Diagnostic methods for Helicobacter suis infection

Abstract

To provide diagnostic methods specific to H. suis, and to provide diagnostic methods specific to H. suis, which are simple testing methods comprising non-invasive methods.SOLUTION: The present inventors have newly found that an outer membrane protein (HsvA; named by the present inventors) that exists specifically only in H. suis and antibodies against it exist in the body of a H. suis infected individual, and have found a diagnostic method utilizing an amino acid sequence that is the antigenic site of HsvA protein. Therefore, the present invention provides a method that can specifically detect H. suis using a H. suis-specific antigen consisting of a HsvA antigen peptide, and H. suis-specific DNA derived from hsvA gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method and a diagnostic agent for Helicobacter suis infection, which utilize a newly discovered outer membrane protein gene specific to Helicobacter suis and its gene product (protein), as well as antibodies against them. [Background technology]

[0002] It is now known that infection with Helicobacter pylori (a microaerophilic gram-negative spiral bacterium that parasitizes the human stomach, hereafter referred to as "H. pylori") is involved in chronic gastritis, gastric ulcers, duodenal ulcers, gastric cancer, gastric mucosa-associated lymphoid tissue (MALT) lymphoma, and diffuse large B-cell lymphoma. The main methods used to test for H. pylori infection are isolation and culture, urea breath tests, measurement of H. pylori antibody titers in serum and urine (ELISA and latex agglutination method), and measurement of H. pylori antigens in stool (immunochromatography method).

[0003] However, in recent years, with the spread of diagnosis and eradication drugs for H. pylori, Helicobacter heilmannii in the broad sense has become a problem as a Helicobacter that induces serious gastric diseases in humans other than H. pylori. Helicobacter heilmannii in the broad sense (Helicobacter heilmannii sensu lato, hereafter referred to as "H. heilmannii") includes Helicobacter heilmannii in the narrow sense (H. heilmannii sensu stricto), Helicobacter suis (H. suis), H. bizzozeronnii, H. felis, and H. salmonis, and most of the Helicobacter found in the human stomach is H. suis (hereafter referred to as H. suis), but a rapid diagnostic method has not been established (Non-Patent Document 1).

[0004] H. pylori only infects primates, and infection from close relatives is assumed only in infancy, whereas H. suis can be transmitted by animals of any age, such as pigs, cats, and animals. H. pylori has a total length of 2.5-5.0 μm, whereas H. heilmannii has a total length of 5-10 μm (Non-Patent Document 2). H. heilmannii, including H. suis, lacks the gene for a protein toxin that has a wide range of effects, such as causing erosion and ulcers in the gastric mucosa, causing cell death by denaturing cultured cells, and inducing apoptosis, called CagPAI (pathogenicity island), a gene cluster containing a type IV secretion apparatus-related protein gene, which is the main pathogenic factor of H. pylori, and a protein gene that is injected into the host and induces cancer, called VacA (Vacuolating cytotoxin A), which is a gene cluster containing a protein gene that is injected into the host and induces cancer, and a gene cluster containing a gene cluster containing a protein toxin that has a wide range of effects, such as causing erosion and ulcers in the gastric mucosa, causing cell death by denaturing cultured cells, and inducing apoptosis (Non-Patent Document 3).

[0005] It has also been reported that infection with H. suis frequently leads to the development of gastric MALT lymphoma, which is mainly caused by the accumulation of lymphocytes. Furthermore, infection experiments using mice have shown that H. suis has a much stronger infectiousness than H. pylori (Non-Patent Document 4), and it has been reported that H. suis has flagella at both ends, is highly motile, and invades deep within the gastric gland cavity and into parietal cells, making antibiotics less effective against it (Non-Patent Document 5).

[0006] In fact, approximately 60% or more of patients who are H. pylori negative but exhibit symptoms of gastritis or gastric disease are thought to be H. suis infection positive (Non-Patent Document 6). In addition, 25-50% of MALT lymphomas are thought to be caused by H. suis infection (Non-Patent Document 5).

[0007] However, while H. pylori is urease positive, H. suis isolated from humans often show negative results in urease tests and urea breath tests despite having the urease gene (H. suis isolated from animals are urease and urea breath tests positive). Therefore, infection with H. suis cannot be diagnosed using the urease test or urea breath test used for H. pylori. In addition, although there have been reports of successful in vitro culture of strains isolated from pigs (Patent Document 1), there have been no reports of colony formation by H. suis on isolation agar medium, and strains isolated from humans cannot be cultured in vitro. Furthermore, H. suis contained in gastric biopsies of human patients cannot yet be cultured in vitro in pure form (Non-Patent Document 7). For this reason, diagnosis using the isolation and culture method used for H. pylori was also impossible. Therefore, H. suis found in humans is difficult to culture and has weak urease activity, so it cannot be detected by standard H. pylori testing methods.

[0008] On the other hand, the outlines (draft genomes) of the whole genomes of H. heilmannii sensu stricto ASB1 strain isolated from a cat with severe gastritis (Non-Patent Document 8), H. bizzozeronnii CIII-1 strain isolated from human gastric mucosa (Non-Patent Document 9), H. suis H1 and H5 strains isolated from porcine gastric mucosa (Non-Patent Document 10, H. felis CS1 strain (Non-Patent Document 11), and H. suis SNTW101 strain isolated from a Japanese patient with splenic gastritis (Non-Patent Document 12) have been analyzed and reported. Currently, the PCR method using DNA prepared from a gastric biopsy and targeting the H. heilmannii-specific 16S rRNA gene is the general diagnostic method for H. heilmannii infection, including H. suis.

[0009] However, existing diagnostic methods for H. heilmannii require tissue examination and cannot distinguish between H. suis and other H. heilmannii (Patent Document 2). Thus, a method capable of diagnosing only H. suis infection and a non-invasive method have not yet been established (Non-Patent Document 13). Therefore, there has been a demand for the development of a simple and highly sensitive test method for H. suis. Previously, the inventors have reported a method for diagnosing H. suis infection that targets the F2R2 protein and its gene sequence, based on genome analysis information of H. suis isolated from cynomolgus monkeys (Patent Document 3). [Prior art documents] [Patent documents]

[0010] [Patent Document 1] JP 2011-15664 A [Patent Document 2] U.S. Patent Publication No. 2006-0078919 [Patent Document 3] JP 2016-10331 A [Non-patent literature]

[0011] [Non-Patent Document 1] Blaecher C et al., Helicobacter. (2016) 22(3): e12369 [Non-Patent Document 2] Overby A et al., Digestion. (2016) 93(4):260-5 [Non-Patent Document 3] Vermoote M et al., Vet Res. (2011) 42:51 [Non-Patent Document 4] Nakamura M et al., Infect Immun. (2007) 75(3):1214-22 [Non-Patent Document 5] Overby A et al., Digestion. (2017) 95(1):61-6 [Non-Patent Document 6] Masahiko Nakamura et al., Inspection and Technology (2016) 44(4):278-84 [Non-Patent Document 7] Matsui H et al., Helicobacter. (2014)19(4):260-71 [Non-Patent Document 8] Smet A et al., Genome Announcements (2013) 1(1): e00033-12 [Non-Patent Document 9] Schott T et al., Journal of Bacteriology (2011) 193(17):4565-6 [Non-Patent Document 10] Vermoote M et al., Veterinary Research (2011) 42:51 [Non-Patent Document 11] Arnold IC et al., Genom Biol. Evol. (2011)3:302-8 [Non-Patent Document 12] Matsui H et al., Genome Announcements(2016)4(5):e00934-16 [Non-Patent Document 13] Bento-Miranda M et al., World J Gastroenterol(2014)20(47):17779-87 Summary of the Invention [Problem to be solved by the invention]

[0012] The present invention aims to provide a diagnostic method specific to H. suis. Another aim of the present invention is to provide a diagnostic method specific to H. suis, which is a simple and rapid test method including a non-invasive method. [Means for solving the problem]

[0013] In this study, the inventors have newly discovered that an outer membrane protein (HsvA; named by the inventor) that is specific to H. suis and antibodies against it exist in the bodies of H. suis-infected individuals, and have found a diagnostic method that utilizes the amino acid sequence that is the antigenic site of the HsvA protein. The F2R2 protein does not have structures such as an amino-terminal signal peptide region that is common to outer membrane proteins of bacterial cells and an autotransporter (an outer membrane transport mechanism of proteins specific to gram-negative bacteria) at the carboxyl terminal, and a disorder region involved in functional expression that are present in the HsvA protein that is the target of this invention (see Figure 1). Therefore, it can be assumed that H. suis-infected individuals have a higher antibody titer against the HsvA protein, which is assumed to be an outer membrane protein, than against the F2R2 protein.

[0014] As a result of various investigations into methods capable of specifically detecting H. suis, the inventors discovered the presence of antibodies against HsvA, an outer membrane protein specific to H. suis, in the blood of patients infected with H. suis, and demonstrated that by utilizing the amino acid sequence that serves as the antigenic site of the HsvA protein, it is possible to detect H. suis infection and distinguish it from H. pylori infection.

[0015] The hsvA gene is contained in the H. suis SNTW101 strain isolated from a patient with splenic gastritis (see Matsui H et al., Genome Announcements (2016) 4 (5): e00934-16). Its base sequence (hsvA gene: SEQ ID NO: 1) is significantly different in molecular weight from the H. pylori empty toxin protein VacA (Cover TL et al., Nat Rev Microbiol. (2005) 3 (4): 320-32) and has no identity, but it has an amino-terminal signal peptide region, which is characteristic of the outer membrane protein of H. pylori, and a carboxy-terminal autotransporter (an outer membrane transport mechanism of proteins specific to gram-negative bacteria) β domain. In addition, it also has a disorder region involved in functional expression (see Figure 1). In addition, the hsvA gene is also included in the draft genomes of H. suis strains HS1 and HS5 isolated from pigs (Vermoote M et al., Vet Res. (2011) 42:51), but neither has identity with the VacA protein of H. pylori, and it was thought that not only does it not have the function of VacA of H. pylori, but it is also a gene that is not expressed in the first place. However, the present inventors have newly discovered the presence of HsvA protein and antibodies against it in the bodies of H. suis-infected individuals, and as a result of further investigation of HsvA, they have found for the first time that HsvA protein is expressed as an outer membrane protein of H. suis.

