Compositions for DRG-specific reduction of transgene expression

Abstract

Provided herein is a recombinant AAV (rAAV) comprising an AAV capsid and a vector genome packaged therein, the vector genome comprising an AAV 5' inverted terminal repeat (ITR), an engineered nucleic acid sequence encoding a gene product for expression in a target cell, and an miRNA target sequence that selectively suppresses expression in dorsal root ganglion (DRG) cells. Also provided are pharmaceutical compositions comprising the rAAV described herein in a formulation buffer, and methods for treating human subjects with CNS-targeted gene therapy while selectively preventing expression in DRG cells.

Description

[Background technology]

[0001] The vector platform of choice for in vivo gene therapy is based on primate-derived adeno-associated virus (AAV). In the 1960s, gene therapy products were derived from AAV isolated from preparations of adenovirus (Hoggan, MD et al. Proc Natl Acad Sci USA 55:1467-1474, 1966). Although these vectors were safe, many programs failed in the clinic due to insufficient transduction. At the turn of the century, researchers discovered a family of endogenous AAVs that achieved much higher transduction efficiency while retaining a favorable safety profile as a vector (Gao, G., et al. J Virol 78:6381-6388, 2004).

[0002] The host's adverse response to the AAV vector was minimal. In contrast to non-viral and adenoviral vectors, which induce a strong acute inflammatory response (Raper, SE, et al. Mol Genet Metab 80:148-158, 2003; Zhang, Y., et al. Mol Ther 3:697-707, 2001), the AAV vector is not pro-inflammatory. After administration of the AAV vector, the destructive adaptive immune response against the vector-transduced cells, such as cytotoxic T cells, was minimal. There is evidence that AAV can induce resistance to the capsid or transgene product in animals and humans under certain circumstances, depending on the serotype, dose, route of administration, and immunosuppressive regimen (Gernoux, G., et al. Hum Gene Ther 28:338-349, 2017; Mays, LE & Wilson, JMMol Ther 19:16-27, 2011; Manno, CS, et al. Nat Med 12:342-347, 2006; Mingozzi, F., et al. Blood 110:2334-2341, 2007). However, given the recent expansion of clinical application of AAV gene therapy, toxicities that may limit the clinical impact of this technology are beginning to appear.

[0003] The most severe toxicity occurred after intravenous administration of high-dose AAV targeting the CNS and musculoskeletal system. Studies in non-human primates (NHPs) showed acute onset of thrombocytopenia and hypertransaminasemia, which in some cases developed into a fatal syndrome of hemorrhage and shock (Hordeaux, J., et al. Mol Ther 26:664-668, 2018; Hinderer, C., et al. Hum Gene Ther. 29(3):285-298, 2018). Acute elevation of liver enzymes and / or reduction in platelets have also been observed in most high-dose AAV clinical trials (AveXis, I. ZOLGENSMA Prescribing Information, 2019; Solid Biosciences Provides SGT-001 Program Update, 2019, Pfizer, Pfizer Presents Initial Clinical Data on Phase 1b Gene Therapy Study for Duchenne Muscular Dystrophy (DMD), 2019, Flanigan, KT et al. Molecular Genetics and Metabolism 126:S54, 2019). Although rare, severe toxicity was characterized by anemia, renal failure, and complement activation (Solid Biosciences, 2019, Pfizer, 2019).

[0004] More recently, in NHPs and pigs receiving AAV vectors either in the cerebrospinal fluid (CSF) or, at high doses, in the blood, neurons in the dorsal root ganglion (DRG) degenerate. Problems have been observed (Hinderer, C., et al. Hum Gene Ther. 29(3): 285-298, 2018; Hordeaux, J., et al. Mol Ther Methods Clin Dev 10: 68-78, 2018; Hordeaux, J., et al. Mol Ther Methods Clin Dev 10: 79-88, 2018). This neurotoxicity is associated with degeneration of both peripheral axons in the peripheral nerves and central axons ascending through the dorsal columns of the spinal cord.

[0005] There is a need in the art for compositions and methods for gene therapy that minimize expression of the gene product in cells that are more susceptible to toxicity. Summary of the Invention

[0006] In certain embodiments, compositions and methods are provided that suppress the expression of transgenes in DRG neurons.Advantageously, these compositions reduce neurodegeneration and / or reduce secondary dorsal spinal cord axon degeneration that may be caused by overexpression and / or immune-mediated toxicity after intrathecal or systemic gene therapy administration.

[0007] In certain embodiments, a composition for gene delivery is provided to specifically suppress the expression of a gene product in dorsal root ganglion (DRG) that contains an expression cassette. In certain embodiments, the expression cassette is a nucleic acid sequence, comprising: (a) a coding sequence of a gene product, the coding sequence of the gene product being under the control of a regulatory sequence that directs the expression of the gene product in a cell that contains the expression cassette; and (b) at least one target sequence specific to at least one of miR-183, miR-182, or miR-96, the at least one target sequence being operably linked at the 3' end of the coding sequence (a). In certain embodiments, the expression cassette is carried by a non-viral vector, a viral vector, or a non-vector-based delivery system. In certain embodiments, the composition comprises at least one first miRNA target sequence and at least one second miRNA target sequence, which may be the same or different, and which comprise tandem repeats of at least two target sequences. In certain embodiments, the expression cassette comprises at least two miRNA tandem repeats located in the 3'UTR. In certain embodiments, the expression cassette comprises a 3'UTR with three miRNA tandem repeats. In certain embodiments, at least two DRG-specific miRNA target sequences are located in both the 5'UTR and the 3'UTR. In certain embodiments, the expression cassette is carried by a viral vector selected from a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adenovirus. In certain embodiments, the expression cassette is carried by a non-viral vector or delivery system selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based formulations.

[0008] In certain embodiments, a composition is provided that includes an expression cassette, wherein the start of a first of the at least two miRNA tandem repeats is within 20 nucleotides from the 3' end of the gene coding sequence. In certain embodiments, a composition is provided that includes an expression cassette, wherein the start of a first of the at least two miRNA tandem repeats is at least 100 nucleotides from the 3' end of the gene coding sequence. In certain embodiments, a composition is provided that includes an expression cassette, wherein the 3'UTR and the miRNA tandem repeats comprise 200-1200 nucleotides in length. In certain embodiments, the expression cassette includes four miRNA target sequences located in the 3'UTR. In certain embodiments, a composition is provided, wherein the expression cassette further includes at least one target sequence specific for miR-183, miR-182, or miR-96 in the 5'UTR. In certain embodiments, the expression cassette includes at least two miRNA target sequences located in both the 5'UTR and the 3'UTR. In certain embodiments, the expression cassette contains miR-183, miR-182, or comprises at least one target sequence specific for miR-96. In certain embodiments, the expression cassette comprises at least two miRNA target sequences located in both the 5'UTR and the 3'UTR.

[0009] In certain embodiments, compositions are provided that include an expression cassette, and two or more consecutive miRNA target sequences are consecutive and are not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer, and each spacer is different. In certain embodiments, the spacer located between the miRNA target sequences is located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence. In certain embodiments, the spacer between the miRNA target sequences is the same.

[0010] In certain embodiments, a recombinant AAV (rAAV) is provided for delivering a gene product that specifically inhibits expression of a gene product in DRG to a patient in need thereof, the rAAV comprising a viral capsid into which an AAV vector genome is packaged, the vector genome comprising (a) a coding sequence for the gene product, the coding sequence for the gene product being under the control of regulatory sequences that direct expression of the gene product in a cell containing the vector genome, and (b) at least one miRNA target sequence specific for at least one of miR-183, miR-182, or miR-96.

[0011] In certain embodiments, the composition comprises an expression cassette or rAAV and a formulation buffer suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection.

[0012] In certain embodiments, a method is provided for suppressing the expression of transgenes in DRG neurons.The method comprises delivering a composition comprising expression cassette and / or rAAV to a patient.In certain embodiments, the method allows the dose or duration of immunosuppressive therapy to be reduced compared with gene therapy that does not include miRNA tandem repeats.

[0013] In certain embodiments, a method is provided for regulating neurodegeneration and / or reducing secondary dorsal spinal cord axon degeneration after intrathecal or systemic gene therapy administration.The method comprises delivering a composition comprising expression cassette and / or rAAV to a patient.In certain embodiments, the method allows for a reduction in the dose or duration of immunosuppressive therapy compared to gene therapy that does not include miRNA tandem repeats.

[0014] In certain embodiments, a method is provided for enhancing transgene expression in cells of the central nervous system (CNS) after administration of intrathecal or systemic gene therapy. The method comprises delivering a composition comprising an expression cassette and / or rAAV to a patient. In certain embodiments, the expression cassette or rAAV vector genome comprises at least one miR183 target sequence. In certain embodiments, transgene expression is enhanced in cells of the CNS, including one or more of pyramidal neurons, Purkinje neurons, granule cells, spindle neurons, interneurons, astrocytes, oligodendrocytes, microglia, and ependymal cells.

[0015] Other aspects and advantages of the present invention will become readily apparent from the following detailed description of the invention. [Brief description of the drawings]

[0016] [Figure 1A-1C]DRG toxicity and secondary axonopathy after ICM administration of AAV. (Figure 1A) DRG contains the cell bodies of sensory pseudounipolar neurons, which relay sensory messages from the periphery to the CNS via peripheral axons located in peripheral nerves and central axons located in the ascending dorsal white matter tracts of the spinal cord. (Figure 1B) Axonopathy and DRG neurodegeneration. Axonopathy (top left) appears as obvious vacuoles that are either empty (missing axons) or filled with macrophages and cellular debris (arrows) digesting myelin. DRG lesions (top right and bottom left) consist of degeneration of neuronal cell bodies (arrows) with infiltration of mononuclear cells (circles). Eosinophilic (pink) cytoplasm resulting from dissolution of Nissl bodies (central chromatolysis) characterizes degenerating neurons. Increase in cell types is due to proliferation of satellite cells (satellite lesions) and inflammatory cell infiltration. Some mononuclear cells infiltrate and phagocytose neuronal cell bodies (neurophagocytosis). The bottom right picture shows immunostaining for the transgene encoded by the AAV (in this case, GFP). Neurons showing degenerative changes and mononuclear cell infiltration are the ones showing the strongest protein expression (evidenced by dark brown staining of IHC). (Figure 1C) Examples of DRG lesions from grade 1 to grade 5 and dorsal spinal cord axonopathy from grade 1 to grade 4. Grades of severity are defined as follows: 1. minimal (less than 10%), 2. mild (10-25%), 3. moderate (25-50%), 4. marked (50-95%), and 5. severe (more than 95%). Grade 5 was not observed at all in the spinal cord. Arrows and circles depict neurodegeneration (left column) and axonopathy (right column) with mononuclear cell infiltration into the DRG. [Figure 2A-2B]Overexpression-associated toxicity model and mitigation strategy using miRNA-induced silencing are shown. (Figure 2A) The cell body of the pseudounipolar sensory neuron is located in the DRG and surrounded by satellite cells and fenestrated capillaries. The peripheral axon of the pseudounipolar sensory neuron is located in the peripheral nerve, and the central axon is located in the dorsal tract of the spinal cord. The AAV vector hijacks and overloads the transcription and protein synthesis machinery, thus resulting in ER stress and secondary failure to maintain the distal axon. The satellite cells undergo reactive proliferation and attract inflammatory cells such as lymphocytes by secreting cytokines. These reversible changes may result in cell death. Glial cells and macrophages then infiltrate and phagocytose the neuronal cell body. (Figure 2B) Exemplary AAV expression cassette design for DRG-specific silencing. Four short tandem repeats of the miRNA reverse complement sequence (miR target or target sequence) are introduced between the stop codon and poly-A. In DRG neurons, miRNAs such as miRNA183 bind to the 3' untranslated region of mRNAs, recruit the RNA-induced silencing complex (RISC), and then result in silencing by mRNA cleavage. In other cell types that do not express miRNA183, translation and protein synthesis occur without influence from the 3' UTR region. [Figure 3A-3D]We show that miR183 targets specifically silence transgene expression in vitro and in mouse DRG neurons. (Figure 3A) 293 cells were transiently co-transfected with GFP-expressing AAV plasmids carrying miR183 or miR145 targets, and control or miR183 expression vectors. GFP protein levels were detected 72 hours after transfection, and the levels were quantified by Western blotting. Experiments were performed in triplicate. Error bars indicate standard deviation. (Figure 3B) C57BL6 / J mice were injected IV with AAV9.CB7.GFP control vector or AAV9.CB7.GFP-miR vector at a dose of 4x1012 gc. We screened three DRG-enriched miRs: miR183, miR145, and miR182. DRGs were harvested 2 weeks after injection and stained for GFP using IHC. The percentage of GFP-expressing neurons relative to total DRG neurons was counted using the ImageJ cell counting tool. Wilcoxon test: *=p<0.05, **=p<0.01, ***=p<0.001. (Figure 3C) Here, representative pictures of GFP immunostaining from DRG quantified in panel Figure 3B are shown. (Figure 3D) C57BL6 / J mice were injected IV with AAV-PHP.B.CB7.GFP control vector or AAV-PHP.B.CB7.GFP-miR (miR183, miR145, miR182). Three weeks after injection, the CNS and liver were harvested for direct GFP observation using a fluorescent microscope. Here, representative pictures of the cerebellum, cortex, and liver are shown. [Figure 4A-4C]We show that miR183 targets specifically silence GFP expression in DRG and reduce toxicity after ICM administration of AAVhu68.GFP to NHPs. We injected adult rhesus macaques with 3.5×1013 GC of AAVhu68.CB7.GFP control vector (n=2) or AAVhu68.CB7.GFP-miR183 (n=4) in the ICM. Two weeks after injection, half of the animals were sacrificed for GFP expression analysis, and two months after injection, the other half were sacrificed for GFP expression and histopathology. (Figure 4A) Representative photographs of GFP immunostained sections of DRG, spinal motor neurons, cerebellum, cortex, heart, and liver two weeks after vector administration. (Figure 4B) Quantification of GFP-positive cells in the DRG (sensory neurons), spinal cord (lower motor neurons), cerebellum, and cortex of NHPs (n=2: AAV.GFP, n=4: AAV.GFP-miR183). At least 5 20x fields per region per animal were quantified using the ImageJ cell counting tool. Error bars indicate standard deviation. Wilcoxon test: *=p<0.05, **=p<0.01, ***=p<0.001. (Figure 4C) Histopathology 2 months after injection shows dorsal spinal cord axonopathy, peripheral nerve axonopathy (median, peroneal and radial nerves), as well as severity grades of DRG neurodegeneration and mononuclear infiltration. A board-certified veterinary pathologist blinded to vector group established severity grades and were defined as follows: 1. minimal (<10%), 2. mild (10-25%), 3. moderate (25-50%), 4. marked (50-95%), and 5. severe (>95%, not observed). Each bar represents one animal. 0 represents the absence of lesions. [Diagram 5]Figure 1 shows miR183 targeting specifically silencing expression of hIDUA in the DRG following ICM administration of AAVhu68.hIDUA to NHPs. Adult rhesus macaques were injected in ICM with either 1) 1x1013 GC of AAVhu68.CB7.hIDUA control vector (n=3), 2) AAVhu68.CB7.hIDUA control vector (n=3) with prophylactic steroid treatment (1 mg / kg / day prednisolone from day -7 to day 30, followed by gradual taper), or 3) AAVhu68.CB7.hIDUA-miR183 (n=3). Animals were sacrificed 3 months after injection to analyze transgene expression and histopathology. Representative pictures show analysis of hIDUA expression by anti-hIDUA antibody immunofluorescence (DRG, first row), IHC of anti-hIDUA (lower motor neurons, cerebellum, cortex), and ISH of anti-IDUA (DRG, last row). ISH of hIDUA: Exposure time is 200 ms for AAVhu68.hIDUA with or without steroids. Sensory neurons show high amounts of transgene mRNA expression. Exposure time for AAV.hIDUA-miR183 is 1 s. Sensory neurons have low ISH signals (mRNA) in the nucleus and cytoplasm. mRNA can be seen in satellite cells surrounding the neurons at this longer exposure time. [Figures 6A-6C]We show that miR183-mediated silencing is specific to DRG neurons and completely prevents DRG toxicity in NHPs treated with ICM with AAVhu68.hIDUA. (FIG. 6A) Quantification of hIDUA-positive cells in the DRG (sensory neurons), spinal cord (lower motor neurons), cerebellum, and cortex of NHPs (n=3 per group). A minimum of five 20x magnification fields per region per animal were quantified. Error bars represent standard deviation. Wilcoxon test: *=p<0.05, **=p<0.01, ***=p<0.001. (Figure 6B) Histopathology scoring 3 months after injection: Dorsal Axonopathy Cumulative Score (sum of severity grades from cervical, thoracic, and lumbar spinal cord segments - maximum possible score is 15), DRG Cumulative Score (sum of severity grades from cervical, thoracic, and lumbar spinal cord segments - maximum possible score is 15), and Median Neurological Score (sum of severity grades of axonopathy and fibrosis - maximum possible score is 10). A board-certified veterinary pathologist blinded to the vector group established the severity grades, with the following definitions: 1. Minimal (<10%), 2. Mild (10-25%), 3. Moderate (25-50%), 4. Marked (50-95%), and 5. Severe (>95%, not observed). 0 represents absence of lesions. Error bars represent standard deviation. (FIG. 6C) ISH using a hIDUA transgene-specific probe, high magnification of DRG sensory neurons and satellite cells, 1 s exposure time with nuclear counterstaining with blue DAPI. Arrows: DRG sensory neurons, arrowheads: satellite cells. [Figure 7A-7D]T cell and antibody responses to hIDUA in NHPs are shown. Adult rhesus macaques were injected in ICM with either 1) 1x1013 GC of AAVhu68.CB7.hIDUA control vector (n=3), 2) AAVhu68.CB7.hIDUA control vector (n=3) with prophylactic steroid treatment (1 mg / kg / day prednisolone from day -7 to day 30, followed by gradual tapering), or 3) AAVhu68.CB7.hIDUA-miR183 (n=3). (Figure 7A-C) ELISPOT responses for interferon-gamma in lymphocytes isolated from PBMCs, spleen, liver, and deep cervical lymph nodes 90 days after injection. Each animal has three values ​​representing different peptide pools (three overlapping peptide pools covering the entire hIDUA sequence). Red indicates a positive ELISPOT response, defined as >55 spot-forming units per 106 lymphocytes and 3-fold higher than unstimulated medium negative control. (FIG. 7D) ELISA assay for anti-hIDUA antibodies, serum dilution 1:1,000. [Figure 8] Cytokine / chemokine concentrations in the CSF are shown. Samples were collected at the time of vector administration (D0), and 24 hours (24 hours), day 21 (D21) and day 35 (D35) after vector administration. [Figure 9] Vector biodistribution in the brain, spinal cord, and DRG of NHPs is shown. Adult rhesus macaques were injected in the ICM with either 1) 1x1013GC AAVhu68.CB7.hIDUA control vector (n=3), 2) AAVhu68.CB7.hIDUA control vector (n=3) with prophylactic steroid treatment (1mg / kg / day prednisolone from day -7 to day 30, followed by gradual taper), or 3) AAVhu68.CB7.hIDUA-miR183 (n=3). NHP tissue DNA was extracted with QIAamp DNA Mini kit. We quantified vector genomes by real-time polymerase chain reaction using Taqman reagents and primers / probes targeting the rBG polyadenylation sequence of the vector. Results are expressed in genome copies per diploid genome. Error bars represent standard deviation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The compositions and methods provided herein are useful in gene delivery therapy to suppress transgene expression in DRG neurons by the use of miRNAs. As used herein, the term "suppression" includes partial reduction or complete abolishment or silencing of transgene expression. Transgene expression may be assessed using an assay suitable for the selected transgene. The compositions and methods provided reduce DRG toxicity characterized by neurodegeneration, secondary dorsal spinal cord axon degeneration, and / or mononuclear cell infiltration. In certain embodiments, the expression cassette or vector genome comprises one or more miRNA target sequences in the untranslated region (UTR) 3' of the gene product coding sequence. Preferably, two or more miRNA target sequences are provided in tandem, optionally separated by a spacer sequence. In certain embodiments, four or more miRNA target sequences are provided in tandem, optionally separated by a spacer sequence. In certain embodiments, three or more miRNA target sequences are provided in tandem, optionally separated by a spacer sequence. A variety of delivery systems can be used to deliver the expression cassette to a subject (e.g., a human patient). Such delivery systems can be viral vectors, non-viral vectors, or non-vector based systems (e.g., liposomes, naked DNA, naked RNA, etc.). These delivery systems can be used for delivery directly to the central nervous system (CNS), peripheral nervous system (PNS), or intravenously or alternative delivery routes. In other embodiments, these compositions and methods are used for systemic delivery of gene therapy vectors (e.g., rAAV). In certain embodiments, these compositions and methods are used for the delivery of high dose These compositions and methods are useful when a vector (e.g., rAAV) is delivered. In certain embodiments, the compositions and methods provided herein allow for a reduced dose, length, and / or number of immunomodulatory agents to be co-administered with a gene therapy vector (e.g., rAAV-mediated gene therapy). In certain embodiments, the compositions and methods provided herein eliminate the need to co-administer an immunosuppressant or immunomodulatory therapy before, during, and / or after administration of a viral vector (e.g., rAAV).

