Compositions and methods for immunotherapy

Abstract

The present invention provides biological circuit systems, effector modules, and compositions for cancer immunotherapy, as well as methods for inducing anti-cancer immune responses in a subject. [Selection diagram] Figure 19

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 466,601, entitled "Compositions and Methods for Immunotherapy," filed March 3, 2017, U.S. Provisional Patent Application No. 62 / 484,063, entitled "Compositions and Methods for Immunotherapy," filed April 11, 2017, and U.S. Provisional Patent Application No. 62 / 542,402, entitled "Compositions and Methods for Immunotherapy," filed August 8, 2017, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing

[0001] This application is submitted with an electronic Sequence Listing, which is provided as a file named 2095_1207PCT_SL.txt, created on March 2, 2018, with a file size of 1,566,189 bytes. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0003] The present invention relates to compositions and methods for immunotherapy. The present invention provides biological circuits, effector modules, stimulus response elements (SREs), and immunotherapeutic polypeptides, polynucleotides encoding the same, and vectors and cells containing the polypeptides and / or polynucleotides for use in cancer immunotherapy. In one embodiment, the composition comprises a destabilization domain (DD) that modulates protein stability. [Background technology]

[0004] Cancer immunotherapy aims to eradicate cancer cells by rejuvenating the tumoricidal function of tumor-reactive immune cells, primarily T cells. Cancer immunotherapy strategies, including checkpoint blockade, adoptive cell transfer (ACT), and the recent development of cancer vaccines, which can expand antitumor immune effector cells, have produced remarkable results in several tumors.

[0005] Host antitumor immunity and the impact of cancer immunotherapy are hindered by three major hurdles: 1) low numbers of tumor antigen-specific T cells due to clonal deletion; 2) insufficient activation of innate immune cells and the accumulation of tolerogenic antigen-presenting cells in the tumor microenvironment; and 3) the formation of an immunosuppressive tumor microenvironment. In particular, in solid tumors, the therapeutic efficacy of immunotherapy regimens remains insufficient due to the lack of effective antitumor responses in the immunosuppressive tumor microenvironment. In many cases, such immune tolerance is acquired because tumor cells induce immune tolerance or immunosuppression, leading to immune tolerance even to truly foreign tumor antigens. Because cancer vaccines and adoptive transfer of preactivated immune effector cells (e.g., T cells) are suppressed by inhibitors in the tumor microenvironment (TME), such immune tolerance is also active and dominant.

[0006] Furthermore, administration of modified T cells can lead to on-target / off-target toxicity and cytokine release syndrome (reviewed in Tey Clin. Transl. Immunol., 2014, 3:e17 10.1038).

[0007] The development of tunable switches that can turn on or off the expression of transgenic immunotherapeutic drugs in the event of adverse events is necessary. For example, the half-life of adoptive cell therapy can be very long and uncertain. Because toxicity can be progressive, a safety switch to remove infused cells is desirable. Systems and methods that allow for flexible adjustment of transgenic protein levels and expression windows could enhance therapeutic efficacy and reduce potential side effects.

[0008] To develop tunable therapeutic agents for disease treatment, particularly cancer immunotherapy, the present invention provides a biological circuit system that controls the expression of an immunotherapeutic agent. The biological circuit system includes a stimulus and at least one effector module that responds to the stimulus. The effector module may include a stimulus response element (SRE) that binds to and responds to the stimulus, and an immunotherapeutic agent operably linked to the SRE. In one embodiment, the SRE is a destabilization domain (DD) that is destabilized in the absence of its specific ligand and can be stabilized by binding to its specific ligand. Summary of the Invention [Means for solving the problem]

[0009] The present invention provides compositions and methods for immunotherapy. The compositions relate to tunable systems and agents that induce anti-cancer immune responses in cells or in a subject. The tunable systems and agents may be biological circuit systems comprising at least one effector module responsive to at least one stimulus. The biological circuit systems may be, but are not limited to, destabilization domain (DD) biological circuit systems, dimerization biological circuit systems, receptor biological circuit systems, and cell biological circuit systems. These systems are further taught in co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, U.S. Provisional Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO 2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0010] In some embodiments, the composition for inducing an immune response may include a first effector module. In some embodiments, the effector module may comprise a first stimulus response element (SRE) operably linked to at least one payload. In one aspect, the payload may be an immunotherapeutic drug.

[0011] In some embodiments, the immunotherapeutic agent may be selected from, but is not limited to, a cytokine, a safety switch, a regulatory switch, a chimeric antigen receptor, and combinations thereof.

[0012] In one embodiment, the first SRE of the composition is capable of responding to or interacting with at least one stimulus.

[0013] In some embodiments, the first SRE may comprise a destabilization domain (DD). The DD may be derived from a parent protein or a mutant protein having one, two, three, or more amino acid mutations compared to the parent protein. In some embodiments, the parent protein may be selected from, but is not limited to, the human protein FKBP having the amino acid sequence of SEQ ID NO: 3; human DHFR (hDHFR) having the amino acid sequence of SEQ ID NO: 2; E. coli DHFR having the amino acid sequence of SEQ ID NO: 1; PDE5 having the amino acid sequence of SEQ ID NO: 4; PPARγ having the amino acid sequence of SEQ ID NO: 5; CA2 having the amino acid sequence of SEQ ID NO: 6; or NQO2 having the amino acid sequence of SEQ ID NO: 7.

[0014] In one embodiment, the parent protein is hDHFR and DD is selected from the group consisting of M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I7 2T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G , S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P10 4S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K1 23E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133 E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F14 8S, F148L, F149L, P150L, ​​E151G, I152V, D153A, D153G, E155G, K156R, Y157R , Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V 170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T, K177E, K17 7R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R,The present invention also includes mutant proteins having at least one mutation selected from K185del, K185E, N186S, N186D, D187G, and D187N.

[0015] In one embodiment, the stimulus for the SRE may be trimethoprim or methotrexate.

[0016] In some embodiments, the immunotherapeutic agent may be a cytokine. In one aspect, the cytokine may be an interleukin, an interferon, a tumor necrosis factor, a transforming growth factor B, a CC chemokine, a CXC chemokine, a CX3C chemokine, or a growth factor. In some embodiments, the cytokine is an interleukin. In some embodiments, the interleukin is IL1, IL1-α, IL1-β, IL1-δ, IL1-ε, IL1-η, IL1-ζ, IL-RA, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11a, IL11b, IL13, IL14, IL16, IL17, IL-17A, IL17B, IL17C, IL17E, IL17 F, IL18, IL19, IL20, IL20L, IL21, IL22, IL23, IL23A, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL34, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, IL37d, IL37e, and IL38.

[0017] In one embodiment, the interleukin may be IL2, which has the amino acid sequence of SEQ ID NO:51.

[0018] In one aspect, the immunotherapeutic agent can be a safety switch. In some embodiments, the safety switch can be selected from caspase 9, inducible FAS (iFAS), inducible caspase 9 (icasp9), a CD20 / anti-CD20 antibody pair, a protein tag / anti-tag antibody, and a mini suicide gene (RQR8). In one aspect, the safety switch can be caspase 9 having the amino acid sequence of SEQ ID NO: 65.

[0019] In one aspect, the immunotherapeutic agent can encode a regulatory switch. In some embodiments, the regulatory switch can be selected from FOXP3, Nr4a, FOXO, and NF-κB. In one aspect, the regulatory switch can be FOXP3 having the amino acid sequence of SEQ ID NOs: 103-106.

[0020] In one aspect, the immunotherapeutic agent may be a chimeric antigen receptor (CAR). In some embodiments, the CAR may be selected from a GD2 CAR, a Her2 CAR, a BCMA CAR, a CD33 CAR, an ALK CAR, a CD22 CAR, and a CD276 CAR. The CARs described herein may comprise an extracellular portion, a transmembrane domain, an intracellular signaling domain, and optionally one or more costimulatory domains.

[0021] In one embodiment, the CAR may be selected from, but is not limited to, a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.

[0022] In some embodiments, the extracellular targeting portion of the CAR can be selected from, but is not limited to, an Ig NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single-chain variable fragment (scFv), a bis-scFv, an (scFv)2, a minibody, a diabody, a triabody, a tetrabody, an intrabody, a disulfide-stabilized Fv protein (dsFv), a unibody, a nanobody, and an antigen-binding region derived from an antibody that can specifically bind to either a protein, ligand, receptor, receptor fragment, or peptide aptamer of interest.

[0023] In some embodiments, the extracellular targeting moiety may be selected from an ALK targeting moiety having the amino acid sequence of SEQ ID NOs: 242-257 and 422-429, a CD22 targeting moiety having the amino acid sequence of SEQ ID NOs: 258-262 and 430-432, a CD276 targeting moiety having the amino acid sequence of SEQ ID NOs: 263-270 and 433-436, a GD2 targeting moiety having the amino acid sequence of SEQ ID NOs: 271-349 and 437-465, a CD33 targeting moiety having the amino acid sequence of SEQ ID NOs: 350-357, a BCMA targeting moiety having the amino acid sequence of SEQ ID NOs: 358-365, and a Her2 targeting moiety having the amino acid sequence of SEQ ID NOs: 366-421 and 466-473.

[0024] In some embodiments, the intracellular signaling domain of the CAR can be derived from the T cell receptor CD3ζ or a cell surface molecule selected from the group consisting of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0025] In some embodiments, the CAR may comprise a costimulatory domain, which may be selected from the group consisting of 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

[0026] In one embodiment, the transmembrane domain of the CAR can be derived from a transmembrane domain. In one aspect, the transmembrane domain can have an amino acid sequence selected from the group consisting of SEQ ID NOs: 527-624, but is not limited thereto.

[0027] In some embodiments, the CAR of the effector module may further comprise a hinge region near the transmembrane domain. In one aspect, the hinge region may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 628-694.

[0028] In one embodiment, the first effector module may comprise IL2-DD having the amino acid sequence of any of SEQ ID NOs: 52-54.

[0029] In one embodiment, the first effector module may comprise caspase-9-DD having the amino acid sequence of any of SEQ ID NOs: 72-80.

[0030] In one embodiment, the first effector module may comprise FOXP3-DD having the amino acid sequence of any of SEQ ID NOs: 107-116.

[0031] In one embodiment, the first effector module may comprise a BCMA CAR-DD having the amino acid sequence of any of SEQ ID NOs: 775-777.

[0032] In one embodiment, the first effector module may comprise HER2-DD having the amino acid sequence of any of SEQ ID NO:906.

[0033] The present invention also provides polynucleotides encoding the compositions of the present invention.

[0034] In one aspect, the polynucleotide may be a DNA or RNA molecule. In one aspect, the polynucleotide may include spatiotemporally selected codons. In some embodiments, the polynucleotide may be an RNA molecule. In one aspect, the RNA molecule may be a messenger molecule. In some embodiments, the RNA molecule may be chemically modified. In some embodiments, the polynucleotide may include spatiotemporally selected codons.

[0035] In some embodiments, the polynucleotide may further comprise at least one additional feature selected from, but not limited to, a promoter, a linker, a signal peptide, a tag, a cleavage site, and a targeting peptide.

[0036] The present invention also provides a vector comprising the polynucleotide described herein. In one aspect, the vector may be a viral vector. In some embodiments, the viral vector may be a retroviral vector, a lentiviral vector, a gammaretroviral vector, a recombinant AAV vector, an adenoviral vector, or an oncolytic viral vector.

[0037] The present invention also provides compositions of the present invention, immune cells for adoptive cell transfer (ACT) capable of expressing the polynucleotides described herein. In one embodiment, the immune cells may be infected or transfected with the vectors described herein. The immune cells for ACT may be selected from, but are not limited to, CD8+ T cells, CD4+ T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), memory T cells, regulatory T (Treg) cells, cytokine-induced killer (CIK) cells, dendritic cells, human embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, or a mixture thereof.

[0038] In one aspect, the immune cell may have a destabilization domain DD, in which case the DD is derived from the human protein FKBP having the amino acid sequence of SEQ ID NO: 3, DHFR having the amino acid sequence of SEQ ID NO: 1-2, PDE5 having the amino acid sequence of SEQ ID NO: 4, PPARγ having the amino acid sequence of SEQ ID NO: 5, CA2 having the amino acid sequence of SEQ ID NO: 6 and NQO2 having the amino acid sequence of SEQ ID NO: 7.

[0039] In one embodiment, the DD may be derived from a parent protein, wherein the parent protein is hDHFR and the DD is selected from the group consisting of M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T , G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K 69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G , H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D11 1N, M112T, M112V, V113A, W114R, I115V, V116I, G117D, V121A, Y122C, Y122D , Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H1 31R, L132P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138 G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D 146G, T147A, F148S, F148L, F149L, P150L, ​​E151G, I152V, D153A, D153G, E15 5G, K156R, Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I17 6T, K177E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R,The present invention also includes mutant proteins having at least one mutation selected from E184G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.

[0040] In some embodiments, immune cells may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

[0041] The present invention provides a method for reducing tumor volume or tumor burden in a subject, comprising contacting the subject with an immune cell of the present invention. Also provided herein is a method for inducing an anti-tumor immune response in a subject, comprising administering immune cells of the system to the subject.

[0042] Also provided herein are methods of inducing an immune response in a subject, administering to the subject a composition of the invention, a polynucleotide of the invention, and / or an immune cell of the invention.

[0043] The present invention also provides methods for preventing or reversing T cell depletion in a subject in need thereof. Such methods may include administering to the subject a therapeutically effective amount of a composition described herein, a polynucleotide of the invention, a vector of the invention, or an immune cell described herein. Such methods may include an SRE that responds to a stimulus and modulates the expression and / or function of an immunotherapeutic agent, thereby preventing or reversing T cell depletion.

[0044] In some aspects, the immunotherapeutic agent is a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor may be a GD2 CAR, a BCMA CAR, a CD33 CAR, a Her2 CAR, an ALK CAR, a CD22 CAR, or a CD276 CAR.

[0045] Also provided herein is a method for detecting cancer in a mammal, comprising the steps of: (a) contacting a sample comprising one or more cells derived from a mammal with a composition, polynucleotide, vector, or immune cell of the present invention; and (b) detecting a complex, wherein detection of the complex may indicate the presence of cancer in the mammal.

[0046] In some embodiments, the effector module comprises a stimulus response element (SRE) and at least one payload comprising a protein of interest (POI).

[0047] In some embodiments, the SRE can be a destabilizing domain (DD). In some examples, the DD is a mutant domain derived from a protein, such as FKBP (FK506 binding protein), E. coli DHFR (dihydrofolate reductase) (ecDHFR), human DHFR (hDHFR), or any protein of interest. In this context, the biological circuit is a DD biological circuit.

[0048] The payload may be an immunotherapeutic drug used in cancer immunotherapy, for example, a cytokine such as IL2, a safety switch such as caspase 9, a regulatory switch encoding FOXP3, a chimeric antigen receptor such as a BCMA CAR, a CD33 CAR, a GD2 CAR, a Her2 CAR, an ALK CAR, a CD22 CAR, a CD276 CAR, or any agent capable of inducing an immune response. The SRE and payload may be operably linked via one or more linkers, and the location of the components may vary within the effector module.

[0049] In some embodiments, the effector module may further comprise one or more additional features, such as a linker sequence (with a particular sequence and length), a cleavage site, a regulatory element (which regulates expression of a protein of interest, such as a microRNA target site), a signal sequence that directs the effector module to a particular cellular or subcellular location, a penetration sequence, or tags and biomarkers for tracking the effector module.

[0050] The present invention provides isolated biological circuit polypeptides, effector modules, stimulus response elements (SREs), and payloads, as well as polynucleotides encoding any of the foregoing; vectors comprising the polynucleotides of the invention; and cells expressing the polypeptides, polynucleotides, and vectors of the invention. The polypeptides, polynucleotides, viral vectors, and cells are useful for inducing anti-tumor immune responses in a subject.

[0051] In some embodiments, the vectors of the present invention are viral vectors, which may include, but are not limited to, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, or lentiviral vectors.

[0052] In some embodiments, the vectors of the present invention may be non-viral vectors, such as nanoparticles and liposomes.

[0053] The present invention also provides immune cells modified to contain one or more polypeptides, polynucleotides, or vectors of the present invention. The cells may be immune effector cells, including T cells such as cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CIK) cells, cytotoxic T lymphocytes (CTLs), and tumor-infiltrating lymphocytes (TILs). The modified cells may be used in adoptive cell transfer to treat diseases (e.g., cancer).

[0054] The present invention also provides methods for inducing an immune response in a subject using the compositions of the present invention, methods for reducing tumor burden in a subject using the compositions of the present invention, and methods for preventing or reversing T cell depletion. [Brief explanation of the drawings]

[0055] [Figure 1]1 shows a schematic diagram of a biological circuit system of the present invention. The biological circuit comprises a stimulus and at least one effector module that responds to the stimulus, producing a signal or result. The effector module includes at least one stimulus response element (SRE) and a payload. [Figure 2] A representative effector module carrying one payload is shown. The signal sequence (SS), SRE, and payload may be positioned or arranged in various configurations, without (A-F) or with (G-Z and AA-DD) cleavage sites. Optional linkers may be inserted between each component of the effector module. [Figure 3] A representative effector module carrying two payloads and no cleavage site is shown. The two payloads can be directly linked to each other or can be separate. [Figure 4] A representative effector module carrying two payloads and having a cleavage site is shown. In one embodiment, the SS is located at the N-terminus of the construct, while the other components: the SRE, two payloads, and the cleavage site may be located at different positions (A-L). In another embodiment, the cleavage site is located at the N-terminus of the construct (M-X). Optional linkers may be inserted between each component of the effector module. [Figure 5] An effector module of the invention carrying two payloads is shown, with the SRE located at the N-terminus of the construct (A-L), while the SS, two payloads, and cleavage site can be configured in any manner. Optional linkers may be inserted between each component of the effector module. [Figure 6] The effector module of the present invention, which carries two payloads, is shown. Either two payloads (A-F) or one of two payloads (G-X) is placed at the N-terminus of the construct (A-L), while the SS, SRE, and cleavage site can be configured in any way. An optional linker may be inserted between each component of the effector module. [Figure 7]A representative configuration of stimulus and effector modules within a biological circuit is shown. A free stimulus (Figure 7A) or membrane-bound stimulus (Figure 7B) that binds to an SRE activates a transmembrane effector module. In response to the stimulus, the intracellular signal / payload is cleaved, activating the downstream effector / payload. [Figure 8] This shows a dual-stimulus-dual-presenter biological circuit system in which two binding stimuli (A and B) from two different presenters (e.g., different cells) simultaneously bind to two different effector modules on a single receiver (e.g., another single cell), generating dual signals to downstream payloads. [Figure 9] This shows a dual-stimulus-single-presenter biological circuit system in which two binding stimuli (A and B) from the same presenter (e.g., a single cell) simultaneously bind to two different effector modules on another single cell, generating dual signals. [Figure 10] A single-stimulus-bridged-receiver biological circuit system is shown, in which a binding stimulus (A) binds to an effector module on a bridge cell, generating a signal to activate a payload, which then becomes a stimulus (B) for another effector module on a final receiver (e.g., another cell). [Figure 11] This shows a single-stimulus-single-receiver type biological circuit system, in which a single receiver contains two effector modules, which are sequentially activated by a single stimulus. [Figure 12] (B) A biological circuit system requiring dual activation. In this embodiment, one stimulus must first bind to the transmembrane effector module and prime the receiver cell, which is then activated by the other stimulus. The receiver is activated only if it senses both stimuli (C). [Figure 13] 1 is a line graph showing the effect of Shield-1 on DD-IL2 levels. [Figure 14] The frequency of IFNγ-positive T cells is shown. [Figure 15A-1] IFNγ production in T cells. [Figure 15A-2] IFNγ production in T cells. [Figure 15B] Figure 1 shows T cell proliferation in the presence of IL15 / IL15Ra treatment. [Figure 15C] 1 is a dot plot showing the percentage of human cells after in vivo cell transplantation. [Figure 15D] FIG. 1 is a scatter plot showing CD4+ / CD8+ T cells. [Figure 16A] 1 is a Western blot showing luciferase levels in DD-luciferase expressing cells. [Figure 16B] Luciferase activity is shown. [Figure 17] (Figure 17A) Western blot showing DD-regulated expression of FOXP3. (Figure 17B) Western blot showing DD-regulated expression of FOXP3. [Figure 18] 1 is a bar graph depicting the effect of promoters on transgene expression. [Figure 19] Figure 1 shows Shield-1 regulation of DD-IL2 secretion from HCT116 cells in vivo. [Figure 20] Shown is the viability of T cells cultured with different ratios of CD3 / CD8 beads. [Figure 21] The percentage of BCMA CAR-positive T cells by ligand treatment is shown. DETAILED DESCRIPTION OF THE INVENTION

[0056] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are described herein. Other features, objects, and advantages of the invention will become apparent from the description. In the description, the singular also includes the plural unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present description shall control.

[0057] I. Introduction Cancer immunotherapy aims to induce or restore immune system responsiveness against cancer. Significant advances in immunotherapy research have led to the development of various strategies that can be broadly classified as active and passive immunotherapy. Generally, these strategies can be utilized to directly kill cancer cells or counteract the immunosuppressive tumor microenvironment. Active immunotherapy aims to induce an endogenous, long-lasting tumor antigen-specific immune response. Responses can be further enhanced by nonspecific stimulation of immune response modifiers such as cytokines. In contrast, passive immunotherapy involves administering immune effector molecules, such as tumor antigen-specific cytotoxic T cells or antibodies, to the host. This approach is temporary and requires multiple treatments.

[0058] Despite significant advances, the efficacy of current immunotherapy strategies is limited by associated toxicities. These are often related to the narrow treatment window associated with immunotherapy and, in part, stem from the need to push therapeutic doses to the limits of potentially fatal toxicity in order to achieve clinically meaningful therapeutic effects. Furthermore, adoptively transferred immune cells often continue to expand unpredictably within patients, resulting in in vivo dose escalation.

[0059] A major risk associated with immunotherapy is on-target but off-tumor side effects resulting from T cell activation in response to normal tissue expression of tumor-associated antigens (TAA). Clinical trials utilizing T cells expressing T cell receptors against specific TAAs have reported skin rash, colitis, and hearing loss in response to immunotherapy.

[0060] Immunotherapy can also cause on-target, on-tumor toxicity, which occurs when tumor cells are killed in response to immunotherapy.Adverse effects include tumor lysis syndrome, cytokine release syndrome, and related macrophage activation syndrome.Importantly, these adverse effects may occur during tumor destruction, and therefore, even if on-tumor immunotherapy is successful, toxicity may occur.Therefore, the approach of regulating immunotherapy is highly desirable, as it may reduce toxicity and maximize efficacy.