[0016] The present invention has been made based on such findings, and therefore relates to the following inventions. (1) An HsvA antigenic peptide or an immunologically equivalent variant thereof. (2) An antigen peptide described in (1) or its immunological variant (immunologically equivalent variant), which is derived from H. suis. (3) The antigenic peptide according to (1) or its immunological variant (immunologically equivalent variant), wherein the HsvA antigenic peptide has a sequence consisting of 5 to 50 amino acids contained in any one of the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, and SEQ ID NO: 78 to 83. (4) The peptide described in (3) or an immunologically equivalent variant thereof, wherein the HsvA antigen peptide has a sequence consisting of 5 to 50 amino acids included in any one of the amino acid sequences described in SEQ ID NOs: 78 to 83. (5) The peptide according to (1) or its immunologically equivalent variant, wherein the HsvA antigen peptide is a peptide having any one of the amino acid sequences selected from the following group or an immunologically equivalent variant thereof: EKX1AVX2X3X4X5NSNX6X7 (Peptide No. 11: SEQ ID NO: 24), NQGTLEFLSNDVSX8 (Peptide No. 19: SEQ ID NO: 25), X9SX10KLQX11X12LKSX13X14X15 (Peptide No. 33: SEQ ID NO: 26), TNGQEVSASIDYNK (Peptide No. 16: SEQ ID NO: 12), AKLSNFASNDALPD (Peptide No. 23: SEQ ID NO: 13), PTTSSGASPDSSNP (Peptide No. 10: SEQ ID NO: 14), GLGRDLFVHSMGDK (Peptide No. 21: SEQ ID NO: 15), QIGKIKLSDVLSAS (Peptide No. 15: SEQ ID NO: 16), YGAIDKELHFSGGK (Peptide No. 34: SEQ ID NO: 17), NVDNILNMPSTTSG (Peptide No. 20: SEQ ID NO: 18), GNLKGVYYPKSSTT (Peptide No. 22: SEQ ID NO: 19), ITEKIQSGKLTITI (Peptide No. 14: SEQ ID NO: 20), FHDFLVSLKGKKFA (Peptide No. 26: SEQ ID NO: 21), TTGGEVRLFRSFYV (Peptide No. 31: SEQ ID NO: 22), and and IGARFGLDYQDINI (Peptide No. 35: SEQ ID NO: 23) Here, X1 is K or D, X2 is Q, E or T, X3 is Q or S, X4 is M or L, X5 is E or K, X6 is P or S, X7 is D or G, X8 is N or T, X9 is L or F, X10 is N or D, X11 is G, D or N, X12 is Q or M, X13 is M or L, X14 is G or N, and X15 is L or M. (6) The peptide according to (5) or its immunologically equivalent variant, wherein the HsvA antigen peptide is a peptide having any one of the amino acid sequences selected from the following group or an immunologically equivalent variant thereof: EKKAVQQMENSNPD (Peptide No. 11: SEQ ID NO: 3), EKKAVEQMENSNPD (Peptide No. 11 (TKY): SEQ ID NO: 4), EKDAVTSLKNSNSG (Peptide No. 11 (SH8): SEQ ID NO: 5), EKDAVTSLENSNSG (Peptide No. 11 (SH10): SEQ ID NO: 6), NQGTLEFLSNDVSN (Peptide No. 19: SEQ ID NO: 7), NQGTLEFLSNDVST (Peptide No. 19 (TKY): SEQ ID NO: 8), LSNKLQGQLKSMGL (Peptide No. 33: SEQ ID NO: 9), LSNKLQDQLKSMGL (Peptide No. 33 (TKY): SEQ ID NO: 10), FSDKLQNMLKSLNM (Peptide No. 33 (SH10): SEQ ID NO: 11), TNGQEVSASIDYNK (Peptide No. 16: SEQ ID NO: 12), AKLSNFASNDALPD (Peptide No. 23: SEQ ID NO: 13), PTTSSGASPDSSNP (Peptide No. 10: SEQ ID NO: 14), GLGRDLFVHSMGDK (Peptide No. 21: SEQ ID NO: 15), QIGKIKLSDVLSAS (Peptide No. 15: SEQ ID NO: 16), YGAIDKELHFSGGK (Peptide No. 34: SEQ ID NO: 17), NVDNILNMPSTTSG (Peptide No. 20: SEQ ID NO: 18), GNLKGVYYPKSSTT (Peptide No. 22: SEQ ID NO: 19), ITEKIQSGKLTITI (Peptide No. 14: SEQ ID NO: 20), FHDFLVSLKGKKFA (Peptide No. 26: SEQ ID NO: 21), TTGGEVRLFRSFYV (Peptide No. 31: SEQ ID NO: 22), IGARFGLDYQDINI (Peptide No. 35: SEQ ID NO: 23), KQLPQPKRSELKPK (Peptide No. 8: SEQ ID NO: 86), TNIKQYMQNNHRSQ (Peptide No. 31N: SEQ ID NO: 87), TLTLEGTETFAQNS (Peptide No. 81: SEQ ID NO: 88), EAYAKNQGDIWSTI (Peptide No. 63: SEQ ID NO: 89), VIGSKSSITLNSAN (Peptide No. 73: SEQ ID NO: 90), and ADIQSSQTTFANSV (Peptide No. 61: SEQ ID NO: 91). (7) An antibody or an immunoreactive fragment thereof that specifically binds to any one of the peptides (1) to (6) or an immunologically equivalent variant thereof. (8) A nucleic acid molecule consisting of 5 to 40 nucleotides, capable of binding to the hsvA gene under stringent conditions. (9) The nucleic acid molecule described in (8), wherein the hsvA gene has the base sequence described in SEQ ID NO: 1, SEQ ID NO: 27 or SEQ ID NO: 29. (10) The nucleic acid molecule according to (9), having any one of the following base sequences: CTTTTAGCGTGGTATCCTTC (SEQ ID NO: 31), TTACAAAGACCACCAACGGA (SEQ ID NO: 32), TACCATAGAAAGCGGAAAC (SEQ ID NO: 33), AGCTATAGCTTTGCACCTGA (SEQ ID NO: 34), ACTAACAGCATAGAAGTTGGGGA (SEQ ID NO: 35), AACAACATTACAGGCATGAG (SEQ ID NO: 36), CAAATAGTAACAGGACAATT (SEQ ID NO: 37), CAGGATTTAAGAGGCACTTA (SEQ ID NO: 38), TCTTAACCAATC TGAGCAA (SEQ ID NO: 39), GTCAAACACGTTATTGATGGCTT (SEQ ID NO: 40), GGGGTTTAATAGCATAGGG (SEQ ID NO: 41), TAGAGCTCTACACCAGTCTT (SEQ ID NO: 42), ATAAAGCCCATGAATTCTTAGGCATGCGTGCTCTG (SEQ ID NO: 43), TGCTATTGATAAAGAGTTACATTTCTCAGG (SEQ ID NO: 44), ATTTCTCAGGGGGAAAGTC (SEQ ID NO: 45), GGCTAATAATTTAACCACAATAAGCGCCTT TAA (SEQ ID NO: 46), GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47), ATGAATTCTTAGGCATGCGTGCTCT (SEQ ID NO: 48), TTTTGGAGGTGTAGGAGTAGAT (SEQ ID NO: 49), AGCGCGCATTTAAAACAGGT (SEQ ID NO: 50), AGAAACGAGATTACAGGAAG (SEQ ID NO: 51), AGGAGCAAGTTTGTAGCAG (SEQ ID NO: 52), AAAATGCGACTGATTGGATG (SEQ ID NO: 53), TTGAAATTTGGCCACGCT (SEQ ID NO: 54) ), TCACCCATAGAATGGACGAA (SEQ ID NO: 55), CTAGCGCATTAACCACAGACTG (SEQ ID NO: 56), TAGAAGTTGTAGACACGGT (SEQ ID NO: 57), GTGATATTGCCTTTCTGAAC (SEQ ID NO: 58), GCAAGTTTGTGCGGATT (SEQ ID NO: 59), ATGTGATACACATCTGACC (SEQ ID NO: 60), AGTGCCGTTACCATCGTGAA (SEQ ID NO: 61), TATTCAAGGAAAGTCCCTGGAGAAACTCCAGAGAC (SEQ ID NO: 62),TTAAAGGCGCTTATTGTGGTTAAATTATTAGCC (SEQ ID NO: 63), ATTAGCCTTAAGGGTGCTATC (SEQ ID NO: 64), CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65), TACGCGCAAAATAGGTTCTT (SEQ ID NO: 66), TGGAGAAACTCCAGAGACTA (SEQ ID NO: 67), TTGTTCGCTGTAGTGCCGTGG (SEQ ID NO: 68), GAAGGATACCACGCTAAAAG (SEQ ID NO: 69), AAGCTAGAGGTTTTGGTTGAG (SEQ ID NO: 70), TTG, CTCAGATTGGTTAAGA (SEQ ID NO:71), ATCGAAATAAGCGAACCTCA (SEQ ID NO:72), TTGAAAGCTTAGCTAAACGG (SEQ ID NO:73), TGGTATTGCTGGTTAAGAGG (SEQ ID NO:74), CAAACAGATGAGCCGT (SEQ ID NO:75), ATGAAAAAGTTTAGTTCTCTCACATTGAAATTTGGCCACGCTC (SEQ ID NO:76), and CTAAAAAGCATAGCGCATCCCGACATTGCCTGTAATATTAATATC (SEQ ID NO:77). (11) The nucleic acid molecule according to any one of (8) to (10), which is a primer capable of amplifying all or a part of the hsvA gene. (12) The nucleic acid molecule according to any one of (8) to (10), which is a probe for detecting an hsvA gene. (13) A method for determining the presence of H. suis, comprising detecting all or part of the hsvA gene in a sample, wherein a sample in which all or part of the hsvA gene is detected is determined to contain H. suis. (14) A method for determining the presence of H. suis according to (13), comprising the steps of: amplifying all or part of the hsvA gene using the primers described in (11) above, using DNA in the sample as a template; Detecting the amplified DNA, and determining that a sample in which DNA amplification is detected contains H. suis. (15) A method for determining the presence of H. suis according to (13), comprising the steps of: contacting DNA in a sample with the probe according to (12); (12) detecting DNA bound to the probe; and (11) A method comprising determining that a sample in which DNA bound to the probe described in (11) is detected contains H. suis. (16) A method for determining the presence of H. suis, comprising detecting HsvA protein or a fragment thereof in a sample, and determining that a sample in which the HsvA protein or a fragment thereof is detected contains H. suis. (17) A method for determining the presence of H. suis according to (16), comprising the steps of: contacting the sample with the antibody or immunoreactive fragment thereof according to (7); detecting HsvA protein or a fragment thereof in said sample bound to said antibody or an immunoreactive fragment thereof; and determining that a sample in which HsvA protein or a fragment thereof bound to the antibody or its immunoreactive fragment is detected is a sample in which H. suis is present. (18) A method for determining infection of a subject with H. suis, comprising: Carrying out the method according to any one of (12) to (17) using a sample derived from a subject as a sample; and A method comprising determining that a subject from whom a sample determined to contain H. suis in said method was derived is infected with H. suis. (19) A method for determining infection of a subject with H. suis, comprising: detecting antibodies that bind to HsvA antigenic peptides in a blood sample from the subject; and The method includes determining that a subject in which an antibody that binds to the peptide is detected is infected with H. suis. (20) A method for determining infection with H. suis according to (19), comprising the steps of: contacting a sample derived from a subject with the peptide according to any one of (1) to (6); detecting antibodies in the blood sample bound to the peptide; and A subject in which an antibody bound to the peptide is detected is determined to be infected with H. suis. (21) A composition for determining H. suis infection, comprising any one selected from a peptide described in any one of (1) to (6), a nucleic acid molecule described in any one of (8) to (10), and an antibody or its immunoreactive fragment described in (7). (22) A pharmaceutical composition comprising any one selected from the peptide according to any one of (1) to (6), the nucleic acid molecule according to any one of (8) to (10), and the antibody or its immunoreactive fragment according to (7). (23) The pharmaceutical composition described in (22), which is for H. suis eradication therapy. (24) The pharmaceutical composition according to (22), which is for the treatment or prevention of gastritis, gastric ulcer, duodenal ulcer, gastric cancer, chronic gastritis, gastric MALT lymphoma, goosebump gastritis, idiopathic thrombocytopenic purpura, functional dyspepsia, or diffuse large B-cell lymphoma.

[0017] (H.Switzerland) In this specification, "H. suis" refers to a strain belonging to H. heilmannii type 1, which is included in H. heilmannii (broad sense). H. suis is known to infect the stomachs of dogs, cats, pigs, monkeys, and other animals in addition to humans. The infected mammal from which H. suis is isolated in this specification is not particularly limited and may be, for example, a human, a monkey, or a pig. Preferably, H. suis is H. suis isolated from a human (e.g., SNTW101 strain).

[0018] (hsvA gene and HsvA protein) In this specification, the term "hsvA gene" and "HsvA protein" refer to a gene and amino acids having a signal peptide region on the amino-terminal side of an outer membrane protein of a bacterium belonging to the genus Helicobacter, which is derived from H. suis, an autotransporter (an outer membrane transport mechanism for proteins) β domain on the carboxy-terminal side, and a disorder region involved in functional expression. As a non-limiting example, the hsvA gene and HsvA protein can be a gene having the nucleotide sequence shown in SEQ ID NO: 1 (or the nucleotide sequence shown in FIG. 2, as used herein) and a protein having the amino acid sequence shown in SEQ ID NO: 2 (or the amino acid sequence shown in FIG. 2, as used herein), which are derived from H. suis strain SNTW101. In the amino acid sequence shown in SEQ ID NO: 2, the 1st to 27th amino acids code for a signal sequence, the 2273rd to 2475th amino acids code for a disorder region, and the 2686th to 2992nd amino acids code for an autotransporter β region. Thus, in this specification, the term "HsvA protein" includes a protein consisting of the 28th to 2992nd amino acids of the amino acid sequence shown in SEQ ID NO: 2, excluding the signal sequence. Other hsvA genes and HsvA proteins derived from other strains of H. suis are also included in the hsvA genes and HsvA proteins of the present specification. As an example, the HsvA protein includes a protein derived from H. suis and having an amino acid sequence that is 80%, 85%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 (or the amino acid sequence consisting of the 28th to 2992nd amino acids of the amino acid sequence set forth in SEQ ID NO: 2). Similarly, the hsvA gene includes a gene derived from H. suis and having a nucleotide sequence that encodes an amino acid sequence that is 80%, 85%, 90%, 95%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 (or the amino acid sequence consisting of the 28th to 2992nd amino acids of the amino acid sequence set forth in SEQ ID NO: 2). Here, the identity of the amino acid sequence can be determined by a method commonly used by those skilled in the art using known programs such as BLAST and FASTA.Alternatively, the hsvA gene includes a gene derived from H. suis and including a gene containing DNA that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence set forth in SEQ ID NO: 1. The HsvA protein also includes a protein encoded by the gene. Furthermore, the HsvA protein includes a protein derived from H. suis and including a protein having an amino acid sequence in which 1 to 50 amino acids (for example, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 amino acids may be replaced with other amino acids, deleted, added, or inserted in the amino acid sequence set forth in SEQ ID NO: 2 (or an amino acid sequence consisting of amino acids 28 to 2992 of the amino acid sequence set forth in SEQ ID NO: 2). Similarly, the hsvA gene is a gene derived from H. suis and includes a gene having a base sequence that encodes an amino acid sequence in which 1 to 50 amino acids have been replaced with other amino acids, deleted, added, or inserted in the amino acid sequence set forth in SEQ ID NO: 2 (or the amino acid sequence consisting of amino acids 28 to 2992 of the amino acid sequence set forth in SEQ ID NO: 2).

[0019] For example, the hsvA gene and HsvA protein include a gene having the base sequence set forth in SEQ ID NO: 27 or 29, and an amino acid sequence set forth in SEQ ID NO: 28 or 30, derived from H. suis strain HS1 or HS5, respectively.

[0020] Preferably, the HsvA protein has an amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83; an amino acid sequence having 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83; or an amino acid sequence in which 1 to 50 amino acids have been replaced with other amino acids, deleted, added, or inserted from the amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83.

[0021] (HsvA antigen peptide) In the present specification, the term "HsvA antigen peptide" refers to a peptide having an amino acid sequence contained in the above-mentioned HsvA protein and capable of functioning as an antigen in a living body, and is preferably a peptide having an amino acid sequence conserved among a plurality of H. suis strains. The HsvA antigen peptide is preferably composed of an amino acid sequence specific to H. suis and not present in H. pylori or other H. heilmannii. Since HsvA is a membrane protein, the HsvA antigen peptide preferably contains an amino acid sequence constituting the extracellular domain of the HsvA protein. For example, the HsvA antigen peptide is composed of an amino acid sequence contained in the 1467th to 2992th, 1467th to 2685th, 1535th to 2135th, or 2008th to 2135th amino acid sequences of the HsvA protein derived from H. suis SNTW101 strain described in SEQ ID NO: 2. The present inventors analyzed amino acid sequences specific to HsvA and fulfilling such conditions, and as a result, succeeded in finding partial amino acid sequences shown in SEQ ID NO: 78 to 83. The amino acid sequences described in SEQ ID NOs: 78 to 83 are those of HsvA proteins derived from different strains of H. suis that infect different species, but the amino acid sequences are relatively conserved and have 76.7% identity. Thus, the HsvA protein antigen peptide of the present invention can have an amino acid sequence having 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence described in any one of SEQ ID NOs: 78 to 83; or an amino acid sequence in which 1 to 50 amino acids of the amino acid sequence described in any one of SEQ ID NOs: 78 to 83 are replaced with other amino acids, deleted, added, or inserted, or an amino acid sequence contained in the amino acid sequence. Throughout this specification, the expression "having a (specific) amino acid sequence" is intended to be interpreted as including the case where the peptide is composed of the amino acid sequence.