[0018] The "5'UTR" is upstream of the start codon of the coding sequence of a gene product. The 5'UTR is generally shorter than the 3'UTR. Generally, the 5'UTR is about 3 to about 200 nucleotides long, but can optionally be longer.

[0019] The "3'UTR" is downstream of the coding sequence of a gene product and is generally longer than the 5'UTR. In certain embodiments, the 3'UTR is about 200 to about 800 nucleotides in length, but can optionally be longer or shorter.

[0020] As used herein, "miRNA" refers to microRNA, which is a small non-coding RNA molecule that regulates mRNA and stops its translation into protein. miRNAs contain a "seed sequence," a region of nucleotides, that specifically binds to mRNA by complementary base pairing, resulting in the destruction or silencing of the mRNA. In certain embodiments, the seed sequence is located in the mature miRNA (5' to 3'), generally at positions 2-7 or 2-8 of the miRNA (from the 5' end of the sense (+) strand), but may be longer than the strand length. In certain embodiments, the length of the seed sequence is about 30% or more of the length of the miRNA sequence, and can be at least 7 nucleotides to about 28 nucleotides long, at least 8 nucleotides to about 28 nucleotides long, 7 nucleotides to 28 nucleotides long, 8 nucleotides to 18 nucleotides long, 12 nucleotides to 28 nucleotides long, about 20 nucleotides to about 26 nucleotides long, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides long.

[0021] As used herein, a "miRNA target sequence" is a sequence located on the DNA plus strand (5' to 3') that is at least partially complementary to a miRNA sequence, including a miRNA seed sequence. The miRNA target sequence is exogenous to the untranslated region of the encoded transgene product and is designed to be specifically targeted by the miRNA in cells where suppression of transgene expression is desired. The term "miR183 cluster target sequence" refers to a target sequence that responds to one or more members of the miR183 cluster (alternatively referred to as family), including miR-183, -96 and -182 (described by Dambal, S. et al. Nucleic Acids Res 43:7173-7188, 2015, incorporated herein by reference). Without intending to be bound by theory, the messenger RNA (mRNA) of the transgene (which encodes a gene product) is present in the cell type into which the expression cassette containing the miRNA is delivered, such that specific binding of the miRNA to its target sequence in the 3'UTR miRNA results in silencing and cleavage of the mRNA, thereby reducing or eliminating expression of the transgene only in cells that express the miRNA.

[0022] Typically, the miRNA target sequence is at least 7 nucleotides to about 28 nucleotides in length, at least 8 nucleotides to about 28 nucleotides in length, 7 nucleotides to 28 nucleotides, 8 nucleotides to 18 nucleotides in length, about 12 to about 28 nucleotides in length, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length, and contains at least one contiguous region (e.g., 7 or 8 nucleotides) that is complementary to the miRNA seed sequence. In certain embodiments, the target sequence is a sequence that is complementary to the miRNA seed sequence. The target sequence may comprise a sequence that has exact complementarity (100%) with the miRNA seed sequence, or a sequence that has partial complementarity with some mismatches with the miRNA seed sequence. In certain embodiments, the target sequence comprises at least 7-8 nucleotides that are 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence consists of a sequence that is 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence comprises multiple copies (e.g., 2 or 3 copies) of a sequence that is 100% complementary to the seed sequence. In certain embodiments, the region of 100% complementarity comprises at least 30% of the length of the target sequence. In certain embodiments, the remainder of the target sequence has at least about 80% to about 99% complementarity to the miRNA. In certain embodiments, in an expression cassette comprising a DNA positive strand, the miRNA target sequence is the reverse complement of the miRNA.

[0023] In certain embodiments, engineered expression cassettes or vector genomes are provided herein, comprising at least one copy of miR target sequence that targets one or more members of the miR-183 family or cluster operably linked to transgene, for suppressing the expression of transgene in DRG and / or reducing or eliminating DRG toxicity and / or axonopathy.In certain embodiments, engineered expression cassettes or vector genomes comprise multiple miRNA target sequences, such that the number of miRNA target sequences is sufficient to reduce or minimize the expression of transgene in DRG, for reducing and / or eliminating DRG toxicity and / or axonopathy.Expression cassettes or vector genomes can be delivered via any suitable carrier system, viral or non-viral vector, and via any route, but are particularly useful for intrathecal administration.

[0024] As used herein, the term "intracranial delivery" or "intracranial administration" refers to a route of administration via injection into the spinal canal, and more specifically into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including intraventricular cerebroventricular (ICV)), suboccipital / intracisternal, and / or C1-2 puncture. For example, material may be introduced by lumbar puncture for diffusion throughout the subarachnoid space. In another example, injection may be intracisternal.

[0025] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to a route of administration directly into the cerebrospinal fluid of the cisterna magna cerebellomedularis, more specifically, via a suboccipital puncture or by direct injection into the cisterna magna, or via a permanently placed tube.

[0026] Surprisingly, compositions comprising miR-183 targeting sequences described herein for suppressing expression in DRG have been observed to provide enhanced transgene expression in one or more different cell types (other than DRG) in the central nervous system, including, but not limited to, neurons (including, for example, pyramidal cells, Purkinje cells, granule cells, spindle cells, and interneurons), or glial cells (including, for example, astrocytes, oligodendrocytes, microglia, and ependymal cells). Although this observation was made after an intrathecal delivery route, this CNS-enhancing effect is not limited to CNS delivery routes and can be achieved using other routes (e.g., high-dose intravenous delivery route, high-dose intramuscular delivery route, or other systemic delivery route).

[0027] In certain embodiments, one may wish to select miR-182 and / or miR-96 targeting sequences for expression cassettes containing transgenes that do not target the CNS (while suppressing DRG expression) to avoid enhancing CNS expression of the transgene. For example, expression cassettes containing transgenes for delivery to skeletal muscle or liver may wish to avoid any enhancement of CNS expression, but prevent DRG toxicity and / or axonopathy that may be associated with the high doses that may be required.

[0028] In certain embodiments, the vector genome or expression cassette comprises at least one miRNA target sequence that is a target sequence for miR-183. TIFF0007660062000001.tif9163 (sequences complementary to the miR-183 seed sequence are underlined). In certain embodiments, the vector genome or expression cassette comprises two or more copies (e.g., two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and comprises at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence comprises a sequence that is partially complementary to SEQ ID NO:1 and thus has one or more mismatches when aligned to SEQ ID NO:1. In certain embodiments, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO:1, and the mismatches can be non-contiguous. In certain embodiments, the miR-183 target sequence comprises a region of 100% complementarity and comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence having 100% complementarity with the miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence has at least about 80% to about 99% complementarity with miR-183. In certain embodiments, the expression cassette or vector genome comprises a miR-183 target sequence and comprises a truncated SEQ ID NO:1 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5' or 3' end of SEQ ID NO:1). In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-183 target sequence, hi yet other embodiments, the expression cassette or vector genome comprises at least two, three, or four miR-183 target sequences.

[0029] In certain embodiments, the expression cassette or vector genome comprises a combination of miRNA target sequences. In certain embodiments, the combination of target sequences comprises different target sequences that have at least partial complementarity with the same miRNA (such as miR-183). In certain embodiments, the expression cassette or vector genome comprises a combination of miRNA target sequences, selected from the target sequences of miR-183, miR-182, and / or miR-96 provided herein. In certain embodiments, the expression cassette or vector genome comprises a transgene and two, three, or four miR-96 target sequences. In certain embodiments, the expression cassette or vector genome comprises a transgene and two, three, or four miR-182 target sequences. In certain embodiments, the expression cassette or vector genome comprises at least one, at least two, at least three, or at least four miR-183 target sequences, optionally in combination with at least one, at least two, at least three, or at least four miR-182 target sequences, and / or optionally in combination with at least one, at least two, at least three, or at least four miR-96 target sequences.

[0030] It has been observed that compositions that contain transgenes and miR-182 can minimize or eliminate dorsal root ganglion toxicity and / or prevent axonopathy.However, expression cassettes or vector genomes that contain miR-182 targeting sequences, while effective for this purpose, have not been observed to enhance CNS expression, as has been found with complexes that contain miR-183 targeting sequences.Therefore, it may be desirable for these compositions to target genes outside the CNS.

[0031] In certain embodiments, expression cassettes or vector genomes are provided herein that contain one or more miR-183 family targeting sequences and lack a transgene (i.e., the miR-183 family targeting sequence(s) is not operably linked to a sequence encoding a heterologous gene product).

[0032] In certain embodiments, the vector genome or expression cassette comprises at least one miRNA target sequence that is a target sequence of miR-182. In certain embodiments, the vector genome or expression cassette comprises a miR-182 target sequence and comprises AGTGTGAGTTTCTACCATTGCCAAA (SEQ ID NO: 3). In certain embodiments, the vector genome or expression cassette comprises two or more copies (e.g., two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and comprises at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence comprises a sequence that is partially complementary to SEQ ID NO: 3 and thus has one or more mismatches when aligned with SEQ ID NO: 3. In certain embodiments, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned with SEQ ID NO:3, and the mismatches can be non-contiguous. In certain embodiments, the miR-182 target sequence comprises a region of 100% complementarity and also comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence having 100% complementarity with the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity with miR-182. In certain embodiments, the expression cassette or vector genome comprises a miR-182 target sequence, and the miR-182 target sequence comprises a truncated SEQ ID NO:3 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both of the 5' or 3' ends of SEQ ID NO:3). In certain embodiments, the expression cassette or vector genome comprises a transgene and one miR-182 target sequence. In yet other embodiments, the expression cassette or vector genome comprises at least two, three, or four miR-182 target sequences.

[0033] In certain embodiments, an expression cassette or vector genome has two or more consecutive miRNA target sequences, which are contiguous and not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer. In certain embodiments, the spacer is a non-coding sequence about 1 to about 12 nucleotides, or about 2 to about 10 nucleotides in length, or about 3 to about 10 nucleotides, about 4 to about 6 nucleotides in length, or 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleotides in length. Optionally, a single expression cassette may contain three or more miRNA target sequences, optionally with different spacer sequences between them. In certain embodiments, one or more spacers are independently selected from (i) GGAT (SEQ ID NO: 5), (ii) CACGTG (SEQ ID NO: 6), or (iii) GCATGC (SEQ ID NO: 7). In certain embodiments, the spacer is located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same.

[0034] In certain embodiments, the expression cassette comprises a transgene, an miR-183 target sequence, and one or more different miRNA target sequences. In certain embodiments, the expression cassette comprises a miR-96 target sequence: mRNA and DNA positive strand (5' to 3'): AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 2), a miR-182 target sequence: mRNA and DNA positive strand (5' to 3'): and / or AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 3).

[0035] Although miR-145 has been associated with the brain in the literature, previous studies have shown that miR-145 target sequences are ineffective at reducing transgene expression in the dorsal root ganglion. miR-145 target sequence: mRNA and DNA positive strand (5' to 3') AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 4)

[0036] As provided herein, expression cassettes and vector genomes contain transgenes and are operably linked to or under the control of regulatory sequences that direct the expression of transgene products in target cells.In certain embodiments, expression cassettes or vector genomes contain transgenes and are operably linked to one or more miRNA target sequences provided herein.In certain embodiments, expression cassettes or vector genomes are designed to contain multiple miRNA target sequences.The miRNA target sequences are integrated into the UTR of the transgene (i.e., 3' or downstream of the open reading frame of the gene).

[0037] The term "tandem repeat" is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be consecutive, i.e., the 3' end of one sequence is immediately upstream of the 5' end of the next sequence, without any intervening sequence, or vice versa, directly one after the other. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.

[0038] As used herein, a "spacer" refers to any selected nucleic acid sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, located between two or more consecutive miRNA target sequences. In certain embodiments, the spacer is 1-8 nucleotides in length, 2-7 nucleotides in length, 3-6 nucleotides in length, 4 nucleotides in length, 4-9 nucleotides in length, 3-7 nucleotides in length, or longer. Suitably, the spacer is a non-coding sequence. In certain embodiments, the spacer can be four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0039] In certain embodiments, the tandem repeat comprises two, three, four or more of the same miRNA target sequences. In certain embodiments, the tandem repeat comprises at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeat may comprise two or three of the same miRNA target sequences, and a different fourth miRNA target sequence.

[0040] In certain embodiments, there may be at least two different sets of tandem repeats in the expression cassette.For example, the 3'UTR may include a tandem repeat immediately downstream of the transgene, the UTR sequence, and two or more tandem repeats near the 3' end of the UTR.In another example, the 5'UTR may include one, two or more miRNA target sequences.In another example, the 3' may include a tandem repeat and the 5'UTR may include at least one miRNA target sequence.

[0041] In certain embodiments, the expression cassette comprises two, three, four or more tandem repeats beginning within about 0-20 nucleotides of the transgene's stop codon, hi other embodiments, the expression cassette comprises miRNA tandem repeats at least 100 to about 4000 nucleotides from the transgene's stop codon.

[0042] "Comprising" means that the term includes other elements or method steps. When "comprising" is used, the relevant embodiment includes It should be understood that descriptions using the term "consisting of," which excludes other components or method steps, and the term "consisting essentially of," which excludes any components or method steps that materially change the nature of the embodiment or invention, are included. Although various embodiments herein are presented using the word "comprising," it should also be understood that, under various circumstances, relevant embodiments will be described using the words "consisting of" or "consisting essentially of."

[0043] It should be noted that the terms "a" or "an" refer to one or more, e.g., "a vector" is understood to represent one or more vectors. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0044] As used herein, the term "about" means a plus or minus 10% variability from a given reference, unless otherwise specified.

[0045] 1. Expression Cassette An "expression cassette" as described herein comprises a nucleic acid sequence that encodes a functional gene product operably linked to a regulatory sequence that induces its expression in a target cell and a miRNA target sequence in a UTR. As described herein, the miRNA target sequence is designed to be specifically recognized by a miRNA present in a cell in which expression of a transgene is undesirable and / or a reduction in the expression level of a transgene is desired. In certain embodiments, the miRNA target sequence specifically reduces the expression of a transgene in a dorsal root ganglion. In certain embodiments, the miRNA target sequence is located in the 3'UTR, the 5'UTR, and / or both the 3'UTR and the 5'UTR. The discussion of miRNA target sequences found herein is incorporated herein by reference.

[0046] In one embodiment, the expression cassette is designed for expression in a human subject, while reducing or eliminating DRG expression of the transgene product. In one embodiment, the expression cassette is designed for expression in the central nervous system (CNS), including cerebrospinal fluid and the brain. In certain embodiments, the expression cassette or vector genome is designed for expression or enhanced expression of the transgene in one or more cell types present in the CNS (excluding the dorsal root ganglion), including neurons (such as pyramidal cells, Purkinje cells, granule cells, spindle cells, and interneurons) and glial cells (such as astrocytes, oligodendrocytes, microglia, and ependymal cells). In certain embodiments, enhanced expression of the transgene is achieved in one or more cell types, with little or no expression of the transgene in another cell type of the CNS. In certain embodiments, the expression cassette is useful for expression in cells other than cells of the CNS.

[0047] As used herein, the term "expression" or "gene expression" refers to the process by which information from a gene is used to synthesize a functional gene product. A gene product can be a protein, peptide, or nucleic acid polymer (such as RNA, DNA, or PNA).

[0048] As used herein, the term "regulatory sequence" or "expression control sequence" refers to nucleic acid sequences, such as initiator sequences, enhancer sequences, and promoter sequences, that induce, repress, or otherwise control the transcription of a protein-encoding nucleic acid sequence to which they are operably linked.

[0049] As used herein, the term "operably linked" refers both to expression control sequences that are contiguous with a nucleic acid sequence encoding a gene product and / or expression control sequences that act in trans or at a distance to affect its transcription and expression.

[0050] The term "exogenous" as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the chromosome or at the location present in the host cell. Exogenous nucleic acid sequences also refer to sequences that originate from and are inserted into the same host cell or subject, but exist in a non-native state (e.g., in a different copy number, or under the control of different regulatory elements).

[0051] When used to describe a nucleic acid sequence or protein, the term "heterologous" means that the nucleic acid or protein is derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed. When used with reference to a protein or a nucleic acid of a plasmid, expression cassette, or vector, the term "heterologous" indicates that the protein or nucleic acid is present with another sequence or subsequence from the protein or nucleic acid that is not found in the same relationship to each other in nature.

[0052] In one embodiment, the regulatory sequence comprises a promoter. In one embodiment, the promoter is a chicken β-actin promoter. In a further embodiment, the promoter is a hybrid of the cytomegalovirus immediate early enhancer and the chicken β-actin promoter (CB7 promoter). In another embodiment, a suitable promoter is the elongation factor 1 alpha (EF1α) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene. 1990 Jul 16;91(2):217-23), synapsin 1 promoter (e.g., Kugler S et al, Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on in the transduced area. Gene Ther. 2003 Feb;10(4):337-47), the neuron-specific enolase (NSE) promoter (see, e.g., Kim J et al, Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology. 2004 Feb;145(2):613-9. Epub 2003 Oct 16), or the CB6 promoter (see, e.g., Large-Scale Production of Adeno-Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, Mol BioTechnol. 2016 Jan;58(1):30-6. doi:10.1007 / s12033-015-9899-5).