[0061] The present invention provides systems, compositions, immunotherapeutic agents, and methods for cancer immunotherapy. These compositions provide tunable regulation of gene expression and function in immunotherapy. The present invention also provides biological circuit systems, effector modules, stimulus response elements (SREs), and payloads, as well as polynucleotides encoding any of the foregoing. In one aspect, the systems, compositions, immunotherapeutic agents, and other components of the present invention can be controlled by separately applied stimuli, thereby providing great flexibility for modulating cancer immunotherapy. Furthermore, the systems, compositions, and methods of the present invention may be combined with therapeutic agents such as chemotherapeutic agents, small molecules, gene therapies, and antibodies.

[0062] The tunable nature of the systems and compositions of the present invention has the potential to improve the efficacy and duration of efficacy of immunotherapies. By using the compositions of the present invention to reversibly silence the biological activity of adoptively transferred cells, the potential of cell therapy can be maximized without irreversibly killing them and terminating the treatment.

[0063] The present invention provides a method for fine-tuning immunotherapy after administration to a patient, thereby improving the safety and efficacy of immunotherapy and expanding the subject population that can benefit from immunotherapy.

[0064] II. Compositions of the Invention The present invention provides a biological circuit system comprising at least one effector module system at its core. Such an effector module system includes at least one effector module associated with or integrated with one or more stimulus response elements (SREs). The overall architecture of the biological circuit system of the present invention is shown in Figure 1. Generally, the stimulus response element (SRE) may be operably linked to a payload construct, which may be any protein of interest (POI) (e.g., an immunotherapeutic drug), to form an effector module. When activated by a specific stimulus, such as a small molecule, the SRE generates a signal or result that can up- or down-regulate the transcription and / or protein levels of the linked payload by perpetuating a stabilizing or destabilizing signal, or any other type of regulation. Detailed descriptions of biological circuit systems are provided in commonly owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, U.S. Provisional Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety. In accordance with the present invention, biological circuit systems, effector modules, SREs, and components are provided that modulate the expression levels and activity of any agent used in immunotherapy.

[0065] As used herein, a "biological circuit" or "biological circuit system" is defined as a circuit within or useful within a biological system that includes a stimulus and at least one effector module responsive to the stimulus, where the response to the stimulus produces at least one signal or result within, between, as an indicator of, or on the biological system. A biological system is generally understood to be any cell, tissue, organ, organ system, or organism, such as an animal, plant, fungus, bacterium, or virus. It is also understood that a biological circuit may be an artificial circuit that uses a stimulus or effector module as described herein to provide a signal or result in a cell-free environment, such as a diagnostic, reporter system, device, assay, or kit. The artificial circuit may also be associated with one or more electronic, magnetic, or radioactive components or components.

[0066] According to the present invention, the biological circuitry may be a destabilization domain (DD) biological circuitry, a dimerization biological circuitry, a receptor biological circuitry, and a cell biological circuitry, any of which may act as a signal to any other of these biological circuits.

[0067] Effector modules and SREs for immunotherapy The present invention provides biological circuits, effector modules, SREs, and components that modulate the expression level and activity of any agent used in immunotherapy. By way of non-limiting example, immunotherapeutic agents may be antibodies and their fragments and variants, cancer-specific T cell receptors (TCRs) and their variants, anti-tumor-specific chimeric antigen receptors (CARs), chimeric switch receptors, inhibitors of co-inhibitory receptors or ligands, agonists of co-stimulatory receptors and ligands, cytokines, chemokines, cytokine receptors, chemokine receptors, soluble growth factors, metabolic factors, suicide genes, homing receptors, or any agent that elicits an immune response in cells and subjects.

[0068] As described above, the biological circuits of the present invention include at least one effector module as a component of the effector module system. As used herein, an "effector module" is a single- or multi-component construct or complex that includes at least (a) one or more stimulus response elements (i.e., proteins of interest (POIs)). As used herein, a "stimulus response element (SRE)" is a component of an effector module that binds, connects, links, or associates with one or more payloads of the effector module and, in some cases, is responsible for the responsiveness of the effector module to one or more stimuli. As used herein, the nature of the "responsiveness" of an SRE to a stimulus can be characterized by covalent or non-covalent interactions, direct or indirect associations, or structural or chemical responses to the stimulus. Furthermore, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response may ultimately result in a regulated signal or output. Such output signals may be relative in nature to the stimulus, for example, a modulation effect between 1% and 100%, or an increase or decrease by a factor such as 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more.

[0069] In some embodiments, the present invention provides methods for modulating protein expression, function, or levels. In some aspects, modulation of protein expression, function, or levels means modulation of protein expression, function, or levels by at least about 20%, e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, This refers to 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% modulation of expression, function or levels.

[0070] In some embodiments, the present invention provides methods for modulating protein expression, function, or levels by measuring stabilization and destabilization ratios. As used herein, a stabilization ratio can be defined as the ratio of the expression, function, or level of a protein of interest in response to a stimulus to the expression, function, or level of the protein of interest in the absence of the SRE-specific stimulus. In some aspects, the stabilization ratio is at least 1, e.g., at least 1-10, 1-20, 1-30, 1-40, 1-50, 1-60, 1-70, 1-80, 1-90, 1-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-95, 20-100, 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-95, 30- 100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-95, 40-100, 50-60, 50-70, 50-80, 50-90, 50-95, 50-100, 60-70, 60-80, 60-90, 60-95, 60-100, 70-80, 70-90, 70-95, 70-100, 80-90, 80-95, 80-100, 90-95, 90-100, or 95-100. As used herein, a destabilization ratio may be defined as the ratio of expression, function, or levels of a protein of interest in the absence of a stimulus specific for the effector module to the expression, function, or levels of a protein of interest constitutively expressed and in the absence of a stimulus specific for the SRE. As used herein, "constitutively" refers to the expression, function or level of a protein of interest that is not linked to an SRE and is therefore expressed in both the presence and absence of a stimulus.In some embodiments, the destabilization rate is at least 0, e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or at least 0-0.1, 0-0.2, 0-0.3, 0-0.4, 0-0.5, 0-0.6, 0-0.7, 0-0.8, 0-0.9, 0.1-0.2, 0.1-0.3, 0.1-0.4, 0.1-0.5, 0.1-0.6, 0.1-0.7, 0.1-0.8, 0.1-0.9, 0.2-0.3, 0.2-0.4, 0 0.2-0.5, 0.2-0.6, 0.2-0.7, 0.2-0.8, 0.2-0.9, 0.3-0.4, 0.3-0.5, 0.3-0.6, 0.3-0.7, 0.3-0.8, 0.3-0.9, 0.4-0.5, 0.4-0.6, 0.4-0.7, 0.4-0.8, 0.4-0.9, 0.5-0.6, 0.5-0.7, 0.5-0.8, 0.5-0.9, 0.6-0.7, 0.6-0.8, 0.6-0.9, 0.7-0.8, 0.7-0.9 or 0.8-0.9.

[0071] The SRE of the effector module can be selected from, but not limited to, a peptide, a peptide complex, a peptide-protein complex, a protein, a fusion protein, a protein complex, and a protein-protein complex. The SRE can comprise one or more regions derived from any native or mutant protein or antibody. In this embodiment, the SRE is an element that responds to a stimulus and can regulate the intracellular localization, intramolecular activation, and / or degradation of the payload.

[0072] In some embodiments, effector modules of the present invention may contain additional features that facilitate expression and regulation of the effector module, such as one or more signal sequences (SS), one or more cleavage and / or processing sites, one or more targeting and / or penetrating peptides, one or more tags, and / or one or more linkers. Furthermore, effector modules of the present invention may further contain other regulatory moieties, such as an inducible promoter, an enhancer sequence, a microRNA site, and / or a microRNA targeting site. Each aspect or modality may confer differentially tailored properties to the effector module or biological circuit. For example, an SRE may represent a destabilization domain, while mutation of the protein payload may alter its cleavage site, dimerization properties, or half-life, and the inclusion of one or more microRNAs or microRNA-binding sites may confer cellular detargeting or trafficking properties. Consequently, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biological circuits may be designed to contain one, two, three, four, or more tailored properties.

[0073] In some embodiments, the effector module of the present invention may contain one or more degrons to modulate expression. As used herein, "degron" refers to the minimal sequence within a protein sufficient for recognition and degradation by a proteolytic system. An important property of a degron is that it is transposable; that is, adding a degron to a sequence results in degradation of that sequence. In some embodiments, a degron may be added to a destabilization domain, a payload, or both. Incorporation of a degron into an effector module of the present invention may confer additional protein instability to the effector module, which may be used to minimize basal expression. In some embodiments, the degron may be an N-degron, a phosphodegron, a heat-inducible degron, a light-sensitive degron, or an oxygen-dependent degron. As a non-limiting example, the degron may be the ornithine decarboxylase degron described by Takeuchi et al. (Takeuchi J et al. (2008). Biochem J. 2008 Mar 1;410(2):401-7; the contents of which are incorporated by reference in their entirety.) Other examples of degrons useful in the present invention include those described in International Patent Publication Nos. WO2017004022, WO2016210343, and WO2011062962; the contents of each are incorporated by reference in their entirety.

[0074] As shown in Figure 2, a representative effector module embodiment containing one payload, i.e., one immunotherapeutic agent, is shown. The components of the effector module may be positioned or arranged in various configurations, without (A-F) or with (G-Z and AA-DD) cleavage sites. Optional linkers may be inserted between the components of the effector module.

[0075] Figures 3-6 show exemplary effector module embodiments containing two payloads, i.e., two immunotherapeutic agents. In some embodiments, an effector module may contain three or more immunotherapeutic agents (payloads) under the control of the same SRE (e.g., the same DD). The two or more agents may be directly linked to each other or may be separate (Figure 3). The SRE may be located at the N-terminus of the construct, the C-terminus of the construct, or an internal location.

[0076] In some embodiments, the two or more immunotherapeutic agents may be of the same type, e.g., two antibodies, or of different types, e.g., a CAR construct and the cytokine IL12. Biological circuits and components utilizing such effector molecules are shown in Figures 7-12.

[0077] In some embodiments, the biological circuits of the present invention may be modified to reduce their immunogenicity. Immunogenicity is the result of a complex series of responses to substances recognized as foreign, which may include the production of neutralizing and non-neutralizing antibodies, immune complex formation, complement activation, mast cell activation, inflammation, hypersensitivity reactions, and anaphylaxis. Several factors, including but not limited to the protein sequence, route and frequency of administration, and patient population, may contribute to the immunogenicity of a protein. In preferred embodiments, the compositions of the present invention may be modified to reduce their immunogenicity. In some embodiments, modifications to reduce immunogenicity may include modifications that reduce binding of processed peptides derived from the parent sequence to major histocompatibility complex (MHC) proteins. For example, amino acid modifications may be designed to ensure a minimum number of immune epitopes are available for high-affinity binding to any common MHC allele. Several methods for identifying MHC-binding epitopes of known protein sequences are known in the art and may be useful in the present invention. Such methods are disclosed in U.S. Patent Publication Nos. US20020119492, US20040230380, and US20060148009; the contents of each are incorporated by reference in their entirety.

[0078] Epitope identification and subsequent sequence modification may be applied to reduce immunogenicity. Identification of immunogenic epitopes may be achieved using physical or computational methods. Physical methods of epitope identification may include, for example, mass spectrometry and tissue culture / cell techniques. Computational approaches use information on antigen processing, antigen loading, and antigen presentation, structural data, and / or proteomic data to identify non-self peptides produced by antigen processing that have good binding properties to the MHC groove. One or more mutations that direct protein expression may be introduced into the biological circuit of the present invention to maintain its function while simultaneously making the identified epitope less immunogenic or abolishing it.

[0079] Protein modifications may also be used to interfere with antigen processing and peptide loading, such as glycosylation and PEGylation. The compositions of the present invention may also be designed to contain non-classical amino acid side chains to design compositions with reduced immunogenicity. Any of the methods discussed in International Patent Publication No. WO2005051975 for reducing immunogenicity may be useful in the present invention (the contents of which are incorporated by reference in their entirety).

[0080] In one embodiment, patients may be stratified according to the immunogenic peptides presented by their immune cells, which may be used as a parameter to determine appropriate patient cohorts that may benefit therapeutically from the compositions of the invention.

[0081] In some embodiments, reduced immunogenicity can be achieved by limiting immunoproteasome processing. The proteasome is an important cellular protease found in two forms: the constitutive proteasome, which is expressed in all cell types and contains an active, e.g., catalytic, subunit, and the immunoproteasome, which is expressed in cells of the hematopoietic system and contains distinct active subunits called low molecular weight proteins (LMPs), namely LMP-2, LMP-7, and LMP-10. The immunoproteasome exhibits altered peptidase activity and cleavage site preferences, resulting in more efficient release of many MHC class I epitopes. A well-described function of the immunoproteasome is to generate peptides with hydrophobic C-termini that can be processed to fit into the groove of MHC class I molecules. Deol P et al. showed that the immunoproteasome leads to frequent cleavage of specific peptide bonds, thereby allowing specific peptides to appear more quickly on the surface of antigen-presenting cells and increasing the amount of peptide (Deol P et al. (2007) J Immunol 178(12)7557-7562; the contents of which are incorporated herein by reference in their entirety). This study indicates that reduced immunoproteasome processing may be accompanied by reduced immunogenicity. In some embodiments, the immunogenicity of the compositions of the present invention may be reduced by modifying the encoding sequence of the compositions of the present invention to prevent immunoproteasome processing. The biological circuit of the present invention may also be used in combination with an immunoproteasome-selective inhibitor to achieve the same effect. Examples of inhibitors useful in the present invention include UK-101 (a Bli-selective compound), IPSI-001, ONX0914 (PR-957), and PR-924 (IPSI).

[0082] Another embodiment of the present invention provides a method for detecting the presence of cancer in a mammal, comprising: (a) contacting a sample comprising one or more cells from the mammal with any of a CAR, nucleic acid, recombinant expression vector, host cell, cell population, or pharmaceutical composition of the present invention, thereby forming a complex; and (b) detecting the complex, wherein detection of the complex indicates the presence of cancer in the mammal. The sample may be obtained by any suitable method, for example, biopsy or autopsy. A biopsy is the removal of tissue and / or cells from an individual. Such removal may involve obtaining tissue and / or cells from the individual in order to perform experiments on the removed tissue and / or cells. This experiment may also be used to determine whether an individual has and / or is afflicted with cancer.

[0083] Regarding the embodiment of the method of the present invention for detecting the presence of cancer in a mammal, the sample containing mammalian cells can be a sample containing whole cells, their lysate, or a fraction of whole cell lysate, such as a nuclear or cytoplasmic fraction, a total protein fraction, or a nucleic acid fraction. When the sample contains whole cells, the cells can be any cells of a mammal, for example, cells of any organ or tissue, including tumor cells. The contacting can occur in vitro or in vivo in a mammal. Preferably, the contacting is in vitro. Furthermore, detection of the complex can be performed by many methods known in the art. For example, the CAR, nucleic acid, recombinant expression vector, host cell, cell population, or pharmaceutical composition of the present invention described herein can be labeled with a detectable label, such as a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and a nuclear particle (e.g., gold particle). Methods for testing the compositions of the present invention for their ability to recognize target cells and antigen specificity are known in the art. For example, Clay et al., J. Immunol., 163:507-51 3 (1999) show methods for measuring the release of cytokines (e.g., interferon-γ, granulocyte / monocyte colony-stimulating factor (GM-CSF), tumor necrosis factor α (TNF-α), or interleukin 2 (IL2)). Furthermore, the function of anti-CD276 agents can be assessed by measuring cytotoxicity, as described in Zhao et al., J. Immunol., 174:44)5-4423 (2005).

[0084] In some embodiments, the stimulus of the present invention may be an ultrasound stimulus. In some embodiments, the SRE of the present invention may be derived from a mechanosensitive protein. In one embodiment, the SRE of the present invention may be the mechanosensitive ion channel, Piezo1.

[0085] In such cases, expression of the target payload is regulated by providing focused ultrasound stimulation. In other embodiments, the SRE of the present invention may be derived from a calcium biosensor, and the stimulus of the present invention may be calcium. Calcium may be generated by ultrasound-induced mechanical stimulation of a mechanosensitive ion channel. Ultrasound activation of the ion channel causes calcium influx, thereby generating the stimulus. In one embodiment, the mechanosensitive ion channel is Piezo1. Mechanosensors can be advantageously used because they provide spatial control over specific locations within the body.

[0086] 1. Destabilization domain (DD) In some embodiments, the biological circuit systems, effector modules, and compositions of the present invention relate to post-translational modulation of protein (payload) function in anti-tumor immune responses of immunotherapeutics. In one embodiment, the SRE is a stabilizing / destabilizing domain (DD). The presence, absence, or amount of a small molecule ligand that binds to or interacts with the DD can modulate the stability of the payload(s) and, therefore, the function of the payload, due to such binding or interaction. Depending on the degree of binding and / or interaction, the altered function of the payload may vary, thus providing "tuning" of payload function.

[0087] In some embodiments, destabilization domains described herein or known in the art may be used as SREs in the biological circuit systems of the present invention in conjunction with any of the immunotherapeutic drugs (payloads) described herein. A destabilization domain (DD) is a small protein domain that can be added to a target protein of interest. The DD destabilizes the attached protein of interest in the absence of a DD-binding ligand, so that the protein is rapidly degraded by the cellular ubiquitin-proteasome system (reviewed in Stankunas, K., et al., Mol. Cell, 2003, 12:1615-1624; Banaszynski, et al., Cell; 2006, 126(5):995-1004; Banaszynski, L.A., and Wandless, T.J. Chem. Biol.; 2006, 13:11-21; and Rakhit R. et al., Chem. Biol. 2014, 21(9):1238-1252). However, upon binding of a specific small molecule ligand to the intended DD as a ligand-binding partner, the instability is reversed and protein function is restored. The conditional nature of DD stability allows for rapid, non-perturbative switching from a stable protein to a substrate unstable to degradation. Furthermore, its ligand concentration dependence further provides tunable control of the degradation rate.

[0088] In some embodiments, desirable properties of a DD may include, but are not limited to, low protein levels in the absence of the DD's ligand (i.e., low basal stability), a large dynamic range, robust and predictable dose-response behavior, and rapid degradation rates. A DD that binds to a desired ligand but not endogenous molecules may be preferred.

[0089] Several protein domains with destabilizing properties and their paired small molecules have been identified and used to control protein expression, including the FKBP / shield-1 system (Egeler et al., J. Biol. Chem. 2011, 286(36):32328-31336; the contents of which are incorporated herein by reference in their entirety), ecDHFR and its ligand trimethoprim (TMP); estrogen receptor domains that can be regulated by several estrogen receptor antagonists (Miyazaki et al., J. Am. Chem. Soc., 2012, 134(9):3942-3945; the contents of which are incorporated herein by reference in their entirety); and the fluorescence destabilizing domain (FDD) derived from the bilirubin-inducible fluorescent protein UnaG and its cognate ligand bilirubin (BR) (Navarro et al., ACS Chem Biol., 2016, June 6; the contents of which are incorporated herein by reference in their entirety).

[0090] Known DDs also include those described in US Pat. No. 8,173,792 and US Pat. No. 8,530,636, the contents of which are incorporated herein by reference in their entirety.

[0091] In some embodiments, the DD of the present invention can be derived from several known sequences recognized to be capable of post-translational protein regulation. For example, Xiong et al. showed that the non-catalytic N-terminal domain (54 residues) of Arabidopsis ACS7 (1-aminocyclopropane-1-carboxylic acid synthase) can significantly reduce the accumulation of GUS fusion proteins when fused to a β-glucuronidase (GUS) reporter (Xiong et al., J. Exp. Bot., 2014, 65(15):4397-4408). Xiong et al. further showed that both exogenous 1-aminocyclopropane-1-carboxylic acid (ACC) treatment and salt can rescue the N-terminus of ACS and the accumulation level of GUS fusion proteins. The N-terminus of ACS mediates the regulation of ACS7 stability via the ubiquitin-26S proteasome pathway.

[0092] Another non-limiting example is the stability control region (SCR, residues 97-118) of tropomyosin (Tm), which controls protein stability. The destabilizing mutation L110A and the stabilizing mutation A109L dramatically affect the dynamics of tropomyosin protein (Kirwan and Hodges, J. Biol. Chem., 2014, 289:4356-4366). Such sequences can be screened for ligands that bind to them and modulate their stability. Identified sequence and ligand pairs may be used as building blocks of the present invention.

[0093] In some embodiments, the DDs of the present invention may be developed from known proteins. Regions, portions, or domains of wild-type proteins may be utilized, in whole or in part, as SREs / DDs. These may be combined or rearranged to create novel peptides, proteins, regions, or domains, any of which may be used as SREs / DDs or as starting points for the design of additional SREs and / or DDs.

[0094] Ligands, such as small molecules known to bind to candidate proteins, can be tested for their modulation of protein responses. The small molecules may be clinically approved for safety and have suitable pharmacokinetics and distribution. In some embodiments, the stimulus is a ligand of a destabilization domain (DD), e.g., a small molecule that binds to a destabilization domain and stabilizes a POI fused to the destabilization domain. In some embodiments, the ligands, DDs, and SREs of the present invention include, but are not limited to, any of those set forth in Tables 2-4 of co-pending, co-owned U.S. Provisional Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO 2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety. Some examples of proteins that can be used to develop DDs and their ligands are listed in Table 1. [Table 1-1] [Table 1-2] [Table 1-3]

[0095] In some embodiments, a DD of the present invention can be an FKBP DD or an ecDHFR DD as listed in Table 2. The positions of the mutant amino acids listed in Table 2 are relative to ecDHFR (Uniprot ID: P0ABQ4) of SEQ ID NO: 1 for ecDHFR DD, and relative to FKBP (Uniprot ID: P62942) of SEQ ID NO: 3 for FKBP DD. [Table 2]

[0096] The present inventors have tested and identified several candidate human proteins that can be used to develop destabilization domains. As shown in Table 2, these candidates include human DHFR (hDHFR), PDE5 (phosphodiesterase 5), PPARγ (peroxisome proliferator-activated receptor γ), CA2 (carbohydrate anhydrase II), and NQO2 (NRH:quinone oxidoreductase 2). Destabilization domain sequences identified from the protein domains of these proteins (as templates) can be mutagenized to generate mutant libraries based on the template candidate domain sequences. Mutagenesis strategies used to generate DD libraries can include, for example, site-directed mutagenesis using structure-guided information; or random mutagenesis using, for example, error-prone PCR, or a combination of both. In some embodiments, destabilization domains identified using random mutagenesis can be used to identify structural features of candidate DDs that may be required for destabilization, which can then be used to generate further mutant libraries using site-directed mutagenesis.