[0022] The number of amino acids constituting the HsvA antigen peptide can be appropriately selected depending on the purpose, and may be, for example, 5 to 50 amino acids, 5 to 45 amino acids, 5 to 40 amino acids, 5 to 35 amino acids, 5 to 30 amino acids, 5 to 25 amino acids, 5 to 20 amino acids, 5 to 15 amino acids, 10 to 50 amino acids, 10 to 45 amino acids, 10 to 40 amino acids, 10 to 35 amino acids, 10 to 30 amino acids, 10 to 25 amino acids, or 10 to 20 amino acids. Examples of HsvA antigen peptides include EKX1AVX2X3X4X5NSNX6X7 (peptide No. 11 (mix): sequence number 24) (wherein X1 is K or D, X2 is Q, E or T, X3 is Q or S, X4 is M or L, X5 is E or K, X6 is P or S, and X7 is D or G), EKKAVQQMENSNPD (peptide No. 11 (SNTW101; HS1; HS5): sequence number 3), EK KAVEQMENSNPD (Peptide No. 11 (TKY): SEQ ID NO: 4), EKDAVTSLKNSNSG (Peptide No. 11 (SH8): SEQ ID NO: 5), EKDAVTSLENSNSG (Peptide No. 11 (SH10): SEQ ID NO: 6), NQGTLEFLSNDVSX8 (Peptide No. 19: SEQ ID NO: 25) (wherein X8 is N or T), NQGTLEFLSNDVSN (Peptide No. 19: SEQ ID NO: 7), NQGTLEF LSNDVST (Peptide No. 19 (TKY): SEQ ID NO: 8), X9SX10KLQX11X12LKSX13X14X15 (Peptide No. 33: SEQ ID NO: 26) (wherein X9 is L or F, X10 is N or D, X11 is G, D or N, X12 is Q or M, X13 is M or L, X14 is G or N, and X15 is L or M), LSNKLQGQLKSMGL (Peptide No. 33: SEQ ID NO: 9) , LSNKLQDQLKSMGL (Peptide No. 33 (TKY): SEQ ID NO: 10), FSDKLQNMLKSLNM (Peptide No. 33 (SH10): SEQ ID NO: 11), TNGQEVSASIDYNK (Peptide No. 16: SEQ ID NO: 12), AKLSNFASNDALPD (Peptide No. 23: SEQ ID NO: 13), PTTSSGASPDSSNP (Peptide No. 10: SEQ ID NO: 14), GLGRDLFVHSMGDK (Peptide No.21: SEQ ID NO: 15), QIGKIKLSDVLSAS (Peptide No. 15: SEQ ID NO: 16), YGAIDKELHFSGGK (Peptide No. 34: SEQ ID NO: 17), NVDNILNMPSTTSG (Peptide No. 20: SEQ ID NO: 18), GNLKGVYYPKSSTT (Peptide No. 22: SEQ ID NO: 19), ITEKIQSGKLTITI (Peptide No. 14: SEQ ID NO: 20), FHDFLVSLKGKKFA (Peptide No. 26: SEQ ID NO: 21), TTGGEVRLFRSFYV (Peptide No. 31: SEQ ID NO: 22), IGARFGLDYQDIN Examples of the peptides include peptides having all or part of the amino acid sequence contained in I (peptide No. 35: SEQ ID NO: 23), KQLPQPKRSELKPK (peptide No. 8: SEQ ID NO: 86), TNIKQYMQNNHRSQ (peptide No. 31N: SEQ ID NO: 87), TLTLEGTETFAQNS (peptide No. 81: SEQ ID NO: 88), EAYAKNQGDIWSTI (peptide No. 63: SEQ ID NO: 89), VIGSKSSITLNSAN (peptide No. 73: SEQ ID NO: 90), and ADIQSSQTTFANSV (peptide No. 61: SEQ ID NO: 91). The HsvA antigen peptide may have one to several amino acids substituted, deleted, added, or inserted in the peptide sequence, so long as it functions as the intended HsvA antigen. When an amino acid is substituted, it is preferably substituted conservatively with a similar amino acid residue, for example, substitutions between amino acids such as G and P, G and A or V, L and I, E and Q, D and N, C and T, T and S or A, K and R.

[0023] In this specification, amino acids are written in single-letter notation. That is, C represents cysteine, A represents alanine, Y represents tyrosine, H represents histidine, R represents arginine, G represents glycine, E represents glutamic acid, L represents leucine, V represents valine, W represents tryptophan, T represents threonine, Y represents tyrosine, I represents isoleucine, F represents phenylalanine, D represents aspartic acid, N represents asparagine, Q represents glutamine, M represents methionine, K represents lysine, and P represents proline. In addition, in this specification, Xn (n is a natural number) represents one type of amino acid selected from a group consisting of multiple amino acids each defined. For example, in EKX1AVX2X3X4X5NSNX6X7 (SEQ ID NO: 24), "X1" being K or D means that the amino acid represented by X1 is either lysine or aspartic acid.

[0024] In one embodiment, the present invention relates to immunologically equivalent variants of HsvA antigenic peptides. In the present specification, "immunologically equivalent variant of peptide" means a peptide capable of binding to an antibody that binds to a peptide having a sequence derived from a natural HsvA protein, and having an amino acid sequence different from that of the peptide having a sequence derived from a natural HsvA protein. For example, the variant may be a peptide in which one to several amino acids in the peptide sequence are replaced with natural or artificial amino acids, deleted, added, or inserted. Alternatively, the variant may be a peptide in which a part of the amino acids constituting the peptide having a sequence derived from a natural HsvA protein is modified. Alternatively, both amino acid mutations and modifications may be introduced. Binding to an antibody that binds to a peptide having a sequence derived from a natural HsvA protein means, in other words, binding to an anti-HsvA antibody. For example, a peptide capable of binding to an anti-HsvA antibody present in the blood of a patient infected with H. suis is included in the immunologically equivalent variant of the peptide of the present invention. Whether or not a test peptide variant can bind to an antibody that binds to a peptide having a sequence derived from the natural HsvA protein, or to an anti-HsvA antibody present in the blood of a patient infected with H. suis, can be determined by reacting the antibody with a solid phase to which the peptide variant is bound, and then, after washing, further reacting the antibody with a labeled anti-IgG antibody. If labeled IgG bound to the solid phase is detected after washing the labeled IgG, the peptide is determined to be an immunologically equivalent variant of the peptide of the present invention. Throughout this specification, the term "HsvA antigenic peptide" includes immunologically equivalent variants of the HsvA antigenic peptide, unless otherwise inconsistent.

[0025] (Anti-HsvA antibody or its immunoreactive fragment) In another aspect, the present invention relates to an antibody (herein referred to as "anti-HsvA antibody") that specifically recognizes HsvA protein or an immunoreactive fragment thereof. The anti-HsvA antibody of the present invention preferably binds to any of the above-defined HsvA protein antigen peptides. For example, the anti-HsvA antibody binds to a peptide having an amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83; an amino acid sequence having 80%, 85%, 90%, 95%, 98%, or 99% identity to the amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83; or an amino acid sequence in which 1 to 50 amino acids of the amino acid sequence set forth in any one of SEQ ID NOs: 78 to 83 have been replaced with other amino acids, deleted, added, or inserted. The "immunoreactive fragment of an antibody" means a part (partial fragment) of an antibody or a peptide containing a part of an antibody, which retains the binding activity of the antibody to an antigen. Examples of such antibody fragments include F(ab')2, Fab', Fab, single-chain Fv (hereinafter referred to as "scFv"), disulfide-linked Fv (hereinafter referred to as "dsFv") or polymers thereof, dimerized V region (hereinafter referred to as "diabody"), or peptides containing CDR. Preferably, the antibody of the present invention or its immunoreactive fragment specifically recognizes the HsvA antigen peptide. In this specification, the expression "specifically" recognizes (binds to) an antibody or its immunoreactive fragment means that the antibody or its immunoreactive fragment binds to the HsvA antigen peptide with substantially higher affinity than the affinity for other amino acid sequences or three-dimensional structures. The binding constant (Ka) for the binding between the antibody of the present invention and the HsvA antigen is, for example, at least 10 7 M -1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M -1 , at least 10 13 M -1The following can be mentioned.

[0026] The antibody of the present invention may be polyclonal or monoclonal as long as it can specifically recognize the HsvA antigen peptide, but is preferably a monoclonal antibody. Here, "monoclonal antibody" means an antibody derived from a single clone. The antibody of the present invention includes a complete antibody, as well as a bispecific antibody and a single-chain antibody as long as it retains the binding activity with the antigen. Complete antibodies include non-human animal antibodies, antibodies having the amino acid sequence of a non-human animal antibody and the amino acid sequence of a human-derived antibody, and human antibodies. Examples of non-human animal antibodies include antibodies of mice, rats, hamsters, rabbits, etc., and preferably antibodies of animals from which hybridomas can be produced, and more preferably antibodies of mice. Examples of antibodies having the amino acid sequence of a non-human animal antibody and the amino acid sequence of a human-derived antibody include human-type chimeric antibodies in which the antigen-binding domain Fv of an animal-derived monoclonal antibody is replaced with a human antibody, and humanized antibodies in which the CDR, which is a sequence on the Fv domain directly involved in the antigen binding of an animal-derived antibody monoclonal antibody, is incorporated into the frame of a human antibody. Furthermore, a human antibody is a human antibody that is a product of expression of an antibody gene derived from a human. The immunoglobulin class of the antibody of the present invention is not particularly limited, and may be any of the immunoglobulin classes IgG, IgM, IgA, IgE, IgD, and IgY, preferably IgG. The antibody of the present invention also includes antibodies of any isotype.

[0027] Furthermore, the HsvA antigen peptide, anti-HsvA antibody or its immunoreactive fragment may be labeled as necessary. Examples of such labels that can be used include detectable labels such as radioactive labels, enzymes, fluorescent labels, bioluminescent labels, and chemiluminescent metal labels. Examples of such labels include, but are not limited to, radioactive labels such as 35S (sulfur 35), 32P (phosphorus 32), 3H (tritium), 125I (iodine 125), 131I (iodine 131), and 14C (carbon 14); enzymes such as β-galactosidase, peroxidase, alkaline phosphatase, glucose oxidase, lactate oxidase, alcohol oxidase, monoamine oxidase, and horseradish peroxidase; coenzymes or prosthetic groups such as FAD, FMN, ATP, biotin, and heme; and fluorescein derivatives (fluorescein isothiocyanate). Fluorescein isothiocyanate (FITC), fluorescein thiofluoramyl, etc.), rhodamine derivatives (tetramethylrhodamine, trimethylrhodamine (RITC), Texas Red, rhodamine 110, etc.), Cy dyes (Cy3, Cy5, Cy5.5, Cy7), Cy-chrome, spectrum green, spectrum orange, propidium iodide, allophycocyanin (APC), R-phycoerythrin (R-PE), Alexa-Flour (registered trademark) fluorescent dyes such as Alexa-Flour (registered trademark) 488 and Alexa-Flour (registered trademark) 568 (Molecular Examples of detectable labels include fluorescent labels such as Alexa-Flour (registered trademark) 568 (Probes, Inc., USA) and Alexa-Flour (registered trademark) 568; bioluminescent labels such as luciferase; or luminol derivatives such as luminol, isoluminol, N-(4-aminobutyl)-N-ethylisoluminose ester, acridinium derivatives such as N-methylacridinium ester, N-methylacridinium acylsulfonamide ester, chemiluminescent labels such as lucigenin, adamantyl dioxetane, indoxyl derivatives, ruthenium complexes, and metals such as gold colloid.

[0028] (Nucleic acid molecule, primer, and probe with a base sequence specific to the hsvA gene) In another aspect, the present invention relates to a nucleic acid molecule capable of specifically binding to the hsvA gene. Preferably, the nucleic acid molecule capable of specifically binding to the hsvA gene is a nucleic acid molecule having an hsvA gene-specific base sequence or a sequence complementary to said base sequence, or a nucleic acid molecule capable of binding to an hsvA gene-specific base sequence or a sequence complementary to said base sequence under stringent conditions (hereinafter referred to as "nucleic acid molecule having an hsvA gene-specific base sequence, etc."). The hsvA-specific nucleic acid molecule may be a primer or a probe depending on the application. Here, a primer is a nucleic acid molecule used for the purpose of amplifying DNA by PCR or the like. A primer is a nucleic acid molecule that can amplify DNA by hybridizing with DNA having a complementary sequence and extending the DNA, and allows the DNA to be detected by detecting the amplified DNA. A probe is a nucleic acid molecule used for the purpose of detecting the presence of a target DNA by binding to the target DNA. The nucleic acid molecule capable of binding to the hsvA gene of the present invention may have a base sequence that is not derived from hsvA, as long as H. pylori and H. heilmannii (excluding H. suis) do not have the same or similar sequence among the base sequences of the hsvA gene. Whether or not a base sequence is specific to the hsvA gene can be determined, for example, by searching a database already published for the sequence to see whether H. pylori and H. heilmannii (excluding H. suis) have the same or similar sequence, and if they do, it is determined that the base sequence is not specific, and if they do not, it is specific. Here, "not similar" may mean that the identity is 10% or less, 20% or less, 30% or less, 40% or less, or 50% or less. A nucleic acid molecule capable of specifically binding to the hsvA gene can be selected from any sequence, for example, SEQ ID NO: 1, according to the above method. Furthermore, the nucleic acid molecule capable of binding to the hsvA gene of the present invention can be, for example, 5 to 50 nucleotides, 5 to 45 nucleotides, 5 to 40 nucleotides, 5 to 35 nucleotides, 5 to 30 nucleotides, 5 to 25 nucleotides, 5 to 20 nucleotides, 5 to 15 nucleotides, 5 to 10 nucleotides, 10 to 50 nucleotides, 10 to 45 nucleotides, 10 to 40 nucleotides, 10 to 35 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, 10 to 15 nucleotides, 15 to 50 nucleotides, 15 to 45 nucleotides, 15 to 40 nucleotides, 15 to 35 nucleotides, 15 to 30 nucleotides, 15 to 25 nucleotides, 15 to 20 nucleotides, or 17 to 25 nucleotides. Preferably, the hsvA gene-specific base sequence is, for example, CTTTTAGCGTGGTATCCTTC (sequence number 31), TTACAAAGACCACCAACGGA (sequence number 32), TACCATAGAAAGCGGAAAC (sequence number 33), AGCTATAGCTTTGCACCTGA (sequence number 34), ACTAACAGCATAGAAGTTGGGGA (sequence number 35), AACAACATTACAGGCATGAG (sequence number 36), CAAATAGTAACAGGACAATT (sequence number 37), CAGGATTTAAGAGGCACTTA (sequence number 38), TCTTAACCAATCTGAGCAA (sequence number 39), GTCAAACACGTTATTGATGGCTT (sequence number 40), GGGGTTTAATAGCATAGGG (sequence number 41), TAGAGCTCTACACCAGTCTT (sequence number 42),ATAAAGCCCATGAATTCTTAGGCATGCGTGCTCTG (SEQ ID NO: 43), TGCTATTGATAAAGAGTTACATTTCTCAGG (SEQ ID NO: 44), ATTTCTCAGGGGGAAAGTC (SEQ ID NO: 45), GGCTAATAATTTAACCACAATAAGCGCCTTTAA (SEQ ID NO: 46), GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47), ATGAATTCTTAGGCATGCGTGCTCT (SEQ ID NO: 48), TTTTGGAGGTGTAGGAGTAGAT (SEQ ID NO: 49), AGCG CGCATTTAAAACAGGT (SEQ ID NO: 50), AGAAACGAGATTACAGGAAG (SEQ ID NO: 51), AGGAGCAAGTTTGTAGCAG (SEQ ID NO: 52), AAAATGCGACTGATTGGATG (SEQ ID NO: 53), TTGAAATTTGGCCACGCT (SEQ ID NO: 54), TCACCCATAGAATGGACGAA (SEQ ID NO: 55), CTAGCGCATTAACCACAGACTG (SEQ ID NO: 56), TAGAAGTTGTAGACACGGT (SEQ ID NO: 57), GTGATATTGCCTTTCTGAAC (SEQ ID NO: 58), No. 58), GCAAGTTTTTGTGCGGATT (SEQ ID NO: 59), ATGTGATACACATCTGACC (SEQ ID NO: 60), AGTGCCGTTACCATCGTGAA (SEQ ID NO: 61), TATTCAAGGAAAGTCCCTGGAGAAACTCCAGAGAC (SEQ ID NO: 62), TTAAAGGCGCTTATTGTGGTTAAATTATTAGCC (SEQ ID NO: 63), ATTAGCCTTAAGGGTGCTATC (SEQ ID NO: 64), CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65), TACGCGCAAA ATAGGTTCTT (SEQ ID NO: 66), TGGAGAAACTCCAGAGACTA (SEQ ID NO: 67), TTGTTGCTGTAGTGCCGTGG (SEQ ID NO: 68), GAAGGATACCACGCTAAAAG (SEQ ID NO: 69), AAGCTAGAGTTTGGTTGAG (SEQ ID NO: 70), TTGCTCAGATATGGTTAAGA (SEQ ID NO: 71), ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72), TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73), TGGTATTGCTGGTTAAGAGG (SEQ ID NO: 74),CAAACAGATGAGCCGT (SEQ ID NO: 75), A, Examples include TGAAAAAGTTTAGTTCTCTCACATTGAAATTTGGCCACGCTC (sequence number 76), CTAAAAAGCATAGCGCATCCCGACATTGCCTGTAATATTAATATC (sequence number 77).