[0053] A suitable promoter can be selected, including, but not limited to, a constitutive promoter, a tissue-specific promoter, or an inducible / regulatable promoter. An example of a constitutive promoter is the chicken β-actin promoter. Various chicken β-actin promoters have been described, either alone or in combination with various enhancer elements (e.g., CB7: chicken β-actin promoter with cytomegalovirus enhancer element). Chicken beta-actin promoter, CAG promoter: containing the first exon and first intron of chicken beta-actin and the splice acceptor of the rabbit beta-globin gene, CBh promoter: SJ Gray et al, Hu Gene Ther, 2011 Sep;22(9):1143-1153). Examples of promoters that are tissue specific include the liver (albumin: Miyatake et al., (1997) J. Virol., 71:5124-32, hepatitis B virus core promoter: Sandig et al., (1996) Gene Ther., 3:1002-9, alpha-fetoprotein (AFP): Arbuthnot et al., (1996) Hum. Gene Ther., 7:1503-14), neurons (neuron-specific enolase (NSE) promoter: Andersen et al., (1993) Cell. Mol. NeuroBiol., 13:503-15, neurofilament light chain gene: Piccioli et al., (1991) Proc. Natl. Acad. Sci. USA, 88:5611-5, and the neuron-specific vgf gene: Piccioli et al. al., (1995) Neuron, 15:373-84, etc., as well as other tissues. Alternatively, a regulatable promoter may be selected. See, for example, WO2011 / 126808B2 (hereby incorporated by reference).

[0054] In one embodiment, the regulatory sequence further comprises an enhancer. In one embodiment, the regulatory sequence comprises one enhancer. In another embodiment, the regulatory sequence comprises two or more expression enhancers. These enhancers may be the same or different. For example, the enhancer may comprise an αmic / bik enhancer or a CMV enhancer. The enhancer may be present in two copies located adjacent to each other. Alternatively, the double copies of the enhancer may be separated by one or more sequences.

[0055] In one embodiment, the regulatory sequence further comprises an intron. In a further embodiment, the intron is a chicken β-actin intron. Other suitable introns include those known in the art, and may be the human β-globin intron, and / or the commercially available Promega® introns, and those described in WO2011 / 126808.

[0056] In one embodiment, the regulatory sequence further comprises a polyadenylation signal (polyA). In a further embodiment, the polyA is rabbit globin polyA. See, for example, WO2014 / 151341. Alternatively, another polyA (e.g., human growth hormone (hGH) polyadenylation sequence, SV40 polyA, or synthetic polyA) can be included in the expression cassette.

[0057] It is to be understood that the compositions in the expression cassettes described herein are intended to apply to other compositions, regimens, aspects, embodiments and methods described throughout the specification.

[0058] Expression cassette can be delivered via any suitable non-viral vector delivery system or by suitable viral vector.Suitable non-viral vector delivery system is known in the art (e.g., Ramamoorth and Narvekar.J Clin Diagn Res.2015 Jan;9(1):GE01-GE06, incorporated herein by reference), can be easily selected by those skilled in the art, and can include, for example, naked DNA, naked RNA, dendrimer, PLGA, polymethacrylate, inorganic particles, lipid particles, polymer-based vector, or chitosan-based formulation.

[0059] 2. Vector As used herein, a "vector" is a biological or chemical moiety that contains a nucleic acid sequence. The vector may be introduced into a suitable target cell for replication or expression of said nucleic acid sequence. Examples of vectors include, but are not limited to, recombinant viruses, plasmids, lipoplexes, polymersomes, polyplexes, dendrimers, cell penetrating peptide (CPP) conjugates, magnetic particles, or nanoparticles. In one embodiment, a vector is a nucleic acid molecule, which contains an exogenous or heterologous nucleic acid or an engineered nucleic acid that encodes a functional gene product, and can then be introduced into a suitable target cell. Such vectors preferably have one or more origins of replication and one or more sites into which recombinant DNA can be inserted. Vectors often have a means by which cells carrying the vector can be selected from cells that do not carry the vector (e.g., they encode drug resistance genes). Common vectors include plasmids, viral genomes, and "artificial chromosomes". Conventional methods of generating, producing, characterizing, or quantifying vectors are available to those skilled in the art.

[0060] In one embodiment, the vector is a non-viral plasmid and includes the described expression cassettes (e.g., "naked DNA", "naked plasmid DNA", RNA, and mRNA) and is combined with various compositions and nanoparticles (e.g., micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymer, lipid and / or cholesterol-based-nucleic acid conjugates, and other constructs as described herein). See, for example, X. Su et al, Mol. Pharmaceutics, 2011, 8(3), pp774-787; web publication: March 21, 2011, WO2013 / 182683, WO2010 / 053572, and WO2012 / 170930 (all of which are incorporated herein by reference).

[0061] In certain embodiments, the vectors described herein are "replication-defective viruses" or "viral vectors" refer to synthetic or artificial viral particles in which an expression cassette containing a nucleic acid sequence encoding a functional gene product and a DRG detargetting miRNA target sequence is packaged into the viral capsid or envelope, and similarly, any viral genomic sequences packaged within the viral capsid or envelope are replication-defective (i.e., retain the ability to infect target cells but cannot generate progeny virions). In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless," containing only nucleic acid sequences encoding flanking signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. It is therefore considered safe for use in gene therapy because replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication.

[0062] As used herein, recombinant virus vector is any suitable virus vector. Examples provide exemplary recombinant adeno-associated virus (rAAV). Other suitable virus vectors can include, for example, adenovirus, poxvirus, bocavirus, hybrid AAV / bocavirus, herpes simplex virus, or lentivirus. In a preferred embodiment, these recombinant viruses are replication-incompetent.

[0063] As used herein, the term "host cell" can refer to a packaging cell line in which a vector (e.g., recombinant AAV) is produced. Host cells can be prokaryotic or eukaryotic (e.g., human, insect, or yeast) and can be delivered by any means (e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion) of exogenous DNA or virions introduced into the cell. or heterologous DNA. Examples of host cells can include, but are not limited to, isolated cells, cell cultures, Escherichia coli cells, yeast cells, human cells, non-human cells, mammalian cells, non-mammalian cells, insect cells, HEK-293 cells, liver cells, kidney cells, cells of the central nervous system, neurons, glial cells, or stem cells.

[0064] As used herein, the term "target cell" refers to any target cell in which expression of a functional gene product is desired. Examples of target cells may include, but are not limited to, liver cells, kidney cells, cells of the central nervous system, neurons, glial cells, and stem cells. In certain embodiments, the vector is delivered to the target cell ex vivo. In certain embodiments, the vector is delivered to the target cell in vivo.

[0065] As used herein, "vector genome" refers to a nucleic acid sequence that is packaged into a viral vector. In one example, a "vector genome" includes at least, from 5' to 3', a vector-specific sequence, a nucleic acid sequence encoding a functional gene product operably linked to a regulatory control sequence that directs its expression in a target cell, an miRNA target sequence in the untranslated region(s), and a vector-specific sequence. For example, an AAV vector genome includes an inverted terminal repeat sequence and an expression cassette, the expression cassette including, for example, a nucleic acid sequence encoding a functional gene product operably linked to a regulatory control sequence that directs its expression in a target cell, and an miRNA target sequence in the untranslated region(s). As described herein, the miRNA target sequence is designed to be specifically recognized by the miRNA sequence in cells where transgene expression is undesirable (e.g., dorsal root ganglion) and / or where reduced levels of transgene expression are desired.

[0066] It is to be understood that the vector compositions described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0067] 3. Adeno-associated virus (AAV) In one aspect, a recombinant AAV (rAAV) is provided herein, which comprises an AAV capsid and a vector genome packaged therein.

[0068] In one embodiment, the regulatory sequences are as described above. In one embodiment, the vector genome comprises an AAV 5' inverted terminal repeat (ITR), an expression cassette as described herein, and an AAV 3' ITR. In one embodiment, the vector genome refers to a nucleic acid sequence that is packaged into a rAAV capsid forming a rAAV vector. Such a nucleic acid sequence comprises an AAV inverted terminal repeat (ITR) adjacent to the expression cassette. In one example, the "vector genome" comprises at least, from 5' to 3', an AAV 5' ITR, a nucleic acid sequence encoding a functional gene product operably linked to a regulatory control sequence that directs its expression in a target cell, a miRNA target sequence in the untranslated region(s), and an AAV 3' ITR. In a particular embodiment, the ITR is from AAV2 and the capsid is from a different AAV. Alternatively, other ITRs may be used. As described herein, the miRNA target sequence is designed to be specifically recognized by the miRNA sequence in cells in which expression of the transgene is undesirable and / or where reduced levels of transgene expression are desired.

[0069] ITRs are genetic elements involved in genome replication and packaging during vector production, and are the only viral cis-elements required to generate rAAV. In one embodiment, the ITRs are from a different AAV than the one that supplies the capsid. In a preferred embodiment, the ITR sequence from AAV2, or a deleted version thereof (ΔITR), may be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV origins may be selected. If the origin of the ITR is from AAV2 and the AAV capsid is from another AAV origin, the resulting vector may be referred to as pseudotyped. Typically, an AAV vector genome comprises the 5'ITR of AAV, the NAGLU coding sequence and any regulatory sequences, and the 3'ITR of AAV. However, other structures of these elements may also be suitable. A shortened version of the 5'ITR, called ΔITR, in which the D sequence and the final terminal release site (trs) are deleted, has been described. In other embodiments, full-length AAV 5' and 3'ITRs are used.

[0070] The term "AAV" as used herein refers to naturally occurring adeno-associated viruses, adeno-associated viruses available to those skilled in the art, and / or in the context of the composition(s) and method(s) described herein, as well as artificial AAVs. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles with AAV protein capsids, in which expression cassettes packaged are flanked by AAV inverted terminal repeats (ITRs) for delivery to target cells. AAV capsids consist of 60 capsid protein subunits VP1, VP2, and VP3, arranged in icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending on the AAV selected. Various AAVs may be selected as the source of capsids for the AAV viral vectors identified above. For example, see US Patent Application Publication No. 2007 / 0036760-A1, US Patent Application Publication No. 2009 / 0197338-A1, EP1310571. Also see WO2003 / 042397 (AAV7 and other simian AAVs), US Patent No. 7790449 and US Patent No. 7282199 (AAV8), WO2005 / 033321 and US7,906,111 (AAV9), and WO2006 / 110689, and WO2003 / 042397 (rh10). Also, these documents describe other AAVs that can be selected to generate AAVs (incorporated by reference). Among the well-characterized AAVs isolated or engineered from humans or non-human primates (NHPs), human AAV2 was the first AAV developed as a gene transfer vector, and it has been widely used for efficient gene transfer experiments in different target tissues and animal models.Unless otherwise specified, the AAV capsid, ITRs, and other selected AAV components described herein can be easily selected from among any AAV, including, but not limited to, AAV commonly identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV8bp, AAVrhlO, AAVhu37, AAV7M8, and AAVAnc80, any variant of known or mentioned AAV, or any AAV or variant yet to be discovered, or mixtures thereof.See, for example, WO2005 / 033321 (herein incorporated by reference).In one embodiment, the AAV capsid is an AAV9 capsid or a variant thereof.In certain embodiments, the capsid protein is designated by a number or a combination of numbers and letters following the term "AAV" in the name of the rAAV vector.

[0071] As used herein, the term "variant" with respect to AAV refers to any AAV sequence derived from a known AAV sequence, including AAV sequences with conservative amino acid substitutions, and AAV sequences that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or more sequence identity across the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant that may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining percent identity of AAV capsids, the comparison may be This can be done across any of the mutant proteins (e.g., vp1, vp2, or vp3).

[0072] ITRs or other AAV components can be easily isolated or engineered from AAV using techniques available to those skilled in the art. Such AAV can be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be engineered through synthesis or other suitable means by referencing published sequences such as those available in the literature or databases (e.g., GenBank, PubMed, etc.). AAV viruses can be engineered by conventional molecular biology techniques, allowing these particles to be optimized for cell-specific delivery of nucleic acid sequences, to minimize immunogenicity, to tailor stability and particle life span, for efficient degradation, for precise delivery to the nucleus, etc.

[0073] As used herein, the terms "rAAV" and "artificial AAV" refer interchangeably, but are not limited to, to an AAV that includes a capsid protein and a vector genome packaged therein, the vector genome including a nucleic acid heterologous to the AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such an artificial capsid can be produced by any suitable technique using a selected AAV sequence (e.g., a fragment of vp1 capsid protein) in combination with a heterologous sequence (which can be obtained from a different selected AAV, a non-contiguous portion of the same AAV, a non-AAV viral source, or a non-viral source). An artificial AAV can be, but is not limited to, a pseudotyped AAV capsid, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. A pseudotyped vector in which the capsid protein of one AAV is replaced with a heterologous capsid protein is useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotype vectors.Selected genetic elements can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA-coated pellet, viral infection, and protoplast fusion.The methods used to create such constructs are known to those skilled in nucleic acid manipulation, and include genetic engineering, recombinant engineering, and synthetic technology.See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0074] As used herein, "AAV9 capsid" refers to an AAV9 having (a) the amino acid sequence of GenBank Accession No. AAS99264 (incorporated herein by reference) (the AAV vp1 capsid protein is reproduced in SEQ ID NO: 17), and / or (b) the amino acid sequence encoded by the nucleotide sequence of GenBank Accession No. AY530579.1: (nt1...2211) (reproduced in SEQ ID NO: 16). Some variations from this coding sequence are encompassed by the present invention, and can include sequences having about 99% identity to the reference amino acid sequences in GenBank Accession Nos. AAS99264 and US7906111 (as well as WO2005 / 033321) (i.e., less than about 1% variation from the reference sequence). Such AAVs can include, for example, naturally occurring isolates (e.g., hu68, hu31, or hu32), or variants of AAV9 with amino acid substitutions, deletions, or additions (e.g., including but not limited to, amino acid substitutions selected from alternative residues "recruited" from corresponding positions in any other AAV capsid that aligns with the AAV9 capsid, such as those described in US9,102,949, US8,927,514, US2015 / 349911, WO2016 / 049230A1l, US9,623,120, US9,585,971). However, in other embodiments, other barrier proteins of AAV9 can be used. AAV9 capsid having at least about 95% identity with the above reference sequence may be selected.See, for example, US Patent Application Publication No. 2015 / 0079038.Methods for generating capsids, their coding sequences, and methods for producing rAAV viral vectors are described.See, for example, Gao, et al, Proc.Natl.Acad.Sci.USA100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0075] AAVhu68 differs from another phylogenetic group F virus, AAV9, by two encoded amino acids at positions 67 and 157 of vp1 (SEQ ID NO:9). In contrast, other phylogenetic group F AAVs (AAV9, hu31, hu31) have an Ala at position 67 and an Ala at position 157. Novel AAVhu68 capsids and / or engineered AAV capsids are provided that have a valine (Val or V) at position 157 and, optionally, a glutamic acid (Glu or E) at position 67 based on the numbering of SEQ ID NO:9. See also WO2018 / 160582 (including sequence listing), which is incorporated by reference in its entirety).

[0076] As used herein, the term "clade" in reference to a group of AAVs refers to a group of AAVs that are phylogenetically related to each other, based on an alignment of AAV vp1 amino acid sequences, with a bootstrap value of at least 75% (out of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less, as determined using a Neighbor-Joining algorithm. Neighbor-joining algorithms have been described in the literature. See, e.g., M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements a modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequence of the AAV vp1 capsid protein, one of skill in the art can readily determine whether a selected AAV falls within one of the clades identified herein, or within another clade outside of these clades. See, e.g., G Gao, et al, J. Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). See Virol 2004 Jun;78(10:6381-6388), which identifies phylogenetic groups A, B, C, D, E, and F, and provides nucleic acid sequences of novel AAVs (GenBank accession numbers AY530553-AY530629). See also WO2005 / 033321.

[0077] In certain embodiments, the AAV68 capsid is further characterized by one or more of the following: The AAVhu68 capsid protein is an AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:8, a vp1 protein produced from SEQ ID NO:9, or a vp1 protein produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:8 that encodes the predicted amino acid sequence of 1-736 of SEQ ID NO:9, an AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding at least about amino acids 138-736 of SEQ ID NO:9, vp2 protein, vp2 protein produced from a sequence including at least nucleotides 412-2211 of SEQ ID NO:8, or vp2 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 412-2211 of SEQ ID NO:8 encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:9, and / or AAVhu68 vp3 protein produced by expression from a nucleic acid sequence that encodes the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:9, vp3 protein produced from a sequence including at least nucleotides 607-2211 of SEQ ID NO:8, or vp2 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 412-2211 of SEQ ID NO:8 encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:9 The vp3 protein is produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO:8, which encodes the nucleic acid sequence.

[0078] The AAVhu68 vp1, vp2, and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence that encodes the full-length vp1 amino acid sequence of SEQ ID NO:9 (amino acids 1-736). Optionally, the vp1 coding sequence is used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence may be co-expressed with one or more of a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO:9 (about aa 203-736) without the vp1 unique region (about 1 to about 137) and / or the vp2 unique region (about aa 1 to about aa 202), or a complementary strand thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO:8), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:8 that encodes aa 203-736 of SEQ ID NO:9. Additionally or alternatively, the vp1 and / or vp2 coding sequences can be co-expressed with a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO:9 (about aa 1 to about 137) without the vp1 unique region (about aa 1 to about 137), or a complementary strand thereto, the corresponding mRNA or tRNA (nt 412 to 22121 of SEQ ID NO:8), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:8 that encodes about aa 138 to 736 of SEQ ID NO:9.

[0079] As described herein, rAAVhu68 has rAAVhu68 capsids produced in a production system expressing capsids from an AAVhu68 nucleic acid sequence encoding the vp1 amino acid sequence of SEQ ID NO:9, and, optionally, additional nucleic acid sequences (e.g., sequences encoding vp3 proteins without the vp1 and / or vp2 unique regions). rAAVhu68 resulting from production using a single nucleic acid sequence vp1 produces a heterogeneous population of vp1, vp2, and vp3 proteins. More specifically, AAVhu68 capsids include subpopulations within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO:9. These subpopulations include at least deamidated asparagine (N or Asn) residues. For example, the asparagine of an asparagine-glycine pair is highly deamidated.

[0080] In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO:8, or a complementary strand thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, vp2 and / or vp3 proteins may additionally or alternatively be expressed from a nucleic acid sequence different from vp1, e.g., to alter the ratio of vp proteins in a selected expression system. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO:9 (about aa203-736), or a complementary strand thereto, the corresponding mRNA or tRNA (about nt607 to about nt2211 of SEQ ID NO:8), without the vp1 unique region (about aa1 to about aa137) and / or the vp2 unique region (about aa1 to about aa202), is also provided. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO:9 (about aa 138-736) without the vp1 unique region (about aa 1 to about aa 137), or a complementary strand thereto, the corresponding mRNA or tRNA (nt 412-2211 of SEQ ID NO:8) is also provided.

[0081] However, other nucleic acid sequences that encode the amino acid sequence of SEQ ID NO:9 may be selected for use in producing the rAAVhu68 capsid. In certain embodiments, the nucleic acid sequence is The nucleic acid sequence has a nucleic acid sequence of SEQ ID NO: 8, or a sequence at least 70%-99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 8, and encodes SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence of SEQ ID NO: 8, or a sequence at least 70%-99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 8 from about nt 412 to about nt 2211, and encodes the vp2 capsid protein of SEQ ID NO: 9 (about aa 138-736). In certain embodiments, the nucleic acid sequence has a nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO:8, or a sequence that is at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to at least nt of SEQ ID NO:8, and encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO:9.