[0097] In some embodiments, the novel DD derived from E. coli DHFR (ecDHFR) can include amino acids 2-159 of the wild-type ecDHFR sequence, which may be referred to as the M1del mutation.

[0098] In some embodiments, the novel DD derived from ecDHFR may include amino acids 2-159 of the wild-type ecDHFR sequence (also referred to as the M1del mutation) and may contain one, two, three, four, five or more mutations, including, but not limited to, M1del, R12Y, R12H, Y100I, and E129K.

[0099] In some embodiments, the novel DD from FKBP may have amino acids 2-107 of the wild-type FKBP sequence, which may be referred to as the M1del mutation.

[0100] In some embodiments, the novel DD derived from FKBP may have amino acids 2-107 of the wild-type FKBP sequence (also referred to as the M1del mutation) and may contain one, two, three, four, five or more mutations, including, but not limited to, M1del, E31G, F36V, R71G, K105E, and L106P.

[0101] In some embodiments, a DD mutant library can be screened for mutations that have altered, preferably higher, binding affinity for a ligand compared to the wild-type protein. The DD library can be screened using two or more ligands to preferentially select DD mutations that stabilize with some ligands but not others. DD mutations that bind preferentially to a ligand compared to the native protein can also be selected. Such methods can be used to optimize the ligand selectivity and ligand-binding affinity of the DD. Furthermore, such an approach can be used to minimize adverse effects caused by off-target ligand binding.

[0102] In some embodiments, suitable DDs may be identified by screening a mutant library using barcodes. Such methods may be used to detect, identify, and quantify individual mutant clones within a heterogeneous mutant library. Each DD mutant within a library may have a different barcode sequence (relative to each other). In other examples, polynucleotides may also have barcode sequences that differ by 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleobases. Each DD mutant within a library may have multiple barcode sequences. When multiple barcodes are used, each barcode may be unique relative to any other barcode. Alternatively, each barcode used may not be unique, but the combination of barcodes used may create unique sequences that can be individually tracked. The barcode sequence may be located upstream of the SRE, downstream of the SRE, or, in some instances, within the SRE. DD mutants may be identified by barcodes using sequencing approaches such as Sanger sequencing or next-generation sequencing, but may also be identified by polymerase chain reaction or quantitative polymerase chain reaction. In some embodiments, each barcode may be identified on an agarose gel using polymerase chain reaction primers that amplify a different size product for each barcode. In other examples, each barcode may have a unique quantitative polymerase chain reaction probe sequence that allows for targeted amplification of each barcode.

[0103] In some embodiments, the DD of the present invention can be derived from human dihydrofolate reductase (hDHFR). hDHFR is a small (18 kDa) enzyme that catalyzes the reduction of dihydrofolate and plays a key role in various anabolic pathways. Dihydrofolate reductase (DHFR) is an essential enzyme that converts 7,8-dihydrofolate (DHF) to 5,6,7,8-tetrahydrofolate (THF) in the presence of nicotinamide adenine dihydrogen phosphate (NADPH). Antifolate drugs, such as methotrexate (MTX), a structural analog of folic acid, bind more tightly to DHFR than to the natural substrate DHF, interfering with folate metabolism primarily through inhibition of dihydrofolate reductase and suppressing the synthesis of purine and pyrimidine precursors. Other inhibitors of hDHFR, such as folic acid, TQD, trimethoprim (TMP), epigallocatechin gallate (EGCG) and ECG (epicatechin gallate), can also bind to hDHFR mutants and modulate their stability.

[0104] In one aspect of the invention, the DHFR DD is V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N 20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F3 2M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44 A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V 75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A9 7T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N 108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, V11 6I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127 R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135L , F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P1 50L, E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K15 8R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G , E173G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E,These mutations may include, but are not limited to, mutations such as N186S, N186D, D187G, and D187N.

[0105] In one embodiment, the stimulus is a small molecule that binds to the SRE to regulate post-translational protein levels. In one aspect, the DHFR ligands trimethoprim (TMP) and methotrexate (MTX) are used to stabilize hDHFR mutants. Destabilization domains based on hDHFR are listed in Table 3. The positions of the mutated amino acids listed in Table 3, for human DHFR, are relative to human DHFR of SEQ ID NO: 2 (Uniprot ID: P00374). In Table 3, mutations are underlined and in bold. In Table 3, "del" means that the mutation at that position compared to the wild-type sequence is a deletion of the amino acid. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]

[0106] In some embodiments, DD mutations that do not inhibit ligand binding may be preferentially selected. In some embodiments, DHFR residues may be mutated to improve ligand binding. Amino acid positions selected for mutation include aspartic acid at position 22 of SEQ ID NO:2, glutamic acid at position 31 of SEQ ID NO:2; phenylalanine at position 32 of SEQ ID NO:2; arginine at position 33 of SEQ ID NO:2; glutamine at position 36 of SEQ ID NO:2; asparagine at position 65 of SEQ ID NO:2; and valine at position 115 of SEQ ID NO:2. In some embodiments, one or more mutations, including but not limited to the following, may be utilized in the DD of the present invention to improve TMP binding. The mutated amino acid positions are relative to the wild-type human DHFR of SEQ ID NO:2 (Uniprot ID: P00374).

[0107] In some embodiments, the novel DDs from human DHFR are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I7 2T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G , S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P10 4S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K1 23R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132 P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T14 7A, F148S, F148L, F149L, P150L, ​​E151G, I152V, D153A, D153G, E155G, K156R , Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D 169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T, K17 7E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G,It may contain one, two, three, four, five or more mutations, including, but not limited to, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.

[0108] In some embodiments, the novel DD derived from human DHFR may comprise amino acids 2-187 of the wild-type human DHFR sequence, which may be referred to as the M1del mutation.

[0109] In some embodiments, the novel DD derived from human DHFR may have amino acids 2-187 of the wild-type human DHFR sequence (also referred to as the M1del mutation), and may be any of the following: M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K6 4R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D9 6G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107 V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M12 6I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P , F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M1 40V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149 L, P150L, ​​E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K 158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E17 2G, E173G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H,The mutations may include one, two, three, four, five or more mutations, including, but not limited to, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.

[0110] 2. Stimulation The biological circuits of the present invention are induced by one or more stimuli, which may be selected from ligands, exogenously added or endogenous metabolites, the presence or absence of a defined ligand, pH, temperature, light, ionic strength, radioactivity, cell location, target site, microenvironment, and the presence or concentration of one or more metal ions.

[0111] In some embodiments, the stimulus is a ligand. The ligand may be nucleic acid-based, protein-based, lipid-based, organic, inorganic, or any combination of the foregoing. In some embodiments, the ligand is selected from the group consisting of proteins, peptides, nucleic acids, lipids, lipid derivatives, sterols, steroids, metabolite derivatives, and small molecules. In some embodiments, the stimulus is a small molecule. In some embodiments, the small molecule is cell-permeable. Ligands useful in the present invention include, but are not limited to, those listed in Table 2 of co-pending and co-owned U.S. Ser. No. 62 / 320,684, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO 2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the small molecule is FDA-approved, safe, and orally administered.

[0112] In some embodiments, the ligand binds to dihydrofolate reductase. In some embodiments, the ligand binds to dihydrofolate reductase and inhibits its function, referred to herein as a dihydrofolate inhibitor.

[0113] In some embodiments, the ligands may be selective inhibitors of human DHFR. The ligands of the invention may also be selective inhibitors of dihydrofolate reductase in bacteria and parasites, such as Pneumocystis species, Toxoplasma species, Trypanosoma species, Mycobacterium species, and Streptococcus species. Other DHFR-specific ligands may be modified to improve binding to human dihydrofolate reductase.

[0114] Examples of dihydrofolate inhibitors include, but are not limited to, trimethoprim (TMP), methotrexate (MTX), pralatrexate, piritrexim-pyrimethamine, tarotrexin, chlorguanide, pentamidine, trimetrexate, aminopterin, C1 898 trihydrochloride, pemetrexed disodium, raltitrexed, sulfaguanidine, folothin, iclaprim, and diaveridine.Other examples of DHFR inhibitors include BAL0030543, BAL0030544, and BAL0030545 developed by Basilea Pharmaceuticals; and WR99210, and P218, any of the inhibitors described by Zhang Q et al. (2015) Int J Antimicrob Agents. 2015 Aug; 46(2): 174-182 (the contents of which are incorporated herein by reference in their entirety). Some inhibitors contain bulky benzyl groups that dramatically reduce binding to human DHFR. In some embodiments, inhibitors may be designed without bulky benzyl groups to improve TMP binding.

[0115] In some embodiments, the ligands of the present invention may be polyglutamate or may not be polyglutamylated. Like natural folates, polyglutamylated folates contain glutamic acid residues and therefore undergo intracellular polyglutamylation. In contrast, non-polyglutamylated antifolates lack glutamic acid residues and therefore are not accessible to polyglutamylation. In some embodiments, polyglutamylated ligands may be preferred for increased intracellular retention, as they can no longer be transported out of cells. In other embodiments, non-polyglutamylated ligands may be preferred for reduced intracellular retention.

[0116] In some embodiments, the ligands of the present invention may include dihydrofolic acid or any of its derivatives capable of binding to human DHFR. In some embodiments, the ligands of the present invention may be 2,4-diaminoheterocyclic compounds. In some embodiments, the 4-oxo group of dihydrofolic acid may be modified to generate DHFR inhibitors. In one example, the 4-oxo group may be replaced with a 4-amino group. Various diaminoheterocycles, including pteridines, quinazolines, pyridopyrimidines, pyrimidines, and triazines, may also be used as scaffolds for developing DHFR inhibitors and may be used in the present invention. Crystal structures of DHFR complexed with known DHFR inhibitors may be utilized in the rational design of more suitable DHFR ligands. Ligands used herein include a 2,4-diaminopyrimidine ring bearing a propargyl group linked to an optionally substituted aryl or heteroaryl ring (as described in U.S. Pat. No. 8,426,432, the contents of which are incorporated herein by reference in their entirety).

[0117] In some embodiments, the ligands include TMP-derived ligands that contain a portion of the ligand known to mediate binding to DHFR, and the ligands may be modified to decrease off-target binding to other folate metabolism enzymes and increase specific binding to DHFR.

[0118] 3. Payload: Immunotherapeutic drug In some embodiments, the payload of the present invention may be an immunotherapeutic agent that induces an immune response in an organism. The immunotherapeutic agent may be, but is not limited to, a cytokine, a safety switch (e.g., a suicide gene), a regulatory switch, a chimeric antigen receptor, or any agent that induces an immune response. In one embodiment, the immunotherapeutic agent induces an anti-cancer immune response in a cell or a subject.

[0119] In some embodiments, the payload of the present invention may be any of the costimulatory molecules and / or intracellular domains described herein. In some embodiments, one or more costimulatory molecules, each under the control of a different SRE, may be used in the present invention. SRE-regulated costimulatory molecules may also be expressed with first-generation CARs, second-generation CARs, third-generation CARs, fourth-generation CARs, or other CAR designs described herein.

[0120] Cytokines, chemokines, and other soluble factors According to the present invention, the CARs of the present invention may be used in conjunction with other payloads of the present invention, which may be cytokines, chemokines, growth factors, and soluble proteins produced by immune cells, cancer cells, and other cell types, which act as chemical messengers between cells and tissues in the body. These proteins mediate a wide range of physiological functions, from influencing cell proliferation, differentiation, migration, and survival to several effector activities. For example, activated T cells produce various cytokines for cytotoxic function and eliminate tumor cells.

[0121] In some embodiments, the payload of the present invention may be a cytokine, including, but not limited to, an interleukin, tumor necrosis factor (TNF), interferon (IFN), TGFβ, and a chemokine, as well as fragments, variants, analogs, and derivatives thereof. It is understood in the art that specific gene and / or protein nomenclature may or may not include punctuation marks such as dashes or symbols such as Greek letters for the same gene or protein. Whether or not these are included herein does not imply a change in meaning, as understood by those skilled in the art. For example, IL2, IL2, and IL 2 refer to the same interleukin. Similarly, TNF alpha, TNFα, TNF-alpha, TNF-α, TNF alpha, and TNFα all refer to the same protein. In some embodiments, the payload of the present invention may be a cytokine that stimulates an immune response. In other embodiments, the payload of the present invention may be a cytokine antagonist, which negatively impacts anti-cancer immune responses.

[0122] In some embodiments, the payload of the present invention may be a cytokine receptor, a recombinant receptor, variants, analogs, and derivatives thereof; or a signaling component of a cytokine.

[0123] In some embodiments, cytokines of the present invention are utilized to induce CD8+ T cell proliferation for use in immunotherapy. EMThe proliferation, survival, persistence, and efficacy of immune cells, such as thymocytes, natural killer cells, and tumor-infiltrating lymphocyte (TIL) cells, may be improved. In other embodiments, T cells engineered with two or more DD-regulating cytokines are utilized to provide rate control of T cell activation and tumor microenvironment remodeling. In one aspect, the present invention provides biological circuits and compositions for minimizing the toxicity associated with cytokine therapy. Despite successful reduction in tumor burden, systemic cytokine therapy often produces severe, dose-limiting side effects. Two factors contribute to the observed toxicity: (a) pleiotropy, in which cytokines affect different cell types and may produce opposing effects on the same cells depending on the context; and (b) cytokines have short serum half-lives, necessitating administration at high doses to achieve therapeutic efficacy, which exacerbates the pleiotropic effect. In one aspect, cytokines of the present invention may be utilized to regulate cytokine expression in the event of adverse effects. In some embodiments, cytokines of the present invention may be engineered to extend longevity or enhance specificity to minimize toxicity.

[0124] In some embodiments, the payload of the present invention may be an interleukin (IL) cytokine. Interleukins (IL) are a class of glycoproteins produced by white blood cells to regulate immune responses. As used herein, the term "interleukin (IL)" refers to an interleukin polypeptide from any species or source, including full-length proteins as well as fragments or portions of proteins. In some embodiments, the interleukin payload is selected from the group consisting of IL1, IL1α (also known as hematopoietin-1), IL1β (catabolin), IL1δ, IL1ε, IL1η, IL1ζ, interleukin-1 family members 1-11 (IL1F1-IL1F11), interleukin-1 homologs 1-4 (IL1H1-IL1H4), IL1-related proteins 1-3 (IL1RP1-IL1RP3), IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11, IL11a, IL11b, IL12, IL13, The antibody is selected from IL14, IL15, IL16, IL17, IL17A, IL17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20-like (IL20L), IL21, IL22, IL23, IL23A, IL23-p19, IL23-p40, IL24, IL25, IL26, IL27, IL28A, IL28B, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, IL37d, IL37e, and IL38. In another aspect, the payload of the invention may be an interleukin receptor selected from CD121a, CDw121b, IL2Rα / CD25, IL2Rβ / CD122, IL2Rγ / CD132, CDw131, CD124, CD131, CDw125, CD126, CD130, CD127, CDw210, IL8RA, IL11Rα, CD212, CD213α1, CD213α2, IL14R, IL15Rα, CDw217, IL18Rα, IL18Rβ, IL20Rα, and IL20Rβ.

[0125] In one embodiment, the payload of the present invention may comprise IL2. In one aspect, the effector module of the present invention may be a DD-IL2 fusion polypeptide. The amino acid sequences corresponding to DD-IL2 and its components are set forth in Table 4. The amino acid sequences in Table 4 may contain a stop codon, which may be added at the end of the amino acid sequence with " * " is shown in the table. [Table 4-1] [Table 4-2]

[0126] In some aspects of the present invention, an IL2 mutein may be used as a payload. As used herein, the term "mutein" refers to a construct, molecule, or sequence that has a mutation, change, or alteration in a protein, and is therefore also known as a mutant, e.g., a protein mutant, or mutein. Thus, an "IL2 mutein" is an IL2 mutant. In some embodiments, an IL2 mutein is a variant of the wild-type IL2 protein, where wild-type IL2 consists of the amino acid sequence of SEQ ID NO: 51. In some aspects, it refers to an IL2 variant that binds to and activates only cells that express IL2Rαβγ, but does not significantly bind to or activate cells that express only IL2Rβγ. In some examples, an IL2 mutein may be an IL2 protein in which the residues of IL2 responsible for binding to either IL2Rβ or IL2Rγ have been substituted to abolish the interaction of IL2 with IL2Rβ or IL2Rγ. In another example, an IL2 mutein may be an IL2 protein containing a mutation that confers higher affinity for IL2Rα. The IL2 muteins are IL2-selective agonists (IL2Rs) that can preferentially activate the high-affinity IL2 receptor (i.e., IL2Rαβγ) required for selective activation of T cells versus NK cells. SA In some embodiments, the IL2 mutein may be an IL2 protein that preferentially binds to the low affinity IL2Rβγ but has reduced affinity for CD25.

[0127] In some embodiments, the IL2 muteins may be used to preferentially expand or stimulate Treg cells. As used herein, "preferentially expand or stimulate Treg cells" means that the IL2 muteins promote the proliferation, survival, activation and / or function of regulatory T cells.

[0128] Exemplary IL2 muteins include IL2 with an N88R substitution (Shanafelt et al., Nature Biotech., 2000, 18:1197-1202), an IL2 with a V91K substitution (e.g., U.S. Patent Publication No. US20140286898); an IL2 with a V91K substitution, a C125A substitution, and three mutations: V69A, N71R, Q74P; an IL2 mutein with high affinity for IL2Rα (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P); These may include, but are not limited to, IL2 muteins (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P, N88D) that have lower affinity and reduced signaling activity, as well as the D20H, D20I, N88G, N88I, N88R, and Q126L substitutions described in PCT Application No. 1999060128; the contents of each of which are incorporated herein by reference in their entirety. In other aspects, the IL2 muteins include those described in U.S. Patent Nos. 4,518,584; 5,116,943; 5,206,344; 6,955,807; 7,105,653; 7,371,371; 7,803,361; 8,124,066; 8,349,311; 8,759,486; and 9,206,243; PCT Patent Publication Nos. WO2005086751 and WO2012088446; European Patent Nos. EP0234599 and EP0200280; and Sim, GC et al. (2016) Cancer Immunol Res;4(11):983-994; the contents of each of which are incorporated herein by reference in their entirety.

[0129] In some embodiments, the IL2 mutein may be fused to a polypeptide that extends the serum half-life of the IL2 mutein, such as an IgG Fc fragment. Preferred Fc regions are derived from human IgG, including IgG1, IgG2, IgG3, and IgG4. In other embodiments, the payload of the present invention may be an IL2 fusion protein that combines a second functional polypeptide. In a non-limiting example, the IL2 fusion protein may include an IL2 or IL2 mutein polypeptide fused to a pro-apoptotic Bcl-2 family polypeptide (such as Bad, Bik / Nbk, Bid, Bim / Bod, Hrk, Bak, or Bax); such a fusion protein may be capable of inhibiting cell survival, inhibiting cell proliferation, or promoting cell death or apoptosis of target cells expressing the IL2 receptor. Alternatively, the IL2 or IL2 mutein polypeptide may be fused to an anti-apoptotic Bcl-2 family polypeptide (such as Bcl- XL The fusion protein may be fused to a target cell expressing an IL2 receptor (e.g., Bcl-w or Bcl-2). The fusion protein may be capable of enhancing cell survival, enhancing cell proliferation, or inhibiting cell death or apoptosis of target cells expressing the IL2 receptor. See, e.g., U.S. Patent Publication No. US2016 / 0229901.

[0130] Furthermore, IL2 fusion proteins can promote cell-cell interactions; therefore, it may be an IL2-GMCSF fusion protein that promotes anti-cancer immune responses (Wen et al., J. Translational Med., 2016, 14:41).

[0131] safety switch In some embodiments, the payloads of the present invention may include an SRE-regulated safety switch that can eliminate adoptively transferred cells if toxicity is severe, thereby reducing the adverse effects of T cell therapy. In immunotherapy, adoptively transferred T cells may attack normal cells in response to normal tissue expression of TAAs. Even on-tumor targeting activity of adoptively transferred T cells can result in toxicity, such as tumor lysis syndrome, cytokine release syndrome, and related macrophage activation syndrome. A safety switch may be utilized to eliminate inappropriately activated adoptively transferred cells by apoptosis induction or immune surveillance.

[0132] In some embodiments, the payload of the present invention may contain an inducible killer / suicide gene that acts as a safety switch. When introduced into adoptively transferred immune cells, the killer / suicide gene can control their alloreactivity. The killer / suicide gene may also be an apoptotic gene (e.g., any caspase gene) that allows conditional apoptosis of the transduced cells upon administration of a non-therapeutic ligand (e.g., DD) of the SRE.

[0133] In some embodiments, the payload of the present invention may be caspase 9. In some instances, caspase 9 may be modified to reduce basal expression and lack the caspase recruitment domain (CARD) (SEQ ID NO: 26 and SEQ ID NO: 28 of U.S. Pat. No. US9434935B2; the contents of which are incorporated by reference in their entirety).

[0134] In one embodiment, the payload of the present invention is a suicide gene system, the iCasp9 / chemically induced dimerization (CID) system, which consists of a polypeptide derived from the caspase-9 gene fused to a drug-binding domain derived from the human FK506 protein. Administration of the biologically inactive small molecule AP1903 (rimiducid) induces cross-linking of the drug-binding domain and dimerization of the fusion protein, leading to caspase-9 dimerization. This results in activation of the downstream effector caspase-3 and induction of cell apoptosis (Straathof et al., Blood, 2005.105:4247-4254; incorporated herein by reference in its entirety). Preclinical studies using CARTs containing the iCasp9 gene have shown effective in vivo elimination of CAR T cells in mouse models, demonstrating the potential efficacy of this approach (Budde et al, Plos One, 2013, 8:e82742.10.1371; Hoyos et al., Leukemia, 2010; 24(6):1160-1170). In one embodiment, the payload of the invention may comprise caspase 9. In one aspect, the effector module of the invention may be a DD-caspase 9 fusion polypeptide. The DD-caspase 9 may have the amino acid sequence shown in Table 5. The amino acid sequences in Table 5 may contain a stop codon, which may be added by appending " * " is shown in the table. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6]

[0135] In some instances, the iCasp9 / CID system has been shown to exhibit a basal dimerization rate in the absence of rimiducid, resulting in unintended cell death. Regulation of iCasp9 / CID expression levels is important for maximizing the efficacy of the iCasp9 / CID system. The biological circuits of the present invention and / or any of their components may be utilized to modulate or regulate the iCasp9 / CID system to optimize its utility. Other examples of proteins for use in the dimerization-induced apoptosis paradigm may include, but are not limited to, the Fas receptor, the death effector domain of Fas-associated protein, FADD, caspase-1, caspase-3, caspase-7, and caspase-8 (Belshaw PJ et al., Chem Biol., 996, 3:731-738; MacCorkle RA et al., Proc Natl Acad Sci., 1998, 95:3655-3660; Spencer, DM et al., Curr Biol. 1996; 6:839-847; the contents of each are incorporated herein by reference in their entirety).