[0029] When a nucleic acid molecule having a nucleotide sequence specific to the hsvA gene is used as a primer, a combination of primers selected from the following primers can be used as the forward primer and reverse primer. (forward primer) HSVANOFW-2: AGAAACGAGATTACAGGAAG (SEQ ID NO:51) HSVANOFW-3: AGGAGCAAGTTTGTAGCAG (SEQ ID NO: 52) HSVANOFW-5: AAAATGCGACTGATTGGATG (SEQ ID NO: 53) (reverse primer) HSVANORV-1: ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72) HSVANORV-3: TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73) HSVANORV-4: TGGTATTGCTGGTTAAGAGG (sequence number 74).

[0030] When a nucleic acid molecule having a base sequence specific to the hsvA gene is used as a primer, preferred combinations of forward and reverse primers are HSVANOFW-2 / HSVANORV-4 (101 bp), HSVANOFW-3 / HSVANORV-4 (291 bp), HSVANOFW-5 / HSVANORV-4 (556 bp), HSVANOFW-2 / HSVANORV-1 (508 bp), and HSVANOFW-5 / HSVANORV-3 (108 bp) (the numbers in parentheses indicate the lengths of the DNA fragments obtained by PCR amplification using the primers).

[0031] In this specification, "hybridizing under stringent conditions" means hybridizing under hybridization conditions commonly used by those skilled in the art. For example, whether or not hybridization occurs can be determined by the method described in Molecular Cloning, a Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press (2012) or Current Protocols in Molecular Biology, Wiley Online Library, etc. For example, the hybridization conditions may be hybridizing in 6×SSC (0.9M NaCl, 0.09M trisodium citrate) or 6×SSPE (3M NaCl, 0.2M NaH2PO4, 20mM EDTA·2Na, pH 7.4) at 42°C, followed by washing with 0.5×SSC at 42°C.

[0032] Throughout this specification, a sequence being "specific" means that it is characteristic of the protein, peptide, or nucleic acid molecule in question, and is not substantially present in other proteins, peptides, or nucleic acid molecules. Here, "substantially not present" includes cases where there is no perfectly identical sequence, as well as cases where there is a sequence similar to the target molecule (hsvA gene or HsvA protein) in another molecule to be detected and distinguished (e.g., a component derived from H. pylori) to such an extent that it can be distinguished in a biological binding reaction.

[0033] Additionally, "specifically recognize" or "specifically bind" means to bind to a target substance but not to substantially bind to other substances. Whether a candidate substance binds to a target substance and / or does not substantially bind to other substances can be confirmed by employing methods well known to those skilled in the art, such as Southern hybridization, PCR, Western blotting, and ELISA, depending on the type of candidate substance (e.g., nucleic acid or antibody) and the target substance (e.g., nucleic acid or protein). For example, a protein can be detected by Western blotting. When confirming by hybridization, the protein can be dissolved in a solution of 2% SDS, 10% glycerol, 50 mM Tris-HCl (pH 6.8), 100 mM dithiothreitol, boiled, and subjected to Western blot analysis using an anti-His antibody and a test antibody. When confirming by Southern hybridization, PCR, or ELISA, the protein can be confirmed by using the method described below. Here, "does not substantially bind" includes a case where the binding of the test substance to a nucleic acid, protein, or peptide that is not bound (or not recognized) is sufficiently low to be distinguished in comparison with the binding to the target substance. For example, the cross-reaction rate with other substances compared with the target substance may be 1% or less, 0.5% or less, 0.3% or less, 0.1% or less, 0.05% or less, or 0.03% or less. Cross-reactivity can be calculated as {(actual measured value (concentration) for binding to other substances to be compared / (added sample concentration of other substances to be compared) × 100%}. In particular, in this specification, an antibody or an immunoreactive fragment thereof "specifically" recognizes (binds to) an antigen means that the antibody or an immunoreactive fragment thereof binds to the antigen with substantially higher affinity than the affinity for other amino acid sequences, or that the antigen binds to the antibody or an immunoreactive fragment thereof with substantially higher affinity than the affinity for other antibodies or immunoreactive fragments thereof. In this specification, "substantially high affinity" means an affinity high enough to enable the specific amino acid sequence to be detected in distinction from other amino acid sequences by a desired measurement device or method. For example, substantially high affinity may be 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, or 10 times or more in terms of intensity (e.g., fluorescence intensity) detected by ELISA or EIA.

[0034] Kits and Compositions In another aspect, the present invention relates to a kit for determining H. suis infection, a composition for determining H. suis infection, and a pharmaceutical composition, which contain an HsvA antigen peptide and a nucleic acid molecule capable of specifically binding to the hsvA gene. The kit and composition of the present invention may further contain a carrier selected from the group consisting of a solid phase, a hapten, and an insoluble carrier.

[0035] When the kit and composition of the present invention contain a nucleic acid molecule capable of specifically binding to the hsvA gene, they can be based on known methods using nucleic acids, such as hybridization methods, PCR methods, and the method known as the Invader (registered trademark) method (see, for example, Kwiatkowski, RW et al., Mol. Diagn. (1999) 4:353-364).

[0036] For example, the kit and composition of the present invention may include a solid phase or hapten on which a nucleic acid molecule capable of specifically binding to a labeled hsvA gene is immobilized, and optionally a solid phase on which a substance that specifically binds to the hapten is immobilized. The kit and composition of the present invention may also include a nucleic acid molecule capable of specifically binding to the hsvA gene as a primer (or primer pair) or a probe. Alternatively, the kit and composition of the present invention may include an allele-specific probe having an hsvA gene-specific base sequence or the like and a sequence (flap) complementary to a part of a quenching probe, an invader probe having an hsvA gene-specific base sequence or the like, a triplex-specific DNA degrading enzyme, and a fluorescently labeled universal probe having a quenching probe. The above-mentioned flaps are preferably different between each allele-specific probe. The above-mentioned fluorescent label may be appropriately selected from probes known to those skilled in the art, and is preferably different between each fluorescently labeled universal probe. For example, FAM and VIC can be used as the fluorescent label.

[0037] Kits and compositions containing HsvA antigen peptides or antibodies or immunoreactive fragments thereof that recognize the peptides can be based on known methods using antibody molecules. Such methods include, for example, labeled immunoassays, immunoblotting, immunocloning, and the like. Examples of the methods include the chromatographic method, the chromatography method, the turbidimetric method (TIA method), the nephelometric method (NIA method), the colorimetric method, the latex agglutination method (LIA method), the particle counting method (CIA method), the chemiluminescence measurement method (CLIA method, CLEIA method), the sedimentation reaction method, the surface plasmon resonance method (SPR method), the resonant mirror detector method (RMD method), the comparative interference method, etc. Whether or not the kit of the present invention is capable of performing the desired measurement can be confirmed by measuring whether or not the desired measurement is possible by performing each measurement method using the sample or a sample of the relevant concentration by a method well known to those skilled in the art.

[0038] For example, the kit and composition of the present invention may include (i) an HsvA antigen peptide, or a solid phase or hapten to which an antibody or an immunoreactive fragment thereof that recognizes the peptide is immobilized, and (ii) a labeled second antibody. The second antibody may be an anti-IgG antibody (to which an HsvA antigen peptide is immobilized) or an anti-HsvA antibody (to which an anti-HsvA antibody or an immunoreactive fragment thereof is immobilized) depending on the immobilized substance and the detection target. In addition, when the kit and composition of the present invention includes a hapten, it may further include a solid phase to which a substance that specifically binds to the hapten is immobilized.

[0039] In the kit and composition of the present invention, the solid phase is not particularly limited as long as it can be used in immunochemical measurements, but examples thereof include nitrocellulose, sepharose, nylon, vinylon, polyester, acrylic, polyolefin, polyurethane, rayon, polynosic, cupra, lyocell, acetate, polyvinylidene difluoride, silicone rubber, latex, polystyrene, polypropylene, polyethylene, polyvinyl chloride, polyvinylidene chloride, polystyrene, polyvinyl acetate, fluorine-processed resin, ABS resin, AS resin, acrylic resin, polymer alloy, glass fiber, carbon fiber, glass, gelatin, polyamino acid and / or magnetically sensitive material-containing plates, tubes, chips (e.g., protein chips, lab chips, etc.), beads, membranes, absorbents and / or particles, etc., preferably plates and magnetic beads. In this specification, the insoluble carrier means a suspendable insoluble solid phase such as beads, and examples thereof include latex beads and magnetic beads.

[0040] The kit and composition of the present invention may contain, as necessary, a coloring reagent, a reaction stopping reagent, a standard antigen reagent, a sample pretreatment reagent, a blocking reagent, etc. Furthermore, when the kit and composition of the present invention contain a labeled antibody, it may further contain a substrate that reacts with the label. Furthermore, the kit of the present invention may appropriately contain a package insert, an instruction manual, a container for storing the kit or composition, etc. Effect of the Invention

[0041] The HsvA antigen peptide and the nucleic acid molecule capable of specifically binding to the hsvA gene can be used to measure the presence or absence or antibody titer of anti-H. suis antibodies in blood from subjects diagnosed with H. suis infection. The HsvA antigen peptide can also be used as a peptide vaccine for preventing or treating H. suis infection. Furthermore, the HsvA antigen peptide can be used as an antigen for obtaining anti-HsvA antibodies. Furthermore, the anti-HsvA antibody or its immunoreactive fragment can be used to detect the HsvA antigen peptide. Furthermore, the anti-HsvA antibody or its immunoreactive fragment can be used as a therapeutic agent for treating H. suis infection. [Brief description of the drawings]