[0082] In certain embodiments, AAVhu68 capsids are produced using at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% of the sequence encoding the nucleic acid sequence of SEQ ID NO:8 or the vp1 amino acid sequence of SEQ ID NO:9 including modifications described herein (e.g., deamidated amino acids). In certain embodiments, the vp1 amino acid sequence is reproduced in SEQ ID NO:9.

[0083] As used herein, when used to refer to vp capsid proteins, the term "heterologous" or any grammatical variation thereof refers to a population of non-identical members, e.g., having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 9 provides the encoded amino acid sequence of the AAVhu68 vp1 protein. The term "heterologous" used in relation to vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of vp1, vp2, and vp3 proteins within the capsid. AAV capsids contain subpopulations within the vp1, vp2, and vp3 proteins, with modifications from predicted amino acid residues. These subpopulations include at least certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation contains at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs, and optionally further contains other deamidated amino acids, where the deamidation results in an amino acid change and any other modifications.

[0084] As used herein, a "subpopulation" of vp proteins, unless otherwise specified, refers to a group of vp proteins that have at least one defined common characteristic and that consists of at least one group member and fewer than all members of a reference group.

[0085] For example, a "subpopulation" of vp1 proteins is at least one (1) vp1 protein in an assembled AAV capsid, but less than all vp1 proteins, unless otherwise specified. A "subpopulation" of vp3 proteins can be one (1) vp3 protein, but less than all vp3 proteins, unless otherwise specified. For example, vp1 proteins can be a subpopulation of vp proteins, vp2 proteins can be a separate subpopulation of vp proteins, and vp3 can be a further subpopulation of vp proteins in an assembled AAV capsid. In another example, vp1, vp2, and vp3 proteins can include subpopulations with, for example, at least one, two, three, or four highly deamidated asparagines, e.g., different modifications at asparagine-glycine pairs.

[0086] Unless otherwise specified, high deamidation is the predicted amino acid at the reference amino acid position. It refers to at least 45% deamidation, at least 50% deamidation, at least 60% deamidation, at least 65% deamidation, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidation at a reference amino acid position compared to a sequence (e.g., at least 80% of the asparagine at amino acid 57 [AAVHu68] based on the numbering of SEQ ID NO:9 may be deamidated based on the total vp1 protein, or may be deamidated based on the total vp1, vp2, and vp3 proteins). Such percentages may be determined using 2D gels, mass spectrometry techniques, or other suitable techniques.

[0087] In the AAVhu68 capsid protein, four residues (N57, N329, N452, N512) routinely show deamidation levels of more than 70% across various lots, and in most cases, more than 90%. Additional asparagine residues (N94, N253, N270, N304, N409, N477, and Q599) also show deamidation levels of up to about 20% across various lots. Deamidation levels were initially identified using trypsin digestion and verified with chymotrypsin digestion.

[0088] AAVhu68 capsids contain subpopulations within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO: 9. These subpopulations contain at least certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations contain at least one, two, three, or four highly deamidated asparagine (N) positions in the asparagine-glycine pairs of SEQ ID NO: 9, and optionally further contain other deamidated amino acids, where deamidation results in an amino acid change and any other modifications.

[0089] In other embodiments, the method involves increasing the yield of rAAV and thus increasing the amount of rAAV present in the supernatant without the need for cell lysis or prior to cell lysis. The method involves engineering the AAV VP1 capsid gene to express a capsid protein with Glu at position 67, Val at position 157, or both, based on an alignment with amino acid numbering of the AAVhu68vp1 capsid protein. In other embodiments, the method involves engineering the VP2 capsid gene to express a capsid protein with Val at position 157. In yet other embodiments, the rAAV has a modified capsid and includes both vp1 and vp2 capsid proteins with Glu at position 67 and Val at position 157.

[0090] In certain embodiments, the rAAV described herein is a self-complementary AAV. "Self-complementary AAV" refers to a construct in which the coding region carried by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. During infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV assemble to form one double-stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, for example, DM McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated by reference in its entirety.

[0091] In certain embodiments, the rAAV described herein is nuclease resistant. Such nucleases can be a single nuclease or a mixture of nucleases, which can be endonucleases or exonucleases. Nuclease-resistant rAAV indicates that the AAV capsid is fully assembled and protects these packaged genomic sequences from degradation (digestion) during the nuclease incubation step designed to remove contaminating nucleic acids that may be present from the production process. In many cases, the rAAV described herein are DNase-resistant.

[0092] The recombinant adeno-associated virus (AAV) described herein can be produced using known techniques. For example, see WO2003 / 042397; WO2005 / 033321, WO2006 / 110689; US7588772B2. Such methods include culturing a host cell, which comprises a nucleic acid sequence encoding an AAV capsid, a functional rep gene, an expression cassette described herein flanked by AAV inverted terminal repeats (ITRs), and sufficient helper functions to allow the expression cassette to be packaged into AAV capsid proteins. Also provided herein is a host cell, which comprises a nucleic acid sequence encoding an AAV capsid, a functional rep gene, a vector genome described, and sufficient helper functions to allow the vector genome to be packaged into AAV capsid proteins. In one embodiment, the host cell is a HEK293 cell. These methods are described in further detail in WO2017 / 160360A2, which is incorporated herein by reference.

[0093] Other methods of producing rAAV available to those skilled in the art can also be used. Suitable methods can include, but are not limited to, baculovirus expression systems or yeast-mediated production. See, for example, Robert M. Kotin, Large-scale recombinant adeno-associated virus production. Hum Mol Genet.2011 Apr 15;20(R1):R2-R6.Published online 2011 Apr 29.doi:10.1093 / hmg / ddr141、Aucoin MG et al.,Production of adeno-associated viral vectors in insect cells using triple infection:optimization of baculovirus concentration ratios.BioTechnol Bioeng.2006 Dec 20;95(6):1081-92、SAMI S.THAKUR,Production of Recombinant Adeno-associated viral vectors in yeast.Thesis presented to the Graduate School of the University of Florida,2012、Kondratov O et al.Direct Head-to-Head Evaluation of Recombinant Adeno-associated Viral Vectors Manufactured in Human versus Insect Cells,Mol Ther.2017 Aug 10.pii:S1525-0016(17)30362-3.doi:10.1016 / j.ymthe.2017.08.003.[Epub ahead of print]、Mietzsch M et al,OneBac 2.0:Sf9 Cell Lines for Production of AAV1,AAV2,and AAV8 Vectors with Minimal Encapsidation of Foreign DNA.Hum Gene Ther Methods.2017 Feb;28(1):15-22.doi:10.1089 / hgtb.2016.164.、Li L et al.Production and characterization of novel recombinant adeno-associated virus replicative-form genomes:a eukaryotic source of DNA for gene transfer.PLoS One. 2013 Aug 1;8(8):e69879.doi:10.1371 / journal.pone.0069879.Print 2013, Galibert L et al, Latest developments in the large-scale production of adeno-associated virus vectors in insect cells toward the treatment of neuromuscular diseases. J Invertebr Pathol. 2011 Jul;107 Suppl:S80-93. doi:10.1016 / j.jip.2011.05.008; and Kotin RM, Large-scale recombinant adeno-associated virus production. Hum Mol Genet. 2011 Apr 15;20(R1):R2-6. doi:10.1093 / hmg / ddr141. Epub 2011 Apr 29.

[0094] A two-step high salt affinity chromatography purification, followed by anion exchange resin chromatography, is used to purify the vector drug product and remove empty capsids. These methods are described in "Scalable Purification Methods." This method is described in further detail in WO 2017 / 160360, entitled "A method for separating rAAV9 particles having packaged genome sequences from genome-defective AAV9 intermediates," incorporated herein by reference. Briefly, the method for separating rAAV9 particles having packaged genome sequences from genome-defective AAV9 intermediates involves subjecting a suspension containing recombinant AAV9 viral particles and AAV9 capsid intermediates to high performance liquid chromatography, in which the AAV9 viral particles and AAV9 intermediates are bound to a strong anion exchange resin equilibrated at a pH of 10.2 and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 and about 280. The pH may range from about 10.0 to 10.4, although less optimal for rAAV9. In this method, AAV9 complete capsids are recovered from the fraction that elutes when the ratio of A260 / A280 reaches the infection point. In one example, for an affinity chromatography step, the diafiltered product may be applied to Capture Select™ Poros-AAV2 / 9 affinity resin (Life Technologies), which efficiently captures the AAV2 / 9 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flows through the column, and the AAV particles are efficiently captured.

[0095] Conventional methods for characterization or quantification of rAAV are available to those skilled in the art. To calculate empty and full particle content, the VP3 band volume for a selected sample (e.g., in the examples herein, iodixanol gradient-purified preparation, where number of GC = number of particles) is plotted against the GC particles loaded. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test article peak. The number of particles (pt) per 20 μL loaded is then multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the ratio of particles to genome copies (pt / GC). Pt / mL to GC / mL gives empty pt / mL. Empty pt / mL is divided by pt / mL and then multiplied by 100 to obtain the percentage of empty particles. In general, assay methods for AAV vector particles with empty capsids and packaged genomes are well known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer See, e.g., et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method involves subjecting the processed AAV stock to SDS-polyacrylamide gel electrophoresis in any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in buffer, then running the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon. Anti-A The AV capsid antibody is then used as the primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Viral. (2000) 74:9281-9293). A secondary antibody is then used that binds to the primary antibody and includes a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively measure the binding between the primary and secondary antibodies, a method for detecting binding is used, preferably a detection method capable of detecting radioisotope radiation, electromagnetic radiation, or color change, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions may be collected and heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and capsid proteins are resolved on a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, i.e., SYPRO Ruby or Coomassie staining. In one embodiment, the concentration of AAV vector genome (vg) in column fractions can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is further diluted and amplified using a TaqMan™ fluorogenic probe specific for the primers and the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as that contained in the AAV vector is used to generate a standard curve in the Q-PCR reaction.The cycle threshold (Ct) value obtained from the sample is used to determine the vector genome titer by normalizing it to the Ct value of a plasmid standard curve. Digital PCR-based endpoint assays can also be used.

[0096] In one embodiment, an optimized q-PCR method utilizing a broad-spectrum serine protease, such as Protease K (e.g., commercially available from Qiagen), is used. More specifically, the optimized qPCR genomic titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with Protease K buffer and treated with Protease K, followed by heat inactivation. Suitably, the sample is diluted with an amount of Protease K buffer equal to the sample size. The Protease K buffer may be concentrated 2-fold or more. Typically, the Protease K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55° C. for about 15 minutes, but may be carried out at lower temperatures (e.g., about 37° C. to about 50° C.) for longer periods (e.g., about 20 minutes to about 30 minutes), or at higher temperatures (e.g., up to about 60° C.) for shorter periods (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95° C. for about 15 minutes, but may be performed at lower temperatures (e.g., about 70 to about 90° C.) and for longer periods (e.g., about 20 minutes to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described for standard assays.

[0097] Additionally or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for measuring single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al., Hu et al., See Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi:10.1089 / hgtb.2013.131. Epub 2014 Feb 14.

[0098] Methods are also available for determining the ratio of capsid proteins vp1, vp2, and vp3. See, e.g., Vamseedhar Rayaprolu et al, Comparative Analysis of Adeno-Associated Virus Capsid Stability and Dynamics, J Virol. 2013 Dec;87(24):13150-13160; Buller RM, Rose JA. 1978. Characterization of adenovirus-associated virus-induced polypeptides in KB cells. J. Virol. 25:331-338; and Rose See JA, Maizel JV, Inman JK, Shatkin AJ. 1971. Structural proteins of adenovirus-associated viruses. J. Virol. 8:766-770.

[0099] It is to be understood that the compositions in the rAAV described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0100] 4. Pharmaceutical Compositions The pharmaceutical composition comprising the expression cassette comprising the transgene and the miRNA target sequence may be a liquid suspension, a lyophilized or frozen composition, or another suitable formulation. In certain embodiments, the composition comprises the expression cassette and a physiologically compatible liquid (e.g., a solution, diluent, carrier) that forms a suspension. Such liquid is preferably aqueous and may include one or more buffering agent(s), surfactant(s), pH adjusting agent(s), preservative(s), or other suitable excipient(s). Suitable components are discussed in more detail below. The pharmaceutical composition comprises an aqueous suspension and any selected excipients, and the expression cassette.

[0101] The expression cassette comprising transgene and miRNA target sequence is as described throughout the present specification.For example, the expression cassette can be a nucleic acid sequence, and comprises: (a) a coding sequence of a gene product under the control of a regulatory sequence that directs the expression of the gene product in the cell that contains the recombinant virus; (b) a regulatory sequence that directs the expression of the gene product in the cell; (c) a 5' untranslated region (UTR) sequence that is 5' of the coding sequence; (d) a 3'UTR sequence that is 3' of the coding sequence; and e) at least two tandem dorsal root ganglion (DRG) specific miRNA target sequences, and the at least two miRNA target sequences comprise at least one first miRNA target sequence and at least one second miRNA target sequence that can be the same or different.

[0102] In certain embodiments, the pharmaceutical composition comprises an expression cassette, which comprises a transgene and a miRNA target sequence, and a non-viral delivery system, which may include, for example, naked DNA, naked RNA, inorganic particles, lipid or lipid-like particles, chitosan-based formulations, and others known and described in the art (e.g., as exemplified by Ramamoorth and Narvekar, cited above).

[0103] In other embodiments, the pharmaceutical composition is a suspension containing an expression cassette (including a transgene and a miRNA target sequence) engineered in a non-viral or viral vector system. Such non-viral vector systems may include, for example, plasmids or non-viral genetic elements, or protein-based vectors.

[0104] In certain embodiments, the pharmaceutical composition comprises a non-replicating viral vector. A suitable viral vector may be any suitable delivery vector, such as a recombinant adenovirus, a recombinant lentivirus, a recombinant bocavirus, a recombinant adeno-associated virus (AAV), or another recombinant In certain embodiments, the viral vector is a recombinant AAV for delivery of a gene product to a patient in need thereof.

[0105] In one embodiment, the pharmaceutical composition comprises an expression cassette, including a transgene and a miRNA target sequence, and a formulation buffer suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection. In one embodiment, the expression cassette including the transgene and the miRNA target sequence is packaged into a recombinant AAV.

[0106] In one embodiment, the compositions provided herein include surfactants, preservatives, excipients, and / or buffers dissolved in an aqueous suspension. In one embodiment, the buffer is PBS. In another embodiment, the buffer is artificial cerebrospinal fluid (aCSF), such as Elliot's buffer, or Harvard apparatus perfusate (artificial CSF with final ionic concentrations (mM): Na 150, K 3.0, Ca 1.4, Mg 0.8, P 1.0, Cl 155). A variety of suitable solutions are known, including solutions that include one or more of buffered saline, surfactant, and physiologically compatible salts or mixtures of salts (adjusted to an ionic strength of about 100 mM sodium chloride (NaCl) to about 250 mM sodium chloride equivalent), or physiologically compatible salts adjusted to equivalent ionic concentrations.

[0107] Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6 to 8, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. The pH of cerebrospinal fluid is about 7.28 to about 7.32, so for intrathecal delivery, a pH within this range is desirable, while for intravenous delivery, a pH of 6.8 to about 7.2 may be desirable. However, other pHs in the broader range, and subranges of these, may be selected for other delivery routes.

[0108] A suitable surfactant or combination of surfactants can be selected from among non-toxic non-ionic surfactants. In one embodiment, a primary hydroxyl terminated bifunctional block copolymer surfactant is selected, such as Pluronic® F68 [BASF], also known as Poloxamer 188, with neutral pH and average molecular weight of 8400. Other surfactants and other poloxamers can be selected, i.e., a non-ionic triblock copolymer consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycapric acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using the letter "P" (for poloxamer) followed by three digits, the first two digits x 100 giving the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 giving the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.

[0109] In one example, the formulation can contain a buffered saline solution, for example, including one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate 7H2O), potassium chloride, calcium chloride (e.g., calcium chloride·2H2O), dibasic sodium phosphate, and mixtures thereof, in water. Suitably, for intrathecal delivery, the osmolality is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290), see, e.g., emedicine.medscape.com / article / 2093316-overview. Optionally, for intrathecal delivery, commercially available diluents can be used as suspending agents or or in combination with another suspending agent and any other excipients, see, for example, Elliotts B® solution [Lukare Medical].

[0110] In other embodiments, the formulation may contain one or more penetration enhancers. Examples of suitable penetration enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0111] Further provided are pharmaceutical compositions, comprising a pharma- ceutically acceptable carrier and a vector comprising a nucleic acid sequence as described herein. As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharma- ceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like can be used to introduce the compositions of the present invention into suitable host cells. In particular, the rAAV vectors can be formulated for delivery either encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, and the like. In one embodiment, a therapeutically effective amount of the vector is included in the pharmaceutical composition. The choice of carrier does not limit the invention. Other conventional pharma- ceutical acceptable carriers, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0112] The phrase "pharmacologically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host.

[0113] As used herein, the term "dosage" or "amount" can refer to the total dosage or amount delivered to a subject over the course of treatment, or the dosage or amount delivered in a single unit (or multiple units or divided doses) administration.

[0114] The aqueous suspensions or pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or combination of different routes.

[0115] In one embodiment, the pharmaceutical composition is formulated for delivery via intracerebroventricular (ICV), intrathecal (IT) or intracisternal injection. In one embodiment, the composition described herein is designed for delivery to a subject in need thereof by intravenous injection. Alternatively, other administration routes (e.g., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular and other parenteral routes) may be selected.

[0116] As used herein, the term "intracyanal delivery" or "intracyanal administration" refers to the route of administration of a drug via injection into the spinal canal, more specifically into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular, suboccipital / intracyanal, and / or C1-2 puncture. For example, the material may be introduced by lumbar puncture to diffuse across the subarachnoid space. In another example, the injection may be intracisternal. Intracisternal delivery may increase vector diffusion and / or reduce toxicity and inflammation caused by administration. See, for example, Christian Hinderer et al, Widespread gene transfer in the central nervous system of cynomolgus macaques, es following delivery of AAV9 into the cisterna magna, Mol Ther Methods Clin Dev. 2014;1:14051. Published online 2014 Dec 10. doi:10.1038 / mtm.2014.51.

[0117] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to the administration of a drug directly into the cerebrospinal fluid of the ventricles or within the cisterna magna, more specifically, by suboccipital puncture or by direct injection into the cisterna magna, or by a permanently placed tube.

[0118] In one aspect, a pharmaceutical composition is provided herein, comprising a vector as described herein in a formulation buffer. In a specific embodiment, the replication-defective virus composition is about 1.0×10 for a human patient, including all integers or fractions within the range. 9 GC~approx. 1.0×10 16 GC (to treat an average subject weighing 70 kg), preferably 1.0 × 10 12 GC~1.0×10 14 The dosage units can be formulated to contain a quantity of replication-defective virus in the range of GC. In one embodiment, the composition contains at least 1×10 per dose, including all integers or fractions within the range. 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10, 8×10 10 , or 9×10 10 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 15, 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 In one embodiment, for human applications, the dose is 1×10 per dose, including all integers or fractions within the range. 10 ~Approx. 1×10 12 It may be in the GC range.