[0136] In some embodiments, the safety switch of the present invention may comprise metabolic enzymes such as herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD). HSV-TK phosphorylates nucleoside analogs, including acyclovir and ganciclovir (GCV), to generate nucleoside triphosphates, which, when incorporated into DNA, cause chain termination and cell death. Unlike mammalian thymidine kinases, HSV-TK is characterized by a 1000-fold higher affinity for nucleoside analogs such as GCV, making it suitable for use as a suicide gene in mammalian cells. Cytosine deaminase (CD) can convert 5-fluorocytosine (5-FC) to the cytotoxic 5-fluorouracil (5-FU) (Tiraby et al., FEMS Lett., 1998, 167:41-49).

[0137] In some embodiments, a safety switch of the invention may comprise a CYP4B1 variant (as a suicide gene) that may be co-expressed in CAR-modified T cells (Roellecker et al., Gen Ther., 2016, May 19, doi:10.1038 / gt.2016.38).

[0138] In some embodiments, the payloads of the invention may comprise a fusion construct capable of inducing cell death, e.g., a polypeptide having the formula St-R1-S1-Q-S2-R2, where St is a stalk sequence, R1 / 2 and Q are different epitopes; and S1 / 2 is an optional spacer sequence (see International Patent Publication No. WO2013153391, the contents of which are incorporated herein by reference in their entirety).

[0139] In some embodiments, the safety switch may be mediated by a therapeutic antibody that specifically binds to an antigen expressed on the plasma membrane of the adoptively transferred cells. The antigen-antibody interaction allows for the cells to be removed after administration of a specific monoclonal antibody against the antigen. By way of non-limiting example, the payload of the present invention may be an antigen and antibody pair used to mediate a safety switch, such as CD20 and an anti-CD20 antibody (Griffioen et al., Haematologica, 2009, 94:1316-1320), a protein tag and an anti-tag antibody (Kieback et al., Natl. Acad. Sci. USA, 2008, 105:623-628), a compact suicide gene (RQR8) composite epitope derived from CD34 (as a marker moiety) and CD20 (as a suicide moiety) that allows for CD34 selection, cell tracking, and cell deletion after administration of an anti-CD20 monoclonal antibody (Philip et al., Blood, 2014, 124:1277-1287); a truncated human EGFR polypeptide and an anti-EGFR monoclonal antibody (Wang et al., al., Blood, 2011, 118:1255-1263); as well as small polypeptide safety switches having structural formulas as described in U.S. Patent Application Publication No. US20150093401; the contents of each of which are incorporated herein by reference in their entirety.

[0140] Adjustment switch The usefulness of adoptive cell therapy (ACT) has been limited by the high incidence of graft-versus-host disease (GVHD). GVHD occurs when adoptively transferred T cells elicit an immune response resulting in host tissue damage. Recognition of host antigens by transplanted cells triggers a pro-inflammatory cytokine storm cascade, signifying acute GVHD. GVHD is characterized as an imbalance between the effector and regulatory arms of the immune system. In some embodiments, the payload of the present invention may be used as a regulatory switch. As used herein, "regulatory switch" refers to a protein that, when expressed in target cells, enhances tolerance to the graft by strengthening the regulatory arm of the immune system.

[0141] In one embodiment, the regulatory switch can comprise a payload that preferentially promotes the expansion of regulatory T (Treg cells). Tregs are a distinct cell population that are positively selected on high-affinity ligands in the thymus and play a key role in tolerance to self-antigens. Furthermore, Tregs have also been shown to play a role in peripheral tolerance to foreign antigens. Because Tregs promote immune tolerance, expansion of Tregs by the compositions of the present invention may be desirable to limit GVHD.

[0142] In some embodiments, regulatory switches may include, but are not limited to, Treg activators such as NFκβ, FOXO, nuclear receptor Nr4a, retinoic acid receptor α, NFAT, AP-1, and SMAD, which result in expression of Fork headbox P3 (FOXP3) in T cells, leading to activation of the regulatory T cell program and proliferation of T cells.

[0143] In one embodiment, the regulatory switch may be FOXP3, a transcriptional regulator of T cells. The function of FOXP3 is to suppress NFAT function, which leads to the suppression of expression of many genes, including IL2 and effector T cell cytokines. FOXP3 also functions as a transcriptional activator of genes such as CD2S, cytotoxic T lymphocyte antigen 4 (CTLA4), glucocorticoid-inducible TNF receptor family gene (GITR), and folate receptor 4. FOXP3 suppresses the differentiation of IL17-producing helper T cells (Th17) by antagonizing RORC (RAR-related orphan receptor C). FOXP3 isoforms lacking exon 2 (FOXP3δ2) or exon 7 (FOXP3δ7) may also be used as regulatory switches. In one aspect, the effector module of the present invention may be a DD-FOXP3 fusion polypeptide. DD-FOXP3 may comprise the amino acid sequence shown in Table 6. The amino acid sequences in Table 6 may contain a stop codon, which may be indicated by " * " is shown in the table. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5]

[0144] antibody In some embodiments, antibodies, fragments and variants thereof are payloads of the present invention.

[0145] In some embodiments, antibodies of the present invention include, but are not limited to, any of those set forth in Table 5 of co-pending and co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated herein by reference in their entireties.

[0146] Antibody Fragments and Variants In some embodiments, antibody fragments and variants may comprise antigen-binding regions derived from intact antibodies. Examples of antibody fragments and variants include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules such as single-chain variable fragments (scFv); and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments called "Fab" fragments, each with a single antigen-binding site. A residual "Fc" fragment is also produced, the name of which reflects its ability to readily crystallize. Pepsin treatment produces an F(ab')2 fragment with two antigen-binding sites that is still capable of cross-linking antigen. The pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention may comprise one or more of these fragments.

[0147] For purposes of this specification, an "antibody" may include heavy and light chain variable domains as well as an Fc region. As used herein, the term "native antibody" typically refers to a heterotetrameric glycoprotein of approximately 150,000 daltons, consisting of two identical light (L) chains and two identical heavy (H) chains. The genes encoding antibody heavy and light chains are known, and the constituent segments of each have been well characterized and described (Matsuda et al., The Journal of Experimental Medicine. 1998, 188(11):2151-62 and Li et al., Blood, 2004, 103(12):4602-4609; the contents of each are incorporated herein by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by several constant domains. Each light chain has at one end a variable domain (VL) and at the other end a constant domain. The constant domain of the light chain aligns with the first constant domain of the heavy chain, and the variable domain of the light chain aligns with the variable domain of the heavy chain.

[0148] As used herein, the term "variable domain" refers to a specific antibody domain found in both antibody heavy and light chains that varies significantly in sequence between antibodies and is responsible for the binding and specificity of each particular antibody to a particular antigen. Variable domains include hypervariable regions. As used herein, the term "hypervariable region" refers to the region within a variable domain that contains amino acid residues involved in antigen binding. The amino acids present within the hypervariable region determine the structure of the complementarity-determining region (CDR), which becomes part of the antigen-binding site of an antibody. As used herein, the term "CDR" refers to the region of an antibody that contains the structure complementary to the target antigen or epitope. The other portion of the variable domain that does not interact with the antigen is called the framework (FW) region. The antigen-binding site (also known as the antigen-binding site or paratope) contains the amino acid residues necessary for interacting with a specific antigen. The exact residues that make up the antigen-binding site are usually elucidated by co-crystallography with bound antigen, but computational assessment based on comparison with other antibodies can also be used (Strohl, W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p. 47-54, the contents of which are incorporated herein by reference in their entirety).The residues that constitute the CDRs have been determined according to the methods of Kabat (Wu et al., JEM, 1970, 132(2):211-250 and Johnson et al., Nucleic Acids Res. 2000, 28(1):214-218, the contents of each of which are incorporated herein by reference in their entirety), Chothia (Chothia and Lesk, J. Mol. Biol. 1987, 196, 901, Chothia et al., Nature, 1989, 342, 877, and Al-Lazikani et al., J. Mol. Biol. 1997, 273(4):927-948, the contents of each of which are incorporated herein by reference in their entirety), Lefranc (Lefranc et al., Immunome Res. 2005, 1:3), and Honegger (Honegger and Pluckthun, J. Mol. Biol. 2001, 309(3):657-70, the contents of which are incorporated herein by reference in their entirety.

[0149] Each VH and VL domain has three CDRs. Herein, the VL CDRs are referred to as CDR-L1, CDR-L2, and CDR-L3, in order of appearance when moving from N-terminus to C-terminus along the variable domain polypeptide. Herein, the VH CDRs are referred to as CDR-H1, CDR-H2, and CDR-H3, in order of appearance when moving from N-terminus to C-terminus along the variable domain polypeptide. Each of the CDRs prefers a canonical structure, except for CDR-H3, which has an amino acid sequence that is highly variable in sequence and length between antibodies and can confer different three-dimensional structures to the antigen-binding domain (Nikoloudis, et al., Peer J. 2014, 2:e456). In some cases, CDR-H3 may be analyzed across a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, WR Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are incorporated herein by reference in their entirety).

[0150] As used herein, the term "Fv" refers to an antibody fragment that contains the minimum fragment of an antibody required to form a complete antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain tightly bound by non-covalent bonds. Fv fragments can be generated by proteolysis, but most are unstable. Recombinant methods for generating stable Fv fragments are known in the art, usually by inserting a flexible linker between the light and heavy chain variable domains (to form single-chain Fvs (scFvs)) or by introducing disulfide bridges between the heavy and light chain variable domains (Strohl, W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia, PA. 2012. Ch. 3, p. 46-47, the contents of which are incorporated herein by reference in their entirety).

[0151] As used herein, the term "light chain" refers to a component of an antibody from any vertebrate species that is assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequence of its constant domain. Depending on the amino acid sequence of the constant domain of its heavy chain, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.

[0152] As used herein, the term "single-chain Fv" or "scFv" refers to a fusion protein of VH and VL antibody domains, which are linked into a single polypeptide chain by a flexible peptide linker. In some embodiments, the Fv polypeptide linker allows the scFv to form the desired structure for antigen binding. In some embodiments, scFvs are utilized in conjunction with phage, yeast, or other display methods, where the scFv is expressed in association with a surface member (e.g., a phage coat protein) and can be used to identify high-affinity peptides against a predetermined antigen.

[0153] Using molecular genetics, two scFvs can be engineered in tandem into a single polypeptide separated by a linker domain, termed a "tandem scFv" (tascFv). Constructing a tascFv containing the genes for two different scFvs generates a "bispecific single-chain variable fragment" (bis-scFv). Only two tascFvs are in clinical development by commercial companies; both are bispecific agents in active early-stage development by Micromet for oncology indications and are described as "bispecific T-cell engagers (BiTEs)." Blinatumomab is an anti-CD19 / anti-CD3 bispecific tascFv in Phase 2 that enhances T-cell responses against B-cell non-Hodgkin's lymphoma. MT110 is an anti-EP-CAM / anti-CD3 bispecific tascFv in Phase 1 that enhances T-cell responses against solid tumors. Bispecific, tetravalent "TandAbs" have also been investigated by Affimed (Nelson, AL, MAbs., 2010, Jan-Feb;2(1):77-83). Maxibodies (bivalent scFvs fused to the amino terminus of the Fc (CH2-CH3 domains) of IgG) may also be included.

[0154] As used herein, the term "bispecific antibody" refers to an antibody capable of binding to two different antigens. Such antibodies typically contain regions derived from at least two different antibodies. Bispecific antibodies may include any of the bispecific antibodies described in Riethmuller, G. Cancer Immunity. 2012, 12:12-18, Marvin et al., 2005. Acta Pharmacologica Sinica. 2005, 26(6):649-658, and Schaefer et al., PNAS. 2011, 108(27):11187-11192, the contents of each of which are incorporated herein by reference in their entirety.

[0155] As used herein, the term "diabody" refers to a small antibody fragment having two antigen-binding sites. Diabodies are functional bispecific single-chain antibodies (bscAbs). Diabodies contain a heavy-chain variable domain, VH, connected to a light-chain variable domain, VL, in the same polypeptide chain. By using a linker that is too short to allow pairing of the two domains on the same chain, the domains are forced to pair with complementary domains on another chain, generating two antigen-binding sites. Diabodies are fully described, for example, by EP 404,097; WO 93 / 11161; and Hollinger et al. (Hollinger, P. et al., "Diabodies": Small bivalent and bispecific antibody fragments. PNAS, 1993. 90:6444-6448); the contents of each of which are incorporated herein by reference in their entirety.

[0156] The term "intrabody" refers to a form of antibody that is not secreted from the cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies may be used to affect numerous cellular processes, including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, growth signaling, and cell division. In some embodiments, the methods of the invention may involve intrabody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein may be incorporated into one or more constructs for intrabody-based therapy.

[0157] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., apart from possible variants that arise during monoclonal antibody production (such variants are generally present in small amounts), the individual antibodies within the population are identical and / or bind to the same epitope. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.

[0158] The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. Monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chains are identical to or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) are identical to or homologous to corresponding sequences in antibodies from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.

[0159] As used herein, the term "humanized antibody" refers to a chimeric antibody containing minimal portions derived from one or more non-human (e.g., murine) antibody source(s) and residual portions derived from one or more human immunoglobulin sources. In most cases, a humanized antibody is a human immunoglobulin (recipient antibody) in which hypervariable region residues from the recipient antibody are replaced with hypervariable region residues from a non-human species antibody (donor antibody), such as mouse, rat, rabbit, or non-human primate, possessing the desired specificity, affinity, and / or performance. In one embodiment, the antibody may be a humanized full-length antibody. As a non-limiting example, antibodies may be humanized using the methods set forth in U.S. Patent Publication No. US20130303399, the contents of which are incorporated herein by reference in their entirety.

[0160] As used herein, the term "antibody variant" refers to an engineered antibody (relative to a natural or starting antibody) or a biomolecule (e.g., an antibody mimetic) that resembles a natural or starting antibody in structure and / or function. Antibody variants may have altered amino acid sequence, composition, or structure compared to a natural antibody. Antibody variants include, but are not limited to, antibodies with altered isotypes (e.g., IgA, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, multispecific antibody variants (e.g., bispecific variants), and antibody fragments.

[0161] In some embodiments, the pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention may be antibody mimics. As used herein, the term "antibody mimic" refers to any molecule that mimics the function or effect of an antibody and binds specifically and with high affinity to its molecular target. In some embodiments, the antibody mimic may be a monobody designed to incorporate a fibronectin type III domain (Fn3) as a protein scaffold (US Pat. No. 6,673,901; US ​​Pat. No. 6,348,584). In some embodiments, the antibody mimic may be any antibody mimic known in the art, including, but not limited to, affibody molecules, affilins, affitins, anticalins, avimers, centyrins, DARPINST™, Fynomers, and Kunitz domain peptides. In other embodiments, the antibody mimic may include one or more non-peptide regions.

[0162] In one embodiment, the antibody may comprise a modified Fc region. By way of non-limiting example, the modified Fc region may be produced by the methods described in U.S. Patent Publication No. US20150065690, or may be any region described therein, the contents of which are incorporated by reference in their entirety.

[0163] In some embodiments, the payload of the invention may encode a multispecific antibody that binds to two or more epitopes. As used herein, the term "multibody" or "multispecific antibody" refers to an antibody in which two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In one embodiment, multispecific antibodies may be generated and optimized by the methods described in International Patent Publication No. WO2011109726 and U.S. Patent Publication No. US20150252119, the contents of which are incorporated herein by reference in their entireties. These antibodies are capable of binding to multiple antigens with high specificity and high affinity.

[0164] In certain embodiments, a multispecific antibody is a "bispecific antibody" that recognizes two different epitopes on the same or different antigens. In one aspect, a bispecific antibody can bind to two different antigens. Such antibodies typically contain antigen-binding regions from at least two different antibodies. For example, a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, so that a BsAb can bind to two different types of antigens. Bispecific antibody frameworks may include any of those described in Riethmuller, G., 2012. Cancer Immunity, 2012, 12:12-18; Marvin et al., Acta Pharmacologica Sinica. 2005, 26(6):649-658; and Schaefer et al., PNAS. 2011, 108(27):11187-11192, the contents of each of which are incorporated herein by reference in their entirety. A new generation of BsMAbs, called "trifunctional bispecific" antibodies, has been developed. They consist of two heavy and two light chains, each derived from two different antibodies, with two Fab regions (arms) directed against two antigens and an Fc region (legs) containing two heavy chains and forming a third binding site.

[0165] In some embodiments, the payload may encode an antibody containing a single antigen-binding domain. These molecules are very small, approximately one-tenth the molecular weight observed in full-sized mAbs. Additional antibodies may include "nanobodies," which are derived from the antigen-binding variable heavy chain regions (VHHs) of heavy-chain antibodies lacking light chains found in camels and llamas (Nelson, AL, MAbs. 2010. Jan-Feb;2(1):77-83).

[0166] In some embodiments, antibodies may be "miniaturized." The best example of mAb miniaturization is Trubion Pharmaceuticals' small modular immunopharmaceuticals (SMIPs). These molecules, which can be monovalent or bivalent, are recombinant single-chain molecules containing one VL, one VH antigen-binding domain, and one or two constant "effector" domains, all connected by a linker domain. Potentially, such molecules could offer the advantage of increased tissue or tumor penetration acquired by the fragments while retaining the immune effector function conferred by the constant domains. At least three "miniaturized" SMIPs have entered clinical development. TRU-015, an anti-CD20 SMIP developed in collaboration with Wyeth, is the most advanced project, progressing to Phase 2 for rheumatoid arthritis (RA). Previous attempts for systemic lupus erythematosus (SLE) and B-cell lymphoma were ultimately discontinued. Trubion and Facet Biotechnology are collaborating to develop TRU-016, an anti-CD37 SMIP, for the treatment of CLL and other lymphoid malignancies, a project that has reached Phase 2. Wyeth has licensed SBI-087, an anti-CD20 SMIP, for the treatment of autoimmune diseases such as RA, SLE, and possibly multiple sclerosis, but these projects remain in early clinical trials (Nelson, AL, MAbs, 2010. Jan-Feb;2(1):77-83).

[0167] One example of a miniaturized antibody, called a "unibody," is an IgG4 molecule with the hinge region removed. While IgG4 molecules are unstable and capable of interchanging light-heavy chain heterodimers, the deletion of the hinge region completely prevents heavy-chain pairing, maintaining a highly specific monovalent light / heavy chain heterodimer while retaining the Fc region to ensure in vivo stability and half-life. This configuration may minimize the risk of immune activation or oncogenic proliferation due to insufficient IgG4-FcR interaction and the inability of monovalent unibodies to promote the formation of intracellular signaling complexes (see, e.g., Nelson, AL, MAbs, 2010. Jan-Feb;2(1):77-83).

[0168] In some embodiments, the payload of the present invention may encode a single-domain antibody (sdAb, or nanobody), an antibody fragment consisting of a single monomeric variable antibody domain. Like whole antibodies, it can selectively bind to a specific antigen. In one aspect, the sdAb may be a "camelid Ig" or "camelid VHH." As used herein, the term "camelid Ig" refers to the smallest known antigen-binding unit of a heavy-chain antibody (Koch-Nolté, et al., FASEB J., 2007, 21:3490-3498). A "heavy-chain antibody" or "camelid antibody" refers to an antibody that contains two VH domains and no light chains (Riechmann L. et al., J. Immunol. Methods, 1999, 231:25-38; International Patent Publication Nos. WO1994 / 04678 and WO1994 / 025591; and U.S. Patent No. 6,005,079). In another embodiment, the sdAb may be an "immunoglobulin novel antigen receptor" (Ig NAR). As used herein, the term "immunoglobulin novel antigen receptor" refers to a class of antibodies derived from the shark immune repertoire consisting of a homodimer of one variable novel antigen receptor (VNAR) domain and five constant novel antigen receptor (CNAR) domains. Ig NARs represent some of the smallest known immunoglobulin-based protein scaffolds and possess highly stable and efficient binding properties. Their inherent stability is due to both (i) the underlying Ig scaffold, which displays a significant number of charged and hydrophilic surface-exposed residues compared to traditional antibody VH and VL domains found in murine antibodies; and (ii) stabilizing structural features of the complementarity-determining region (CDR) loops, including inter-loop disulfide bridges and intra-loop hydrogen-bonding patterns.

[0169] In some embodiments, the payload of the invention may encode an intracellular antibody. Intracellular antibodies are a type of antibody that are not secreted from the cell that produces the antibody but rather target one or more intracellular proteins. Intracellular antibodies are expressed and function within the cell and may be used to affect numerous cellular processes, including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, growth signaling, and cell division. In some embodiments, the methods described herein include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein are incorporated into one or more constructs for intracellular antibody-based therapy. For example, an intracellular antibody may target one or more glycosylated intracellular proteins or modulate the interaction between one or more glycosylated intracellular proteins and alternative proteins.

[0170] Intracellular expression of intracellular antibodies in different compartments of mammalian cells allows them to block or modulate the function of endogenous molecules (Biocca, et al., EMBO J. 1990, 9:101-108; Colby et al., Proc. Natl. Acad. Sci. USA 2004, 101:17616-17621). Intracellular antibodies can alter protein folding, protein-protein interactions, protein-DNA interactions, protein-RNA interactions, and protein modifications. Intracellular antibodies can induce phenotypic knockouts and function as neutralizing agents by directly binding to target antigens, bypassing intracellular transport, or inhibiting binding with binding partners. Due to their high specificity and affinity for target antigens, intracellular antibodies have the advantage of blocking specific binding interactions of specific target molecules while sparing other molecules.