[0042] [Figure 1] FIG. 1 is a schematic diagram of an hsvA gene-specific nucleic acid molecule. [Figure 2A] 2A to 2N show the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. The sequences are continuous and show the coding sequence of one gene and protein. [Figure 2B] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2C] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2D] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2E] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2F] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2G] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2H] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2I] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2J] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2K] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2L] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2M] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Figure 2N] 1 shows the sequence of the hsvA gene and HsvA protein from H. suis strain SNTW101. [Diagram 3] This figure compares the amino acid sequences of the regions containing peptides Nos. 11, 33, and 19 of H. suis strains SNTW101 (sequence number 78), HS1 (sequence number 79), HS5 (sequence number 80), TKY (sequence number 81), SH8 (sequence number 82), and SH10 (sequence number 83). [Figure 4] FIG. 1 is a diagram comparing the amino acid sequences of the regions corresponding to peptide Nos. 11, 33, and 19 of H. suis strains SNTW101, HS1, HS5, TKY, SH8, and SH10 (SEQ ID NOs: 3 to 11). [Diagram 5]Identification of H. suis by PCR. H. pylori (SS1 strain, TN2GF4 strain, NCTC11637 strain, ATCC43579 strain, and RC-1 strain) and H. suis (SNTW101 strain and TKY strain) were amplified by PCR using the designed forward primers FW2, FW3, FW5, or VAC3624F (Non-Patent Document 7 above), and reverse primers RV1, RV3, RV4, or VAC4041R (Non-Patent Document 7 above), and the amplified products were confirmed by electrophoresis. Each lane indicates that DNA prepared from 1) H. suis TKY strain, 2) H. suis SNTW101 strain, 3) H. pylori SS1 strain, 4) H. pylori TN2GF4 strain, 5) H. pylori NCTC 11637 strain, 6) H. pylori ATCC43579 strain, and 7) H. pylori RC-1 strain was used as a template. The primer set used is shown under each photograph. The primer sets consisting of forward primers FW2, FW3, and FW5 and reverse primers RV1, RV3, and RV4 all produced amplification products only in DNA prepared from gastric mucosa of H. suis-infected mice. [Figure 6] The graphs show the results of ELISA measurements of the binding titers of antibodies to various peptides in the sera obtained from A, H. suis-infected humans, B, H. pylori-infected humans, and C, non-infected humans. The horizontal axis shows the peptide number. The vertical axis shows the absorbance at 450 nm. The average value of two experiments is shown. The 15 synthesized HsvA antigen peptides (Nos. 10 (SEQ ID NO: 14), 11 (SEQ ID NO: 3), 14 (SEQ ID NO: 20), 15 (SEQ ID NO: 16), 16 (SEQ ID NO: 12), 19 (SEQ ID NO: 7), 20 (SEQ ID NO: 18), 21 (SEQ ID NO: 15), 22 (SEQ ID NO: 19), 23 (SEQ ID NO: 13), 26 (SEQ ID NO: 21), 31 (SEQ ID NO: 22), 33 (SEQ ID NO: 9), 34 (SEQ ID NO: 17), and 35 (SEQ ID NO: 23)) reacted specifically with the sera of H. suis-infected humans. [Figure 7]This is a graph showing the results of ELISA measurement of the binding titers of antibodies in the sera of five subjects to No. 11 peptide (sequence number 3), B, No. 19 peptide (sequence number 7), and C, No. 33 peptide (sequence number 9). A and B show data for different H. suis-infected sera, C and D show data for different H. pylori-infected sera, and E shows data for a non-infected serum. The horizontal axis shows the sequence number of the antigen peptide and the dilution factor of the serum, and the vertical axis shows the absorbance at 450 nm. The average value and standard deviation of three experiments are shown. For all peptides, there was a strong reaction with H. suis-infected sera, and a weak reaction with H. pylori-infected and non-infected sera. [Figure 8] This graph shows the results of ELISA measurement of the binding titers of antibodies in the serum of six subjects (two H. suis-infected, three H. pylori-infected, and one non-infected) to No. 11 peptide (sequence numbers 3, 4, 5, 6, and 24), No. 19 peptide (sequence numbers 7, 8, and 25), and No. 33 peptide (sequence numbers 9, 10, 11, and 26). A and B show data from different H. suis-infected sera, C, D, and E show data from different H. pylori-infected sera, and F shows data from a non-infected serum. The horizontal axis shows the sequence number of the antigen peptide and the dilution rate of the serum, and the vertical axis shows the absorbance at 450 nm. The average value of two experiments is shown. For all peptides, there was a strong reaction with H. suis-infected sera, and a weak reaction with H. pylori-infected and non-infected sera. [Figure 9] This graph shows the results of ELISA measurement of the binding titer of antibodies in the serum of eight subjects (three infected with H. suis, three infected with H. pylori, and two uninfected) to whole H. pylori TN2GF4 strain bacteria. A and B show the results when the serum was diluted 600-fold and 1800-fold, respectively. The vertical axis represents the absorbance at 450 nm. The average value of two experiments is shown. Only H. pylori-infected serum reacted strongly with H. pylori bacteria. [Figure 10]1 is a graph showing the results of ELISA measurement of the binding titers of mouse sera infected with H. suis TKY strain or H. suis SNTW101 strain to No. 11 peptide (SEQ ID NO: 3, 4, 5, 6, 24), No. 19 peptide (SEQ ID NO: 7, 8, 25), No. 33 peptide (SEQ ID NO: 9, 10, 11, 26) and whole cells of H. pylori TN2GF4 strain and SS1 strain. The horizontal axis indicates the type of peptide or cell used in ELISA. A, B, and C respectively show data of sera infected with different H. suis TKY strains, and CD, E, and F respectively show data of sera infected with different H. suis SNTW101 strains. A and D represent 20-fold diluted sera, B and E represent 100-fold diluted sera, and C and F represent 400-fold diluted sera. The horizontal axis shows the sequence number of the antigen peptide and the dilution factor of the serum, and the vertical axis shows the absorbance at 450 nm. The average value of two experiments is shown. Sera from H. suis-infected mice reacted strongly with whole H. pylori cells, but also with peptides of Nos. 11, 19, and 33. [Figure 11] This is a graph showing the results of sandwich ELISA of the sera of mice infected with H. suis TKY strain or H. pylori SS1 strain. The horizontal axis indicates the type of peptide or bacteria used in the sandwich ELISA. The peptides and bacteria used are as follows: SEQ ID NO: 3 (Peptide No. 11 (SNTW101; HS1; HS5), SEQ ID NO: 7 (Peptide No. 19 (SNTW101; HS1; HS5; SH8), SEQ ID NO: 9 (Peptide No. 33 (SNTW101; HS1; HS5). The vertical axis indicates absorbance at 450 nm. The average value and standard deviation of three experiments are shown. Only the serum of H. suis-infected mice reacted strongly to all of the peptides Nos. 11, 19, and 33. [Figure 12]13 is a graph showing the results of ELISA for the binding of each rabbit antibody to various antigens (HsvA-derived peptides or whole H. pylori cells). The horizontal axis shows various solid-phase antigens (numbers are the same as in FIG. 10), and the vertical axis shows absorbance at 450 nm. A shows the results using rabbit antibody against No. 11 peptide (sequence number 3) prepared in Example 2, B shows rabbit antibody against No. 33 peptide (sequence number 9) prepared in Example 2, and C shows rabbit antibody against No. 19 peptide (sequence number 7) prepared in Example 2. The average and standard deviation of three experiments are shown. The antibodies against various peptides reacted strongly to each peptide, but reacted weakly to whole H. pylori cells. [Figure 13] The photographs show immunohistochemistry using polyclonal antibodies obtained by immunizing rabbits with the No. 11 peptide. Stomach tissue sections from a patient infected with H. suis were reacted with rabbit antibodies against the No. 11 peptide, prepared at 2 μg / mL in phosphate-buffered saline, and then reacted with Alexa-Flour 488 anti-rabbit IgG diluted 1:400 in phosphate-buffered saline. The photographs were taken with a Leica confocal laser fluorescence microscope (TCS-SP5). Alexa-Flour 568 diluted 1:400 in phosphate-buffered saline was used for counterstaining. A is a 200x magnification, and B is a 760x magnification of the boxed area in A. The arrow indicates H. suis bacteria. [Figure 14]Graphs showing the results of ELISA measurements of the binding of antibodies in serum collected from patients infected with H. suis or H. pylori to each peptide and bacteria. Values ​​are shown as mean ± standard deviation (SD). (A) Binding between antibodies in serum collected from H. suis-infected patients (n=4) and each peptide. The vertical axis shows absorbance at 450 nm, and the horizontal axis shows the peptides used for immobilization by sequence number. (B) Binding between antibodies in serum collected from H. pylori-infected patients (n=5) and each peptide. The vertical axis shows absorbance at 450 nm, and the horizontal axis shows the peptides used for immobilization by sequence number. (C) Binding between antibodies in serum obtained from non-infected patients (n=3) and each peptide. The vertical axis shows absorbance at 450 nm, and the horizontal axis shows the peptides used for immobilization by sequence number. (D) Binding of antibodies contained in 600-fold or 1800-fold diluted serum from H. suis-infected patients, H. pylori-infected patients, and non-infected patients to H. pylori TN2GF4 (black symbols) or SS1 (white symbols). The vertical axis indicates absorbance at 450 nm. The horizontal axis indicates the attributes of the patients from whom the serum used was derived (H. suis: H. suis-infected patients, H. pylori: H. pylori-infected patients, none: non-infected patients). The 1:600 ​​shown at the top indicates that the patient serum was diluted 600-fold and used as the sample, and the 1:1800 indicates that the patient serum was diluted 1800-fold and used as the sample. At 600-fold and 1800-fold, the results shown by the black symbols on the left indicate binding to H. pylori TN2GF4, and the results shown by the white symbols on the right indicate binding to H. pylori SS1. ***P<0.0001 (H. suis-infected sera vs. H. pylori-infected or uninfected sera). [Figure 15]This is a graph showing the results of investigating the specificity of each peptide antibody Nos. 61, 11, 33, 19, 10, and 16 against the corresponding antigen peptide. At the top of each graph, it is stated which peptide was used as an antigen to obtain the antibody measured in that graph (for example, "Ab. against SEQ ID NO:91" means an antibody obtained using the peptide of SEQ ID NO:91 as an antigen). The vertical axis indicates absorbance at 450 nm, and the horizontal axis indicates the peptide used for immobilization by its SEQ ID NO. Values ​​are shown as mean ± standard deviation (SD). [Figure 16] 1 is a graph showing the results of ELISA measurement of the binding affinity of anti-peptide rabbit polyclonal antibodies obtained in Example 2 to the cells of each Helicobacter species. At the top of each graph, it is stated which peptide was used as an antigen for the antibody measured in that graph (for example, "Ab. against SEQ ID NO:91" means an antibody obtained using the peptide of SEQ ID NO:91 as an antigen). The vertical axis indicates absorbance at 450 nm, and the horizontal axis indicates each Helicobacter species strain used for immobilization. Values ​​are shown as mean ± standard deviation (SD). [Figure 17] (A) A stomach section from a mouse infected with H. suis SNTW101, (B) an enlarged view of the boxed area in (A), and (C) a stomach section from a non-infected mouse were immunohistochemically stained with anti-No. 16 peptide (SEQ ID NO: 12) antibody. The arrows indicate stained bacteria. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0043] In one aspect, the present invention relates to a method for determining the presence of H. suis in a sample, comprising detecting an hsvA gene or a part thereof, an HsvA protein or a part thereof, or an antibody against an HsvA protein in the sample. In particular, the present invention relates to a method for determining an infection of H. suis in a subject, comprising detecting an hsvA gene or a part thereof, an HsvA protein or a part thereof, or an antibody against an HsvA protein in a sample derived from the subject. In this method, a sample or a subject in which the hsvA gene or a part thereof, the HsvA protein or a part thereof, or an antibody against an HsvA protein is detected is determined to have H. suis present or to be infected with H. suis, respectively.

[0044] When the method of the present invention is carried out by measuring the binding of a polynucleotide, a protein or a part thereof, an antibody or a part thereof in the sample with a test reagent, the determination of whether or not a substance is "detected" does not necessarily mean the absolute presence or absence of detection, and may be determined by comparison with other samples. In other words, the presence or absence of detection may be determined from a measurement value, not based on a ± detection result. That is, in the method of the present invention, the "detecting" step may be replaced with "measuring" as necessary, and whether or not a substance is "detected" may be determined based on the measurement value of the target substance in comparison with a negative control. For example, when a substance of interest is detected in a negative control, i.e., a sample not containing H. suis or a sample derived from a subject who is clearly not infected with H. suis, if the measurement value of the subject is equivalent to that of the negative control, even if a small amount of the substance is detected, it is determined in the method of the present invention as "not detected" and that H. suis does not exist or that the subject is not infected with H. suis. On the other hand, if the measurement value of the subject is higher than that of the negative control, it is determined as "detected" and that H. suis exists or that the subject is infected with H. suis. Therefore, in the method of the present invention, it is within the range previously permitted by the present invention that a slight measurement value is recognized for a negative subject.

[0045] Preferably, the method of the present invention for determining the presence of H. suis or the method for determining infection with H. suis in a subject uses at least one selected from the group consisting of (i) a nucleic acid molecule capable of specifically binding to the hsvA gene, (ii) an HsvA antigenic peptide, and (iii) an anti-HsvA antibody or an immunoreactive fragment thereof in a sample derived from the subject.

[0046] (Method using a nucleic acid molecule having a base sequence specific to the hsvA gene) Whether or not a subject is infected with H. suis can be determined by detecting the hsvA gene present in a sample from the subject. Detection of H. suis using a nucleic acid molecule capable of specifically binding to the hsvA gene can be performed by a hybridization-based method, a PCR-based method, and a method known as the Invader (registered trademark) method (see, for example, Kwiatkowski, RW et al., Mol. Diagn. (1999) 4:353-364).

[0047] Methods using hybridization include Southern hybridization, Northern hybridization, dot hybridization, fluorescent in situ hybridization (FISH), DNA microarray, ASO method, etc. For example, the method of determining the presence of H. suis in a sample in the present invention may comprise: (a) contacting the sample with a nucleic acid molecule capable of specifically binding to at least one hsvA gene; (b) detecting binding of a polynucleotide in the sample to a nucleic acid molecule capable of specifically binding to the hsvA gene; and (c) determining the presence of H. suis by determining samples in which said binding is detected as samples in which H. suis is present and by determining samples in which said binding is not detected as samples in which H. suis is not present.

[0048] For example, the present invention may also be a method for determining infection of a subject with H. suis, comprising: (a) contacting a sample from a subject with a nucleic acid molecule capable of specifically binding to at least one hsvA gene; (b) detecting binding of a polynucleotide in the sample to a nucleic acid molecule capable of specifically binding to the hsvA gene; and (c) determining that the subject from whom the sample in which said binding was detected was derived is infected with H. suis and / or determining that the sample in which said binding was not measured or detected is a sample in which H. suis is not present.

[0049] The detection of the binding of the polynucleotide in the sample to the nucleic acid molecule capable of specifically binding to the hsvA gene can be carried out, for example, by labeling the nucleic acid molecule capable of specifically binding to the hsvA gene in advance, contacting the nucleic acid molecule capable of specifically binding to the hsvA gene with a sample derived from a subject, washing the sample, and detecting or measuring the label of the remaining nucleic acid molecule capable of specifically binding to the hsvA gene. In this case, the sample derived from a subject is preferably immobilized on a solid phase.

[0050] Examples of methods using PCR include the Amplification Refractory Mutation System (ARMS) method, the Reverse Transcription-PCR (RT-PCR) method, and the Nested PCR method. For example, the method of determining the presence of H. suis in the present invention may include the following steps: (a) amplifying a portion of the hsvA gene in a sample using a nucleic acid molecule capable of specifically binding to the hsvA gene as a primer: (b) detecting the amplified nucleic acid molecules; and (c) determining the presence of H. suis by determining samples in which the amplified nucleic acid molecule is detected as samples in which H. suis is present and by determining samples in which the amplified nucleic acid molecule is not detected as samples in which H. suis is not present.

[0051] The present invention also relates to a method for determining H. suis infection, comprising: (a) amplifying a portion of the hsvA gene in a sample derived from a subject using a nucleic acid molecule capable of specifically binding to the hsvA gene as a primer: (b) detecting the amplified nucleic acid molecules; and (c) determining that subjects from samples in which an amplified nucleic acid molecule is detected are infected with H. suis and determining that subjects from samples in which an amplified nucleic acid molecule is not detected are not infected with H. suis.

[0052] In another aspect, the present invention relates to a method for determining H. suis infection comprising: (a) amplifying a portion of the hsvA gene in a sample derived from a subject using a nucleic acid molecule specific to the hsvA gene as a primer; (b) measuring the level of the amplified nucleic acid molecule; and (c) determining that the subject is infected with H. suis if the level of the measured nucleic acid molecule is higher than the level of the nucleic acid molecule measured for a negative control by the same method, and determining that the subject is not infected with H. suis if the level of the measured nucleic acid molecule is equal to or lower than the level of the nucleic acid molecule measured for a negative control by the same method.

[0053] A portion of the hsvA gene in a sample derived from a subject can be amplified by carrying out a PCR reaction or the like using the sample derived from the subject as a template.

[0054] The amplified nucleic acid can be evaluated by dot blot hybridization, surface plasmon resonance (SPR), PCR-RFLP, in situ RT-PCR, PCR-SSO (sequence specific oligonucleotide), PCR-SSP, AMPFLP (amplifiable fragment length polymorphism), MVR-PCR, and PCR-SSCP (single strand conformation polymorphism).

[0055] For example, a method for determining the presence of H. suis may comprise the following steps when carried out using the method known as the Invader® method: (a) contacting the sample with the nucleic acid described in the following (i) and (ii) to form a triplex with DNA complementary to the allele probe: (i) an allele-specific probe having an hsvA gene-specific base sequence or a sequence complementary to said sequence and a sequence (flap) complementary to a portion of the quenching probe, and / or an allele-specific probe having an hsvA gene-specific base sequence or a sequence complementary to said sequence and a sequence (flap) complementary to a portion of the quenching probe, (ii) an invader probe having a base sequence specific to the hsvA gene; (b) contacting the nucleic acid sample obtained by (a) with a triplex-specific DNase to release the flap from the triplex-forming nucleic acid; (c) contacting each of the released flaps with a fluorescently labeled universal probe having a sequence complementary to the flap and a quenching probe; (d) contacting the nucleic acid sample obtained by (c) with triplex-specific DNase to release the fluorescent label and cause it to emit fluorescence; (e) detecting the hsvA gene by detecting the fluorescence produced; determining the presence of H. suis by determining samples in which fluorescence is detected as samples in which H. suis is present and determining samples in which fluorescence is not detected as samples in which H. suis is not present.

[0056] (Method using detection of HsvA protein-specific antibodies) Whether or not a subject is infected with H. suis can be determined by confirming the presence of antibodies produced by the subject's own immune system against H. suis-derived proteins (in particular the HsvA protein). Detection of H. suis using HsvA antigen peptides, or anti-HsvA antibodies or their immunoreactive fragments can be carried out by labeled immunoassays such as enzyme immunoassay (EIA), simplified EIA, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescent immunoassay (FIA); immunoblotting methods such as Western blotting; immunochromatography methods such as colloidal gold agglutination; chromatography methods such as ion exchange chromatography and affinity chromatography; turbidimetric assay (TIA); nephelometric assay (NIA); colorimetric method; latex agglutination (LIA); particle counting method (CIA); chemiluminescence assay (CLIA, CLEIA); sedimentation reaction method; surface plasmon resonance (SPR); resonant mirror detector (RMD); comparative interference method, etc.

[0057] In one embodiment, the present invention relates to a method for determining H. suis infection comprising: (a) contacting a sample from a subject with an HsvA antigen of the invention; (b) detecting antibodies in the blood sample that are bound to the peptide; and (c) determining that a subject in which antibodies binding to the peptide are detected is infected with H. suis; and determining that a subject in which no antibody binding to the peptide is detected is not infected with H. suis. To do.