[0119] In one embodiment, a pharmaceutical composition is provided, comprising a rAAV as described herein in a formulation buffer. In one embodiment, the rAAV is about 1×10 9 Genome copies (GC) / mL ~ approx. 1 x 10 14 In a further embodiment, the rAAV is formulated at about 3×10 9 GC / mL ~ approx. 3×10 13 In yet a further embodiment, the rAAV is formulated at about 1×10 9 GC / mL ~ approx. 1×10 13 In one embodiment, the rAAV is formulated at a concentration of at least about 1×10 11 In one embodiment, the pharmaceutical composition comprising the rAAV described herein is formulated at about 1×10 GC / mL per gram of brain mass. 9 GC ~ approx. 1 × 10 per gram of brain mass 14 It is administered in the dose of GC.

[0120] In certain embodiments, the compositions are formulated in suitable aqueous suspensions for delivery by any suitable route. The compositions provided herein are useful for systemic delivery of high doses of viral vectors. For rAAV, a high dose is at least 1×10 13 GC, or at least 1 × 10 14However, for improved safety, the miRNA sequences provided herein may be included in expression cassettes and / or vector genomes delivered at other lower doses.

[0121] In certain embodiments, the composition is delivered by two different routes essentially simultaneously.

[0122] It is to be understood that the compositions in the pharmaceutical compositions described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0123] 5.Treatment method In certain embodiments, the compositions provided herein are useful for delivering a desired transgene product to a patient while suppressing transgene expression in dorsal root ganglion neurons. The method involves delivering to a patient a composition comprising an expression cassette that includes a transgene and a miRNA target sequence.

[0124] Examples of suitable transgenes are useful for treating one or more neurodegenerative disorders, including, but not limited to, transmissible spongiform encephalopathies (e.g., Creutzfeldt-Jakob disease), Duchenne muscular dystrophy (DMD), myotubular and other myopathies, Parkinson's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Alzheimer's disease, Huntington's disease, Canavan disease, traumatic brain injury, spinal cord injury (ATI335, anti-nogo1 by Novartis), migraine (ALD403 by Alder Biopharmaceuticals, LY2951742 by Eli, RN307 by Labrys Biologics), lysosomal storage diseases, stroke, and infections affecting the central nervous system. Examples of lysosomal storage diseases include, for example, Gaucher disease, Fabry disease, Niemann-Pick disease, Hunter syndrome, glycogen storage disease II (Pompe disease), or Tay-Sachs disease. For some of these conditions (e.g., DMD and myopathies), the compositions provided herein are useful for reducing or eliminating axonopathy associated with skeletal and cardiac muscle transduction or high doses of expression cassettes for the invention (e.g., delivered by viral vectors).

[0125] Still other nucleic acids may code for immunoglobulins directed against leucine-rich repeat and immunoglobulin-like domain-containing protein 1 (LINGO-1), a functional component of the Nogo receptor and associated with essential tremor in patients with multiple sclerosis, Parkinson's disease or essential tremor. One such commercially available antibody is ocrelizumab (Biogen, BIIB033). See, for example, U.S. Patent No. 8,425,910. In one embodiment, the nucleic acid construct codes for an immunoglobulin construct useful for patients with ALS. Examples of suitable antibodies include antibodies against the ALS enzyme superoxide dismutase 1 (SOD1) and variants thereof (e.g., ALS variant G93A, C4F6 SOD1 antibody), MS785 (directed against the darling-1 binding region), antibodies against neurite outgrowth inhibitors (NOGO-A or reticulon 4) (e.g., GSK1223249, ozanezumab (humanized, GSK, also described as useful for multiple sclerosis). Nucleic acid sequences may be designed or selected to encode immunoglobulins useful in patients with Alzheimer's disease. Such antibody constructs include, for example, adumanucab (Biogen), bapineuzumab (Elan, a humanized mAb directed against the amino terminus of Aβ), solanezumab (Eli Lilly, a humanized mAb against the central part of soluble Aβ), gantenerumab (Chugai and Hoffmann-La Roch e, a fully human mAb directed against both the amino terminus and the central portion of Aβ), crenezumab (Genentech, a humanized mAb acting on monomeric and conformational epitopes, including oligomeric and protofibrillar forms of Aβ), BAN2401 (Esai Co.,Ltd, a humanized immunoglobulin G1 (IgG1) mAb that selectively binds to Aβ protofibrils, believed to promote the clearance of Aβ protofibrils and / or neutralize their toxic effects on neurons in the brain), GSK933776 (a humanized IgG1 monoclonal antibody directed to the amino terminus of Aβ), AAB-001, AAB-002, AAB-003 (Fc-engineered bapineuzumab), SAR228810 (a humanized mAb directed to protofibrils and low molecular weight Aβ), BIIB037 / BART (fully human IgG1 against insoluble fibrillar human Aβ, Biogen Idec), anti-Aβ antibodies such as m266, tg2576 (relative specificity for Aβ oligomers) [Brody and Holtzman, Annu Rev Neurosci, 2008;31:175-193]. Other antibodies may target β-amyloid protein, Aβ, β-secretase, and / or tau protein. In yet other embodiments, the anti-β-amyloid antibody is derived from an IgG4 monoclonal antibody targeting β-amyloid to minimize effector function, or a construct other than scFv is selected that lacks an Fc region to avoid amyloid-associated imaging abnormalities (ARIA) and inflammatory responses. In some of these embodiments, one or more heavy and / or light chain variable regions of the scFv construct are used in another suitable immunoglobulin construct provided herein. These scFVs and other engineered immunoglobulins may reduce the half-life of the immunoglobulin in serum compared to immunoglobulins that contain an Fc region. Reducing the serum concentration of anti-amyloid molecules may further reduce the risk of ARIA, as very high levels of anti-amyloid antibodies in serum may destabilize cerebral blood vessels with high loads of amyloid plaques and cause vascular permeability.Nucleic acids encoding other immunoglobulin constructs for the treatment of patients with Parkinson's disease can be engineered or designed to express constructs including, for example, leucine-rich repeat kinase 2, Dardarin (LRRK2) antibodies, anti-synuclein and alpha-synuclein antibodies, and DJ-1 (PARK7) antibodies. Other antibodies can include PRX002 (Prothena and Roche) Parkinson's disease and related synucleinopathies. These antibodies, particularly anti-synuclein antibodies, can also be useful in the treatment of one or more lysosomal storage diseases.

[0126] Nucleic acid constructs encoding immunoglobulin constructs for treating multiple sclerosis can be engineered or selected. Such immunoglobulins can include or be derived from natalizumab (humanized anti-a4-integrin, iNATA, Tysabri, Biogen Idec and Elan Pharmaceuticals, approved in 2006), alemtuzumab (Campus-1H, humanized anti-CD52), rituximab (Ritujin, chimeric anti-CD20), daclizumab (Zenapax, humanized anti-CD25), ocrelizumab (humanized, anti-CD20, Roche), ustekinumab (CNTO-1275, human anti-IL12p40+IL23p40), anti-LINGO-1 and ch5D12 (chimeric anti-CD40), and rHIgM22 (remyelinating monoclonal antibody, Acorda and Mayo Foundation for Medical Education and Research), etc. Still other anti-α4-integrin antibodies, anti-CD20 antibodies, anti-CD52 antibodies, anti-IL17 antibodies, anti-CD19 antibodies, anti-SEMA4D antibodies, and anti-CD40 antibodies can be delivered via the AAV vectors described herein.

[0127] Antibodies against various infectious diseases of the central nervous system are also contemplated by the present invention. Such infectious diseases include fungal diseases (e.g., cryptococcal meningitis, brain abscesses, spinal epidural infections, e.g., Cryptococcus neoformans, Coccidioides immitis, Mucorales, Aspergillus species, and Ca ndida species), protozoal diseases (such as toxoplasmosis, malaria, and primary amebic meningoencephalitis caused by the pathogens Toxoplasma gondii, Taenia solium, Plasmodium falciparus, Spirometra mansonoides (sparganosis), Echinococcus species (the etiology of neurohydatid disease), as well as cerebral amebiasis), bacterial diseases (such as tuberculosis, leprosy, neurosyphilis, bacterial meningitis, Lyme disease (Borrelia burgdorferi), Rocky Mountain spotted fever (Rickettsia rickettsia), CNS nocardiosis (Nocardia species), CNS tuberculosis (Mycobacterium tuberculosis), CNS listeriosis (Listeria monocytogenes), brain abscess, and neuroborreliosis), viral infections (e.g., viral meningitis, Eastern equine encephalitis (EEE), St. Louis encephalitis, West Nile virus and / or encephalitis, rabies, California encephalitis virus, La Crosse encephalitis, measles encephalitis, poliomyelitis, etc. These include, for example, herpes family viruses (HSV), HSV-1, HSV-2 (neonatal herpes simplex encephalitis), varicella zoster virus (VZV), Bickerstaff encephalitis, Epstein-Barr virus (EBV), cytomegalovirus (CMV, TCN-202 and others being developed by Theraclone Sciences), human herpesvirus 6 (HHV-6), B virus (herpesvirus simiae), flaviviral encephalitis, Japanese encephalitis, Murray Valley fever, JC virus (progressive multifocal leukoencephalopathy), Nipah virus (NiV), measles virus (subacute sclerosing panencephalitis), and other infectious diseases (e.g., subacute sclerosing panencephalitis, progressive multifocal leukoencephalopathy, human immunodeficiency virus (acquired immune deficiency syndrome (AIDS)), Streptococcus pyogenes, and other beta-hemolytic streptococci (e.g., pediatric autoimmune streptococcal infection-associated neuropsychiatric disorder (PANDAS)) and / or Sydenham's chorea, and Guillain-Barré syndrome, and prions).

[0128] Examples of suitable antibody constructs may include, for example, those described in WO2007 / 012924A2 (29 January 2015), which is incorporated herein by reference.

[0129] For example, other nucleic acid sequences may code for anti-prion immunoglobulin constructs. Such immunoglobulins may be directed against the major prion protein (PrP, for prion protein or protease-resistant protein), also known as CD230 (cluster of differentiation 230). The amino acid sequence of PrP is provided, for example, at http: / / www.ncbi.nlm.nih.gov / protein / NP_000302, which is incorporated herein by reference. The protein may exist in multiple isoforms, including normal PrP, disease-causing PrP, and mitochondrially located isoforms. Misfolded versions of PrP have been linked to various cognitive disorders and neurodegenerative diseases, such as Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, and kuru.

[0130] Examples of suitable gene products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis, and rare or orphan diseases. Examples of such rare diseases may include spinal muscular atrophy (SMA), Huntington's disease, Rett syndrome (e.g., methyl-CpG binding protein 2 (MeCP2), UniProtKB-P51608), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy, Friedreich's ataxia (e.g., frataxin), progranulin (PRGN) (associated with non-Alzheimer's brain degeneration, including frontal dementia (FTD), progressive non-fluent aphasia (PNFA), and semantic dementia), and the like. Other useful gene products include carbamoyl synthetase I, ornithine transcarbamylase (OTC), argininosuccinic acid ... arginase, argininosuccinate lyase (ASL) for the treatment of argininosuccinate lyase deficiency, arginase, fumaroacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, rhesus alpha-fetoprotein (AFP), rhesus chorionic gonadotropin (CG), glucose-6-phosphatase, porphobilinogen deaminase, cystathionine beta-synthase, branched-chain keto acid decarboxylase, albumin, isobacterial These include lysyl-CoA dehydrogenase, propionyl-CoA carboxylase, methylmalonyl-CoA mutase, glutaryl-CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, cystic fibrosis transmembrane regulator (CFTR) sequence, and dystrophin gene product (e.g., mini- or micro-dystrophin). Still other useful gene products include enzymes that can be useful for enzyme replacement therapy, which is useful in various conditions caused by insufficient enzyme activity. For example, enzymes that contain mannose-6-phosphate can be used to treat lysosomal storage diseases (e.g., suitable genes include the gene that codes for β-glucuronidase (GUSB)).

[0131] Additional exemplary genes that can be delivered via rAAV include, but are not limited to, glucose-6-phosphatase (associated with glycogen storage disease or type 1A deficiency (GSD1)), phosphoenolpyruvate carboxykinase (PEPCK, associated with PEPCK deficiency, cyclin-dependent kinase-like 5 (CDKL5, also known as serine / threonine kinase 9 (STK9), associated with seizures and severe neurodevelopmental disorders, galactose-1-phosphate uridyltransferase (associated with galactosemia), phenylalanine hydroxylase (associated with phenylketonuria (PKU)), branched-chain alpha ketoacid dehydrogenase (associated with maple syrup urine disease), fumarylacetoacetate hydrolase (associated with tyrosinemia type 1), methylmalonyl-CoA mutase (associated with methylmalonic acidemia), medium-chain acyl-CoA dehydrogenase (associated with medium-chain acetylcholinesterase), and methylmalonyl-CoA mutase (associated with methylmalonic acidemia). CoA deficiency), ornithine transcarbamylase (OTC, associated with ornithine transcarbamylase deficiency), argininosuccinate synthetase (ASS1, associated with citrullinemia), lecithin-cholesterol acyltransferase (LCAT, deficiency), methylmalonic acidemia (MMA), Niemann-Pick disease, type C1), propionic acidemia (PA), low-density lipoprotein receptor (LDLR) protein (associated with familial hypercholesterolemia (FH)), UDP-glucuronosyltransferase (associated with Crigler-Najjar disease), adenosine deaminase (associated with severe combined immunodeficiency), hypoxanthine guanine phosphoribosyltransferase (associated with gout and Lesch-Nyhan syndrome), biotin (associated with biotin deficiency), alpha-galactosidase A (a-GalA, associated with Fabry disease), ATP7B (associated with Wilson disease), β-glucocerebrosidase (associated with Gaucher disease types 2 and 3), peroxisomal membrane protein 70 kDa (associated with Zellweger syndrome), arylsulfatase A (ARSA, associated with metachromatic leukodystrophy), galactocerebrosidase (GALC, an enzyme associated with Krabbe disease), α-glucosidase (GAA, associated with Pompe disease), sphingomyelinase (SMPD1, a gene associated with Niemann-Pick disease type A), argininosuccinate synthase (associated with adult-onset type II citrullinemia (CTLN2)), carbamoyl phosphate synthase 1 (C PS1, associated with urea cycle disorders), survival motor neuron (SMN) protein (associated with spinal muscular atrophy), ceramidase (associated with Farber lipogranulomatosis), β-hexosaminidase (associated with GM2 gangliosidosis, Tay-Sachs disease, and Sandhoff disease), aspartylglucosaminidase (associated with aspartylglucosaminuria), a-fucosidase (associated with fucosidosis), α-mannosidase (associated with α-mannosidosis), porphobilinogen deaminase (associated with acute intermittent porphyria (AIP)), α-1 antitrypsin (for the treatment of α-1 antitrypsin deficiency (emphysema)), erythropoietin thalassemia or renal failure), vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor (for the treatment of ischemic disease), thrombomodulin and tissue factor pathway inhibitor (for the treatment of blocked blood vessels, e.g., as seen in atherosclerosis, thrombosis, or embolism), aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) (for the treatment of Parkinson's disease), beta-adrenergic receptors, antisense to phospholamban or its variants, sarco(endoplasmic reticulum) adenosine triphosphatase-2 (SERCA2), and cardiac adenylate cyclase (for the treatment of congestive heart failure), tumor suppressor genes (such as p53, for the treatment of various cancers), cytokines (including various interleukins for the treatment of inflammatory and immune disorders and cancer), dystrophin or mini-dystrophin and utrophin or mini-utrophin (for the treatment of muscular dystrophies), and insulin or GLP-1 (for the treatment of diabetes). Additional genes and diseases of interest include, for example, SCN9A-related diseases such as dystonin gene-related diseases, such as hereditary sensory and autonomic dystonia type VI (the DST gene codes for dystonin, dual AAV vectors may be required due to the size of the protein (approximately 7570 aa), loss of function variants resulting in an inability to feel pain, and gain of function variants causing pain conditions such as erythromelalgia. Another condition is Charcot-Marie-Tooth types 1F and 2E due to mutations in the NEFL gene (neurofilament light chain). It is characterized by a progressive peripheral motor and sensory neuropathy with variable clinical and electrophysiological manifestations. In certain embodiments, the vectors described herein may be used in the treatment of mucopolysaccharidosis (MPS) disorders.Such vectors may include those carrying a nucleic acid sequence encoding alpha-L-iduronidase (IDUA) for treating MPS I (Hurler, Hurler-Scheie and Scheie syndromes), a nucleic acid sequence encoding iduronate-2-sulfatase (IDS) for treating MPS II (Hunter syndrome), a nucleic acid sequence encoding sulfamidase (SGSH) for treating MPS III A, B, C, and D (Sanfilippo syndrome), a nucleic acid sequence encoding N-acetylgalactosamine-6-sulfate sulfatase (GALNS) for treating MPS IV A and B (Morquio syndrome), a nucleic acid sequence encoding arylsulfatase B (ARSB) for treating MPS VI (Maroteaux-Lamy syndrome), a nucleic acid sequence encoding hyaluronidase for treating MPS I IX (hyaluronidase deficiency), and a nucleic acid sequence encoding beta-glucuronidase for treating MPS VII (Sly syndrome). See, e.g., www.orpha.net / consor / cgi-bin / Disease_Search_List.php;rarediseases.info.nih.gov / diseases.

[0132] Other examples of suitable genes can include, for example, hormones and growth and differentiation factors, including, but not limited to, insulin, glucagon, glucagon-like peptide-1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO) (including, for example, human, canine, or feline EPO), connective tissue growth factor (CTGF), neurotrophic factors, such as basic fibroblast growth factor. (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin-like growth factor I and II (IGF-I and IGF-II), any one of the transforming growth factor α superfamily (including TGFα, activin, and inhibin), or any one of the bone morphogenetic proteins (BMPs) BMP1-15, any one of the growth factors in the heregulin / neuregulin / ARIA / neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell proliferation factor (GLP), glial cell death factor (LSF), glial cell death factor (LSD ... These include glial cell-derived neurotrophic factor (GDNF), neurturin, agrin, any one of the semaphorin / collapsin family, netrin 1 and netrin 2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.

[0133] Other useful transgene products include proteins that regulate the immune system, including, but not limited to, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL), IL-1 through IL-36 (e.g., human interleukins IL-1, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL-35), monocyte chemotactic protein, leukemia inhibitory factor, granulocyte macrophage colony stimulating factor, Fas ligand, tumor necrosis factors α and β, interferon α, β, and γ, stem cell factor, flk-2 / flt3 ligand. Gene products produced by the immune system are also useful in the present invention. These include, but are not limited to, immunoglobulins IgG, IgM, IgA, IgD, and IgE, chimeric immunoglobulins, humanized antibodies, single-chain antibodies, T cell receptors, chimeric T cell receptors, single-chain T cell receptors, class I and class II MHC molecules, and engineered immunoglobulins and MHC molecules. For example, in certain embodiments, rAAV antibodies can be designed to deliver dog or cat antibodies, such as, for example, anti-IgE, anti-IL31, anti-CD20, anti-NGF, anti-GnRH. Useful gene products also include complement regulatory proteins, such as complement regulatory proteins, membrane cofactor proteins (MCPs), decay accelerating factors (DAFs), CR1, CF2, CD59, and C1 esterase inhibitors (C1-INH). Still other useful gene products include any one of the receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins, and immune system proteins. The present invention encompasses receptors for cholesterol control and / or lipid regulation, including the low density lipoprotein (LDL) receptor, the high density lipoprotein (HDL) receptor, the very low density lipoprotein (VLDL) receptor, and scavenger receptors. The present invention also encompasses gene products such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors and other nuclear receptors.Additionally, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box binding proteins, interferon regulatory factors (IRF-1), Wilms tumor proteins, ETS binding proteins, STATs, GATA box binding proteins such as GATA-3, and the forkhead family of winged helix proteins.