[0171] Intrabodies may be developed using sequences derived from donor antibodies. Intrabodies are often recombinantly expressed as single domain fragments, such as isolated VH and VL domains, or as intracellular single-chain variable fragment (scFv) antibodies. For example, intrabodies are often expressed as a single polypeptide to form a single-chain antibody comprising the variable domains of the heavy and light chains connected by a flexible linker polypeptide. Intrabodies typically lack disulfide bonds and can regulate target gene expression or activity through their specific binding activity. Single-chain intrabodies are often expressed from recombinant nucleic acid molecules and engineered to be retained intracellularly (e.g., in the cytoplasm, endoplasmic reticulum, or periplasm).Intracellular antibodies are: (Marasco et al.,PNAS,1993,90:7889-7893;Chen et al.,Hum.Gene Ther.1994,5:595-601;Chen et al.,1994,PNAS,91:5932-5936;Maciejewski et al.,1995,Nature Med.,1:667-673;Marasco,1995,Immunotech,1:1-19;Mhashilkar,et al.,1995,EMBO J.14:1542-51;Chen et al.,1996,Hum.Gene Therap.,7:1515-1525;Marasco,Gene Ther.4:11-15,1997;Rondon and Marasco,1997,Annu.Rev.Microbiol.51:257-283;Cohen,et al.,1998,Oncogene 17:2445-56;Proba et al.,1998,J.Mol.Biol.275:245-253;Cohen et al.,1998,Oncogene 17:2445-2456;Hassanzadeh,et al.,1998,FEBS Lett.437:81-6;Richardson et al.,1998,Gene Ther.5:635-44;Ohage and Steipe,1999,J.Mol.Biol.291:1119-1128;Ohage et al. al.,1999,J.Mol.Biol.291:1129-1134;Wirtz and They may be produced using methods known in the art, such as those disclosed and outlined in Steipe, 1999, Protein Sci. 8:2245-2250; Zhu et al., 1999, J. Immunol. Methods 231:207-222; Arafat et al., 2000, Cancer Gene Ther. 7:1250-6; der Maur et al., 2002, J. Biol. Chem. 277:45075-85; Mhashilkar et al., 2002, Gene Ther. 9:307-19; and Wheeler et al., 2003, FASEB J. 17:1733-5; and references cited therein).

[0172] In some embodiments, the payloads of the invention may encode biosynthetic antibodies, as described in U.S. Patent No. 5,091,513, the contents of which are incorporated herein by reference in their entirety. Such antibodies may contain one or more sequences of amino acids that constitute a region that acts as a biosynthetic antibody binding site (BABS). This site may include: 1) noncovalently or disulfide-linked synthetic VH and VL dimers; 2) VH-VL or VL-VH single chains in which the VH and VL are linked by a polypeptide linker; or 3) individual VH or VL domains. The binding domain comprises linked CDR and FR regions that may be derived from separate immunoglobulins. Biosynthetic antibodies may also contain other polypeptide sequences that function, for example, as enzymes, toxins, binding sites, or attachment sites for immobilization media or radioactive atoms. Methods for producing biosynthetic antibodies, designing BABS with any specificity that can be elicited by in vivo antibody generation, and producing analogs thereof are disclosed.

[0173] In some embodiments, the payload may encode an antibody with an antibody acceptor framework as shown in U.S. Patent No. 8,399,625, which may be particularly suitable for accepting CDRs from an antibody of interest.

[0174] In one embodiment, the antibody may be a conditionally active biological protein. The antibody may be used to generate a conditionally active biological protein that is reversibly or irreversibly inactivated under normal wild-type physiological conditions, and provides methods and uses for such conditionally active biological proteins. Such methods and conditionally active proteins are described, for example, in International Publication Nos. WO2015175375 and WO2016036916 and U.S. Patent Publication No. US20140378660, the contents of each of which are incorporated herein by reference in their entirety.

[0175] Antibody preparation The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Antibody production techniques are well known in the art and are described, for example, in Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane "Using Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1999, and "Therapeutic Antibody Engineering: Current and Future Advances Driving the Strongest Growth Area in the Pharmaceutical Industry", Woodhead Publishing, 2012.

[0176] The antibodies and fragments and variants thereof described herein can be produced using recombinant polynucleotides. In one embodiment, the polynucleotide has a modular design encoding at least one antibody, fragment, or variant thereof. As non-limiting examples, a polynucleotide construct may encode any of the following designs: (1) an antibody heavy chain, (2) an antibody light chain, (3) an antibody heavy and light chain, (4) a heavy and light chain separated by a linker, (5) a VH1, CH1, CH2, CH3 domain, a linker, and a light chain, or (6) a VH1, CH1, CH2, CH3 domain, a VL region, and a light chain. Any of these designs may include optional linkers between any of the domains and / or regions. Polynucleotides of the invention may be designed to produce standard classes of immunoglobulins using any of the antibodies or component parts thereof described herein as starting molecules.

[0177] Recombinant antibody fragments may also be isolated from phage antibody libraries using techniques well known in the art and described, for example, in Clackson et al., 1991, Nature 352:624-628; Marks et al., 1991, J. Mol. Biol. 222:581-597. Recombinant antibody fragments may also be derived from large phage antibody libraries produced by recombination in bacteria (Sblattero and Bradbury, 2000, Nature Biotechnology 18:75-80; the contents of which are incorporated herein by reference in their entirety).

[0178] Antibodies used in immunotherapy In some embodiments, the payload of the present invention may be an antibody, fragment, or variant thereof specific for a tumor-specific antigen (TSA) or tumor-associated antigen (TAA). The antibody circulates in the body until it finds and binds to the TSA / TAA. Once bound, the antibody recruits other parts of the immune system and enhances ADCC (antibody-dependent cellular cytotoxicity) and ADCP (antibody-dependent cellular phagocytosis) to destroy tumor cells. As used herein, the term "tumor-specific antigen (TSA)" refers to an antigenic substance produced by tumor cells that can induce an anti-tumor immune response in the host organism. In one embodiment, the TSA may be a tumor neoantigen. Tumor antigen-specific antibodies mediate complement-dependent cytotoxicity against tumor cells expressing the same antigen.

[0179] In some embodiments, the tumor-specific antigen (TSA), tumor-associated antigen (TAA), pathogen-associated antigen, or fragment thereof can be expressed as a peptide or intact protein or a portion thereof. The intact protein or a portion thereof can be natural or mutagenized. Antigens associated with cancer or virus-induced cancer described herein are known in the art. Such TSA or TAA may already be associated with cancer or may be identified by any method known in the art.

[0180] In one embodiment, the antibody may be GD2 ganglioside. In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for the GD2 antigen. Gangliosides expressed on tumor cell surfaces can be targets for cancer immunotherapy. GD2 is a disialoganglioside with the molecular formula C74H134N4032. Gangliosides are acidic glycosphingolipids found on the outer surface of most cell membranes. They are ideal targets for immunotherapy due to their high antigen concentration, lack of regulation, relative uniformity in many tumors, and potential upregulation by cytokines. Many tumors have abnormalities in glycolipid composition and structure. GD2 has been found in a wide range of human tumors, including tumors of neuroectodermal or epithelial origin, virtually all melanomas, and approximately 50% of tumor samples from osteosarcomas and soft tissue sarcomas. Antibodies with high affinity for GD2 include, but are not limited to, 1B7, 2H12, 1G2, 1E9, 1H3, 2F5, 2F7, 31F9, 31F9V2, 32E2, chl4.18, hul4.18, 3F8, 8B6, 4B5, 1A7, A1G4, GD2 mimotope, hul4.18K322A, 5F11, 3G6, 14g2a, and 14.18. In one embodiment, the GD antibody is the 14g2a antibody (Mujoo K., et al. (1989) Cancer Res. 1;49(11):2857-61; the contents of which are incorporated herein by reference in their entirety). Any of these GD2 antibodies are described in Long AHet al. (2015) Nat Med. 21(6):581-90, the contents of which are incorporated by reference in their entirety.

[0181] In one embodiment, the antigen is the HER2 antigen. In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for the HER2 antigen. HER2 is an oncogene product of the human epidermal growth factor receptor 2-associated oncogene, and is a transmembrane receptor protein with a molecular weight of 185 kDa and a tyrosine kinase domain. HER2 is a member of the EGFR family consisting of HER1 (EGFR, ERBB1), HER2 (neu, ERBB-2), HER2 (ErbB-3), and Her4 (ErbB-4). HER2 is known to be autophosphorylated at intracellular tyrosine residues upon homodimerization or heterodimerization with other EGFR receptors, HER1, HER3, or HER4, and is activated in this manner. As a result, HER2 plays an important role in cell proliferation, differentiation, and survival of normal and tumor cells. In some embodiments, HER2 antibodies useful in the present invention include 3B5 (from Oncogene Science / BAYER), 2C4 (ATCC HB-12697), 7C2 (ATCC HB-12215), ApoB17F / ocHER2, 8A4 (ATCC PTA-4565), A10A12 (ATCC PTA-4566), 9G6, 7H4, AlOE9, A12D6, A6B12, A10E11, B3G4, A5C7, 13A11, 11C11, 13E11, Her2Bi(OKT3 x 9184), Her2Bi(OKT3 x Herc), 7F3 (ATCC HB-12216), huMAb4D5-1, huMAb4D5-2, huMAb4D5-3, huMAb4D5-4, huMAb4D5-6, huMAb4D5-7, 520C9, CB-11 (Novocastra Laboratories), NCLB12 (Novocastra Laboratories), humanized 2C4 mutant 560, humanized 2C4 mutant 561, humanized 2C4 mutant 562, humanized 2C4 mutant 568, humanized 2C4 mutant 569, humanized 2C4 mutant 570, humanized 2C4 mutant 571, humanized 2C4 mutant 56869, 3E8, 3H4, Cl 11 (NeoMarkers), HER-81, 452F2736G9, 741F8, 758G5, 761B10, anti-p185HER2 / FcγRIII (CD16), anti-CD3 / anti-p185HER2, Hu4D5-8 and variants, 4D5-H, CB11 (Ventana Medical Scientific Instruments), 6E9, 2H11, 5B8, 7D3, HER50, HER66, HER70, scFv C6.5, scFv C6ML3-9 (ML3.9 or C6ML3.9), scFv C6MH3-B1 (B1 or C6MH3.B1), scFv C6-B1D2 (B1D2 or C6MH3-B1D2), ALM, L87, N28, N12, MGr6, 9GG.10 (Neomarkers), MGFc-5 (V379M), MGFc-9 (F243I, V379L), MGFc-10 (K288N, A330S, P396L), MGFc-13 (K334E, T359 N, T366S), MGFc-27(G316D, A378V, D399E), MGFc-37(K248M), MGFc-39(E293V, Q295E, A3 27T), MGFc-38 (K392T, P396L), MGFc-41 (H268N, P396L), MGFc-23 (K334E, R292L), MGFc- 44, MGFc-45, MDX-210, 17.6.4, HER2-PY1248, MAb74, FRP5, TAb250, HER-81, PN2A, mAb191924 (R&D systems), IDM1, scFv23, Ab-3, Ab-5, 2502A, Rexomun, MAB-1129 (R&D systems), and MM-111. In one embodiment, the high affinity antibody may be derived from any of the heavy and light chain variable regions of the HER2 antibodies listed in Table 7.

[0182] In one embodiment of the present invention, the antigen is CD33. In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for the CD33 antigen. Acute myeloid leukemia (AML) is the second most common acute leukemia in the United States. Commonly applied treatments for leukemia include radiation and / or chemotherapy. However, very often, cells that survive chemotherapy are enriched in AML leukemia stem cells (AML-LSCs), constituting a reservoir of cells that can repopulate and cause relapse, resulting in 65-80% of treated patients relapsing. AML-LSCs express a distinctive set of cell surface antigens, including CD33. CD33 (sialic acid-binding Ig-like lectin 3) or SIGLEC3 (UNIPROT ID: P20138) is a transmembrane receptor expressed on myeloid cells. While typically considered myeloid-specific, it is also found on some lymphoid cells. CD33 binds to sialic acid and is therefore a member of the SIGLEC family of lectins. Exemplary antibodies targeting CD33 may include, but are not limited to, M195, M2H12, DRB2, and My9-6. In one embodiment, the antibody is derived from My9.6. In some embodiments, high-affinity antibodies may be derived from any of the heavy and light chain variable regions of the CD33 antibodies listed in Table 7.

[0183] In one embodiment, the antigen of the present invention is BCMA (B-cell maturation antigen), also known as CD269. In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for the BCMA antigen. The BCMA antigen (UNIPROT ID: Q02223) is encoded by the gene TNFRS17. BCMA is a member of the TNF receptor superfamily. BCMA binds to B-cell activating factor (BAFF) and proliferation-inducing ligand (APRIL). Among non-malignant cells, BCMA is reported to be expressed primarily in plasma cells and a subset of mature B cells, but not in T cells or NK cells. Therefore, BCMA is a suitable therapeutic candidate for the treatment of multiple myeloma. Exemplary antibodies targeting BCMA include, but are not limited to, BCMA50, BCMA30, C11D5.3, and C13F12.1. In one embodiment, the antibody is derived from C11D5.3. In some embodiments, antibodies with high affinity may be derived from any of the heavy and light chain variable regions of the BCMA antibodies listed in Table 7.

[0184] In one embodiment, the antigen of the present invention is CD276 (also known as B7-H3). In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for CD276. CD276 is expressed in a variety of human tumors, including pediatric solid tumors and adult carcinomas. Any of the CD276 antibodies described in International Patent Publications WO2017044699 and WO2014160627 (the contents of which are incorporated by reference in their entirety) may be useful in the present invention. In some embodiments, high-affinity antibodies may be derived from any of the heavy and light chain variable regions of the CD276 antibodies listed in Table 7.

[0185] In one embodiment, the antigen of the present invention is the ALK protein. ALK, a developmentally regulated cell surface receptor tyrosine kinase, is known to be expressed as a tumor-associated antigen as a fusion protein resulting from a chromosomal translocation. Cancer-associated ALK was first described as a 2;5 translocation involving nucleophosphomin (NPM) in anaplastic large cell leukemia. The fusion protein consists of an intracellular component of NPM fused to ALK. In some embodiments, the ALK antigen may be the extracellular portion of the protein. Any antibody, fragment, or variant specific for ALK may be useful in the present invention. In one embodiment, the ALK antibody is described in International Patent Publication WO2015069922, the contents of which are incorporated herein by reference in their entirety. In some embodiments, high-affinity antibodies may be derived from any of the heavy and light chain variable regions of the ALK antibodies listed in Table 7.

[0186] In one embodiment, the antigen of the present invention is the CD22 antigen. In one embodiment, the payload of the present invention may be an antibody, fragment, or variant thereof specific for CD22. CD22 is a lineage-restricted B cell antigen belonging to the immunoglobulin (Ig) superfamily. CD22 is expressed in 60-70% of B cell lymphomas and leukemias (e.g., B cell chronic lymphocytic leukemia, hairy cell leukemia, acute lymphocytic leukemia (ALL), and Burkitt's lymphoma) and is not present on the cell surface of early B cell development or on stem cells. In some embodiments, the antibody, fragment, or variant thereof may be any of those described in International Patent Publications WO2016149578, WO2014065961, and WO2013059593A1 (the contents of each are incorporated by reference in their entirety). In some embodiments, the high-affinity antibody may be derived from any of the heavy and light chain variable regions of the CD22 antibodies listed in Table 7.

[0187] In some embodiments, a payload of the invention may comprise an antigen-binding region comprising a variable heavy chain and a variable light chain having an amino acid sequence selected from the amino acid sequences of Table 7. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6] [Table 7-7] [Table 7-8]

[0188] Chimeric antigen receptor (CAR) In some embodiments, the payload of the invention may be a chimeric antigen receptor (CAR), which, when transduced into immune cells (e.g., T cells and NK cells), can redirect the immune cells against targets (e.g., tumor cells) that express a molecule recognized by the extracellular targeting portion of the CAR.

[0189] As used herein, the term "chimeric antigen receptor (CAR)" refers to a synthetic receptor that mimics the TCR on the surface of a T cell. Generally, a CAR consists of an extracellular targeting domain, a transmembrane domain / region, and an intracellular signaling / activation domain. In a standard CAR receptor, the components: the extracellular targeting domain, the transmembrane domain, and the intracellular signaling / activation domain are linearly assembled into a single fusion protein. The extracellular domain contains a targeting domain / moiety (e.g., scFv) that recognizes a specific tumor antigen or other tumor cell surface molecule. The intracellular domain may contain the signaling domain of the TCR complex (e.g., the signaling region of CD3ζ) and / or one or more costimulatory signaling domains, such as those derived from CD28, 4-1BB (CD137), and OX-40 (CD134). For example, "first-generation CARs" have only the CD3ζ signaling domain. To enhance T cell persistence and proliferation, costimulatory intracellular domains have been added, resulting in second-generation CARs, which have one costimulatory signaling domain in addition to the CD3ζ signaling domain, and third-generation CARs, which have two or more costimulatory signaling domains in addition to the CD3ζ signaling domain. When expressed in T cells, CARs confer antigen specificity to T cells, determined by the extracellular targeting portion of the CAR. Recently, there has been a desire to develop a more suitable and safer CAR architecture, known as fourth-generation CARs, by adding one or more elements, such as a homing gene or suicide gene.

[0190] In some embodiments, the extracellular targeting domain is linked to the intracellular signaling domain via a hinge (also called a cleft domain or spacer) and a transmembrane region. The hinge connects the extracellular targeting domain to the transmembrane domain, which traverses the cell membrane and connects to the intracellular signaling domain. Depending on the size of the target protein to which the targeting moiety binds, and the size and affinity of the targeting domain itself, the hinge may need to be altered to optimize the efficacy of the CAR-transformed cell against cancer cells. Upon recognition and binding of the targeting moiety to the target cell, the intracellular signaling domain directs an activation signal to the CAR T cell, which is further amplified by a "second signal" from one or more intracellular costimulatory domains. Once activated, the CAR T cell can destroy the target cell.

[0191] In some embodiments, the CARs of the invention may be divided into two parts, each linked to a dimerization domain, such that a dimerization trigger promotes assembly of an intact, functional receptor. Wu and Lim recently separated the extracellular CD19-binding domain and the intracellular signaling elements, and isolated the FKBP domain and FRB domain. * reported a split CAR in which the FKBP-rapamycin binding domain (T2089L mutant) was linked to the rapamycin-binding domain, which heterodimerized in the presence of the rapamycin analog AP21967. The split receptor assembled in the presence of AP21967 and activated T cells upon specific antigen binding (Wu et al., Science, 2015, 625(6258):aab4077).

[0192] In some embodiments, the CAR of the present invention may be designed as an inducible CAR. Sakemura et al. recently reported the incorporation of a Tet-On inducible system into a CD19 CAR construct. The CD19 CAR is activated only in the presence of doxycycline (Dox). Sakemura found that Tet-CD19CAR T cells in the presence of Dox exhibited significantly reduced CD19 activation compared to conventional CD19CAR T cells. +reported that the Tet-CARs are equally cytotoxic to cell lines and have equivalent cytokine production and proliferation upon CD19 stimulation (Sakemura et al., Cancer Immuno. Res., 2016, June 21, online edition). In one example, this Tet-CAR may be a payload for an effector module under the control of an SRE (e.g., DD) of the present invention. The dual system provides greater flexibility in turning on / off CAR expression in transduced T cells.

[0193] According to the present invention, the payload of the present invention may be a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR. Representative effector module embodiments comprising a CAR construct are shown in Figures 13-18. In some embodiments, the payload of the present invention may be a complete CAR construct consisting of an extracellular domain, a hinge and transmembrane domain, and an intracellular signaling region. In other embodiments, the payload of the present invention may be a component of a complete CAR construct, including an extracellular targeting moiety, a hinge region, a transmembrane domain, an intracellular signaling domain, one or more costimulatory domains, and other additional elements that improve CAR architecture and function, including, but not limited to, a leader sequence, a homing element, and a safety switch, or a combination of such components.

[0194] CARs regulated by the biological circuits and compositions of the present invention are tunable, thereby offering several advantages. A reversible on / off switch mechanism allows for the management of acute toxicity caused by excessive proliferation of CAR-T cells. Pulsed CAR expression using the SREs of the present invention can be achieved by cycling ligand levels. Ligand-mediated CAR regulation may be effective in counteracting tumor escape induced by antigen loss, avoiding functional attrition caused by persistent signaling due to chronic antigen exposure, and improving the in vivo persistence of CAR-expressing cells.

[0195] In some embodiments, the biological circuits and compositions of the present invention may be used to downregulate CAR expression to limit on-target, on-tissue toxicity caused by tumor lysis syndrome. Downregulation of CAR expression of the present invention following an antitumor effect may prevent (1) on-target, off-tumor toxicity caused by antigen expression in normal tissues and (2) antigen-independent activation in vivo.

[0196] Extracellular targeting domains / moieties According to the present invention, the extracellular targeting moiety of the CAR may be any agent that recognizes and binds with high specificity and affinity to a predetermined target molecule, such as a neoantigen on a tumor cell. The targeting moiety may be an antibody and variants thereof that specifically bind to a target molecule on a tumor cell, or a peptide aptamer selected from a random sequence pool based on its ability to bind to a target molecule on a tumor cell, or a variant or fragment thereof that can bind to a target molecule on a tumor cell, or an exogenous recognition component such as an antigen recognition domain from a natural T cell receptor (TCR) (e.g., the CD4 extracellular domain that recognizes HIV-infected cells), or a bound cytokine that induces recognition of a target cell bearing a cytokine receptor, or a natural ligand of the receptor.

[0197] In some embodiments, the targeting domain of the CAR can be an Ig NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single-chain variable fragment (scFv), a bis-scFv, an (scFv)2, a minibody, a diabody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a unit body, a nanobody, or an antigen-binding region derived from an antibody that specifically recognizes a target molecule, e.g., a tumor-specific antigen (TSA). In one embodiment, the targeting moiety is an scFv antibody. The scFv domain is expressed on the surface of the CAR T cell and, upon subsequent binding to a target protein on the cancer cell, can maintain the CAR T cell in the vicinity of the cancer cell and trigger T cell activation. scFvs can be generated using conventional recombinant DNA techniques, which are contemplated in the present invention.

[0198] In some embodiments, natural ligands may be used as the targeting moiety of the CAR of the present invention. Such natural ligands may be capable of binding to antigens with affinities within the range of scFvs and can redirect T cell specificity and effector function to target cells expressing complementary receptors. In some embodiments, the targeting moiety of the CAR may be neuregulin-1 (NRG1), the natural ligand for HER3 and HER4; VEGF, the natural ligand for VEGFR; IL13 wild-type protein or an IL13 mutein, such as E13Y, that binds to IL13Ra2; NKG2D ligand, the natural ligand for the NKG2D receptor; CD70, the ligand for CD27; and proliferation-inducing ligand (APRIL), the natural high-affinity ligand for BCMA8 and transmembrane activator and CAML interactor (TACI). All of the ligand-based BCMA CARs described in U.S. Patent Publication No. US20160362467A1 are incorporated by reference in their entirety.

[0199] In one embodiment, the targeting moiety of the CAR can recognize an antigen, such as, but not limited to, a ganglioside, a growth factor receptor, a lectin, or any other cell surface antigen. In some embodiments, any of the sequences listed in Table 7 or Table 8 can be useful in the present invention.

[0200] In some embodiments, the targeting portion of the CAR may recognize a tumor-specific antigen (TSA), e.g., a cancer neoantigen that is expressed only in tumor cells due to a genetic mutation or transcriptional change that alters the protein coding sequence, thus creating a novel foreign antigen. The genetic change results from a genetic substitution, insertion, deletion, or any other genetic alteration of the native cognate protein (i.e., a molecule expressed in normal cells).