[0058] In another embodiment, the present invention relates to a method for determining H. suis infection comprising: (a) contacting a sample from a subject with an HsvA antigenic peptide of the present invention; (b) measuring the level of antibodies in the blood sample that are bound to the peptide; and (c) determining that the subject is infected with H. suis if the level of antibody measured is higher than the level of antibody measured in a negative control by the same method, and determining that the subject is not infected with H. suis if the level of antibody measured is equal to or lower than the level of antibody measured in a negative control by the same method.

[0059] Whether or not the peptide binds to the antibody in the sample derived from the subject can be confirmed by, for example, contacting the sample derived from the subject with the HsvA antigen peptide of the present invention, washing the reaction solution to remove unbound antibodies, contacting the sample derived from the subject with a labeled anti-Ig antibody to bind the antibody derived from the subject bound to the HsvA antigen peptide to the anti-Ig antibody, washing the reaction solution to remove unbound antibodies, and detecting the label of the anti-Ig antibody. If the label of the anti-Ig antibody is detected, it is considered that the peptide binds to the antibody in the sample derived from the subject. The binding level of the peptide and the antibody in the sample derived from the subject can also be measured by measuring the label level of the anti-Ig antibody. When the binding level is used, a standard curve can be created using a standard solution whose amount is known in advance, and the amount of antibody can be calculated from the measured value. Alternatively, the binding of the peptide to the antibody in the sample derived from the subject can be detected or measured using a surface plasmon resonance sensor.

[0060] (Diagnosis of H. suis infection using detection of HsvA antigen peptides) Whether or not a subject is infected with H. suis can be determined by confirming the presence of H. suis-derived proteins (especially HsvA protein) in a sample from the subject. Detection of H. suis using HsvA protein can be performed by a method similar to the above-mentioned method using detection of HsvA protein-specific antibodies. For example, a method for determining the presence of H. suis of the present invention may comprise: (a) contacting the sample with a labeled anti-HsvA antibody or immunoreactive fragment thereof; (b) detecting the label of the bound antibody; (c) determining the presence of H. suis by determining samples in which the label is detected as samples in which H. suis is present and by determining samples in which the binding is not detected as samples in which H. suis is not present.

[0061] The method of the present invention for determining whether a subject is infected with H. suis may also comprise: (a) contacting a sample from a subject with a labeled anti-HsvA antibody or immunoreactive fragment thereof; (b) detecting the label of the bound antibody; (c) determining that a subject from whom a sample in which the marker was detected was derived is infected with H. suis and / or determining that a subject from whom a sample in which the marker was not detected was derived is not infected with H. suis.

[0062] Alternatively, the method for determining the presence of H. suis of the present invention may comprise: (a) contacting the sample with an anti-HsvA antibody or an immunoreactive fragment thereof; (b) contacting the sample obtained from (a) with a labeled anti-HsvA antibody or immunoreactive fragment thereof that is different from said anti-HsvA antibody or immunoreactive fragment thereof; (c) measuring or detecting the label of the bound antibody; (d) determining the presence of H. suis by determining samples in which said binding is measured or detected as samples in which H. suis is present and by determining samples in which said binding is not measured or detected as samples in which H. suis is not present.

[0063] The method of the present invention for determining infection of a subject with H. suis may comprise: (a) contacting a sample from a subject with an anti-HsvA antibody or an immunoreactive fragment thereof; (b) contacting the sample obtained from (a) with a labeled anti-HsvA antibody or immunoreactive fragment thereof that is different from said anti-HsvA antibody or immunoreactive fragment thereof; (c) measuring or detecting the label of the bound antibody; (d) determining that the subject from whom the sample in which the binding was measured or detected was derived is infected with H. suis and / or determining that the subject from whom the sample in which the binding was not measured or detected was derived is not infected with H. suis.

[0064] Labeling of an antibody or a fragment thereof can be performed by a method commonly used in the art. For example, when fluorescently labeling a protein or peptide, the protein or peptide can be washed with a phosphate buffer, and then a dye prepared with DMSO, a buffer, or the like is added, mixed, and then allowed to stand at room temperature for 10 minutes to bind the protein or peptide. In addition, commercially available labeling kits include biotin labeling kits (Biotin Labeling Kit-NH2, Biotin Labeling Kit-SH: Dojindo Laboratories, Ltd.), alkaline phosphatase labeling kits (Alkaline Phosphatase Labeling Kit-NH2, Alkaline Phosphatase Labeling Kit-SH: Dojindo Laboratories, Ltd.), peroxidase labeling kits (Peroxidase Labeling Kit-NH2, Peroxidase Labeling Kit-NH2: Dojindo Laboratories, Ltd.), phycobiliprotein labeling kits (Allophycocyanin Labeling Kit-NH2, Allophycocyanin Labeling Kit-SH, B-Phycoerythrin Labeling Kit-NH2, B-Phycoerythrin Labeling Kit-SH, R-Phycoerythrin Labeling Kit-NH2, R-Phycoerythrin Labeling Kit-SH: Dojindo Laboratories, Ltd.), fluorescent labeling kits (Fluorescein Labeling Kit-NH2, HiLyte Fluor (registered trademark) 555 Labeling Kit Labeling can also be performed using Alexa Fluor (registered trademark) 647 Labeling Kit-NH2 (Dojindo Laboratories), DyLight547, DyLight647 (Techno Chemical Co., Ltd.), Zenon (registered trademark) Alexa Fluor (registered trademark) antibody labeling kit, Qdot (registered trademark) antibody labeling kit (Invitrogen), EZ-Label Protein Labeling Kit (Funakoshi Co., Ltd.), etc. The labeled antibody or a fragment thereof can be detected by using an appropriate device suitable for labeling.

[0065] Since H. suis widely infects mammals, the subject in the method for determining the presence of H. suis and the method for determining infection with H. suis described herein can be a mammal such as a human, monkey, pig, cat, dog, rabbit, or sheep, and is preferably a human, and more preferably a human patient with gastritis, chronic gastritis, goosebump gastritis, gastric MALT lymphoma, diffuse large B-cell lymphoma, gastric cancer, gastric or duodenal ulcer, idiopathic thrombocytopenic purpura, or functional dyspepsia. The method of the present invention can be performed qualitatively, quantitatively, or semi-quantitatively.

[0066] The sample used in the method for determining the presence of H. suis described herein may be, for example, a tissue sample taken from a subject as a biopsy or a liquid taken from a subject. The sample is not particularly limited as long as it is a target of the method of the present invention, and may be, for example, tissue, blood, plasma, serum, lymph, urine, stool, serous fluid, cerebrospinal fluid, synovial fluid, aqueous humor, tears, saliva, or a fraction or processed product thereof. When nucleic acid is to be detected in the method for determining the presence of H. suis described herein, the sample is preferably tissue (particularly stomach tissue (stomach biopsy sample)) or stool. When antibody is to be detected in the method for determining the presence of H. suis described herein, the sample is preferably blood, plasma, serum, lymph, and urine.

[0067] The peptides, nucleic acid molecules, and antibodies or immunoreactive fragments thereof of the present invention can be appropriately prepared by methods well known to those skilled in the art with reference to the disclosures of this specification. Furthermore, the compositions and kits of the present invention can be appropriately manufactured by methods well known in the art.

[0068] Furthermore, since the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention specifically bind to H. suis, they can be used as a pharmaceutical composition for removing H. suis from the body of an H. suis-infected person or for preventing H. suis infection, for example, by selecting siRNA, antisense DNA or RNA, neutralizing antibody or the immunoreactive fragment thereof, non-neutralizing antibody, etc. For example, the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention can be used as a pharmaceutical composition for treating or preventing a disease or disorder whose onset or aggravation is contributed by H. suis infection, by purifying it as necessary and then formulating it according to a conventional method. The present invention also includes the use of the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention for producing an H. suis removal agent or a therapeutic or preventive agent for a disease or disorder whose onset or aggravation is contributed by H. suis infection. Alternatively, the present invention includes the use of the nucleic acid molecule and the antibody or the immunoreactive fragment thereof of the present invention for removing H. suis or for treating or preventing a disease or disorder whose onset or aggravation is contributed by H. suis infection. Furthermore, the present invention relates to a method for removing H. suis, or a method for treating or preventing a disease or disorder in which H. suis infection contributes to the onset or aggravation, comprising administering the antibody of the present invention or an immunoreactive fragment thereof. In this specification, the disease or disorder in which H. suis infection contributes to the onset or aggravation includes gastritis, chronic gastritis, goosebump gastritis, gastric MALT lymphoma, diffuse large B-cell lymphoma, gastric cancer, gastric and duodenal ulcers, idiopathic thrombocytopenic purpura, and functional dyspepsia. In the above, "removal of H. suis" means removing H. suis from the body of a person infected with H. suis. In addition, when used as a pharmaceutical composition, the antibody is preferably a humanized or fully human antibody.

[0069] The pharmaceutical composition of the present invention may be any oral or parenteral formulation that can be administered to a patient. Examples of compositions for parenteral administration include eye drops, injections, nasal drops, suppositories, patches, ointments, etc. Preferably, the composition is an injection. Examples of the dosage form of the pharmaceutical composition of the present invention include liquids or freeze-dried preparations. When the pharmaceutical composition of the present invention is used as an injection, additives such as dissolution aids such as propylene glycol and ethylenediamine, buffers such as phosphates, isotonicity agents such as sodium chloride and glycerin, stabilizers such as sulfites, preservatives such as phenol, and pain-relieving agents such as lidocaine (see "Dictionary of Pharmaceutical Additives" Yakuji Nipposha, "Handbook of Pharmaceutical Excipients Fifth Edition" APhA Publications) can be added as necessary. When the pharmaceutical composition of the present invention is used as an injection, examples of the storage container include ampoules, vials, prefilled syringes, cartridges for pen-type syringes, and drip bags.

[0070] For example, the pharmaceutical composition (therapeutic or prophylactic agent) of the present invention can be used as an injection, and includes dosage forms such as intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, intravitreal injection, and drip injection. Such an injection can be prepared according to a known method, for example, by dissolving, suspending, or emulsifying the above-mentioned antibody in a sterile aqueous or oily liquid that is usually used for injections. As the aqueous liquid for injection, for example, isotonic liquid containing physiological saline, glucose, sucrose, mannitol, and other auxiliary drugs can be used, and it can be used in combination with an appropriate dissolution auxiliary, for example, alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, polyethylene glycol), nonionic surfactant (e.g., polysorbate 80, polysorbate 20, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)), etc. As the oily liquid, for example, sesame oil, soybean oil, etc. can be used in combination with benzyl benzoate, benzyl alcohol, etc. as a dissolution auxiliary. The prepared injection solution is usually filled into a suitable ampule, vial, or syringe. Also, by adding a suitable excipient to the antibody or its immunoreactive fragment of the present invention, a freeze-dried preparation can be prepared, which can be dissolved in water for injection, physiological saline, or the like at the time of use to make an injection solution. Oral administration of proteins such as antibodies is generally considered difficult because they are decomposed by the digestive tract, but oral administration is possible with the ingenuity of antibody fragments or modified antibody fragments and dosage forms. Examples of preparations for oral administration include capsules, tablets, syrups, granules, etc.

[0071] The pharmaceutical composition of the present invention is preferably prepared in a dosage unit form suitable for the dosage of the active ingredient. Examples of such dosage unit forms include injections (ampoules, vials, prefilled syringes), which may usually contain 5 to 500 mg, 5 to 100 mg, or 10 to 250 mg of the antibody or immunoreactive fragment thereof of the present invention per dosage unit form.

[0072] The pharmaceutical composition (therapeutic or prophylactic agent) of the present invention may be administered locally or systemically. There is no particular limitation on the administration method, and it is administered parenterally or orally as described above. Parenteral administration routes include intraocular, subcutaneous, intraperitoneal, injection or drip into blood (intravenous or intraarterial), or spinal fluid, and administration into blood is preferred. The pharmaceutical composition (therapeutic or prophylactic agent) of the present invention may be administered temporarily, or continuously or intermittently. For example, administration may be continuous administration for 1 minute to 2 weeks.

[0073] The dosage of the pharmaceutical composition of the present invention is not particularly limited as long as it is a dosage that can obtain a desired therapeutic or preventive effect, and can be appropriately determined depending on symptoms, sex, age, and the like. The dosage of the pharmaceutical composition of the present invention can be determined, for example, using the therapeutic or preventive effect of a disease or disorder in which cAMP contributes to the onset or aggravation as an index. For example, when used for the prevention and / or treatment of a patient with a disease or disorder in which cAMP contributes to the onset or aggravation, it is convenient to administer a single dose of the active ingredient of the pharmaceutical composition of the present invention, usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 10 times a month, preferably about 1 to 5 times a month, by intravenous injection. In the case of other parenteral and oral administration, a similar amount can be administered. When the symptoms are particularly severe, the amount or frequency of administration may be increased according to the symptoms. EXAMPLES

[0074] The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto. All documents cited throughout this application are hereby incorporated by reference in their entirety.

[0075] Example 1: Detection by PCR (1) Preparation of DNA (1)-1. H. pylori Eleven strains of H. pylori (SS1, TN2GF4, RC-1, ATCC43579, NCTC11637, TK1029, TK1081, TY1289, TY281) were used. The bacterial solution stored at -80°C was applied to Nissui Plate Helicobacter Agar Medium (Nissui Pharmaceutical, Tokyo) and cultured for 3 days at 37°C under microaerobic conditions (5% O2, 10% CO2, 85% N2, 100% humidity). The resulting colonies were suspended in sterile distilled water and centrifuged at 95°C for 5 minutes. The supernatant was used as crude chromosomal DNA. The crude chromosomal DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), purified by ethanol precipitation, and dissolved in a small amount of sterile distilled water. The DNA concentration of the final product was determined by measuring the absorbance at 260 nm (A260) according to the following formula: DNA concentration (μg / mL) = A260×50 (light path length 10 mm)

[0076] (1)-2. H. Switzerland Two strains of H. suis (TKY and SNTW101) were used. Female C57BL / 6 mice (Charles River Japan, Yokohama) infected with H. suis were dissected, and the greater curvature of the stomach was incised. The contents were washed with PBS, and the mucosa was scraped using a slide. The mucosa was rubbed with the ground glass parts of two slides to prepare a suspension. DNA from mouse gastric mucosa containing the bacteria was prepared using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). The DNA concentration of the final product was determined by measuring the absorbance at 260 nm (A260) and using the following formula: DNA concentration (μg / mL) = A260×50 (light path length 10 mm)

[0077] (1)-3. H. felis, H. mustelae, H. heilmannii sensu stricto, H. baculiformis, H. bizzozeronii, H. cynogastricus, H. salmonis The bacterial suspension stored at -80°C was suspended in sterile distilled water, and the supernatant after centrifugation at 95°C for 5 minutes was used as crude chromosomal DNA. The crude chromosomal DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), purified by ethanol precipitation, and dissolved in a small amount of sterile distilled water.