[0134] Methods for sequencing proteins, peptides, or polypeptides (e.g., as immunoglobulins) are known to those of skill in the art. Once the protein sequence is known, there are web-based and commercially available computer programs, as well as service-based companies, that will reverse-translate the amino acid sequence into a nucleic acid coding sequence. See, for example, reverse-translated sequences by EMBOSS (available at www.ebi.ac.uk / Tools / st / ), Gene Infinity (available at geneinfinity.org / sms / sms_backtranslation.html), and ExPasy (available at expasy.org / tools / ). In one embodiment, the RNA and / or cDNA coding sequence is designed for optimal expression in human cells.

[0135] In certain embodiments, the compositions provided herein are useful in methods for modulating neurodegeneration and / or reducing secondary dorsal spinal cord axon degeneration following intrathecal or systemic gene therapy administration. Thus, the compositions provided herein are useful in methods for modulating neurodegeneration and / or reducing secondary dorsal spinal cord axon degeneration following intrathecal or systemic gene therapy administration to the CNS. Although these methods are particularly useful for delivery, they may also be useful for other delivery routes, including, for example, systemic IV delivery, where high doses of gene therapy may result in DRG transduction and toxicity. The methods involve delivering a composition to a patient that includes an expression cassette or vector genome that includes a transgene and miRNA target(s).

[0136] In certain embodiments, the compositions provided herein are useful for a method of suppressing transgene expression in DRG.In certain embodiments, the method comprises delivering an expression cassette or vector genome comprising miR-183 target sequence to suppress the expression level of transgene in DRG.In certain embodiments, the method enhances expression in one or more cells present in CNS selected from one or more of pyramidal neurons, Purkinje neurons, granule cells, spindle neurons, interneurons, astrocytes, oligodendrocytes, microglia, and / or ependymal cells.

[0137] In certain embodiments, methods useful for delivering and / or enhancing expression of a transgene in lower motor neurons of the retina, inner ear, and olfactory receptors are provided, comprising delivering an expression cassette or vector genome comprising a transgene operably linked to one or more miR-183 target sequences and / or a plurality of miR-183 target sequences. In certain embodiments, the cell or tissue may be one or more of the liver or heart.

[0138] In yet another embodiment, a method is provided that includes delivering an expression cassette or vector genome to a cell present in the CNS, the expression cassette or vector genome comprising one or more miR-183 target sequences and lacking a transgene (i.e., a sequence encoding a heterologous gene product). In such an embodiment, delivery of miR-183 to a cell of the CNS is achieved. In certain embodiments, delivery of an expression cassette or vector genome comprising miR-183 sequences results in suppression of DRG expression and enhancement of gene expression in certain other cells present in the CNS.

[0139] In certain embodiments, the compositions provided herein are useful in methods for enhancing expression of transgenes in cells other than CNS. In certain embodiments, the method for enhancing expression in cells other than CNS comprises delivering an expression cassette or vector genome comprising miR-182 target sequence to a patient.

[0140] In one embodiment, the suspension has a pH of about 6.8 to about 7.32.

[0141] Suitable volumes and concentrations for the delivery of these doses can be determined by one of skill in the art. For example, a volume of about 1 μL to 150 mL may be selected, although higher volumes may be selected for adults. Typically, for newborns, a suitable volume may be selected from about 0.5 mL to about 10 mL, and for older infants, from about 0.5 mL to about 15 mL. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, patients may receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. Dosages may be adjusted to balance therapeutic benefit against any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized.

[0142] In one embodiment, a composition comprising an rAAV as described herein has a concentration of about 1×10 per gram of brain mass. 9 GC ~ approx. 1 × 10 per gram of brain mass 14 In certain embodiments, the rAAV is administered at a dose of about 1 x 10 GC per kg of body weight. 9 GC ~ approx. 1 x 10 per kg of body weight 13 It is co-administered systemically at the GC dose.

[0143] In one embodiment, the subject is delivered a therapeutically effective amount of the expression cassette described herein. As used herein, "therapeutically effective amount" refers to the amount of expression cassette that is delivered to and expressed in target cells and that contains nucleic acid sequences that code for gene products and miRNA target sequences that specifically detarget DRG expression.

[0144] The use of rAAV to deliver for the treatment of various pathologies has been described previously. The expression cassettes of these rAAVs can be modified to include the miRNA target sequences described herein (e.g., including miR-183 target sequences, miR-182 target sequences and miR-96 target sequences, or combinations thereof), for example, to reduce transgene expression in DRG and / or reduce or eliminate DRG toxicity and / or axonopathy. Examples of rAAV vector genomes that can be modified to include miRNA target sequences include WO2017 / 136500 (MPS I), WO2017 / 181113 (MPS II), WO2019 / 108857 (MPS III A), WO2019 / 108856 (MPS III B), WO2019 / 108857 (MPS III C), WO2019 / 108857 (MPS III D), WO2019 / 108857 (MPS III E), WO2019 / 108857 (MPS III F), WO2019 / 108857 (MPS III G), WO2019 / 108857 (MPS III H), WO2019 / 108857 (MPS III I ... B), WO2017 / 106354 (SMN1), WO2018 / 160585 (SMN1), WO2018 / 209205 (Batten disease), WO2015 / 164723 (AAV-mediated delivery of anti-HER2 antibodies), WO2015 / 138348 (OTC), WO2015 / 164778 (LDLR variant of FH), WO2017 / 106345 ( Examples include genes described in WO2017 / 106326 (anti-PCSK9 antibodies), WO2017 / 180857 (hemophilia A, factor VIII), WO2017 / 180861 (hemophilia B, factor IX), as well as vectors in clinical trials for the treatment of myotubular myopathies (AT132, AAV8, Audentes, etc.).

[0145] In certain embodiments, the AAV.alpha-L-iduronidase (AAV.IDUA) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to the coding sequence of the IDUA gene (see, e.g., nt 1938-3908 of SEQ ID NO: 15). In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally contain additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, vector genomes contain a single miR target sequence of a miR183 cluster member. In certain embodiments, vector genomes contain two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, vectors contain three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, vector genomes contain two or more miR target sequences of the miR183 cluster that are different from each other in sequence. In certain embodiments, the vector genomes described herein are carried by non-AAV vectors.

[0146] In certain embodiments, an AAV.iduronate-2-sulfatase (IDS) (AAV.IDS) gene therapy vector comprises a vector genome that includes at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and target sequences of miR183, or a combination thereof) operably linked to a coding sequence of an IDS gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally one or more of the target sequences are at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of the miR183 cluster that differ from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0147] In certain embodiments, the AAV.N-sulfoglucosamine sulfohydrolase (AAV.SGSH) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-96, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the SGSH gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0148] In certain embodiments, the AAV.N-acetyl-α-D-glucosaminidase (AAV.NAGLU) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to the coding sequence of the NAGLU gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally contain additional targeting sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genomes are In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of the miR183 cluster that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0149] In certain embodiments, the AAV.Survival Motor Neuron 1 (AAV.SMN1) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the SMN1 gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0150] In certain embodiments, the AAV.tripeptidyl peptidase 1 (AAV.TPP1) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the TPP1 gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally contain additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, vector genomes contain a single miR target sequence of a miR183 cluster member. In certain embodiments, vector genomes contain two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, vectors contain three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, vector genomes contain two or more miR target sequences of the miR183 cluster that are different from each other in sequence. In certain embodiments, the vector genomes described herein are carried by non-AAV vectors.

[0151] In certain embodiments, the AAV.anti-human epidermal growth factor receptor 2 antibody (AAV.anti-HER2) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of an anti-HER2 antibody. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0152] In certain embodiments, the AAV.ornithine transcarbamylase (AAV.OTC) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the OTC gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0153] In certain embodiments, the AAV.Low Density Lipoprotein Receptor (AAV.LDLR) gene therapy vector comprises a vector genome that includes at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the LDLR gene. In certain embodiments, the vector genome includes multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome includes 3-6 copies of the miR183 cluster target sequence. In certain embodiments, the vector genome comprises only one, two, three, or four copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector genome comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of the miR183 cluster that differ from each other in sequence. In certain embodiments, the vector genomes described herein are carried by non-AAV vectors.

[0154] In certain embodiments, the AAV.Uridine diphosphate glucuronosyltransferase 1A1 (AAV.UGT1A1) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the UGT1A1 gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally contain additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, vector genomes contain a single miR target sequence of a miR183 cluster member. In certain embodiments, vector genomes contain two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, vectors contain three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, vector genomes contain two or more miR target sequences of the miR183 cluster that are different from each other in sequence. In certain embodiments, the vector genomes described herein are carried by non-AAV vectors.

[0155] In certain embodiments, the AAV.anti-proprotein convertase subtilisin. / kexin type 9 antibody (AAV.anti-PCSK9 Ab) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the anti-PCSK9 Ab. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally contain additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome contains a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome contains two miR target sequences of a miR183 cluster member and, optionally, at least one spacer. In certain embodiments, the vector genome contains a single miR target sequence of a miR183 cluster member. The vector genome comprises three miR target sequences of three cluster members, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of miR183 cluster that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0156] In certain embodiments, the AAV.Factor VIII (AAV.FVIII) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the FVIII gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0157] In certain embodiments, the AAV.Factor IX (AAV.IX) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (including miR-183, miR-182, and miR183 target sequences, or combinations thereof) operably linked to a coding sequence of the FIX gene. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises 3-6 copies of the miR183 cluster target sequence, optionally with one or more of the target sequences being at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises 1, 2, 3, or 4 copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of a miR183 cluster member, and optionally at least two spacers. In certain embodiments, the vector genome comprises two or more miR target sequences of a miR183 cluster member that are different from each other in sequence. In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0158] In certain embodiments, the AAV.myotubularin 1 (AAV.MTM1) gene therapy vector comprises at least one, at least two, at least three, or a combination of the miRNA183 cluster (including miR-183, miR-182, and a target sequence of miR183) operably linked to the coding sequence of the MTM1 gene. In certain embodiments, the vector genome comprises a vector genome comprising at least one or at least four miR target sequences. In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from each other). In another embodiment, the vector genome comprises three to six copies of the miR183 cluster target sequence, optionally one or more of the target sequences are at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises one, two, three, or four copies of the miR183 target sequence. Such vector genomes may optionally comprise additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, the vector genome comprises a single miR target sequence of a miR183 cluster member. In certain embodiments, the vector genome comprises two miR target sequences of a miR183 cluster member, and optionally at least one spacer. In certain embodiments, the vector comprises three miR target sequences of miR183 cluster members, and optionally at least two spacers.In certain embodiments, the vector genome comprises two or more miR target sequences of miR183 cluster members that are different from each other in sequence.In certain embodiments, the vector genome described herein is carried by a non-AAV vector.

[0159] In one embodiment, the expression cassette comprises, in the vector genome, all integers or decimals within the range and endpoints, and is about 1×10 per gram of brain mass. 9 GC ~ approx. 1 × 10 per gram of brain mass 13 In another embodiment, the dosage is delivered in an amount of 1×10 genome copies (GC) per gram of brain mass. 10 GC ~ approx. 1 × 10 per gram of brain mass 13 In certain embodiments, the dose of the vector administered to the patient is at least about 1.0×10 9 GC / g, approx. 1.5×10 9 GC / g, approx. 2.0×10 9 GC / g, approx. 2.5×10 9 GC / g, approx. 3.0×109 GC / g, about 3.5×10 9 GC / g, about 4.0×10 9 GC / g, about 4.5×10 9 GC / g, about 5.0×10 9 GC / g, about 5.5×10 9 GC / g, about 6.0×10 9 GC / g, about 6.5×10 9 GC / g, about 7.0×10 9 GC / g, about 7.5×10 9 GC / g, about 8.0×10 9 GC / g, about 8.5×10 9 GC / g, about 9.0×10 9 GC / g, about 9.5×10 9 GC / g, about 1.0×10 10 GC / g, about 1.5×10 10 GC / g, about 2.0×10 10 GC / g, about 2.5×10 10 GC / g, about 3.0×10 10 GC / g, about 3.5×10 10 GC / g, about 4.0×10 10 GC / g, about 4.5×10 10 GC / g, about 5.0×10 10 GC / g, about 5.5×10 10 GC / g, about 6.0×10 10 GC / g, about 6.5×10 10 GC / g, about 7.0×10 10 GC / g, about 7.5×10 10 GC / g, about 8.0×10 10 GC / g, about 8.5×10 10 GC / g, about 9.0×10 10 GC / g, about 9.5×10 10 GC / g, about 1.0×10 11 GC / g, about 1.5×10 11 GC / g, about 2.0×10 11 GC / g, about 2.5×10 11 GC / g, about 3.0×10 11 GC / g, about 3.5×10 11 GC / g, about 4.0×10 11 GC / g, about 4.5×10 11 GC / g, about 5.0×1011 GC / g, about 5.5×10 11 GC / g, about 6.0×10 11 GC / g, about 6.5×10 11 GC / g, about 7.0×10 11 GC / g, about 7.5×10 11 GC / g, about 8.0×10 11 GC / g, about 8.5×10 11 GC / g, about 9.0×10 11 GC / g, about 9.5×10 11 GC / g, about 1.0×10 12 GC / g, about 1.5×10 12 GC / g, about 2.0×10 12 GC / g, about 2.5×10 12 GC / g, about 3.0×10 12 GC / g, about 3.5×10 12 GC / g, about 4.0×10 12 GC / g, about 4.5×10 12 GC / g, about 5.0×10 12 GC / g, about 5.5×10 12 GC / g, about 6.0×10 12 GC / g, about 6.5×10 12 GC / g, about 7.0×10 12 GC / g, about 7.5×10 12 GC / g, about 8.0×10 12 GC / g, about 8.5×10 12 GC / g, about 9.0×10 12 GC / g, about 9.5×10 12 GC / g, about 1.0×10 13 GC / g, about 1.5×10 13 GC / g, about 2.0×10 13 GC / g, about 2.5×10 13 GC / g, about 3.0×10 13 GC / g, about 3.5×10 13 GC / g, about 4.0×10 13 GC / g, about 4.5×10 13 GC / g, about 5.0×10 13 GC / g, about 5.5×1 0 13 GC / g, about 6.0×10 13 GC / g, about 6.5×10 13GC / g, approx. 7.0×10 13 GC / g, approx. 7.5×10 13 GC / g, approx. 8.0×10 13 GC / g, approx. 8.5×10 13 GC / g, approx. 9.0×10 13 GC / g, approx. 9.5×10 13 GC / g, or approximately 1.0 x 10 14 GC / g brain mass.

[0160] In certain embodiments, the miR target sequence-containing compositions provided herein minimize the dose, duration, and / or amount of immunosuppressive combination therapy required by a patient. Currently, immunosuppressants for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T-cell inhibitors, macrolides (e.g., rapamycin or rapalogs), and cytostatic agents (including alkylating agents), antimetabolites, cytotoxic antibiotics, antibodies, and agents active against immunophilins. Immunosuppressants may include nitrogen mustards, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, IL-2 receptor (CD25)-specific or CD3-specific antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-α) binding agents. In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 7 or more days prior to gene therapy administration. Such therapy may involve the simultaneous administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration at the same dose or adjusted doses. Such therapy can be for about 1 week (7 days), about 60 days, In certain embodiments, the miR target sequence-containing compositions provided herein eliminate the need for immunosuppressive therapy before, during, or after delivery of a gene therapy (e.g., rAAV) vector.

[0161] In one embodiment, a composition comprising an expression cassette as described herein is administered once to a subject in need thereof. In a particular embodiment, the expression cassette is delivered via rAAV.

[0162] It is to be understood that the compositions in the methods described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0163] 6. Kit In certain embodiments, kits are provided that include concentrated expression cassettes (e.g., in viral or non-viral vectors) suspended in a formulation (optionally frozen), an optional dilution buffer, and devices and components required for intrathecal, intraventricular, or intracisternal administration. In another embodiment, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to allow for injection. Such buffers may allow for about 1:1 to 1:5 dilution of the concentrated vector, or more. In other embodiments, more or less buffer or sterile water is included to allow for dose titration and other adjustments by the treating physician. In still other embodiments, the kit includes one or more components of the device. Suitable dilution buffers are available, such as saline, phosphate buffered saline (PBS), or glycerol / PBS.

[0164] It is to be understood that the compositions in the kits described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0165] 7. Devices In one aspect, the compositions provided herein can be administered intrathecally, for example, via the methods and / or devices described in WO2017 / 136500 (which are incorporated herein by reference in their entirety). Alternatively, other devices and methods can be selected. In summary, the method includes the steps of advancing a spinal needle into the patient's cisterna magna, connecting a length of flexible tubing to the proximal hub of the spinal needle and connecting the outlet port of a valve to the proximal end of the flexible tubing, and after the advancing and connecting steps, allowing the tubing to self-prime with the patient's cerebrospinal fluid, connecting a first container containing a quantity of isotonic solution to the flush inlet port of the valve, and then connecting a second container containing a quantity of pharmaceutical composition to the vector inlet port of the valve. After connecting the first and second containers to the valve, a passage for fluid flow is opened between the vector inlet port and the outlet port of the valve, and the pharmaceutical composition is injected into the patient through the spinal needle; after injection of the pharmaceutical composition, a passage for fluid flow is opened through the flush inlet port and the outlet port of the valve, and an isotonic solution is injected into the spinal needle to flush the pharmaceutical composition into the patient. This method and device can each optionally be used for intrathecal delivery of the compositions provided herein. Alternatively, other methods and devices can be used for such intrathecal delivery.

[0166] It is to be understood that the compositions in the devices described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification. EXAMPLES

[0167] The invention will now be described with reference to the following examples, which are provided for illustrative purposes only and should in no way be construed as limiting the invention to these examples, but rather as embracing any and all variations that become evident as a result of the teachings provided herein.

[0168] Example 1: Methods animal All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Rhesus macaques (Macaca Mulatta) were sourced from Covance Research Products, Inc. (Alice, TX) and Primen / Prelabs Primates (Hines, IL). Animals were housed in stainless steel squeeze-back cages within the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC)-accredited Non-Human Primate Research Program facility at the University of Pennsylvania. Animals received a variety of enrichments, including feeding, visual and auditory stimulation, manipulation, and social interaction.