[0201] In some embodiments, a targeting moiety of the invention may be an scFv having the amino acid sequence of Table 8. [Table 8-1] [Table 8-2] [Table 8-3]

[0202] Intracellular signaling domains After binding to its target molecule, the intracellular domain of the CAR fusion polypeptide transmits a signal to the immune effector cell and activates at least one of the normal effector functions of the immune effector cell, including cytolytic activity (e.g., cytokine secretion) or helper activity. Thus, the intracellular domain comprises the "intracellular signaling domain" of the T cell receptor (TCR).

[0203] In some embodiments, the entire intracellular signaling domain can be used, while in other embodiments, a truncated portion of the intracellular signaling domain can be used in place of the intact chain if that domain transduces an effector function signal.

[0204] In some embodiments, intracellular signaling domains of the invention can contain signaling motifs known as immunoreceptor tyrosine-based activation motifs (ITAMs). Examples of ITAMs containing cytoplasmic signaling sequences include ITAMs derived from TCR CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one example implementation, the intracellular signaling domain is a CD3 zeta (CD3ζ) signaling domain.

[0205] In some embodiments, the intracellular region of the present invention further comprises one or more costimulatory signaling domains that provide additional signals to immune effector cells. These costimulatory signaling domains can be used in combination with signaling domains to further improve the proliferation, activation, memory, persistence, and tumor eradication efficiency of CAR-modified immune cells (such as CAR T cells). In some cases, the costimulatory signaling region comprises one or more intracellular signaling molecules and / or one, two, three, or four cytoplasmic domains of costimulatory molecules. The costimulatory signaling domain may be the intracellular / cytoplasmic domain of a costimulatory molecule, including, but not limited to, CD2, CD7, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), GITR (glucocorticoid-induced tumor necrosis factor receptor), LFA-1 (lymphocyte function-associated antigen-1), LIGHT, NKG2C, and B7-H3. In one example, the costimulatory signaling domain is derived from the cytoplasmic domain of CD28. In another example, the costimulatory signaling domain is derived from the cytoplasmic domain of 4-1BB (CD137). In another example, the costimulatory signaling domain may be the intracellular domain of GITR as set forth in U.S. Patent No. 9,175,308, the contents of which are incorporated herein by reference in their entirety.

[0206] In some embodiments, the intracellular domain of the invention is selected from the group consisting of an MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation protein (SLAM), e.g., CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME, CD2F-10, SLAMF6, SLAMF7, an activating NK cell receptor, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM(LIGHTR), SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, IL15Ra, ITGA4, VLA1, CD49a, ITGA4, VLA1, CD49a, IT GA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, NKD2CSLP76, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100(SEMA 4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, CD270 (HVEM), GADS, SLP-76, PAG / Cbp, CD19a, The ligand that specifically binds to CD83 may comprise a functional signaling domain derived from a protein selected from the group consisting of DAP10, TRIM, ZAP70, killer cell immunoglobulin receptors (KIRs), such as KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DL1 / S1, KIR3DL2, KIR3DL3, and KIR2DP1; and lectin-associated NK cell receptors, such as Ly49, Ly49A, and Ly49C.

[0207] In some embodiments, the intracellular signaling domain of the present invention may comprise a signaling domain derived from JAK-STAT. In other embodiments, the intracellular signaling domain of the present invention may comprise a signaling domain derived from DAP-12 (cell death-associated protein 12) (Topfer et al., Immunol., 2015, 194:3201-3212; and Wang et al., Cancer Immunol., 2015, 3:815-826). DAP-12 is an important signaling receptor for NK cells. Activation signals mediated by DAP-12 play an important role in inducing NK cell cytotoxic responses against certain tumor cells and virus-infected cells. The cytoplasmic domain of DAP12 contains an immunoreceptor tyrosine-based activation motif (ITAM). Therefore, CARs comprising a signaling domain derived from DAP12 may be used for adoptive transfer of NK cells.

[0208] In some embodiments, T cells engineered with two or more CARs incorporating distinct costimulatory domains and regulated by distinct DDs may be used to provide rate control of downstream signaling.

[0209] In some embodiments, the intracellular domain of the invention may comprise an amino acid sequence in Table 9. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] [Table 9-7] [Table 9-8]

[0210] Transmembrane domain In some embodiments, the CAR of the present invention can comprise a transmembrane domain. As used herein, the term "transmembrane domain (TM)" broadly refers to an amino acid sequence of about 15 residues in length that spans the plasma membrane. More preferably, the transmembrane domain comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid residues and spans the plasma membrane. In some embodiments, the transmembrane domain of the present invention can be derived from either natural or synthetic sources. The transmembrane domain of CAR can be derived from any natural membrane-bound or transmembrane protein. For example, the transmembrane region may be derived from (i.e., include at least the transmembrane region(s) of) the α, β, or ζ chain of the T cell receptor, CD3ε, CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, or CD154.

[0211] Alternatively, the transmembrane domains of the invention may be synthetic. In some aspects, the synthetic sequences may comprise primarily hydrophobic residues such as leucine and valine.

[0212] In some embodiments, the transmembrane domains of the present invention include a CD8α transmembrane domain, a CD4 transmembrane domain, a CD28 transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, and a human Ig G4 The Fc region may be selected from the group consisting of: a CTLA-4 transmembrane domain having the amino acid sequences of SEQ ID NOS: 1-5 in International Patent Publication No. WO2014 / 100385; and a PD-1 transmembrane domain having the amino acid sequences of SEQ ID NOS: 6-8 in International Patent Publication No. WO2014100385; the contents of each of which are incorporated herein by reference in their entirety.

[0213] In some embodiments, the CAR of the present invention may comprise an optional hinge region (also called a spacer). A hinge sequence is a short amino acid sequence that promotes flexibility of the extracellular targeting region, distancing the target binding domain from the effector cell surface to allow proper cell-cell contact, target binding, and effector cell activation (Patel et al., Gene Therapy, 1999;6:412-419). The hinge sequence may be positioned between the targeting moiety and the transmembrane domain. The hinge sequence may be any suitable sequence derived from or obtained from any suitable molecule. The hinge sequence may be derived from all or part of the hinge region of an immunoglobulin (e.g., IgG1, IgG2, IgG3, IgG4), i.e., the sequence between the CH1 and CH2 domains of an immunoglobulin, e.g., the IgG4 Fc hinge, or the extracellular region of a type 1 membrane protein, e.g., CD8α, CD4, CD28, and CD7 (which may be a wild-type sequence or a derivative). Some hinge regions include an immunoglobulin CH3 domain or both a CH3 domain and a CH2 domain. In certain embodiments, the hinge region may be modified from IgG1, IgG2, IgG3, or IgG4, and include one or more, for example, 1, 2, 3, 4, or 5 amino acid residues substituted with amino acid residues different from those present in the unmodified hinge. Table 10 lists various transmembrane regions that can be used in the CARs described herein. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4]

[0214] Hinge region sequences useful in the present invention are provided in Table 11. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4] [Table 11-5]

[0215] In some embodiments, the CARs of the present invention may include one or more linkers between any domains of the CAR. The linker may be 1 to 30 amino acids in length. In this regard, the linker may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length. In other embodiments, the linker may be flexible.

[0216] In some embodiments, the CH2CH3 domain may be preferentially omitted from the chimeric antigen structure to induce a higher TNFα response, as disclosed in WO2016149578 (the contents of which are incorporated herein by reference). Some constructs contain a CH2CH3 structural domain. This domain extends the scFV away from the extracellular surface of the plasma membrane, allowing for efficient detection of transduced T cells by anti-IgG Fc-specific antibodies. CAR constructs containing the CH2CH3 domain are disclosed in WO2015069922A3 (the contents of which are incorporated herein by reference in their entirety).

[0217] In some embodiments, components comprising a targeting moiety, a transmembrane domain, and an intracellular signaling domain of the invention may be assembled into a single fusion polypeptide. The fusion polypeptide may be the payload of an effector module of the invention. In some embodiments, two or more CAR fusion polypeptides may be included in an effector module, e.g., two, three, or more CARs under the control of a single SRE (e.g., DD). Exemplary effector modules comprising a CAR payload are shown in Figures 2-6.

[0218] In some embodiments, the CAR sequence may be selected from Table 12. [Table 12-1] [Table 12-2] [Table 12-3]

[0219] In one embodiment of the present invention, the payload of the present invention is a CD33-specific CAR. The heavy and light chains of CD33 may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains, and destabilization domains described herein.

[0220] In one embodiment of the present invention, the payload of the present invention is a GD2-specific CAR. The heavy and light chains of GD2 may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains, and destabilization domains described herein.

[0221] In one embodiment of the present invention, the payload of the present invention is a Her2-specific CAR. The heavy and light chains of Her2 may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains, and destabilization domains described herein. Exemplary BCMA CAR sequences and their components are set forth in Table 13A. The amino acid sequences in Table 13A may contain a stop codon, which may be represented by the " * " is shown in the table. [Table 13A-1] [Table 13A-2]

[0222] In one embodiment, the CAR of the present invention is a BCMA (B cell maturation antigen) CAR, also known as CD269. The heavy and light chains of BCMA may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains, and destabilization domains described herein. Exemplary BCMA CAR sequences and their components are set forth in Table 13B. The amino acid sequences in Table 13B may contain a stop codon, which may be indicated by the " * " is shown in the table. [Table 13B-1] [Table 13B-2]

[0223] Tandem Car (TanCAR) In some embodiments, the CAR of the present invention may be a tandem chimeric antigen receptor (TanCAR) that can target two, three, four, or more tumor-specific antigens. In some aspects, the CAR is a bispecific TanCAR that contains two targeting domains that recognize two different TSAs on tumor cells. A bispecific CAR can be further defined as having an extracellular region that contains a targeting domain (e.g., an antigen recognition domain) specific to a first tumor antigen and a targeting domain (e.g., an antigen recognition domain) specific to a second tumor antigen. In other aspects, the CAR is a multispecific TanCAR that contains three or more targeting domains configured in a tandem arrangement. The spaces between the targeting domains of TanCAR can be between about 5 and about 30 amino acids in length, for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids.

[0224] Split CAR In some embodiments, components comprising the targeting moiety, transmembrane domain, and intracellular signaling domain of the present invention may be split into two or more parts, relying on multiple inputs to promote assembly of an intact, functional receptor. In one embodiment, a split synthetic CAR system can be constructed in which assembly of an activated CAR receptor depends on binding of a ligand to an SRE (e.g., a small molecule) and binding of a specific antigen to the targeting moiety. As a non-limiting example, a split CAR consists of two parts that assemble in a small molecule-dependent manner, with one part of the receptor featuring an extracellular antigen-binding domain (e.g., scFv) and the other part carrying an intracellular signaling domain, such as the CD3ζ intracellular domain.

[0225] In other embodiments, the split portion of the CAR system can be further modified to increase signaling. In one example, the second portion of the cytoplasmic fragment can be anchored to the plasma membrane by incorporating a transmembrane domain (e.g., a CD8α transmembrane domain) into the construct. Additionally, an additional extracellular domain, such as an extracellular domain that mediates homodimerization, can be added to the second portion of the CAR system. These modifications can enhance receptor output activity, i.e., T cell activation.

[0226] In some embodiments, the two parts of the split CAR system contain heterodimerization domains that conditionally interact upon binding of a heterodimerization small molecule. Thus, the receptor components assemble in the presence of the small molecule to form an intact system, which is then activated by antigen engagement. Any known heterodimerization component can be incorporated into the split CAR system. Other small molecule-dependent heterodimerization domains may also be used, including, but not limited to, the gibberellin-induced dimerization system (GID1-GAI), trimethoprim-SLF-induced ecDHFR and FKBP dimerization (Czlapinski et al., J Am Chem Soc., 2008, 130(40):13186-13187), and ABA (abscisic acid)-induced dimerization of PP2C and PYL domains (Cutler et al., Annu Rev Plant Biol. 2010, 61:651-679). Dual regulation of split CAR systems using inducible assembly (e.g., ligand-dependent dimerization) and degradation (e.g., destabilization domain-induced CAR degradation) may provide more flexible control over the activity of CAR-modified T cells.

[0227] Switchable Car In some embodiments, the CAR of the present invention may be a switchable CAR. Juillerat et al. (Juilerat et al., Sci. Rep., 2016, 6:18950; the contents of which are incorporated herein by reference in their entirety) recently reported a controllable CAR that can be temporarily switched on in response to a stimulus (e.g., a small molecule). In this CAR design, a system is directly integrated into the hinge domain that separates the scFv domain from the CAR's plasma membrane domain. Such a system can separate or combine different important functions of the CAR, such as activation and costimulation within different chains of the receptor complex, mimicking the complexity of the TCR's natural architecture. This integrated system can switch the interaction between the scFv and antigen between on and off states, controlled by the presence or absence of a stimulus.

[0228] Reversible CAR In another embodiment, the CAR of the present invention may be a reversible CAR system. In this CAR architecture, a LID domain (ligand-induced degradation) is incorporated into the CAR system. By adding a ligand for the LID domain, the CAR can be temporarily downregulated. The combination of LID and DD regulation provides adjustable control of continuously activated CAR T cells, thereby reducing CAR-mediated tissue toxicity.

[0229] activation conditional CAR In some embodiments, the payload of the present invention may be an activation-conditional chimeric antigen receptor (CAR) that is expressed only in activated immune cells. Expression of the CAR may be combined with an activation-conditional control region, which refers to one or more nucleic acid sequences that induce transcription and / or expression of a sequence, such as a CAR, under its control. Such an activation-conditional control region may be a promoter of a gene that is upregulated during activation of immune effector cells, such as an IL2 promoter or an NFAT binding site. In some embodiments, immune cell activation may be achieved by a constitutively expressed CAR (International Publication No. WO2016126608, the contents of which are incorporated herein by reference in their entirety).

[0230] 4. Additional effect module functions Effector modules of the present invention may include signal sequences that regulate the distribution of the desired payload, cleavage and / or processing functions that facilitate cleavage of the payload from the effector module construct, targeting and / or penetration signals that can regulate the cellular localization of the effector module, tags, and / or one or more linker sequences that connect different components of the effector module.

[0231] signal sequence In addition to the SRE (e.g., DD) and payload region, the effector modules of the present invention may further comprise one or more signal sequences. A signal sequence (also called a signal peptide, targeting signal, targeting peptide, localization sequence, transit peptide, leader sequence, or leader peptide) directs a protein (e.g., an effector module of the present invention) to a specified cellular and / or extracellular location. Protein signal sequences play a central role in the targeting and translocation of nearly all secreted proteins and many integral membrane proteins.

[0232] Signal sequences are short (5–30 amino acids) peptides present at the N-terminus of most newly synthesized proteins that are targeted to specific locations. Signal sequences are recognized by the signal recognition particle (SRP) and can be cleaved using type I and type II signal peptide peptidases. Signal sequences from human proteins can be incorporated as regulatory modules of effector modules to target the effector modules to specific cellular and / or extracellular locations. These signal sequences have been experimentally verified and can be cleaved (Zhang et al., Protein Sci. 2004, 13:2819–2824).

[0233] In some embodiments, a signal sequence may, but is not necessarily, located at the N-terminus or C-terminus of the effector module, and the desired effector module may, but is not necessarily, cleaved to obtain the "mature" payload, i.e., the immunotherapeutic agent discussed herein.

[0234] In some embodiments, the signal sequence may be a secretory signal sequence derived from a naturally occurring secreted protein or a variant thereof. In some examples, the secretory signal sequence may be, but is not limited to, a cytokine signal sequence, such as the IL2 signal sequence (amino acid sequence of SEQ ID NO: 49 encoded by the nucleic acid sequence of SEQ ID NOs: 55-56 and / or 117-118), the p40 signal sequence (amino acid sequence of SEQ ID NO: 119 encoded by the nucleic acid sequence of SEQ ID NOs: 120-128), or the GMCSF leader sequence (SEQ ID NOs: 778 (encoded by SEQ ID NO: 922), 779, and 780).

[0235] In some instances, a signal sequence may be used to target the desired payload to the surface membrane of the target cell. Expression of the payload on the surface of the target cell may be useful for limiting the diffusion of the payload to non-target in vivo environments, thereby potentially improving the safety profile of the payload. Furthermore, membrane presentation of the payload may enable physiological and qualitative signaling, as well as stabilization and recycling of the payload for a longer half-life. The membrane sequence may be the endogenous signal sequence of the N-terminal component of the desired payload. In some cases, it may be desirable to replace this sequence with a different signal sequence. The signal sequence may be selected based on compatibility with the secretory pathway of the desired cell type, such that the payload is presented on the surface of T cells. In some embodiments, the signal sequence may be the IgE signal sequence (amino acid sequence SEQ ID NO: 129 and nucleotide sequence SEQ ID NO: 130), the CD8a signal sequence (also referred to as the CD8a leader) (amino acid sequence SEQ ID NO: 131 and nucleic acid sequence SEQ ID NOs: 132-136, and / or 915), or the IL15Ra signal sequence (amino acid sequence SEQ ID NO: 781, encoded by SEQ ID NO: 782).

[0236] Other examples of signal sequences, including variants, may be the modified signal sequences described in U.S. Pat. Nos. 8,148,494; 8,258,102; 9,133,265; 9,279,007; and U.S. Patent Application Publication No. 20070141666; and International Patent Application Publication No. WO1993018181, the contents of each of which are incorporated herein by reference in their entirety.

[0237] In other examples, the signal sequence may be a heterologous signal sequence from other organisms such as viruses, yeast, and bacteria, which can target the effector module to a specific cellular location, such as the nucleus (e.g., EP1209450). Other examples include the Trichoderma aspartic protease (NSP24) signal sequence (e.g., U.S. Pat. No. 8,093,016 to Cervin and Kim), bacterial lipoprotein signal sequences (e.g., PCT Publication No. WO199109952 to Lau and Rioux), E. coli enterotoxin II signal peptide (e.g., U.S. Pat. No. 6,605,697 to Kwon et al.), E. coli secretion signal sequences (e.g., U.S. Pat. Publication No. US2016090404 to Malley et al.), lipase signal sequences from methylotrophic yeast (e.g., U.S. Pat. No. 8,975,041), and signal peptides of DNases from Corynebacterium bacteria (e.g., U.S. Pat. No. 4,965,197), which can increase secretion of fusion proteins such as enzymes, the contents of each of which are incorporated herein by reference in their entirety.

[0238] Signal sequences may also include nuclear localization signals (NLS), nuclear export signals (NES), polarized cell tubular vesicle structure localization signals (see, e.g., U.S. Patent No. 8,993,742; Cour et al., Nucleic Acids Res. 2003, 31(1):393-396; the contents of each of which are incorporated herein by reference in their entirety), extracellular localization signals, and signals to intracellular locations (e.g., lysosomes, endoplasmic reticulum, Golgi, mitochondria, plasma membranes, peroxisomes, etc.) (see, e.g., U.S. Patent No. 7,396,811; and Negi et al., Database, 2015, 1-7; the contents of each of which are incorporated herein by reference in their entirety).

[0239] In some embodiments, signal sequences of the present invention include, but are not limited to, any of the sequences set forth in Table 7 of co-pending and co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated by reference herein in their entireties.

[0240] Cutting site In some embodiments, the effector module has a cleavage and / or processing function. The effector module of the present invention may comprise at least one protein cleavage signal / site. The protein cleavage signal / site may be located at the N-terminus, the C-terminus, any space between the N-terminus and the C-terminus, for example, but not limited to, midway between the N-terminus and the C-terminus, between the N-terminus and the midpoint, between the midpoint and the C-terminus, and combinations thereof.

[0241] The effector module may comprise one or more cleavage signal(s) / site(s) of any proteinase. The proteinase may be a serine proteinase, a cysteine ​​proteinase, an endopeptidase, a dipeptidase, a metalloproteinase, a glutamic acid proteinase, a threonine proteinase, and an aspartic acid proteinase. In some embodiments, the cleavage site is selected from furin, actinidain, calpain-1, carboxypeptidase A, carboxypeptidase P, carboxypeptidase Y, caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, caspase-6, caspase-7, caspase-8, caspase-9, caspase-10, cathepsin B, cathepsin C, cathepsin G, cathepsin H, cathepsin K, cathepsin L, The signal sequence may be that of cathepsin S, cathepsin V, clostripain, chymase, chymotrypsin, elastase, endoproteinase, enterokinase, factor Xa, formic acid, granzyme B, matrix metallopeptidase-2, matrix metallopeptidase-3, pepsin, proteinase K, SUMO protease, subtilisin, TEV protease, thermolysin, thrombin, trypsin, or TAGZyme.

[0242] In one embodiment, the cleavage site is a furin cleavage site having the amino acid sequence SARNRQKRS (SEQ ID NO: 137) encoded by the nucleotide sequence of SEQ ID NO: 138; or a modified furin cleavage site having the amino acid sequence ARNRQKRS (SEQ ID NO: 139) encoded by the nucleotide sequence of SEQ ID NO: 140; or a modified furin site having the amino acid sequence ESRRVRRNKRSK (SEQ ID NO: 141) encoded by the nucleotide sequence of SEQ ID NO: 142-144; or SGESRRVRRNKRSK (SEQ ID NO: 785) encoded by the nucleotide sequence of SEQ ID NO: 784. In some examples, the cleavage site is a P2A cleavage site (ATNFSLLKQAGDVEENPGP (SEQ ID NO: 783) encoded by SEQ ID NO: 786, or GATNFSLLKQAGDVEENPGP (SEQ ID NO: 864) encoded by SEQ ID NO: 865, where NPGP (SEQ ID NO: 866) is the P2A site.

[0243] In some embodiments, cleavage sites of the present invention include, but are not limited to, any of those set forth in Table 7 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated herein by reference in their entireties.

[0244] Protein tags In some embodiments, the effector module of the present invention may comprise a protein tag. Protein tags may be used to detect and monitor the process of the effector module. The effector module may comprise one or more tags, such as an epitope tag (e.g., a FLAG or hemagglutinin (HA) tag). Numerous protein tags may be used in the effector module, including self-labeling polypeptide tags (e.g., haloalkane dehalogenase (HaloTag2 or HaloTag7), ACP tag, clip tag, MCP tag, snap tag), epitope tags (e.g., FLAG, HA, His, and Myc), fluorescent tags (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), and variants thereof), bioluminescent tags (e.g., luciferase and variants thereof), affinity tags (e.g., maltose binding protein (MBP) tag, glutathione tag), and the like. These include, but are not limited to, GST-tags), immunogenic affinity tags (e.g., protein A / G, IRS, AU1, AU5, glu-glu, KT3, S-tag, HSV, VSV-G, Xpress, and V5), and other tags (e.g., biotin (small molecule), Strep tag (StrepII), SBP, biotin carboxyl carrier protein (BCCP), eXact, CBP, CYD, HPC, CBD intein-chitin binding domain, Trx, NorpA, and NusA).