[0078] (2)PCR (2)-1.PCR Using Dream Taq DNA Polymerase (Thermo Fisher Sci.), PCR reactions were performed in duplicate for a reaction mixture (total 25 μL) with the following composition: 2.5 μL of 10× buffer, 0.5 μL of 10 mM dNTP mix, 1 μL of forward (FW) primer (5 μM), 1 μL of reverse (RV) primer, and 1 μL of template DNA (1 ng and 10 ng of H. pylori (SS1 strain, TN2GF4 strain, RC-1 strain, ATCC43579 strain, NCTC11637 strain, TK1029 strain, TK1081 strain, TY1289 strain, and TY281 strain) DNA, and 10 ng of DNA prepared from stomach biopsies of H. suis (SNTW101 strain and TKY strain)-infected mice. -3 ng,10 -2 ng,10 -1 The PCR reaction conditions were 95°C for 1 minute, followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a 5-minute hold at 72°C.

[0079] We compared the hsvA gene of H. suis with the VacA-like autotransporter proteins present in H. felis, H. bizetzolonii, and H. pylori, and designed primers for the region that shows high identity among H. suis strains and no identity with other species. The designed primers were as follows: (forward primer) HSVANOFW-2: AGAAACGAGATTACAGGAAG (SEQ ID NO:51) HSVANOFW-3: AGGAGCAAGTTTGTAGCAG (SEQ ID NO: 52) HSVANOFW-5: AAAATGCGACTGATTGGATG (SEQ ID NO: 53) (reverse primer) HSVANORV-1: ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72) HSVANORV-3: TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73) HSVANORV4: TGGTATTGCTGGTTAAGAGG (SEQ ID NO: 74)

[0080] In addition, the following primers were used to amplify the vacA gene of H. pylori (Matsui H et al., Helicobacter. (2014) 19(4):260-71.). VAC3624F (forward): GAGCGAGCTATGGTTATGAC (SEQ ID NO: 84) VAC4041R (reverse): CATTCCTAATTGGAAGCGAA (SEQ ID NO: 85)

[0081] 10 μL of the resulting amplified product was applied to 1.5% agarose gel electrophoresis, and the amplified band was confirmed by staining with ethidium bromide.

[0082] (2)-2. Real-time PCR We commissioned IDT to synthesize a double quencher probe (PrimeTime® qPCR Probes) with the following sequence: Because the above-mentioned FW5 and RW3 have high identity between H. suis strains, new primers were designed in the same region. Probe: FAM / TGTACACAC / ZEN / CAAACAGATGAGCCGT (SEQ ID NO: 75) / 3IABkFQ forward: GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47) Reverse: CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65)

[0083] The PCR reaction was carried out using the above probe (final concentration 0.25 μM), the above primer (final concentration 0.5 μM), and PCR master mix: PrimeTime Gene Expression Master Mix (Integrated DNA Technologies) in a QuantStudio (Applied Biosystems) according to the protocol provided by IDT under the following conditions. 95℃ 3 minutes, 1 cycle 95℃ 15 sec-60℃ 1 min, 40 cycles

[0084] (3) Results A calibration curve was created using a plasmid in which the target region had been cloned in advance. 2 Copy to 10 7 Good amplification efficiency and quantitation between copies were observed (results not shown). The results of PCR using stomach biopsy tissue DNA from mice infected with H. pylori and H. suis are shown in Figure 5. The designed primer combinations HSVANOFW-2 / HSVANORV-4, HSVANOFW-3 / HSVANORV-4, and HSVANOFW-5 / HSVANORV-4 all amplified H. suis specifically, and no amplification of H. pylori DNA was observed. On the other hand, primers designed against H. pylori vacA amplified only H. pylori DNA, and no amplification of H. suis DNA was observed.

[0085] Quantitative PCR using DNA from stomach biopsies of H. suis-infected mice showed that the amount of DNA ranged from 100 ng to 10 -2 The amplification efficiency of H. suis strain SNTW101 was 6.9 × 10 per 10 ng DNA (results not shown). 5 copies per 10 ng DNA, and H. suis TKY strain had 3.7 × 10 5 copies per 10 ng DNA for H. suis SH8 strain, and 1.5 x 10 3 copies per 10 ng DNA for H. suis SH10 strain, and 4.2 x 10 3On the other hand, no amplification was observed with H. pylori DNA (SS1, TN2GF4, RC-1, ATCC43579, NCTC11637, TK1029, TK1081, TY1289, and TY281 strains). Similarly, no proliferation was observed when the chromosomal DNA of H. felis, H. mustelle, H. heilmannii ssASB1.4, H. baculiformis, H. bizezolonii, H. cynogastrix, or H. salmonis was used as a template. No amplification was observed in H. pylori (strains SS1, TN2GF4, NCTC11637, ATCC43579, RC-1, TK1029, TK1081, TY1289, and TY281), H. felis, H. mustelae, H. heilmannii sensu stricto (ssASB1.4), H. baculiformis, H. bizzozeronii, H. cynogastricus, or H. salmonis, but amplification was observed only in gastric mucosal DNA from mice infected with H. suis.

[0086] These results demonstrated that all of the designed primer sets were capable of distinguishing H. pylori, H. felis, H. mustelle, H. heilmannii ssASB1.4, H. baculiformis, H. bizezolonii, H. cynogastrix, and H. salmonis from H. suis infection and enabling the diagnosis.

[0087] Example 2: Peptide synthesis and antibody production Since we were able to successfully detect H. suis specifically by PCR, we considered the possibility that HsvA may be expressed and investigated whether it is possible to diagnose H. suis infection by targeting HsvA.

[0088] (1) Peptide synthesis Among the amino acid sequences assumed to be encoded by HsvA (sequence number 2; Figure 2), peptide sequences predicted to be antigenic based on the specificity of the bacterial species and conservation among strains were selected and synthesized as follows. No. 11: EKKAVQQMENSNPD (SEQ ID NO: 3) No. 11 (TKY): EKKAVEQMENSNPD (SEQ ID NO: 4) No. 11 (SH8): EKDAVTSLKNSNSG (SEQ ID NO: 5) No. 11 (SH10): EKDAVTSLENSNSG (SEQ ID NO: 6) No. 19: NQGTLEFLSNDVSN (SEQ ID NO: 7) No. 19 (TKY): NQGTLEFLSNDVST (SEQ ID NO: 8) No. 33: LSNKLQGQLKSMGL (SEQ ID NO: 9) No. 33 (TKY): LSNKLQDQLKSMGL (SEQ ID NO: 10) No. 33 (SH10): FSDKLQNMLKSLNM (SEQ ID NO: 11) No. 16: TNGQEVSASIDYNK (SEQ ID NO: 12) No. 23: AKLSNFASNDALPD (SEQ ID NO: 13) No. 10: PTTSSGASPDSSNP (SEQ ID NO: 14) No. 21: GLGRDLFVHSMGDK (SEQ ID NO: 15) No. 15: QIGKIKLSDVLSAS (SEQ ID NO: 16) No. 34: YGAIDKELHFSGGK (SEQ ID NO: 17) No. 20: NVDNILNMPSTTSG (SEQ ID NO: 18) No. 22: GNLKGVYYPKSSTT (SEQ ID NO: 19) No. 14: ITEKIQSGKLTITI (SEQ ID NO: 20) No. 26: FHDFLVSLKGKKFA (SEQ ID NO: 21) No. 31: TTGGEVRLFRSFYV (SEQ ID NO: 22) No. 35: IGARFGLDYQDINI (SEQ ID NO: 23) No. 8: KQLPQPKRSELKPK (SEQ ID NO: 86) No. 31N: TNIKQYMQNNHRSQ (sequence number 87) No. 81: TLTLEGTETFAQNS (SEQ ID NO: 88) No. 63: EAYAKNQGDIWSTI (sequence number 89) No. 73: VIGSKSSITLNSAN (SEQ ID NO: 90) No. 61: ADIQSSQTTFANSV (sequence number 91)

[0089] (2) Antibody production Of the above selected sequences, peptides were synthesized by adding cysteine ​​(C) to the amino terminus of each 14-mer peptide, No. 10, No. 11, No. 16, No. 19, No. 33, and No. 61. Rabbits (New Zealand White) were immunized with keyhole limpet hemocyanin (KLH) as a carrier, and ELISA titers of 1:512,000 or more were obtained. The immune rabbit serum was purified using an affinity column coupled with Protein G, and the collected IgG fraction was used as anti-peptide rabbit antibody (polyclonal antibody) in the following experiments.

[0090] (4) Preparation of H. pylori antigen for ELISA H. pylori was cultured for 48 hours with shaking in Brucella broth containing 10% fetal calf serum (FCS) at 37°C, 100% humidity, and microaerobic conditions (5% O2, 10% CO2, 85% N2), and the culture was centrifuged to collect the cells. The cells were washed three times with sterilized distilled water to remove lipopolysaccharide components, and a small amount of the cells was suspended in sterilized distilled water.

[0091] (5) Protein quantification Protein was quantified using a Bio-Rad protein assay kit using a 96-well plate. A standard curve was prepared using bovine serum albumin (BSA) as a standard protein.

[0092] Example 3: Measurement of anti-H. suis antibody titers in infected individuals (humans) using ELISA (Enzyme Linked ImmunoSorbent Assay) Peptides dissolved in 0.2 M carbonate-bicarbonate buffer (pH 9.4) or H. pylori whole cells (4 μg / mL) prepared in Example 2 (4) were dropped into 96-well NUNC-Immuno Plate #439454 at 100 μL / well and left at 4°C overnight. The next day, the peptide solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 200 μL / well of Nacalai Tesque blocking solution (PBS system pH 7.2) diluted 5-fold with sterile distilled water was dropped and left at 37°C for 1 hour. The blocking solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4).

[0093] Sera were collected from H. pylori-infected and H. suis-infected subjects, respectively. Sera were also collected from healthy subjects not infected with either virus as a control (non-infected). Human serum diluted with Nacalai Tesque blocking solution (PBS-based pH 7.2) diluted 10-fold with sterile distilled water was dropped at 100 μL / well and incubated at 37°C for 1 hour. The serum solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate-buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Horseradish peroxy-labeled secondary antibody (Goat anti-Human IgG, Jackson Immuno Research) diluted 100,000-fold with Nacalai Tesque blocking solution (PBS-based pH 7.2) diluted 10-fold with sterile distilled water was dropped at 100 μL / well and incubated at 37°C for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T (phosphate-buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 100 μL / well of SuperBlue TMB Microwell Peroxidase Substrate (1-Component), KPL, was dropped to produce a blue color, and 100 μL / well of 1N hydrochloric acid was dropped to produce a yellow color. The absorbance at 450 nm was measured using a plate reader.

[0094] The results of ELISA using human serum are shown in Figures 6 to 9. H. suis positive subjects had high antibody titers against the HsvA antigen peptide, while H. pylori-infected and non-infected subjects who were not infected with H. suis had low antibody titers against the HsvA antigen peptide. In addition, the antibody titers against whole H. pylori cells were high in H. pylori-infected subjects, but low in H. suis-infected and non-infected subjects. This demonstrated for the first time that H. suis expresses the hsvA gene in the human body, and that antibodies against the HsvA protein are produced in the blood of humans infected with H. suis. This demonstrated that H. suis infection can be diagnosed in humans, distinguishing it from H. pylori infection, by using the HsvA antigen peptide.

[0095] Example 4: Measurement of anti-H. suis antibody titers in infected mice using sandwich ELISA Peptide antibodies Nos. 11, 19, and 33 (1 μg / mL) dissolved in 0.2 M carbonate-bicarbonate buffer (pH 9.4) were dropped at 100 μL / well into a 96-well NUNC-Immuno Plate #439454 and left at 4°C overnight. The next day, the antibody solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 200 μL / well of Nacalai Tesque blocking solution (phosphate buffer system pH 7.2) diluted 5-fold with sterile distilled water was dropped and the plate was left at 37°C for 1 hour. The blocking solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Peptides Nos. 11, 19, and 33 (4 μg / mL) were diluted with Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10-fold with sterile distilled water, dropped at 100 μL / well, and left at 37°C for 1 hour. The peptide solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Mouse serum was diluted with Nacalai Tesque blocking solution (PBS system, pH 7.2) diluted 10-fold with exchanged water, dropped at 100 μL / well, and left at 37°C for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Horseradish peroxidase-labeled secondary antibody (Donkey Anti-Mouse IgG, Jackson Immuno Research) diluted 100,000-fold with Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10-fold with sterile distilled water was dropped at 100 μL / well and incubated at 37°C for 1 hour. The secondary antibody solution was discarded and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 100 μL / well of SuperBlue TMB Microwell Peroxidase Substrate (1-Component), KPL, was dropped to develop a blue color, and 100 μL / well of 1N hydrochloric acid was dropped to change the color to yellow.The absorbance was measured at 450 nm using a plate reader.

[0096] The binding titers of antibodies in the serum of mice infected with H. suis TKY strain or H. pylori SS1 strain against peptides were measured by EELISA, and the results of measurements by sandwich ELISA are shown in Figure 10 and Figure 11, respectively. In both systems, high antibody titers were observed in the serum of H. suis-infected mice specifically against peptides derived from HsvA protein. This demonstrated for the first time that H. suis expresses HsvA protein in mice and that antibodies against HsvA protein are produced in the blood of mice infected with H. suis. This demonstrated that H. suis infection can be diagnosed in mice, distinguishing it from H. pylori infection, by using HsvA-specific antigen peptides.

[0097] Example 5: Measurement of peptide antibody specificity using ELISA (Enzyme Linked ImmunoSorbent Assay) Each peptide (4μg / mL) of Nos. 11, 19, and 33 dissolved in 0.2M carbonate-bicarbonate buffer (pH 9.4) or 100μL / well of H. pylori whole cells was dropped onto a 96-well NUNC-Immuno Plate #439454 and left at 4℃ overnight. The next day, the peptide solution was discarded and the plate was washed three times with 200μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 200μL / well of Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 5-fold with sterile distilled water was dropped and left at 37℃ for 1 hour. The blocking solution was discarded and the plate was washed three times with 200μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Each anti-peptide antibody (1 μg / mL) obtained in Example 2(2) was diluted with Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10 times with exchanged water, dropped at 100 μL / well, and left at 37°C for 1 hour. The serum solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Horseradish peroxidase-labeled secondary antibody (Goat anti-Rabbit IgG, Jackson Immuno Research) diluted 100,000 times with Nacalai Tesque blocking solution (PBS system, pH 7.2) diluted 10 times with exchanged water was dropped at 100 μL / well, and left at 37°C for 1 hour. The secondary antibody solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). 100 μL / well of SuperBlue TMB Microwell Peroxidase Substrate (1-Component), KPL, was added to turn the plate blue, and 100 μL / well of 1N hydrochloric acid was added to turn the plate yellow. The absorbance at 450 nm was measured using a plate reader.

[0098] Figure 12 shows the results of measuring the binding of the anti-peptide rabbit antibodies prepared in Example 2 to wells bound with various antigens (H. suis HsvA antigen peptides (Nos. 11, 19 and 33) or whole H. pylori cells (TN2GF4 and SS1 strains). Antibodies against peptide No. 11 (sequence number 3), peptide No. 33 (sequence number 9) and peptide No. 19 (sequence number 7) showed strong specific binding to the peptides used as antigens in the production of each antibody, but only weak binding to whole H. pylori cells. In particular, the antibody against peptide No. 11 showed low non-specific binding strength to whole H. pylori cells.