[0169] C56BL / 6J mice (stock #000664) were purchased from Jackson Laboratory. Animals were housed in an AAALAC International accredited mouse barrier vivarium at the University of Pennsylvania Gene Therapy Program in standard cages, 2–5 mice per cage with enrichment (Nestlets). Cages, water bottles, and bedding in the barrier facility were autoclaved, and cages were changed once a week. An automatically controlled 12-h light-dark cycle was maintained. Each dark phase began at 1,900 h (± 30 min). Irradiated laboratory rodent chow was provided ad libitum.

[0170] vector The AAV9.PHP.B transformant plasmid (pAAV2 / PHP.B) was prepared using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, Inc.) and pAAV2 / 9 (Penn Vector Core) as a template, according to the manufacturer's manual. pAAV2 / 9 and pAAV2 / hu68 were provided by the Penn Vector Core. AAV vectors were generated and titrated by the Penn Vector Core as previously described (Lock, M., et al., 2011). al. Hum Gene Ther 21:1259-1271,2010). Briefly, HEK293 cells were transfected in triplicate, and culture supernatants were harvested, concentrated, and purified on an iodixanol gradient. The purified vector was titrated by digital droplet PCR using primers targeting rabbit β-globin polyA sequences as previously described (Lock, M., et al. Hum Gene Ther Methods 25:115-125,2014). Human α-L-iduronidase (hIDUA) sequence was obtained through reverse translation and codon optimization of the precursor protein sequence NP_000194.2 of the hIDUA isoform and cloned under the CB7 promoter (Penn Vector Core). Dorsal root ganglion (DRG) enriched microRNA sequences were selected from the public database available at mirbase.org. Four tandem repeats of DRG-enriched miR targets were cloned into the 3′ untranslated region (UTR) of green fluorescent protein (GFP) or hIDUA cis plasmids.

[0171] In vivo testing Mice were treated with 1 × 10 12 Genome copies (GC, 5 × 10 13 GC / kg) of AAV-PHP.B, or 4 × 10 12 GC(2×10 14Mice received 1000 GC / kg of AAV9 vectors encoding enhanced GFP (Penn Vector Core) via the lateral tail vein and were euthanized by inhalation of CO2 21 days after injection. Tissues were rapidly collected, starting with the brain, immersion fixed in 10% neutral buffered formalin for approximately 24 hours, briefly washed in phosphate-buffered saline (PBS), and sequentially equilibrated in 15% and 30% sucrose in PBS at 4°C. Tissues were then frozen in optimal cutting temperature embedding medium and cryosectioned for direct visualization of GFP (brains were sectioned at 30 μm thickness, other tissues were sectioned at 8 μm thickness). Images were acquired using a Nikon Eclipse Ti-E fluorescent microscope. GFP expression in DRG was analyzed by immunohistochemistry (IHC). Spinal columns containing DRG were fixed in formalin for 24 hours, decalcified in 10% ethylenediaminetetraacetic acid (pH 7.5) until soft, and embedded in paraffin according to standard protocols. Sections were deparaffinized through an ethanol and xylene series, boiled for 6 min in 10 mM citrate buffer (pH 6.0), antigen retrieval, and sequentially blocked with 2% H2O2 (15 min), avidin / biotin blocking reagent (15 min each, Vector Laboratories, Burlingame, CA), and blocking buffer (1% donkey serum + 0.2% Triton in PBS, 10 min), followed by incubation with primary antibodies diluted in blocking buffer (1 h at 37°C) and biotinylated secondary antibodies (1:500 dilution, 45 min; Jackson ImmunoResearch, West Grove, PA). Rabbit antibodies against GFP were used as primary antibodies (NB600-308, Novus Biologicals, Centennial, CO, 1:500 dilution). The Vectastain Elite ABC kit (Vector Laboratories, Burlingame, Calif.), which uses DAB as a substrate, allowed visualization of bound antibody as a brown precipitate.

[0172] Non-human primates (NHPs) were administered 3.5 × 10 13 AAVhu68.GFP vector for GC, or 1 × 1013 GCs received the AAVhu68.hIDUA vector and were injected intracisternally in a total volume of 1 mL (as previously described by Katz, N., et al. Hum Gene Ther Methods 29:212-219, 2018). Periodic blood draws and cerebrospinal fluid (CSF) taps were performed for safety readouts. Serum chemistry, hematology, coagulation, and CSF analysis were performed at the contract facility An tech Diagnostics (Morrisville, NC). Animals were euthanized with intravenous pentobarbital overdose and necropsied. Tissues were then harvested for comprehensive histopathological examination. Recovered tissues were immediately fixed in formalin and embedded in paraffin. For histopathological examination, tissue sections were stained with hematoxylin and eosin according to standard protocols. IHC for GFP expression was performed as described in the mouse study, but using a different antibody against GFP (goat antibody, NB100-1770, Novus Biologicals, 1:500 dilution, overnight incubation at 4°C). Immunostaining for hIDUA was performed using a sheep antibody against hIDUA (AF4119, R&D Systems, Minneapolis, MN, 1:200 dilution) according to the protocol above for IHC. In addition, sections were stained for hIDUA by immunofluorescence (IF) using the same primary antibody. For IF, sections were deparaffinized and processed for antigen retrieval as described above, then blocked with 1% donkey serum + 0.2% Triton in PBS for 15 min, followed by sequential incubation with primary antibodies diluted in blocking buffer (2 h at room temperature, 1:50 dilution) and FITC-labeled secondary antibodies (45 min, Jackson ImmunoResearch, 1:100 dilution). DAPI was used for nuclear counterstain, and sections were mounted in Fluoromount G.

[0173] In situ hybridization (ISH) was performed using a probe specific for codon-optimized RNA transcribed from a vector genome that does not bind to endogenous monkey IDUA RNA. Z-shaped probe pairs were synthesized by Life Technologies (Carlsbad, CA), and ISH was performed on paraffin sections using the Life Technologies ViewRNA ISH Tissue Assay Kit according to the manufacturer's protocol. Deposition of Fast Red precipitates indicating positive signals was imaged by fluorescence microscopy using a rhodamine filter set. Tissue sections with IDUA IHC were scanned for quantification purposes using an Aperio Versa slide scanner (Leica Biosystems, Buffalo Grove, IL).

[0174] Histopathology and morphometry A board-certified veterinarian blinded to the vector group established the severity grades, with the following definitions: 0. absence of lesions, 1. minimal (<10%), 2. mild (10-25%), 3. moderate (25-50%), 4. marked (50-95%), and 5. severe (>95%). Dorsal axonopathy scores were established from at least three cervical spinal cord dorsal sections, three thoracic spinal cord sections, and three lumbar spinal cord sections in each animal. DRG severity grades were established from at least three cervical spinal cord sections, three thoracic spinal cord sections, and three lumbar spinal cord sections. Median nerve scores, the sum of axonopathy and fibrosis severity grades, with a maximum possible score of 10, were established in the distal and proximal portions of the left and right nerves. For quantification of transgene expression, a board-certified veterinary pathologist counted cells immunostained with anti-GFP or anti-hIDUA antibodies by comparing the signal from control slides obtained from untreated animals. The total number of positive cells per 20 magnification fields was counted on at least five fields per structure and per animal using the ImageJ cell counting tool.

[0175] Vector biodistribution NHP tissue DNA was extracted with a QIAamp DNA Mini kit (Qiagen catalog no. 51306), and vector genomes were quantified by real-time PCR using Taqman reagents (Applied Biosystems, Life Technologies, Foster City, CA) and primers / probes targeting the rBG polyadenylation sequence of the vector.

[0176] immunology Peripheral blood T cell responses to hIDUA were measured by interferon-γ enzyme-linked immunosorbent spot assay using a peptide library specific for the hIDUA transgene according to a previously published method (Gao et al., 2009). The criterion for a positive response was 10 6 >55 spot-forming units per lymphocyte and 3-fold higher than unstimulated medium negative control. In addition, T cell responses were assayed in lymphocytes extracted from spleen, liver, and deep cervical lymph nodes after autopsy on day 90 of the study. Antibodies to hIDUA were measured in serum (1:1,000 sample dilution) (as previously described by Hinderer, C., et al. Mol Ther 23:1298-1307, 2015).

[0177] Cytokine / Chemokine Analysis: CSF samples were collected and stored at -80°C until analysis. CSF samples were analyzed using Milliplex MAP kits containing the following analytes: sCD137, Eotaxin, sFasL, FGF-2, Fractalkine, Granzyme A, Granzyme B, IL-1α, IL-2, IL-4, IL-6, IL-16, IL-17A, IL-17E / IL-25, IL-21, IL-22, IL-23, IL-28A, IL-31, IL-33, IP-10, MIP-3α, Perforin, TNFβ. CSF samples were assessed in duplicate and analyzed on a FLEXMAP 3D instrument using Luminex® xPONENT® 4.2, Bio-Plex Manager™ software 6.1. Only samples with %CV less than 20% were included in the analysis.

[0178] In vitro studies The miR183 human microRNA expression plasmid was modified from Origene's MI0000273 vector by deleting the KpnI-PstI fragment encoding GFP and a partial internal ribosome entry site. We confirmed the lack of GFP expression from the modified vector by transient transfection and anti-GFP immunoblot. Polyethylenimine-mediated transient transfection was performed in HEK293 cells with a GFP cis plasmid carrying a microRNA binding site located in the 3'-UTR of the GFP expression cassette. Seventy-two hours after transfection, cells were lysed in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.5% Triton X-100 containing protease inhibitors. A total of 13 μg of cell lysate was used for anti-GFP immunoblot followed by electrochemiluminescence-based signal detection and quantification. Experiments were performed in triplicate for statistical analysis.

[0179] statistical analysis Statistical differences between groups were assessed using the Wilcoxon rank sum test.

[0180] Example 2: MicroRNA-mediated inhibition of transgene expression reduces AAV-induced dorsal root ganglion toxicity Delivery of adeno-associated virus (AAV) vectors to the CNS of non-human primates (NHPs) via blood or cerebrospinal fluid is associated with dorsal root ganglion (DRG) toxicity. This may be caused by high efficiency transduction, which may result in endoplasmic reticulum stress from overproduction of the transgene product. We have developed an approach to eliminate toxicity associated with CNS-specific AAV gene therapy by introducing miRNA targeting sequences into the vector genome within the 3' untranslated region of the corresponding transgene mRNA. The expression cassette for ITR.CB7.CI.eGFP.miR145 (4 copies). Rabbit β-globin, 3'ITR is provided in SEQ ID NO: 10. The expression cassette for ITR.CB7.CI.GFP.miR182 (4 copies). Rabbit β-globin, 3'ITR is provided in SEQ ID NO: 11. The expression cassette for ITR.CB7.CI.GFP.miRNA96 (4 copies). Rabbit β-globin The expression cassette for ITR.CB7.CI.GFP.miR183 (4 copies).rabbit β-globin, 3′ ITR is provided in SEQ ID NO:12. The expression cassette for ITR.CB7.CI.GFP.miR183 (4 copies).rabbit β-globin, 3′ ITR is provided in SEQ ID NO:13.

[0181] AAV vectors induce DRG degeneration in NHPs Based on our experience in DRG toxicity in NHPs, we developed a system to quantify the severity of toxicity. We evaluate cell bodies located along the spinal cord in the DRG, axons within peripheral nerves, and axons ascending in the dorsal white matter tract (Figure 1B). The primary lesion is thought to be degeneration of sensory neuron cell bodies located in the DRG. The lesion is characterized histologically by eosinophilia, irregular cell shape, disruption of Nissl substance (central chromatolysis), and loss of nuclear borders along with mononuclear cell infiltration (Figure 1B). Cells expressing high levels of transgene protein are more likely to undergo degeneration, as evidenced by immunostaining for the transgene product in animals receiving ICM administration of AAV vectors expressing green fluorescent protein (GFP, Figure 1B). Secondary to the death of the cell bodies is axonopathy, which is the degeneration of distal and proximal axons. Axonopathy is characterized by loss of axons, distended myelin sheaths surrounding cellular debris, and macrophages (Figure 1B). Figure 1C shows examples of different levels of DRG toxicity and spinal cord axonopathy. Grades are based on the percentage of affected tissue on high-power field histopathological examination: 1. minimal (<10%), 2. mild (10-25%), 3. moderate (25-50%), 4. marked (50-95%), and 5. severe (>95%).

[0182] In our experience to date, juvenile / adult NHPs administered AAV vectors via ICM or lumbar puncture (LP) routes into the CSF totaled 101 monkeys across 21 studies, consistent with previously published toxicity studies (Hordeaux, J., et al., 2013). al. Mol Ther Methods Clin Dev 10:68-78, 2018; Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:79-88, 2018) and the two NHP experiments described in the Examples below, as well as some unpublished work. This experience includes seven capsids, 12 transgenes, three promoters (CB7, UBC, hSyn), 1 × 10 12 GC~5.7×10 13These included doses of GC, gradient- or column-purified vectors, three formulations (phosphate-buffered saline and two different artificial CSFs), and cynomolgus monkeys and macaques at various developmental stages. In all experimental groups, DRG toxicity and axonopathy were observed. Pathology peaked approximately 1 month after injection and does not progress for up to 6 months (the longest period evaluated in adult macaques). In most cases, pathology is mild to moderate. However, ICM injection of high doses of GFP-expressing vectors can cause severe pathology associated with ataxia.

[0183] miRNAs specifically expressed in DRG neurons can ablate AAV transgene expression. When considering ways to mitigate DRG toxicity, we evaluated several mechanisms. In a previous study, we analyzed the role of destructive adaptive immune responses against transduced DRGs by immunosuppressing NHPs ICM-administered with AAV9 vectors expressing human IDUA or human ID. Treatment with mycophenolate mofetil (MMF) and rapamycin blunted the adaptive immune response against the vector and transgene product but did not significantly affect DRG toxicity and axonopathy (Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:68-78, 2018, Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:79-88, 2018).

[0184] One possibility that has not been previously explored is the role of the transfer genes in highly transduced DRGs. Whether overexpression of the gene product is responsible for neuronal injury and degeneration of the cell body and associated axons, followed by a reactive inflammatory response (Figure 2A). Therefore, to specifically ablate the expression of the transgene in the DRG, a miRNA target expressed only in DRG neurons was cloned into the 3' untranslated region of the transgene (Figure 2B). Any mRNA expressed from the vector would be destroyed by the endogenously expressed miRNA.

[0185] To evaluate the activity and specificity of the miRNA strategy, an in vitro assay was used. An AAV cis plasmid was constructed to contain a 4-repeat concatemer of the target miRNA sequence in the 3' untranslated region of the expression cassette (Figure 2B). The AAV cis plasmid was co-transfected into HEK293 cells with a plasmid expressing miR183. Expression of the transgene, GFP, was reduced in the presence of miR183 only if it contained the cognate recognition sequence (Figure 3A).

[0186] The in vivo activity and specificity of potential miRNA targets within AAV vectors were screened in C57Bl / 6J mice. We evaluated GFP-expressing vectors with and without miRNA targets from two members of the miRNA183 complex (miR182 and miR183) and miR145. We initially tested another member of the 183 complex, miR96, but excluded it due to reduced transgene expression in mouse cortex (not shown). Animals received high-dose intravenous (IV) injections of AAV9 to target DRG and high-dose AAV-PHP.B (AAV9-PHP.B.CB7.CI.GFP.rBG) injections to target CNS. Animals were necropsied on day 21 and analyzed for GFP expression in DRG by immunohistochemistry (IHC) and direct fluorescence microscopy in brain and liver. Expression of GFP in DRG neurons was substantially reduced by vectors containing miR183 and miR182 targets, whereas miR145 targets had no effect (Figure 3B and Figure 3C). There was no obvious reduction in expression in the liver or other CNS compartments by vectors containing any of the miR targets. Expression appeared to be slightly enhanced in the CNS by the miR183 vector (Figure 3D). In this mouse experiment, the impact of suppression of the miR183 transgene on pathology could not be assessed, since vector-induced DRG toxicity was only observed in NHPs.

[0187] Limited transgene expression by miR183 reduces DRG toxicity in NHPs. Based on the promising data in mice, we evaluated the GFP-miR183 expression cassette in NHPs. We used the CB7 promoter from rhesus monkeys (3.5 × 10 13 GC) were injected with AAVhu68 vectors expressing GFP (AAV9.CB7.CI.GFP.rBG) (N=2) or GFP-miR183 (AAV9.CB7.CI.GFP.miR183.rBG) (N=4). On day 14, half of the animals were necropsied for GFP expression (Figure 4B - representative IHC for GFP expression, Figure 4B - quantification of expression). The remaining animals were necropsied on day 60 to assess expression and DRG toxicity (Figure 4C - DRG degeneration, dorsal spinal cord axonopathy, and peripheral nerve axonopathy). The animals tolerated the ICM-administered vectors without clinical sequelae. There was a statistically significant decrease in GFP expression in the DRG with the miR183 vector, as well as enhanced or similar expression elsewhere, including lumbar motor neurons, cerebellum, cortex, heart, and liver (Figures 4A and 4B). This was associated with a significant reduction in pathology across nine regions (DRG and dorsal spinal axonopathy in the cervical, thoracic, and lumbar spinal cord, as well as axonopathy in the median, peroneal, and radial nerves, Figure 4C). Without the miR183 target in the vector, pathology was present in all regions, evenly distributed between grade 4, grade 2, and grade 1. With the miR183 vector, the greatest pathology was grade 2, present in only 11% of the regions, with the remaining regions being either grade 1 (72%) or no pathology (16%).

[0188] These studies demonstrated that vectors containing miR183 targets selectively silenced GFP expression in DRG sensory neurons. Other CNS neurons and peripheral organs were unaffected. Thus, DRG toxicity and secondary axonopathy were reduced from marked / severe to minimal levels in the context of a highly immunogenic / toxic transgene (GFP).

[0189] Example 3: Specific suppression of therapeutic protein expression in dorsal root ganglia following AAV-mediated delivery containing a vector genome with a miRNA targeting sequence We further evaluated the miR183 target sequence in NHPs using a vector expressing human IDUA, an enzyme that is deficient in patients with mucopolysaccharidosis type I. Studies with this human transgene were the first to shed light on DRG toxicity in NHPs (Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:79-88, 2018). The experiment included three groups (N=3 / group): 1) group 1 - control vector alone without the miR183 target (AAVhu68.CB7.CI.hIDUAcoV1.rBG), 2) group 2 - control vector without the miR183 target (AAVhu68.CB7.CI.hIDUAcoV1.rBG) in animals treated with steroids (prednisolone 1 mg / kg / day from day -7 to day 30, followed by gradual taper), and 3) group 3 - vector with the miR183 target (AAVhu68.CB7.CI.hIDUAcoV1.miR183.rBG). All vector genomes contained the hIDUA coding sequence under the control of the chicken β-actin promoter and CMV enhancer element (referred to as the CB7 promoter), a chimeric intron (CI) consisting of a chicken β-actin splice donor (973 bp, GenBank: X00182.1), and a rabbit β-globin splice acceptor element, as well as a rabbit β-globin polyadenylation signal (rBG, 127 bp, GenBank: V00882.1). The vector genome of ITR.CB7.CI.hIDUAcoV1.rBG.ITR is provided in SEQ ID NO: 14. The vector genome of ITR.CB7.CI.hIDUAcoV1.miRNA183.rBG.ITR is provided in SEQ ID NO: 15. All animals were bred with the AAVhu68 vector (1×10 64-transfected ... 13 Necropsy was performed on day 90 to assess transgene expression and DRG-related toxicity.