[0245] In other embodiments, tags may also be selected from those disclosed in U.S. Patent Nos. 8,999,897; 8,357,511; 7,094,568; 5,011,912; 4,851,341; and 4,703,004; U.S. Patent Application Publication Nos. US2013115635 and US2013012687; and International Application Publication No. WO2013091661, the contents of each of which are incorporated herein by reference in their entirety.

[0246] In some embodiments, multiple protein tags may be used, either the same or different tags, and each tag may be located at the same N- or C-terminus, while in other cases the tags may be located at each terminus.

[0247] In one embodiment, the protein tag is an HA tag. A non-limiting example of an HA tag is YPYDVPDYA (SEQ ID NO: 852, encoded by SEQ ID NOs: 853, 867, and / or 868).

[0248] In some embodiments, protein tags of the present invention include, but are not limited to, any of the tags set forth in Table 8 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated herein by reference in their entireties.

[0249] Targeting Peptides In some embodiments, the effector module of the present invention may further comprise a targeting and / or penetrating peptide. Small targeting and / or penetrating peptides that selectively recognize cell surface markers (e.g., receptors, transmembrane proteins, extracellular matrix molecules) can be used to target the effector module to a desired organ, tissue, or cell. To home the effector module to a desired organ, tissue, and cell, and / or subcellular location, short peptides (5-50 amino acid residues) synthesized in vitro and natural peptides, or analogs, variants, or derivatives thereof, may be incorporated into the effector module.

[0250] In some embodiments, the effector module may include a targeting sequence and / or a penetrating peptide to drive the effector module to a target organ, tissue, or cell (e.g., a cancer cell). In other embodiments, the targeting peptide and / or penetrating peptide may direct the effector module to a specific subcellular location within a cell.

[0251] A targeting peptide can have any number of amino acids, from about 6 to about 30. The peptide can have 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. Generally, a targeting peptide can have 25 or fewer amino acids, e.g., 20 or fewer, e.g., 15 or fewer amino acids.

[0252] Exemplary targeting peptides can include, but are not limited to, those disclosed in the art, for example, U.S. Pat. Nos. 9,206,231; 9,110,059; 8,706,219; and 8,772,449; and U.S. Application Publication Nos. 2016089447; 2016060296; 2016060314; 2016060312; 2016060311; 2016009772; 2016002613; 2015314011 and 2015166621; and International Application Publication Nos. WO2015179691 and WO2015183044, the contents of each of which are incorporated herein by reference in their entirety.

[0253] In some embodiments, targeting peptides of the present invention include, but are not limited to, any of those shown in Table 9 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, the contents of which are incorporated herein by reference in their entirety.

[0254] Linker In some embodiments, the effector module of the present invention may further comprise a linker sequence. The linker region mainly functions as a spacer between two or more polypeptides in the effector module. As used herein, "linker" or "spacer" refers to a molecule or group of molecules that connects two molecules or two parts of a molecule, such as two domains of a recombinant protein.

[0255] In some embodiments, the term "linker" (L) or "linker domain" or "linker region" or "linker module" or "peptide linker" as used herein refers to an oligo- or polypeptide region of about 1-100 amino acids in length that connects any of the domains / regions of an effector module (also referred to as a peptide linker). The peptide linker may be 1-40 amino acids in length, 2-30 amino acids in length, 20-80 amino acids in length, or 50-100 amino acids in length. The length of the linker may be optimized based on the type of payload utilized and the crystal structure of the payload. In some instances, a shorter linker may be selected, preferably. In some embodiments, the peptide linker is composed of amino acids joined together by peptide bonds, preferably 1 to 20 amino acids joined by peptide bonds, where the amino acids are selected from the 20 naturally occurring amino acids: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I), serine (S), cysteine ​​(C), threonine (T), methionine (M), proline (P), phenylalanine (F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), aspartic acid (D), glutamic acid (E), asparagine (N), and glutamine (Q). As will be appreciated by those of skill in the art, one or more of these amino acids may be glycosylated. In some embodiments, the amino acids of the peptide linker may be selected from alanine (A), glycine (G), proline (P), asparagine (R), serine (S), glutamine (Q), and lysine (K).

[0256] In one embodiment, the artificially designed peptide linker preferably consists of a polymer of flexible residues, such as glycine (G) and serine (S), to allow adjacent protein domains to move freely relative to each other. Longer linkers may be used if it is desired to prevent two adjacent domains from interfering with each other. The selection of a particular linker sequence may affect the biological activity, stability, folding, targeting, and / or pharmacokinetic properties of the fusion construct. Examples of peptide linkers include: MH, SG, GGSG (SEQ ID NO: 145; encoded by the nucleotide sequence of SEQ ID NO: 146), GGSGG (SEQ ID NO: 147; encoded by any of the nucleotide sequences of SEQ ID NOs: 148 to 152), GGSGGG (SEQ ID NO: 153; encoded by any of the nucleotide sequences of SEQ ID NOs: 154 to 155), SGGGS (SEQ ID NO: 68; encoded by the nucleotide sequence of SEQ ID NOs: 85, 69, 86), GGSGGGSGG (SEQ ID NO: 156; encoded by the nucleotide sequence of SEQ ID NO: 157), GGGGG (SEQ ID NO: 158), GGGGS (SEQ ID NO: 159) or (GGGGS)n (n = 1 (SEQ ID NO: 159), 2 (SEQ ID NO: 160), 3 (SEQ ID NO: 161, encoded by the nucleotide sequence of SEQ ID NOs: 174, 175, 171, 219, 774, 837) ), 4 (SEQ ID NO: 162), 5 (SEQ ID NO: 163), or 6 (SEQ ID NO: 164)), SSSSG (SEQ ID NO: 165) or (SSSSG)n (n = 1 (SEQ ID NO: 165), 2 (SEQ ID NO: 166), 3 (SEQ ID NO: 167), 4 (SEQ ID NO: 168), 5 (SEQ ID NO: 169), or 6 (SEQ ID NO: 170)), SGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 171; encoded by the nucleotide sequence of SEQ ID NOs: 172, 838-843), EFSTEF (SEQ ID NO: 50; encoded by the nucleotide sequence of SEQ ID NO: 57, 173), GKSSGSGSESKS (SEQ ID NO: 176), GGSTSGSGKSSEGKG (SEQ ID NO: 177), GSTSGSGKSSSEGSGSTKG (SEQ ID NO: 178), GSTSGSGKPGSGEGSTKG (SEQ ID NO: 179), VDYPYDVPDYALD (SEQ ID NO: 67;encoded by the nucleotide sequence of SEQ ID NO:84), EGKSSGSGSESKEF (SEQ ID NO:180), SG3-(SG4)3-SG3-SLQ-YPYDVPDYA (SEQ ID NO:787), encoded by the nucleotide sequence of SEQ ID NO:788; DYKDDDDK (SEQ ID NO:789) encoded by the nucleotide sequence of SEQ ID NO:790; SG3-(SG4)5-SG3-S (SEQ ID NO:791) encoded by SEQ ID NO:792; SGGGSGGGGSGGGGSGGGGSYPYDVPDYASGGGS (SEQ ID NO:793) encoded by SEQ ID NO:794; GSGATNFSLLKQAGDVEENPGP (SEQ ID NO:795) encoded by SEQ ID NO:796 SGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 844) encoded by the nucleotide sequence of SEQ ID NO: 845, QLIGMLQGLMRDL (SEQ ID NO: 908) encoded by SEQ ID NO: 909; ASFE (SEQ ID NO: 920) encoded by SEQ ID NO: 921; GS (encoded by GGTTCC), SG (encoded by AGCGGC), EF (encoded by GAGTTC), TS (encoded by ACTAGT), HM (encoded by CACATG), MH (encoded by ATGCAC), or GSG (encoded by GGATCCGGA or GGATCCGGT);

[0257] In other examples, peptide linkers may be composed of a majority of amino acids that are sterically unhindered, such as glycine (G) and alanine (A). Exemplary linkers are polyglycine ((G)4 (SEQ ID NO:929), (G)5 (SEQ ID NO:930), (G)8 (SEQ ID NO:931), etc.), poly(GA), and polyalanine. The linkers described herein are exemplary; linkers much longer and containing other residues are contemplated by the present invention.

[0258] The linker sequence may be a natural linker derived from a multidomain protein, which is a short peptide sequence that separates two different domains or motifs within a protein.

[0259] In some aspects, a linker may be flexible or rigid. In other aspects, a linker may be cleavable or non-cleavable. As used herein, the terms "cleavable linker domain or region" and "cleavable peptide linker" are used interchangeably. In some embodiments, a linker sequence may be cleaved enzymatically and / or chemically. Examples of enzymes (e.g., proteinases / peptidases) useful for cleaving peptide linkers include, but are not limited to, Arg-C proteinase, Asp-N endopeptidase, chymotrypsin, clostripain, enterokinase, factor Xa, glutamyl endopeptidase, granzyme B, Achromobacter proteinase I, pepsin, proline endopeptidase, proteinase K, Staphylococcal peptidase I, thermolysin, thrombin, trypsin, and members of the caspase family of proteolytic enzymes (e.g., caspases 1-10). Chemically sensitive cleavage sites may also be included in the linker sequence. Examples of chemical cleavage reagents include, but are not limited to, cyanogen bromide, which cleaves at methionine residues; N-chlorosuccinimide, iodobenzoic acid, or BNPS-skatole (2-(2-nitrophenylsulfenyl)-3-methylindole), which cleave at tryptophan residues; dilute acid, which cleaves at aspartyl-prolyl bonds; and aspartate-prophosphate cleavable recognition sites (i.e., cleavable peptide linkers containing one or more DP dipeptide moieties). Fusion modules can contain multiple regions encoding peptides of interest separated by one or more cleavable peptide linkers.

[0260] In other embodiments, the cleavable linker may be a "self-cleaving" linker peptide, such as a 2A linker (e.g., T2A), a 2A-like linker, or functional equivalents and combinations thereof. In some embodiments, the linker includes a picornavirus 2A-like linker, a porcine Teschovirus (P2A), a CHYSEL sequence of Thosea asigna virus (T2A), or combinations, variants, and functional equivalents thereof. Other linkers will be apparent to those of skill in the art and may be used in connection with alternative embodiments of the invention.

[0261] In some embodiments, the biological circuit of the present invention may include a 2A peptide. The 2A peptide is a viral-derived sequence of approximately 20 amino acid residues recognized by endogenous cellular proteases (2A peptidases). 2A peptides have been identified among picornaviruses, a typical example of which is foot-and-mouth disease virus (Robertson BH, et al., J Virol 1985, 54:651-660). 2A-like sequences have also been found in picornaviruses such as equine rhinitis A virus, as well as unrelated viruses such as porcine teschovirus-1 and insect Thosea asigna virus (TaV). In such viruses, multiple proteins are derived from a large polyprotein encoded by an open reading frame. The 2A peptide mediates cotranslational cleavage of this polyprotein at a single site that forms the junction between the viral capsid and replication polyprotein domains. The 2A sequence contains the consensus motif DV / IEXNPGP (SEQ ID NO: 932). These sequences are thought to act cotranslationally, preventing normal peptide bond formation between glycine and the final proline, resulting in ribosomal skipping of the subsequent codon (Donnelly ML et al. (2001). J Gen Virol, 82:1013-1025). After cleavage, a short peptide remains fused to the C-terminus of the protein upstream of the cleavage site, while a proline is added to the N-terminus of the protein downstream of the cleavage site. Of the 2A peptides identified to date, four are widely used: FMDV 2A (abbreviated herein as F2A), equine rhinitis virus (ERAV) 2A (E2A), porcine teschovirus-1 2A (P2A), and Thoseaasigna virus 2A (T2A). In some embodiments, 2A peptide sequences useful in the present invention are selected from SEQ ID NOS: 8-11 of International Patent Publication WO2010042490, the contents of which are incorporated by reference in their entirety.

[0262] The linker of the present invention may be a non-peptide linker. For example, an alkyl linker such as -NH-(CH)C(O)- (wherein a = 2 to 20) may be used. These alkyl linkers may be further substituted with any group that is not sterically hindered, such as lower alkyl (e.g., C-C), lower acyl, halogen (e.g., Cl, Br), CN, NH, or phenyl.

[0263] In some embodiments, the linker may be an artificial linker of U.S. Pat. Nos. 4,946,778; 5,525,491; 5,856,456; and International Patent Publication No. WO2012 / 083424, the contents of each of which are incorporated herein by reference in their entirety.

[0264] In some embodiments, linkers of the present invention include, but are not limited to, any of those shown in Table 11 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated herein by reference in their entireties.

[0265] In some embodiments, the compositions of the present invention may include any proteasome adaptor. As used herein, the term "proteasome adaptor" refers to any nucleotide / amino acid sequence that targets an attached payload for degradation. In some aspects, the adaptor directly targets the payload for degradation, thereby bypassing the need for ubiquitination. Proteasome adaptors may also be used in combination with a destabilization domain to reduce basal expression of the payload. Exemplary proteasome adaptors include the UbL domain of Rad23 or hHR23b, and gankyrin, a protein that binds with high affinity to both the target protein Rb and the S4 subunit of the proteasome, HPV E7, and Rb, as well as the proteasome subunit S6, allowing direct proteasome targeting and bypassing the ubiquitination machinery.

[0266] In one embodiment, the linker may be a spacer region of one or more nucleotides. Non-limiting examples of spacers are TCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 846), TATGGCCACAACCATG (SEQ ID NO: 847), AATCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 848), TCGCGAATG, TCGCGA, GCTTGCCACAACCCACAAGGAGACGACCTTCC (SEQ ID NO: 849), or ATNFSLLKQAGDVEENPGP (SEQ ID NO: 850 encoded by SEQ ID NO: 851).

[0267] In one embodiment, the linker may be a BamHI site. As a non-limiting example, a BamHI site has the amino acid sequence GS and / or the DNA sequence GGATCC.

[0268] Implanted stimuli, signals, and other regulatory properties In some embodiments, the effector modules of the present invention may further comprise one or more microRNAs, microRNA-binding sites, promoters, and tunable elements. In one embodiment, microRNAs may be used to assist in the creation of tunable biological circuits. Each aspect or tunable modality may provide differentially tuned properties to the effector module or biological circuit. For example, a destabilization domain may alter the cleavage site, dimerization properties, or half-life of the payload, while the inclusion of one or more microRNAs or microRNA-binding sites may confer cellular detargeting or transport properties. As a result, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biological circuits and effector modules may be designed to include one, two, three, four, or more tunable properties. In some embodiments, the microRNA sequences of the present invention include, but are not limited to, any of the sequences set forth in Table 13 of co-pending and co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of which are incorporated herein by reference in their entireties.

[0269] Polynucleotides The terms "polynucleotide" or "nucleic acid molecule," in their broadest sense, include any compound and / or substance comprising a polymer of nucleotides, e.g., linked nucleosides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, LNA with a β-D-ribo configuration, α-LNA with an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA with a 2'-amino functionalization, and 2'-amino-α-LNA with a 2'-amino functionalization), or hybrids thereof.

[0270] In some embodiments, the polynucleotide of the present invention may be messenger RNA (mRNA) or any nucleic acid molecule, which may or may not be chemically modified. In one aspect, the nucleic acid molecule is mRNA. As used herein, the term "messenger RNA (mRNA)" refers to any polynucleotide that encodes a polypeptide of interest and can be translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo.

[0271] Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5' UTR, a 3' UTR, a 5' cap, and a polyA tail. Based on this wild-type modular structure, the present invention expands the scope of functionality of conventional mRNA molecules by providing payload constructs that maintain the modular organization but contain one or more structural and / or chemical modifications or alterations that confer useful properties to the polynucleotide, such as durability of function. As used herein, a "structural" property or modification is a property or modification that inserts, deletes, duplicates, inverts, or randomizes two or more linked nucleoside residues in a polynucleotide without significant chemical modification to the nucleosides themselves. Because structural modifications necessarily disrupt and rearrange chemical bonds to alter the structure, they are chemical in nature and therefore chemical modifications. However, structural modifications can result in different nucleotide sequences. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G." The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG." In this case, the dinucleotide "CC" is inserted, resulting in a structural modification of the polynucleotide.

[0272] In some embodiments, polynucleotides of the present invention may possess a 5' UTR sequence that plays a role in translation initiation. The 5' UTR sequence may contain features such as a Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate gene translation. The Kozak sequence has the consensus sequence XCCR(A / G)CCAUG, where R, three bases upstream of the initiation codon (AUG), is a purine (adenine or guanine), and X is any nucleotide. In one embodiment, the Kozak sequence is ACCGCC. By modifying features commonly found in abundantly expressed genes in target cells or tissues, the stability and protein production of polynucleotides of the present invention can be enhanced.

[0273] Additionally, polynucleotides are provided that may contain an internal ribosome entry site (IRES), which plays an important role in initiating protein synthesis when a 5' cap structure is not present on the polynucleotide. The IRES may function as the sole ribosome binding site or as one of multiple binding sites. Polynucleotides of the invention that contain two or more functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by ribosomes, resulting in bicistronic and / or multicistronic nucleic acid molecules.

[0274] In some embodiments, the polynucleotides encoding the biological circuits, effector modules, SREs, and payloads of interest, e.g., immunotherapeutics, are from about 30 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-7 0,000, 100-250, 100-500, 100-1,000, 100-1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000 00, 500-25,000, 500-50,000, 500-70,000, 500-100,000, 1,000-1,500, 1,000-2,000, 1,000-3,000, 1,000-5,000, 1,000-7,000, 1,000-10,000, 1,000-25,000, 1,000-50,000, 1,000-70,000, 1,000-100,000, 1,500-3,000, 1,500-5,000 In some embodiments, polynucleotides of the invention may comprise more than 10,000 nucleotides.

[0275] The region of the polynucleotide encoding a particular feature, e.g., a cleavage site, linker, transport signal, tag, or other feature, can independently be 10 to 1,000 nucleotides in length (e.g., 20, 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10 ... , 700, 800, and 900 nucleotides or more, or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).

[0276] In some embodiments, polynucleotides of the present invention may further comprise an embedded regulatory moiety, such as a microRNA-binding site, within the 3' UTR of the nucleic acid molecule, which downregulates gene expression by reducing the stability of the nucleic acid molecule upon binding to the microRNA molecule or by inhibiting translation. Conversely, for purposes of polynucleotides of the present invention, microRNA-binding sites can be modified (i.e., removed) from their native sequences to increase protein expression in specific tissues. For example, miR-142 and miR-146 binding sites may be removed to improve protein expression in immune cells. In some embodiments, any of the encoded payloads may be regulated by an SRE and then combined with one or more regulatory sequences to generate dual- or multi-regulated effector modules or biological circuits.

[0277] In some embodiments, polynucleotides of the invention may encode fragments, variants, or derivatives of polypeptides of the invention. In some aspects, variant sequences may retain the same or similar activity. Alternatively, variants may have altered (e.g., increased or decreased) activity relative to the starting sequence. Generally, variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art. Such alignment tools include the BLAST suite of tools (Stephen et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res., 1997, 25:3389-3402).

[0278] In some embodiments, polynucleotides of the invention may be modified. As used herein, the term "modified," or, where appropriate, "modification," refers to a chemical modification to an A, G, U (T in DNA), or C nucleotide. Modifications may be on the nucleoside base and / or sugar moiety of a nucleoside contained in a polynucleotide. In some embodiments, a modified nucleic acid or one or more individual nucleosides or nucleotides includes multiple modifications. For example, a modification to a nucleoside may include one or more modifications to the nucleoside base and sugar. Modifications to polynucleotides of the invention may include, for example, any of the modifications set forth in International Publication No. WO2013052523, the contents of which are incorporated herein by reference in their entirety.

[0279] As used herein, a "nucleoside" is defined as a compound comprising a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). As used herein, a "nucleotide" is defined as a nucleoside that comprises a phosphate group.

[0280] In some embodiments, modifications may be made to the internucleoside linkage (e.g., the phosphate backbone). As used herein, the terms "phosphate" and "phosphodiester" are used interchangeably with respect to the polynucleotide backbone. The backbone phosphate group can be modified by replacing one or more oxygen atoms with alternative substituents. Additionally, modified nucleosides and nucleotides can include extensive replacement of the unmodified phosphate moiety with alternative internucleoside linkages. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates replace both non-linking oxygens with sulfur. Phosphate linkers can also be modified by replacing linking oxygens with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates). Other modifications that may be used are set forth, for example, in International Application No. WO2013052523, the contents of which are incorporated herein by reference in their entirety.

[0281] Chemical modifications and / or substitutions of nucleotides or nucleic acid bases of the polynucleotides of the present invention useful in the present invention include any modified substitutions known in the art, such as (±)1-(2-hydroxypropyl)pseudouridine TP, (2R)-1-(2-hydroxypropyl)pseudouridine TP, 1-(4-methoxy-phenyl)pseudo-UTP, 2'-O-dimethyl adenosine, 1,2'-O-dimethyl guanosine, 1,2'-O-dimethyl inosine, 1-hexyl-pseudo-UTP, 1-homoallylpseudouridine TP, 1-hydroxymethylpseudouridine TP, 1-isopropyl-pseudo-UTP, and 1-Me-2-thio-pseudo-UTP. , 1-Me-4-thio-pseudo-UTP, 1-Me-α-thio-pseudo-UTP, 1-Me-GTP, 2'-amino-2'-deoxy-ATP, 2'-amino-2'-deoxy-CTP, 2'-amino-2'-deoxy-GTP, 2'-amino-2'-deoxy-UTP, 2'-azido-2'-deoxy-ATP, tubercidin, incompletely modified hydroxywybutosine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, wybutosine, wyosine, xanthine, xanthosine-5'-TP, xyloadenosine, zebularine, α-thio-adenosine, α-thio-cytidine, α-thio-guanosine, and / or α-thio-uridine.

[0282] Polynucleotides of the present invention may contain one or more modifications as set forth herein. Different sugar modifications, base modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may be present at various positions in polynucleotides of the present invention. Those skilled in the art will understand that nucleotide analogs or other modification(s) may be placed at any position(s) of a polynucleotide so long as the function of the polynucleotide is not substantially diminished. Modifications may be 5' or 3' terminal modifications. Polynucleotides may be from about 1% to about 100% (in terms of overall nucleotide content, or in terms of one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... and 95% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100% of the total bases may contain modified nucleotides.

[0283] In some embodiments, expression of the SRE may be modulated by replacing one or more codons in the polynucleotides of the invention with other codons that encode naturally occurring amino acid sequences through a process called codon selection. Because mRNA codon and tRNA anticodon pools tend to differ across organisms, cell types, subcellular locations, and over time, the codon selection described herein is spatiotemporal (ST) codon selection.

