of combining the 11-1F4 murine V region with the human γ1 / κC region used to generate the chimeric 11-1F4 antibody may have resulted in an antibody with higher affinity.

[0148] A sample of CHO cells (identified as CAEL-101) secreting one embodiment of the chimeric 11-1F4 monoclonal antibody used herein (which may be referred to in this embodiment as CAEL-101 or antibody CAEL-101) was deposited with the American Type Culture Collection (ATCC deposit number: PTA-125146) on June 27, 2018 in accordance with the Budapest Treaty. EXAMPLES

[0149] [Imaging human amyloid deposits in mice] Human amyloid extracts from heart (κ1), liver (κ1), spleen (λ1) and kidney (λ6) were kindly provided by Tufts University. Lyophilized human amyloid extracts were suspended in 25 ml of sterile PBS and homogenized for 3 min before centrifugation at 12,000 g for 30 min. 100 mg of the resulting pellet was resuspended in sterile saline. Amyloid extracts were injected subcutaneously into Balb / c mice.

[0150] [ 124 CAEL-101: cGMP grade CAEL-101 was synthesized using a standard iodogen reaction, a positron-emitting nuclide used in PET imaging. 124The mice were radioactively labeled with I (Fraker et al., Biochem Biophys Res Commun 80(4):849-57, and Markwell et al., Biochem 17:4807-17). Approximately 5 days after implantation of the human amyloid extract to form a subcutaneous amyloidoma, 50–200 μCi of [ 124 Mice were injected with [I]CAEL-101 and imaged using an Inveon microPET scanner at days 1, 4, and 7 after injection. Regions of interest were drawn with the PMOD software package, and tumor-to-background (amyloid deposit to background) ratios (T:B) were calculated at days 1 and 4 after tracer injection to obtain the SUVmax of the amyloidoma and contralateral background.

[0151] [ 124 [I]CAEL-101 successfully imaged 100% of mice bearing human amyloid extracts (κ1, λ1 and λ6 subtypes derived from heart, liver, spleen and kidney). We also demonstrated for the first time imaging of amyloidosis derived from the heart, which was reported not to work in previous literature (Wall et al., Blood. 2010 116:2241) (Figure 9). Human amyloidomas were visualized both at day 1 and day 4 after tracer injection, with a marked increase in T:B ratio at day 4. T:B ratios at day 4 ranged from 2.1 to 4.2. Heterogeneity in uptake was observed among the various amyloidomas. For example, mice transplanted with κ subtypes had significantly better in vivo T:B ratios (4.1 ± 0.20) compared to λ subtypes (2.8 ± 0.46). However, all amyloidomas had T:B uptake >2.1, which is considered clinically significant.

[0152] Thus, the result of heterogeneity of uptake among various amyloidomas can be used to classify patients for treatment with chimeric or humanized antibodies as described herein and to determine the appropriate dosage of antibody therapy using real-time PET imaging. That is, the dosage of the patient can be determined based on the detected uptake of the labeled antibody or antibody fragment. A patient who shows strong uptake (affinity) for the labeled antibody or antibody fragment may require a smaller amount of therapeutic antibody or antibody fragment than a patient who shows weak uptake (affinity) for the labeled antibody or antibody fragment. Thus, the present invention provides a method for determining the appropriate dosage of the humanized or chimeric antibody as described herein for treatment. The method includes administering to a patient a labeled antibody or antibody fragment as described herein, determining the uptake of the labeled antibody or antibody fragment by amyloid deposits in the patient, and administering to the patient a dose or series of doses of the chimeric or humanized antibody or antibody fragment based on the determined amount of the labeled antibody or antibody fragment.

[0153] [ 89 Zr]CAEL-101: [ 124 I]CAEL-101 showed significant binding to amyloidoma, 124 Because the I radiolabel is dehalogenated, much of the detected activity is in the thyroid or is not targeted (if the thyroid is blocked). Therefore, we sought a method to radiolabel with a more stable radionuclide that could be imaged after the unbound radiolabel had been removed from the blood (7-10 days later). Two different strategies were used to radiolabel CAEL-101 with 89-zirconium ( 89 Zr) and radioactively labeled with [ 89We have produced [Zr]-CAEL-101. One strategy employs standard NCS linkers that are attached to random lysines in the antibody (Eur J Nucl Mol Imaging.2010 Feb.37(2):250-59, and Curr Radiopharm.2011 Apr.1;4(2):131-139). This method has been used in many clinical applications, but has been shown to yield multiple radioisomeric forms that can theoretically vary conjugation and biodistribution between batches. Therefore, we radiolabeled CAEL-101 in a site-specific approach targeting cysteines using a bifunctional deferoxamine-maleimide crosslinker (Nuclear Medicine and Biology, 37(2010)289-297). Approximately 5 days after amyloidoma formation by subcutaneous implantation of human cardiac amyloid extract, 50-200 μCi of [ 89 Animals were injected with [Zr]CAEL-101 and imaging was performed on days 1, 4, 7, 11 and 14 post-injection using an Inveon microPET scanner.