[0190] Animals from all groups tolerated the ICM vector without vector-related clinical findings or clinical pathological abnormalities (Tables 1 and 2). CSF pleocytosis was very low, limited to one animal in group 2 and one in group 3 (Table 3). Both T cell responses (measured by ELISPOT) and antibodies against hIDUA were detected in all three groups (Figures 7A-7D). CSF cytokines were decreased in group 3 compared to group 1 at 21 and 35 days post-injection, whereas in group 2 (steroids), levels were decreased at 24 h (Figure 8). Days 21-35 correspond to peak transgene expression and are the time points at which overexpression-induced stress is expected.

[0191] Using direct fluorescence and in situ hybridization (ISH), high expression of hIDUA was observed in the DRG in Groups 1 and 2, which used a control vector (containing no miR183 target) (Figures 5 and 6A). Moderate expression of hIDUA was detected in other CNS compartments, including lower motor neurons in the spinal cord and neurons in the cerebellum and cortex (Figures 5 and 6A). Inclusion of the miR183 target in the vector (Group 3) eliminated expression of hIDUA in DRG neurons without reducing expression in the CNS (Figures 5 and 6A). The reduction in hIDUA expression in the DRG by miR183 was not due to reduced gene transfer, as the biodistribution of the vector throughout the CNS and DRG was essentially the same across all groups (Figure 9). Steroids moderately reduced expression in the DRG and significantly reduced expression in the lower motor neurons compared to Group 1. The expression of miR183 in the IL-16 cells was increased in the IL-16 cells (Figures 5 and 6A). As expected, group 1 exhibited pathology in the DRG, dorsal columns and peripheral nerves. However, these findings were completely absent when a vector with miR183 target was used (group 3, Figure 6B). Interestingly, co-treatment with steroids (group 2) did not reduce the toxicity of the parent vector (i.e., not containing miR183). In fact, a trend towards exacerbated toxicity was observed (Figure 6B). [Table 1-1] [Table 1-2] [Table 1-3] [Table 2-1] [Table 2-2] [Table 2-3] [Table 3]

[0192] DRG toxicity is likely to occur in any therapy that relies on high systemic doses of vector or direct delivery of vector to the CSF. This safety concern has been limited to primates and usually asymptomatic. However, DRG toxicity can cause substantial morbidity, such as deficits in proprioception (Hinderer, C., et al. Hum Gene Ther. 29(3):285-298, 2018) or ataxia due to intractable neuropathic pain. The US Food and Drug Administration recently suspended clinical trials of intrathecal AAV9 for late-onset SMA due to DRG toxicity in NHPs, highlighting how this risk may limit the development of AAV therapy (Novartis. Novartis announces AVXS-101 intrathecal study update, 2019).

[0193] Originally, it was hypothesized that this toxicity was caused by destructive T cell immunity against DRG transduced neurons, directed against epitopes of the foreign capsid or transgene. However, strong immunosuppressive regimens such as MMF and rapamycin failed to prevent toxicity in toxicity studies (Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:68-78, 2018, Hordeaux aux, J., et al. Mol Ther Methods Clin Dev 10:79-88, 2018), and again in this study, steroids did not prevent toxicity. The time course of delayed, but not progressive, DRG degeneration did not support the idea that adaptive immunity played a role. If cytotoxic T cells were involved, DRG degeneration and mononuclear cell infiltration would have been observed to begin earlier and progress over time.

[0194] At high levels of DRG transduction, cellular stress is produced that may result in degeneration in highly transduced DRG neurons. Toxicity can be prevented by suppressing transgene mRNA and protein expression, so capsid or vector DNA cannot be a cellular stressor. Histological analysis demonstrated that degeneration was limited to DRG neurons expressing the highest levels of transgene protein. The time course of delayed, but not self-limited, DRG neurodegeneration is consistent with the idea that non-immunotoxicity is limited to a subset of highly transduced cells. It is unclear whether DRG toxicity and axonal damage are reversible. No consistent reduction in pathology was observed after 6 months of follow-up of adult animals. The only experiment in which DRG toxicity was observed in NHPs after ICM injection was when vectors were administered to 1-month-old macaques and necropsied 4 years later (Hordeaux et al., 2019). It is possible that infant primates are resistant to DRG toxicity, or that their DRG neurons have regenerative capacity, or that the lesions regress over this extended period.

[0195] The findings showed support that DRG toxicity is caused by transgene overexpression. Thus, the severity of DRG toxicity should be influenced by the dose, promoter strength, and nature of the transgene. It is still not understood why sensory neurons are one of the most efficiently transduced cells in primates. DRG resides outside the CNS and has porous and fenestrated capillaries, making it easily accessed by systemically administered vectors. Systemic vectors can also access DRG neurons via retrograde transport after uptake from peripheral axons. The anatomical structure of the sensory nerve compartment present in the intrathecal (intracranial) space may facilitate high transduction of vectors delivered to the CSF. The axons of DRG neurons in the dorsal root are exposed to the CSF, providing easy access to the vector after ICM / LP administration. The open access of the subarachnoid space to the extracellular fluid of the DRG should allow direct contact of ICM / LP vectors to the neuronal soma and other cells of the DRG. Suppression of transgene expression in DRG neurons by miR183 facilitated the analysis of transgene expression in other cells of the DRG that should not be affected by this miR. ISH revealed transgene mRNA in surrounding glial satellite cells, which may suggest direct transduction (Figure 6C). The functional significance of transgene mRNA in glial cells is unknown.

[0196] Selective inhibition of vector transgene expression should reduce and potentially eliminate DRG toxicity. The key to achieving this is a strategy to specifically extinguish expression in DRG neurons without affecting expression elsewhere. Currently, there are no methods to achieve this specificity via capsid modification or tissue-specific promoters. Including miR183 targets in the vector achieved the desired outcome of reducing / eliminating DRG toxicity without affecting vector manufacturing, potency, or biodistribution. The hIDUA NHP study above included a group that received a non-miR183 vector with concomitant steroids (a standard approach to mitigate immune-mediated toxicity in AAV trials). The steroid-treated group did not reduce DRG toxicity and in fact tended to exacerbate it. This experiment demonstrates the limitations of prophylactic steroids in AAV gene therapy trials.

[0197] The modularity of this approach to reduce DRG toxicity suggests its use in any AAV vector considered for CNS gene therapy where it is desired to reduce AAV-induced DRG toxicity. This approach can be used across a wide range of AAV vectors for therapeutic applications.

[0198] Example 4: In vitro evaluation of expression constructs carrying miR183 cluster targeting sequences The activity and specificity of the construct with miRNA target sequence is evaluated using an in vitro assay. As described in Example 2 above, HEK293 cells (or another suitable cell line) are co-transfected with a cis-plasmid carrying a GFP transgene and a plasmid expressing one or more miRNAs, such as miR-182 and miR-183. The cis-plasmid is designed with various numbers of corresponding target miRNA sequences in the 3'UTR of the expression cassette, and alternative spacer sequences are introduced. 72 hours after transfection, the expression of GFP is quantified to determine the relative expression level.

[0199] For example, constructs carrying one, two, three, or four copies of the target miR183 sequence are tested. The individual target sequences are either directly linked or separated by a spacer sequence, such as those provided in SEQ ID NOs: 5-7. Based on the results of the in vitro study, suitable combinations of sequences (including number of repeats) and spacers that reduce or eliminate GFP expression are identified. Candidates from this study are then screened in vivo by delivering AAV vectors (e.g., AAV9 or AAV-PHP.B) carrying expression constructs in which the target miRNA sequence and spacer sequence are in the same or similar arrangement. For example, an exemplary in vivo mouse study to assess expression levels in the CNS, including detargeting of the DRG (i.e., reducing GFP expression), is provided in Example 2.

[0200] Similar studies are also carried out using constructs with 1, 2, 3 or 4 copies of the miR182 target sequence combination, with or without various spacer sequences.In addition, constructs with combinations and different arrangements of the recognition sequences of miR182 and miR183 are generated.Then, the constructs with only the miR182 target sequence and the combination of the miR182 and miR183 target sequence that show favorable reduced expression levels in vitro are evaluated in vivo, for example, after administration of AAV vector, to determine the toxicity and the level of transgene expression (degree of detargeting) in the cells of CNS and DRG.

[0201] Alternatively, constructs are generated that have 1, 2, 3, or 4 copies of a combination of miR182 target sequence and / or other mir183 cluster target sequence (i.e., target sequence corresponding to miR-183, miR-96, or miR-182). The constructs carrying the combination of miR182-miR183 cluster target sequence are tested in vitro using GFP expression assay as described in Example 2 above. As described above, the expression cassettes tested have various numbers of miRNA target sequences that are separated or not separated by spacer sequences. The activity of a particular construct with a combination of miR182 target sequence and other mir183 cluster target sequence is then evaluated in vivo by generating an AAV vector that is then administered IV at a high dose. As described above, the expression of AAV vector transgenes is evaluated in various cells and tissues, including DRG, especially liver tissue.

[0202] Additionally, the effect of 1, 2, 3, or 4 copies of the miR182 target sequence on transgene expression is evaluated. Experimental constructs for in vitro testing are generated as described above, and the miR182 target sequence is introduced into the 3'UTR of the expression cassette. When multiple miR182 sequences are introduced, the sequences may be contiguous or, alternatively, separated by various intervening spacer sequences. The AAV vectors having expression cassettes containing any combination of miR182 target sequences and spacer sequences (if applicable) are generated and tested in vivo. In particular, for expression cassettes having miR182 target sequences, transgene expression is evaluated in muscle tissue after high-dose IV administration of AAV vectors.

[0203] Example 5: Detargeting of the human iduronate-2-sulfatase (hIDS) transgene for the treatment of Mucopolysaccharidosis Type II (MPS II) One strategy for the treatment of MPS II (Hunter syndrome) is to functionally replace the defective iduronate-2-sulfatase in patients via rAAV-based CNS-specific gene therapy (see, e.g., International Patent Application No. PCT / US2017 / 027770, incorporated herein by reference). To reduce DRG toxicity, AAV vector genomes for the treatment of MPS II are modified by introducing miR targeting sequences. Thus, AAV vector genomes containing hIDS coding sequences are designed with one, two, three, or four miR183 targeting sequences. The efficacy of DRG detargeting in vivo is measured, for example, after intrathecal administration of hIDS-encoding AAV vectors to NHPs.

[0204] Example 6: Detargeting the SMN1 Transgene for the Treatment of Spinal Muscular Atrophy (SMA) SMA is an autosomal recessive disorder caused by mutations or deletions in the hSMN1 gene. Although delivery of functional SMN protein via rAAV vectors is effective in treating SMA, DRG toxicity has been observed. Suitable vectors include those described in International Patent Application No. PCT / US2018 / 019996 (hereby incorporated by reference) and Zolgensma®, an AAV9-based gene therapy. Reduction or elimination of DRG toxicity following delivery of AAV vectors encoding human SMN1 is achieved by incorporating miRNA target sequences (such as those recognized by miR182 and miR183) into the vector genome. Thus, AAV vectors (including those with AAV9 or AAVhu68 capsids) are generated that have a nucleic acid sequence encoding a hSMN1 transcript in combination with one, two, three, or four miRNA target sequences. The target sequences are selected, for example, from miR182 and miR183 target sequences, or combinations thereof. DRG toxicity following IV or intrathecal administration of hSMN1-expressing AAV vectors will be evaluated in the NHP model.

[0205] Example 7: Liver-specific gene therapy vectors with miRNA targeting sequences For gene therapy, if it is desired to improve the expression of transgene in liver tissue, AAV vector genome can be modified to include miRNA target sequence.For example, rAAV designed to express functional low density lipoprotein receptor (hLDLR) gene and have AAV8 capsid is suitable for the treatment of familial hypercholesterolemia (FH) (see, for example, International Patent Application No. PCT / US2016 / 065984, which is incorporated herein by reference).Enhanced expression of hLDLR transgene in liver tissue is achieved using rAAV that includes vector genome with hLDLR coding sequence combined with one, two, three or four miR182 target sequence. Similarly, gene therapy for the treatment of hemophilia A (Factor VIII) and hemophilia B (Factor IX) includes vectors with tropism for the liver (see, e.g., International Patent Application Nos. PCT / US2017 / 027396 and PCT / US2017 / 027400, which are incorporated herein by reference). More effective delivery and expression of human Factor VIII and Factor IX in the liver is achieved by delivering rAAV containing a vector genome with one, two, three, or four miR182 targeting sequences in combination with a transgene.

[0206] (Sequence Listing Free Text) The following information is identified by <223> Below we provide an array containing free text. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8]

[0207] All publications cited herein are incorporated by reference in their entirety. U.S. Provisional Patent Application No. 62 / 783,956, filed December 21, 2018, U.S. Provisional Patent Application No. 62 / 924,970, filed October 23, 2019, and U.S. Provisional Patent Application No. 62 / 934,915, filed November 13, 2019, is incorporated herein by reference in its entirety. Similarly, the sequence numbers referenced herein and appearing in the attached sequence listing are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

1. A recombinant AAV (rAAV) for delivering a gene product that specifically inhibits expression of the gene product in a dorsal root ganglion to a patient in need thereof, the rAAV comprising a viral capsid, an AAV vector genome packaged in the viral capsid, the vector genome comprising: (a) a coding sequence for the gene product, the coding sequence being under the control of regulatory sequences that direct expression of the gene product in a cell containing the vector genome; (b) a recombinant AAV comprising at least two miRNA target sequences specific for miR-183.

2. A recombinant AAV (rAAV) for delivering a gene product that specifically inhibits expression of the gene product in a dorsal root ganglion to a patient in need thereof, the rAAV comprising a viral capsid, an AAV vector genome packaged in the viral capsid, the vector genome comprising: (a) a coding sequence for the gene product, the coding sequence being under the control of regulatory sequences that direct expression of the gene product in a cell containing the vector genome; (b) a recombinant AAV comprising at least two miRNA target sequences specific for miR-182.

3. 3. A pharmaceutical composition comprising the rAAV of claim 1 or 2 and a formulation buffer, suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection.

4. A pharmaceutical composition for gene delivery that specifically inhibits expression of a gene product in a dorsal root ganglion (DRG), comprising an expression cassette that is a nucleic acid sequence, the nucleic acid sequence comprising: (a) a coding sequence for a gene product, the coding sequence being under the control of regulatory sequences that direct expression of the gene product in a cell containing the expression cassette; and (b) at least two target sequences specific for miR-183, at least one of the target sequences being operably linked to said coding sequence (a).

5. A pharmaceutical composition for gene delivery that specifically inhibits expression of a gene product in a dorsal root ganglion (DRG), comprising an expression cassette that is a nucleic acid sequence, the nucleic acid sequence comprising: (a) a coding sequence for a gene product, the coding sequence being under the control of regulatory sequences that direct expression of the gene product in a cell containing the expression cassette; and (b) at least two target sequences specific for miR-182, at least one of which is operably linked to said coding sequence (a).

6. The rAAV of claim 1 or 2 or the pharmaceutical composition of claims 3 to 5, wherein the vector genome or expression cassette comprises the at least two target sequences and at least a second miRNA target sequence that is different from the two target sequences.

7. The rAAV or pharmaceutical composition of claim 6, wherein the at least two miRNA target sequences are located in the 3'UTR or 5'UTR.

8. The rAAV or pharmaceutical composition of any one of claims 1 to 7, wherein the vector genome or expression cassette comprises three miRNA tandem repeats.

9. 9. The rAAV or pharmaceutical composition of any one of claims 1 to 8, wherein the miRNA target sequences are contiguous or separated by a spacer of 1 to 10 nucleic acids, wherein the spacer is not a miRNA target sequence.

10. The rAAV or pharmaceutical composition of any one of claims 1 to 9, wherein there are two sets of at least two miRNA target sequences located in the 3' and or 5' UTR.

11. The rAAV or pharmaceutical composition of any one of claims 1 to 10, wherein the start of a first of the at least two miRNA tandem repeats is within 20 nucleotides of the 3' end of the coding sequence of the gene product.

12. 12. The rAAV or pharmaceutical composition of any one of claims 1 to 11, wherein the start of a first of the at least two miRNA target sequences is at least 100 nucleotides from the 3' end of the coding sequence of the gene product.

13. The rAAV or pharmaceutical composition of any one of claims 7 to 12, wherein the 3'UTR and the miRNA target sequence comprise a length of 200 to 1200 nucleotides.

14. The rAAV or pharmaceutical composition of any one of claims 1 to 13, wherein the expression cassette comprises four miRNA target sequences located in the 3'UTR.

15. The rAAV or pharmaceutical composition of any one of claims 1 to 13, wherein the vector genome or expression cassette further comprises at least one target sequence specific for miR-183 or miR-182 in the 5'UTR.

16. The rAAV or pharmaceutical composition of claim 15, wherein the expression cassette comprises at least two miRNA target sequences located in both the 5'UTR and the 3'UTR.

17. At least one miRNA target sequence in the mRNA or DNA positive strand of the expression cassette is AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 1 (miR183)), or AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 3 (miR182)), That is, 17. The rAAV or pharmaceutical composition according to any one of claims 1 to 16.

18. The rAAV or pharmaceutical composition of any one of claims 1 to 17, wherein the two or more consecutive miRNA target sequences are contiguous and not separated by a spacer.

19. 18. The rAAV or pharmaceutical composition of any one of claims 1-17, wherein two or more of the miRNA target sequences are separated by a spacer, each spacer independently selected from one or more of: (i) GGAT (SEQ ID NO:5); (ii) CACGTG (SEQ ID NO:6); or (iii) GCATGC (SEQ ID NO:7).

20. 20. The rAAV or pharmaceutical composition of any one of claims 1 to 19, wherein the spacer located between the miRNA target sequences is located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence.

21. The rAAV of any one of claims 1 or 6 to 20 or the pharmaceutical composition of any one of claims 3 to 20, wherein the spacers between the miRNA target sequences are the same.

22. The pharmaceutical composition according to any one of claims 3 to 21, wherein the expression cassette is carried by a viral vector selected from a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, and a recombinant adenovirus.

23. 22. The pharmaceutical composition of any one of claims 3 to 21, wherein the expression cassette is carried by a non-viral vector selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, and chitosan-based formulations.

24. 22. The rAAV of any one of claims 1, 2 or 6 to 21, or the pharmaceutical composition of any one of claims 5 to 21, for use in the manufacture of a medicament or kit for suppressing expression of a transgene in DRG neurons.

25. 22. An rAAV according to any one of claims 1, 2 or 6 to 21 or a pharmaceutical composition according to any one of claims 5 to 21 for use in the manufacture of a medicament or kit for modulating neurodegeneration and / or reducing secondary dorsal spinal cord axon degeneration following intrathecal or systemic gene therapy administration.

26. 22. The rAAV of any one of claims 1, 2 or 5-21, or the pharmaceutical composition of any one of claims 3-21, for use in the manufacture of a medicament or kit for enhancing expression of a transgene in cells of the central nervous system (CNS), wherein the miRNA target sequence comprises at least one miR183 target sequence.

27. 27. The rAAV or pharmaceutical composition of claim 26, wherein the cells of the CNS include one or more of pyramidal neurons, Purkinje neurons, granule cells, spindle neurons, interneurons, astrocytes, oligodendrocytes, microglia, and ependymal cells.

Images