[0099] (Example 6) Immunostaining using anti-No. 11 peptide antibody Paraffin sections of H. suis-infected human stomach were deparaffinized by immersing them in xylene three times, absolute ethanol once, 90% ethanol once, 80% ethanol once, and pure water once (5 minutes each). The deparaffinized slides were blocked by dropping phosphate-buffered saline pH 7.2 containing 1% (W / V) skim milk and leaving them at room temperature for 30 minutes. The slides were then washed three times with phosphate-buffered saline pH 7.2 at room temperature for 5 minutes each. Anti-No. 11 peptide antibody was diluted to 2 μg / mL with phosphate-buffered saline pH 7.2 and dropped onto the slides for 3 hours at room temperature. The antibody solution was removed from the slides, and the slides were washed three times with phosphate-buffered saline pH 7.2 at room temperature for 5 minutes each. Alexa-Fluor 488 anti-rabbit IgG (Thermo Fisher) (secondary antibody) diluted 400-fold with phosphate-buffered saline pH 7.2 was dropped onto the slides and left to react at room temperature for 3 hours. The secondary antibody solution was removed from the slides, and the slides were washed three times with phosphate-buffered saline, pH 7.2, at room temperature for 5 minutes. Alexa-Fluor 568 phalloidin (Thermo Fisher) diluted 400-fold with phosphate-buffered saline, pH 7.2, was dropped onto the slides and allowed to react at room temperature for 30 minutes for counterstaining (staining F-actin). The secondary antibody solution was removed from the slides, and the slides were washed three times with phosphate-buffered saline, pH 7.2, at room temperature for 5 minutes. The slides were mounted with Permaflow (Therma Fisher). Observations were made using a Leica TCS-SP5 confocal laser fluorescence microscope. Photograph A is a 200x magnification, and Photograph B is a 760x magnification of the boxed area in Photograph A. The arrows indicate H. suis bacteria.

[0100] The results are shown in Figure 13. Bacteria in stomach tissue sections from patients infected with H. suis were stained with anti-No. 11 peptide antibody. It was demonstrated that H. suis infection can be diagnosed by immunohistochemistry using anti-No. 11 peptide antibody.

[0101] Example 7 The peptides Nos. 8, 31N, 81, 63, 73, 61, 11+11(TKY), 11(SH8), 11(SH10), 19+19(TKY), 33+33(TKY), 33(SH10), 16, 23, 10, 21, 20, 22, 31, 35 peptides prepared in Example 2 or H. pylori TN2GF4 and SS1 whole cells (4μg / mL) were dissolved in 0.1M carbonate-bicarbonate buffer (pH 9.4), and 100μL / well was dropped onto a 96-well plate (NUNC-Immuno plate #439454) and left to stand overnight at 4°C. The next day, the peptide solution was discarded and the plate was washed three times with 200μL of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Blocking solution (BSA, 1% (W / V) phosphate buffer system, pH 7.4) was dropped at 200 μL / well and allowed to stand for 1 hour at 37° C. The blocking solution was discarded, and the plate was washed three times with 200 μL of PBS-T.

[0102] Serum samples were obtained from H. suis-infected patients (n=4), H. pylori-infected patients (n=5), and non-infected individuals (n=3). Each serum was diluted 1,800-fold (600-fold and 1,800-fold for reaction with H. pylori samples only) using Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10-fold with distilled water, and dropped at 50 μL / well onto the plate prepared by the above method and left to stand at 37°C for 1 hour. The serum solution was discarded and the plate was washed three times with 200 μL / well of PBS-T. 50μL of horseradish peroxidase-conjugated secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Human IgG(H+L), Jackson ImmunoResearch) diluted 100,000 times with distilled water and Nacalai Tesque blocking solution (phosphate buffer system pH 7.2) was dropped and left to stand at 37℃ for 1 hour. The secondary antibody solution was discarded and washed three times with PBS-T. 50μL / well of SuperBlue TMB Microwell Perpxidase Substrate (1-Component, KPL) was dropped to develop a blue color, and then 50μL of 1N hydrochloric acid was dropped to change the color to yellow. The absorbance at 450nm (reference 630nm) was measured using a plate reader.

[0103] The results are shown in Figure 14. This ELISA method was able to distinguish between 1800-fold diluted human serum samples (four H. suis positive samples (patients 5, 6, 7, 8); five H. pylori positive samples (patients 4, 5, 6, 7, 8); and three non-infected samples (healthy individuals 4, 5, 6)) with an absorbance of 0.5 or higher as positive and below as negative. Ten peptides, Nos. 81, 61, 20, 11+11 (TKY), 11 (SH8), 11 (SH10), 19+19 (TKY), 10, 16, and 23, were identified in the H. suis positive patient sera. High reactivity was observed (A). On the other hand, serum from an H. pylori-positive patient (B) and non-infected serum (C) did not react with any of the peptides. Furthermore, H. pylori-infected serum showed strong reactivity with whole H. pylori cells, but H. suis-infected serum did not react (D). This indicates that these peptides do not react with antibodies against H. pylori, and are highly specific for antibodies against H. suis. Therefore, they are useful for specific infection diagnosis using antibodies in serum.

[0104] Example 8: Specificity of anti-peptide antibodies against peptides Nos. 61, 11, 33, 19, 10, and 16 to the corresponding antigen peptides Nos. 8, 31N, 81, 63, 73, 61, 11+11(TKY), 11(SH8), 11(SH10), 19+19(TKY), 33+33(TKY), 33(SH10), 16, 23, 10, 21, 20, 22, 31, 35 peptides prepared in Example 2 were dissolved in 0.1M carbonate-bicarbonate buffer (pH 9.4) (4μg / mL) and dropped into a 96-well plate (NUNC-Immuno plate #439454) at 100μL / well and left to stand overnight at 4℃. The next day, the peptide solution was discarded and the plate was washed three times with 200μL of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Blocking solution (BSA, 1% (W / V) phosphate buffer system, pH 7.4) was dropped at 200 μL / well and left to stand at 37°C for 1 hour. Blocking solution was discarded, and the plate was washed three times with 200 μL of PBS-T. Anti-peptide rabbit polyclonal antibody (IgG, 0.2 μg / mL) in Example 2 was dropped at 50 μL / well using Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10-fold with distilled water, and the plate was left to stand at 37°C for 1 hour (n=2). Serum solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T. 50μL of horseradish peroxidase-labeled secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG(H+L), Jackson ImmunoResearch) diluted 10-fold with distilled water (phosphate buffer system (pH 7.2) diluted 100,000-fold) was dropped onto the wells and incubated at 37℃ for 1 hour. The secondary antibody solution was discarded and the wells were washed three times with PBS-T. 50μL / well of SuperBlue TMB Microwell Perpxidase Substrate (1-Component, KPL) was dropped onto the wells, and after the blue color developed, 50μL of 1N hydrochloric acid was dropped onto the wells to change the color to yellow. The absorbance at 450nm (reference 630nm) was measured using a plate reader. The results are shown in Figure 15. Each peptide antibody was shown to specifically react only with the corresponding peptide used as the antigen.

[0105] Example 9: Specificity of anti-peptide antibodies against peptides Nos. 61, 11, 33, 19, 10, and 16 to bacterial cells H. pylori SS1, H. pylori TN2GF4, H. pylori NCTC11637, H. pylori TY1289, H. pylori RC-1, H. pylori TK1029, H. pylori TY281, H. pylori ATCC43579, H. pylori TK1081, and H. suis SNTW101 (4 μg / mL) dissolved in 0.1 M carbonate / bicarbonate buffer (pH 9.4) were dropped into a 96-well plate (NUNC-Immuno plate #439454) at 100 μL / well and left to stand overnight at 4° C. The next day, the peptide solution was discarded and the plate was washed three times with 200 μL of PBS-T (phosphate buffered saline containing 0.05% (V / V) Tween 20, pH 7.4). Blocking solution (BSA, 1% (W / V) phosphate buffer system, pH 7.4) was dropped at 200 μL / well and left to stand at 37 ° C for 1 hour. Blocking solution was discarded, and the plate was washed three times with 200 μL of PBS-T. Anti-peptide rabbit polyclonal antibody (IgG, 0.2 μg / mL) or polyclonal antibody against H. pylori SS1 (rabbit IgG) (described in Non-Patent Document 4) prepared in Example 2 was dropped at 50 μL / well using Nacalai Tesque blocking solution (phosphate buffer system, pH 7.2) diluted 10 times with distilled water, and the plate was left to stand at 37 ° C for 1 hour (n = 2 to 4). Serum solution was discarded, and the plate was washed three times with 200 μL / well of PBS-T. 50μL of horseradish peroxidase-conjugated secondary antibody (Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson ImmunoResearch) diluted 100,000 times with Nacalai Tesque blocking solution (phosphate buffer system pH 7.2) diluted 10 times with distilled water was dropped and left to stand at 37℃ for 1 hour. The secondary antibody solution was discarded and washed three times with PBS-T. 50μL / well of SuperBlue TMB Microwell Perpxidase Substrate (1-Component, KPL) was dropped, and after the color developed blue, 50μL of 1N hydrochloric acid was dropped to change the color to yellow. The absorbance at 450nm (reference 630nm) was measured using a plate reader.

[0106] The results are shown in Figure 16. The anti-peptide antibody did not react with H. pylori bacteria, whereas the anti-H. pylori polyclonal antibody reacted with H. pylori and H. suis bacteria.

[0107] Example 10: Cultivation method of H. suis SNTW101 (1) Isolation and culture of H. suis SNTW101 from the gastric mucosa of infected mice The medium was modified based on the method described in Smet A., et al., International Journal of Systematic and Evolutionary Microbiology (2012), 62, 299-306, and culture was performed using Brecella agar plates (skirrow 2 vials / L, vancomycin 10 mg / L, trimethoprim 5 mg / L, polymyxin B 2500 IU / L, vitox 2 vials / L, amphotericin B 5 mg / L, fetal calf serum 20% (V / V)) to which hydrochloric acid 0.05% (V / V) and linezolid 10 mg / L were added. The cells were cultured with shaking at 37°C, 100% humidity, 12% CO2, 5% O2, and 83% N2 for 2 weeks, and 150μL of Brucella broth (skirrow 2 vials / L, vitox 2 vials / L, linezolid 5mg / L, fetal calf serum 20% (V / V), pH5) was added every other day. The culture medium was centrifuged and washed three times with water to obtain H. suis SNTW101 cells. Protein was quantified using a Bio-Rad protein assay kit. A calibration curve was created using bovine serum albumin (BSA) as the standard protein.

[0108] (Example 11) Immunohistochemistry using anti-No. 16 peptide (SEQ ID NO: 12) antibody The stomach of a C57BL / 6 mouse infected with H. suis SNTW101 was incised along the greater vein. The contents were washed with PBS, excised vertically, and fixed with 10% neutral buffered formalin. The stomach tissue was embedded in paraffin and cut into 4 μm sections. After deparaffinization, the tissue was washed with water and heat-treated at 95°C for 20 minutes using citrate buffer (pH 6.0) to activate the antigens. After washing with water, the tissue was reacted with 0.3% hydrogen peroxide for 10 minutes at room temperature. After washing twice with PBS, the tissue was reacted with anti-No.16 peptide antibody (2 μg / mL PBS) for 1 hour at room temperature. After washing twice with PBS, the tissue was reacted with Histofine Siplstain Mouse MAX-PO(R) (Nichirei, Code.414341) as a secondary antibody for 30 minutes at room temperature. After washing twice with PBS, the tissue was colored with DAB (3,3'-diaminobenzidine tetrahydrochloride) solution for 5 minutes at room temperature. After washing twice with PBS, the sections were stained with hematoxylin, washed with water, dehydrated, cleared, mounted, and observed under a microscope.

[0109] The results are shown in Figure 17. It was demonstrated that immunostaining of H. suis cells is possible using the No. 16 peptide (SEQ ID NO: 12) antibody.

Claims

1. 1. A method for determining infection with H. suis in a subject, comprising: detecting all or a portion of the hsvA gene in a sample from a subject, determining that the sample in which all or a portion of the hsvA gene is detected is the presence of H. suis; and determining that the subject from whom the sample was determined to contain H. suis in the method was derived is infected with H. suis; The method according to the present invention, wherein the HsvA protein encoded by the hsvA gene is a protein derived from Helicobacter suis, which has a signal peptide region on the amino-terminal side of an outer membrane protein of a bacterium of the genus Helicobacter, an autotransporter (outer membrane transport mechanism of a protein) β domain on the carboxy-terminal side, and a disorder region involved in functional expression.

2. The method of claim 1 for determining infection with H. suis, comprising the steps of: Using DNA in a sample derived from a subject as a template, amplifying all or a part of the hsvA gene using any one primer selected from the following group (1) and any one primer selected from the following group (2), which are capable of binding to the hsvA gene under stringent conditions and amplifying all or a part of the hsvA gene; Group (1): GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47), AGAAACGAGATTACAGGAAG (SEQ ID NO:51), AGGAGCAAGTTTTGTAGCAG (SEQ ID NO:52), AAATGCGACTGATTGGATG (SEQ ID NO:53), Group (2): CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65), ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72), TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73), TGGTATTGCTGGTTAAGAGG (SEQ ID NO:74) detecting the amplified DNA; and Subjects in whom DNA amplification is detected are determined to be infected with H. suis.

3. The method of claim 1 for determining infection with H. suis, comprising the steps of: Contacting a sample derived from a subject with any one of the following probes capable of binding to the hsvA gene under stringent conditions and for detecting the hsvA gene: GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47), AGAAACGAGATTACAGGAAG (SEQ ID NO:51), AGGAGCAAGTTTTGTAGCAG (SEQ ID NO:52), AAATGCGACTGATTGGATG (SEQ ID NO:53), CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65), ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72), TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73), TGGTATTGCTGGTTAAGAGG (SEQ ID NO:74) detecting DNA in the sample that is bound to the probe; and determining that a subject in which DNA bound to the probe is detected is infected with H. suis;

4. The method according to claim 1 or 2, wherein the hsvA gene has the base sequence set forth in SEQ ID NO: 1, SEQ ID NO: 27 or SEQ ID NO:

29.

5. A composition for determining H. suis infection, which comprises any one of the following nucleic acid molecules capable of binding to the hsvA gene under stringent conditions and amplifying all or a part of the hsvA gene and / or detecting the hsvA gene: GATGGGCGCTTCTGGTTTA (SEQ ID NO: 47), AGAAACGAGATTACAGGAAG (SEQ ID NO:51), AGGAGCAAGTTTTGTAGCAG (SEQ ID NO:52), AAATGCGACTGATTGGATG (SEQ ID NO:53), CTGGTAATGCATCATTAGAAGCAAA (SEQ ID NO: 65), ATCGAAATAAGCGAACCTCA (SEQ ID NO: 72), TTGAAAGCTTAGCTAAACGG (SEQ ID NO: 73), TGGTATTGCTGGTTAAGAGG (sequence number 74).

Images