[0154] [ 89 Both [Zr] and [Zr] variants of CAEL-101 were successfully used to image mice bearing cardiac amyloid extracts. Human amyloidomas were visualized very well throughout the duration of the experiment (14 days after tracer injection) and no significant degradation of the radioactive tracer was observed. This was despite the significant degradation seen on days 4 and 7. 124This is in contrast to [I]CAEL-101. This extended imaging of amyloid deposits allows imaging to be performed using the labeled antibody after the unbound labeled antibody has been substantially cleared from the blood. This improves the tumor-to-background ratio. This plays an important role in imaging disease in organs with many adjacent blood compartments, such as cardiac amyloid deposits. Amyloidomas were observed even 14 days after tracer injection, indicating that the antibody-bound component is long-term stable in vivo. We were again able to demonstrate imaging of amyloidosis originating from the heart, which was reported as non-functional in the prior literature. We also observed for the first time ipsilateral uptake in lymphoid tissues. This could be due to the transplantation of amyloidomas in immunodeficient mice, which resulted in the migration of amyloid in phagocytosed immune cells to the draining nodes. In this model, spontaneous amyloid clearance occurs due to the presence of human amyloid. This novel observation could provide the basis for a method to image the response to therapy by examining lymph node uptake of PET tracers.

[0155] The words "comprise", "comprises" and "comprising" as used in the description and claims of this specification are not intended to exclude other features, additives, ingredients, integers or steps, unless expressly stated otherwise. The scope of these words is to be interpreted broadly to have an inclusive meaning, rather than an exclusive meaning.

[0156] The compositions and methods of the present invention have been described herein with reference to examples, however, it will be understood that the present invention is not limited thereto and that various modifications are possible as known to those skilled in the art without departing from the teachings of the present invention as defined by the appended claims.

Claims

1. 1. A system for detecting the presence, location and / or amount of amyloid deposits in the heart, comprising: a) an antibody linked to a detectable molecule; b) an imaging device that detects the presence, location and / or amount of said amyloid deposits; The antibody of a) comprises a variable heavy chain (VH) having SEQ ID NO: 48 and a variable light chain (VK) having SEQ ID NO: 47; Here, the system detects the presence, location and / or amount of amyloid deposits in the heart by using the imaging device of b) to detect a detectable molecule linked to the antibody of a) bound to the amyloid deposits.

2. The system of claim 1 , wherein the antibody is a chimeric mouse-human antibody.

3. The system of claim 1 , wherein the imaging device is a Positron Emission Tomography (PET) scanner.

4. The detectable label of the detectable molecule is １２４ The system of claim 3, wherein I is

5. The detectable label of the detectable molecule is ８９ The system of claim 3 , wherein Zr is

6. The system of claim 1 , comprising an antibody having a higher affinity than an antibody comprising a VH having sequence number 35 and a VK having sequence number 36.

7. 1. A system for determining efficacy of removal of amyloid deposits in a patient's heart, comprising: a) a chimeric antibody for removing amyloid deposits, comprising a variable heavy chain (VH) having SEQ ID NO: 48, a variable light chain (VK) having SEQ ID NO: 47, and a constant region derived from human IgG1; b) a composition comprising an antibody linked to a detectable molecule; c) an imaging device for detecting the presence, location and / or amount of said amyloid deposits; The antibody of b) comprises a variable heavy chain (VH) having SEQ ID NO: 48 and a variable light chain (VK) having SEQ ID NO: 47; wherein said imaging device is utilized to detect the presence, location and / or amount of said amyloid deposits in the heart by detecting the detectable molecule bound to said detectable molecule-linked antibody of said b) that is bound to amyloid deposits before and after administration of said chimeric antibody of said a). A system for determining the effect of removing the amyloid deposits in the heart by measuring the reduction in the amount of a detectable molecule linked to the antibody contained in the composition of (b).

8. The system of claim 7 , wherein the imaging device is a Positron Emission Tomography (PET) scanner.

9. The detectable label of the detectable molecule is １２４ The system of claim 7, wherein I.

10. The detectable label of the detectable molecule is ８９ The system of claim 7, wherein Zr is

11. The system of claim 7 , comprising a chimeric antibody having a higher affinity than an antibody comprising a VH having sequence number 35 and a VK having sequence number 36.

12. 1. A system for monitoring disease progression of amyloid deposits in the heart, comprising: a) a composition comprising an antibody linked to a detectable molecule; b) an imaging device for detecting the presence, location and / or amount of said amyloid deposits at the first and second or subsequent times; and c) a comparison means for comparing the presence, location, and / or amount of amyloid deposits detected at the first time with the presence, location, and / or amount of amyloid deposits detected at a second or subsequent time. The antibody of a) comprises a variable heavy chain (VH) having SEQ ID NO: 48 and a variable light chain (VK) having SEQ ID NO: 47; Here, a system for monitoring the disease progression of amyloid deposits in the heart by detecting the presence, location and / or amount of amyloid deposits in the heart by utilizing the imaging device of b) to detect a detectable molecule linked to the antibody of a) bound to the amyloid deposits at different time points.

13. The system of claim 12 , wherein the imaging device is a Positron Emission Tomography (PET) scanner.

14. The detectable label of the detectable molecule is １２４ The system of claim 12, wherein I is

15. The detectable label of the detectable molecule is ８９ The system of claim 12 , wherein Zr is

16. The system of claim 12 , comprising an antibody having a higher affinity than an antibody comprising a VH having SEQ ID NO: 35 and a VK having SEQ ID NO: 36.

Images