[0284] In some embodiments of the present invention, certain polynucleotide features may be codon-optimized. Codon optimization refers to the process of modifying a nucleic acid sequence by replacing at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons of the native sequence with the codons most frequently used in the host cell's genes, while maintaining the native amino acid sequence, to enhance expression in the host cell. Codon usage may be measured using the codon adaptation index (CAI), which measures the deviation of a coding polynucleotide sequence from a reference gene set. Codon usage tables are available at the Codon Usage Database (http: / / www.kazusa.or.jp / codon / ), and CAI can be calculated using the EMBOSS CAI program (http: / / emboss.sourceforge.net / ). Codon optimization methods are known in the art and can be useful in attempts to achieve one or more of several goals. These goals include matching codon frequencies between the target and host organisms to ensure proper folding, biasing nucleotide content to alter stability or reduce secondary structure, minimizing tandem repeat codons or base runs that may impair gene assembly or gene expression, customizing transcriptional and translational control regions, inserting or removing protein signal sequences, removing / adding sites for post-translational modification of the encoded protein (e.g., glycosylation sites), adding, removing, or shuffling protein domains, inserting or deleting restriction enzyme sites, altering ribosome binding and degradation sites, adjusting translation rates to allow for proper folding of various domains of the protein, or reducing or eliminating problematic secondary structure within the polynucleotide.Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include algorithms and / or patented methods such as GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), OptimumGene (GenScript, Piscataway, NJ), DNAWorks v3.2.3, Mr.Gene (GmBH, Regensburg, Germany), and the like. In one embodiment, a polynucleotide sequence, or a portion thereof, is codon-optimized using an optimization algorithm. Codon choices for each amino acid are well known in the art, as are tables for various species to optimize expression in that particular species.

[0285] In some embodiments of the present invention, certain polynucleotide features may be codon-optimized. For example, preferred regions for codon optimization may be upstream (5') or downstream (3') of the polypeptide-encoding region. These regions may be incorporated into the polynucleotide before and / or after codon optimization of the payload-encoding region or open reading frame (ORF).

[0286] After optimization (if desired), the polynucleotide components are reconstituted and converted into vectors, including but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.

[0287] Because codon composition determines the translation rate and stability of an mRNA species, spatiotemporal codon selection can affect the expression of the polynucleotides of the present invention. For example, tRNA anticodons for optimized codons are abundant, and therefore translation may be enhanced. In contrast, tRNA anticodons for less common codons are scarce, and therefore translation may proceed at a slower rate. Presnyak et al. have shown that the stability of mRNA species depends on the codon content, and that by utilizing optimized codons, greater stability and therefore higher protein expression can be achieved (Presnyak et al. (2015) Cell 160, 1111-1124; the contents of which are incorporated herein by reference in their entirety). Thus, in some embodiments, ST codon selection includes the selection of optimized codons, which may enhance expression of the SRES, effector modules, and biological circuits of the present invention. In other embodiments, spatiotemporal codon selection may include the selection of codons that are less commonly used in host cell genes, thereby reducing expression of the compositions of the present invention. The ratio of optimized codons to codons less commonly used in the host cell's genes may also be altered to modulate expression.

[0288] In some embodiments, certain regions of a polynucleotide may be preferred for codon selection. For example, preferred regions for codon selection may be upstream (5') or downstream (3') of the region encoding the polypeptide. These regions may be incorporated into the polynucleotide before and / or after the codon selection of the region encoding the payload or open reading frame (ORF).

[0289] The stop codons of polynucleotides of the invention may be modified to include sequences and motifs for altering the expression levels of the SREs, payloads, and effector modules of the invention. Such sequences may be incorporated to induce stop codon readthrough, which may specify an amino acid, for example, selenocysteine ​​or pyrrolysine. In other examples, the stop codon may be skipped entirely, resuming translation via an alternative open reading frame. Stop codon readthrough may be used to adjust expression of components of the effector module at specific ratios (e.g., as dictated by the context of the stop codon). Examples of preferred stop codon motifs include UGAN, UAAN, and UAGN, where N is either C or U. Modification and manipulation of polynucleotides can be accomplished by methods known in the art, including, but not limited to, site-directed mutagenesis and recombinant techniques. The resulting modified molecules may then be tested for activity using in vitro or in vivo assays, such as those described herein or any other suitable screening assay known in the art.

[0290] In some embodiments, polynucleotides of the invention may contain two or more effector module sequences, or two or more payload sequences of interest, repeated once, twice, or more than three times in a pattern such as ABABAB or AABBABBAABB or ABCABCABC or variants thereof, where each letter A, B, or C represents a different effector module component.

[0291] In yet another embodiment, the polynucleotide of the present invention may comprise sequences of two or more effector module components, each component having one or more SRE sequences (DD sequences) or two or more payload sequences. As a non-limiting example, the sequence may be a pattern such as ABABAB, AABBABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times in each region. As another non-limiting example, the sequence may be a pattern such as ABABAB, AABBABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times throughout the polynucleotide. In these patterns, each letter A, B, or C represents a different sequence or component.

[0292] According to the present invention, polynucleotides encoding separate biological circuits, effector modules, SREs, and payload constructs may be linked together via their 3' ends using nucleotides modified at the 3' end. Chemical linkages may be used to control the stoichiometry of delivery to cells. Polynucleotides can be designed to bind to other polynucleotides, dyes, intercalating agents (such as acridine), crosslinkers (such as psoralens and mitomycin C), porphyrins (such as TPPC4, texaphyrin, and sapphyrin), polycyclic aromatic hydrocarbons (such as phenazine and dihydrophenazine), artificial endonucleases (such as EDTA), alkylating agents, phosphate, amino, mercapto, PEG (such as PEG-40K), MPEG, (MPEG)2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (such as biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, and folic acid), synthetic ribonucleases, proteins, such as glycoproteins, or peptides, e.g., molecules with specific affinity for co-ligands, or antibodies, e.g., antibodies that bind to specific cell types such as cancer cells, endothelial cells, and bone cells, hormones and hormone receptors, non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or drugs. As a non-limiting example, they may be complexes with other immunoconjugates.

[0293] In some embodiments, polynucleotide compositions of the invention may be generated by combining various components of an effector module using the Gibson assembly method. The Gibson assembly reaction consists of three isothermal reactions, each relying on a different enzymatic activity: a 5' exonuclease to generate long overhangs, a polymerase to fill gaps in annealed single-stranded regions, and a DNA ligase to seal nicks in the annealed and filled gaps. Gibson assembly is preceded by a polymerase chain reaction, which is used to generate PCR products with overlapping sequences. These methods can be repeated in sequence to assemble larger molecules. For example, this method may involve repeating the above steps to join a second set of two or more DNA molecules of interest, then repeating the method again to join the first and second sets of DNA molecules of interest. At any stage during these multiple assembly rounds, the assembled DNA can be amplified by transformation into an appropriate microorganism, or the DNA can be amplified in vitro (e.g., using PCR).

[0294] In some embodiments, a polynucleotide of the invention may encode a fusion polypeptide comprising a destabilization domain (DD) and at least one immunotherapeutic agent described herein. The DD domain may be an FKBP mutant encoded by the nucleotide sequence of SEQ ID NOs: 60, 87-88, and / or 878-889, an ecDHFR mutant encoded by the nucleotide sequence of SEQ ID NOs: 61, 89, 90, and / or 869-877, or an hDHFR mutant encoded by the nucleotide sequence of SEQ ID NOs: 91-93, 182-192, 797-832, and / or 890-905.

[0295] In some embodiments, the polynucleotide of the present invention may encode an effector module comprising IL2 as a payload having the nucleotide sequence of SEQ ID NO:62-64, or caspase 9 as a payload having the nucleotide sequence of SEQ ID NO:94-102, or FOXP3 as a payload having the nucleotide sequence of SEQ ID NO:193-202, or luciferase as a payload having the nucleotide sequence of SEQ ID NO:203-208, or BCMA CAR as a payload having the nucleotide sequence of SEQ ID NO:833-835, or Her2 as a payload having the nucleotide sequence of SEQ ID NO:907.

[0296] cell In accordance with the present invention, there are provided cells genetically engineered to express at least one biological circuit, SRE (e.g., DD), effector module, and immunotherapeutic agent of the present invention. Cells of the present invention include, but are not limited to, immune cells, stem cells, and tumor cells. In some embodiments, immune cells are CD8 + T cells and CD4 + Immune effector cells include, but are not limited to, T cells such as T cells (e.g., Th1, Th2, Th17, Foxp3+ cells), memory T cells, e.g., T memory stem cells, central memory T cells, and effector memory T cells, terminally differentiated effector T cells, natural killer (NK) cells, NK T cells, tumor-infiltrating lymphocytes (TILs), cytotoxic T lymphocytes (CTLs), regulatory T cells (Tregs), and dendritic cells (DCs), other immune cells capable of eliciting effector function, or mixtures thereof. T cells may be Tαβ cells and Tγδ cells. In some embodiments, stem cells may be derived from human embryonic stem cells, mesenchymal stem cells, and neural stem cells. In some embodiments, T cells may be endogenous T cell receptor depleted (see U.S. Patent Nos. 9,273,283; 9,181,527; and 9,028,812; the contents of each of which are incorporated herein by reference in their entirety).

[0297] In some embodiments, the cells of the present invention may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

[0298] In some embodiments, the cells of the invention may be mammalian cells, particularly human cells. The cells of the invention may be primary cells or immortalized cell lines.

[0299] In some embodiments, the cells of the present invention may be grown using growth factors that induce cell proliferation and expansion. Exemplary growth factors include RAS such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS, DIRAS such as DIRAS1, DIRAS2, and DIRAS3, NKIRAS such as NKIRAS1 and NKIRAS2, RAL such as RALA and RALB, RAP such as RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C, RASD such as RASD1 and RASD2, RASL such as RASL10A, RASL10B, RASL11A, RASL11B, and RASL12, REM such as REM1 and REM2, GEM, RERG, RERGL, and RRAD.

[0300] Artificial immune cells can be achieved by transducing a cell composition with a polypeptide, effector module, SRE, and / or payload of interest (i.e., immunotherapeutic agent), or a polynucleotide encoding the polypeptide, or a vector containing the polynucleotide. The vector may be a viral vector, such as a lentiviral vector, a gammaretroviral vector, a recombinant AAV, an adenoviral vector, or an oncolytic viral vector. In other aspects, non-viral vectors, such as nanoparticles and liposomes, may also be used. In some embodiments, immune cells of the present invention may be genetically engineered to express at least one immunotherapeutic agent of the present invention that can be regulated using a stimulus. In some examples, two, three, or more immunotherapeutic agents constructed in the same biological circuit and effector module are introduced into the cell. In other examples, two, three, or more biological circuits and effector modules, each containing an immunotherapeutic agent, may be introduced into the cell.

[0301] In some embodiments, T cells expressing a chimeric antigen receptor or T cell receptor may be further engineered to express one, two, three, or more additional immunotherapeutic agents of the invention. The immunotherapeutic agents may be additional cytokines, such as IL2, IL12, IL15, and IL18; regulatory switches; or safety switch genes (e.g., suicide genes) that kill activated T cells if a severe event is observed after adoptive cell transfer or if the transferred immune cells are no longer needed. These molecules may be included in the same effector module or in separate effector modules.

[0302] In some embodiments, the immune cells of the present invention may be NK cells modified to express a payload of the present invention.

[0303] Natural killer (NK) cells are members of the innate lymphoid cell family and are characterized in humans by the expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T cell co-receptor). NK cells are potent effector cells of the innate immune system that mediate cytotoxic attack without the need for prior antigen priming and form the first line of defense against diseases such as cancer malignancies and viral infections.

[0304] Several preclinical and clinical studies have shown that adoptive transfer of NK cells is a promising therapeutic approach for cancers such as acute myeloid leukemia (Ruggeri et al., Science; 2002, 295:2097-2100; and Geller et al., Immunotherapy, 2011, 3:1445-1459).

[0305] NK cell activation is characterized by a series of receptors with activating and inhibitory functions. Key activating receptors on NK cells include CD94 / NKG2C and NKG2D (C-type lectin-like receptors) and the natural cytotoxicity receptors (NCRs) NKp30, NKp44, and NKp46, which recognize ligands on tumor cells or virus-infected cells. NK cell inhibition is essentially mediated by the interaction of polymorphic inhibitory killer cell immunoglobulin-like receptors (KIRs) with their cognate human leukocyte antigen (HLA) ligands via the α-1 helix of the HLA molecule. The balance of signals generated by activating and inhibitory receptors primarily determines immediate cytotoxic activation.

[0306] NK cells can be isolated from peripheral blood mononuclear cells (PBMCs) or derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSCs). Primary NK cells isolated from PBMCs can be further expanded for adoptive immunotherapy. Strategies and protocols useful for expanding NK cells can include interleukin 2 (IL2) stimulation and the use of autologous feeder cells or the use of genetically modified allogeneic feeder cells. In some embodiments, NK cells can be selectively expanded with a combination of stimulatory ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1 / SLAMF2 (see, e.g., U.S. Patent Publication No. US20150190471).

[0307] In some embodiments, the cells of the invention may be dendritic cells that have been genetically modified to express the compositions of the invention.

[0308] In some embodiments, the cells of the present invention may be Treg cells. The payloads of the present invention may be used to promote the proliferation, survival, activation, and / or function of regulatory T cells. Tregs are a distinct cell population that are positively selected on high-affinity ligands in the thymus and play an important role in tolerance to self-antigens. Furthermore, Tregs have also been shown to play a role in peripheral tolerance to foreign antigens. The tolerance-inducing ability of Tregs may be utilized to modulate the immune response to the immunotherapeutic agents described herein. Methods for expanding Tregs for immunotherapy have been described in Tang et al., 2004, J. Exp. Med. 199:1455-65; Battaglia et al., 2005, Blood 105:4743-48; Earle et al., 2005, Clin. Immunol. 115:3-9; Godfrey et al., 2004, Blood 104:453-61; Hoffmann et al., 2004, Blood 104:895-903.

[0309] III. Pharmaceutical Compositions and Formulations The present invention further provides pharmaceutical compositions comprising one or more biological circuits, effector modules, SREs (e.g., DDs), stimulatory and targeting payloads (i.e., immunotherapeutics), vectors, cells and other components of the present invention, and optionally at least one pharmaceutically acceptable excipient or inactive ingredient.

[0310] As used herein, the term "pharmaceutical composition" refers to a preparation containing the biological circuits, SREs, stimulatory and intended payloads (i.e., immunotherapeutic agents) described herein, other components, vectors, cells, or pharmaceutically acceptable salts thereof, and optionally other chemical components, such as physiologically suitable carriers or excipients. Pharmaceutical compositions of the present invention comprise an effective amount of one or more active compositions of the present invention. The preparation of pharmaceutical compositions containing at least one composition of the present invention and / or additional active ingredients will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990, incorporated herein by reference.

[0311] The term "excipient" or "inactive ingredient" refers to an inactive substance added to pharmaceutical compositions and formulations to further facilitate administration of an active ingredient. For purposes of this disclosure, the phrase "active ingredient" generally refers to any one or more biological circuits, effector modules, SREs, stimulatory and target payloads (i.e., immunotherapeutics), other components, vectors, and delivered cells, as described herein. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not elicit adverse, allergic, or other untoward reactions when appropriately administered to an animal, e.g., a human.

[0312] In some embodiments, pharmaceutical compositions and formulations are administered to humans, human patients, or subjects. Although the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to any other animal, such as non-human animals, for example, non-human mammals. The intended subjects for administration of pharmaceutical compositions include, but are not limited to, agricultural animals such as cows, horses, chickens, and pigs, domestic animals such as cats and dogs, or non-human mammals, including research animals such as mice, rats, rabbits, dogs, and non-human primates. It will be understood that for administration to humans, preparations must meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biological Standards.

[0313] Pharmaceutical compositions and formulations according to the invention may be prepared, packaged, and / or sold in bulk as a single unit dose and / or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dose, for example, one-half or one-third of such a dose.

[0314] The compositions of the present invention may be formulated in any manner suitable for delivery, including, but not limited to, nanoparticles, poly(lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids, and combinations thereof.

[0315] In one embodiment, the formulation is a nanoparticle that may contain at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, and PEGylated lipids. In another embodiment, the lipid may be a cationic lipid, such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, and DODMA.

[0316] For polynucleotides of the invention, formulations may be selected from, for example, any of the formulations set forth in International Application PCT / US2012 / 069610, the contents of which are incorporated herein by reference in their entirety.

[0317] The relative amounts of active ingredient, pharmaceutically acceptable excipient or inactive ingredient, and / or any additional ingredients in a pharmaceutical composition according to the invention will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is to be administered. By way of example, the composition may contain from 0.1 to 100, e.g., 0.5 to 50, 1 to 30, 5 to 80, at least 80 (w / w) active ingredient.

[0318] The effectiveness of treatment or improvement of disease can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain relief, quality of life, the dose of drug required to maintain therapeutic efficacy, the level of a disease marker, or any other measurable parameter appropriate to the disease being treated or prevented. Monitoring the effectiveness of treatment or prevention by measuring any such parameter or any combination of parameters is well within the capabilities of one of ordinary skill in the art. With respect to the administration of the compositions of the present invention, for example, against cancer, "effective" means that administration in a clinically relevant manner results in a beneficial effect in at least a statistically significant proportion of patients, such as improvement of symptoms, cure, reduction in disease burden, reduction in tumor burden or cell count, extension of life span, improvement in quality of life, or other effect generally recognized as positive by physicians familiar with the treatment of a particular type of cancer.

[0319] Therapeutic or preventive effects are evident when there is a statistically significant improvement in one or more parameters of the disease state, or when symptoms worsen or develop otherwise as expected.For example, a favorable change of at least 10, preferably at least 20, 30, 40, 50 or more in measurable parameters of the disease can be indicative of effective treatment.The effectiveness of a given composition or formulation of the present invention can also be determined using an experimental animal model of a given disease known in the art.When using an experimental animal model, the effectiveness of treatment is proven when a statistically significant change is observed.

[0320] Preferably, the composition of the present invention is administered by injection, for example, intravenously.When the CAR material of the present invention is a host cell (or a group thereof) expressing the CAR of the present invention, the pharmaceutically acceptable carrier for the injectable cell can include any isotonic carrier, such as saline (about 0.90% w / v NaCl in water, about 300 mOsm / L NaCl in water, or about 9.0 g NaCl per liter of water), NORMOSOL R electrolyte solution (Abbott, Chicago, IL), PLASMA-LYTE A (Baxter, Deerfield, IL), about 5% dextrose in water, or lactated Ringer's solution.In one embodiment, the pharmaceutically acceptable carrier can be supplemented with human serum albumin.Any of the carriers shown in WO2016149578A1 can be used in the present invention.

[0321] IV. Application One aspect of the present invention provides a method for reducing tumor volume or burden. The method comprises administering to a tumor-bearing subject a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or a payload of interest (i.e., immunotherapeutic agent), at least one vector, or cells. The biological circuit system and effector module comprising any of the immunotherapeutic agents described herein may be in the form of a polypeptide, a polynucleotide such as mRNA, a viral vector containing the polynucleotide, or a cell engineered to express the biological circuit, effector module, DD, and payload of interest (i.e., immunotherapeutic agent).

[0322] Another aspect of the present invention provides a method for inducing an anti-tumor immune response in a subject. The method comprises administering to a tumor-bearing subject a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or a payload of interest (i.e., an immunotherapeutic agent), at least one vector, or cells. The biological circuit and effector module comprising any of the immunotherapeutic agents described herein may be in the form of a polypeptide, a polynucleotide such as mRNA, a viral vector containing the polynucleotide, or a cell engineered to express the biological circuit, effector module, DD, and payload of interest (e.g., an immunotherapeutic agent).

[0323] The method of the present invention may be adoptive cell transfer (ACT) using genetically modified cells such as immune effector cells of the present invention, cancer vaccines comprising biological circuitry, effector modules, DDs, payloads of interest (i.e., immunotherapeutic drugs) of the present invention, or compositions that manipulate the tumor immunosuppressive microenvironment, or combinations thereof. These treatments may also be used in conjunction with other cancer treatments such as chemotherapy or radiation therapy.

[0324] In some embodiments, the safety switches described herein may be useful in treating protein proliferation and / or protein aggregation, e.g., kidney disease and / or neurological diseases such as Alzheimer's disease, pre-diseases, etc. In one embodiment, the safety switches of the present invention may be expressed in phagocytes engineered to target aggregated proteins, such as amyloid proteins, and the safety switches described herein may be utilized to eliminate the phagocytes following clearance of the aggregated protein.

[0325] 1. Adoptive cell transfer (adoptive immunotherapy) In some embodiments, cells genetically engineered to express at least one biological circuit system, effector module, DD, and / or payload of interest (immunotherapeutic drug) may be used in adoptive cell therapy (ACT). As used herein, adoptive cell transfer refers to the administration of immune cells (autologous, allogeneic, or derived from a genetically engineered host) with direct anti-cancer activity. ACT has promising clinical applications for malignant and infectious diseases. For example, T cells genetically modified to recognize CD19 have been used to treat follicular B-cell lymphoma (Kochenderfer et al., Blood, 2010, 116:4099-4102; and Kochenderfer and Rosenberg, Nat Rev Clin Oncol., 2013, 10(5):267-276), and ACT using autologous lymphocytes genetically modified to express anti-tumor T-cell receptors has been used to treat metastatic melanoma (Rosenberg and Dudley, Curr. Opin. Immunol. 2009, 21:233-240).

[0326] According to the present invention, biological circuits and systems may be used in the development and implementation of cell therapies, such as adoptive cell therapy. Specific effector modules useful for cell therapy are illustrated in Figures 7-12. The biological circuits, their components, effector modules and their SREs, and payloads may be used in cell therapy to modulate epitope-tagged receptors, in APC platforms for stimulating T cells, as tools to enhance ex vivo APC stimulation, to improve methods of T cell expansion, in ex vivo stimulation with antigens, in TCR / CAR combinations, in the manipulation or modulation of TILs, in allogeneic cell therapy, and in combination T cell therapy with other lines of treatment (e.g., radiation, cytokines).

[0327] Provided herein are methods of use in adoptive cell therapy, comprising preconditioning a subject in need thereof, modulating immune cells with the SREs, biological circuits, and compositions of the invention, administering modified immune cells expressing the compositions of the invention to the subject, and successfully engrafting the modified cells in the subject.

[0328] In some embodiments, the SREs, biological circuits, and compositions of the present invention may be used to minimize preconditioning regimens associated with adoptive cell therapy. As used herein, "preconditioning" refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy. Preconditioning strategies include, but are not limited to, total body irradiation and / or lymphodepleting chemotherapy. Clinical trials of adoptive therapy without preconditioning have failed to demonstrate clinical benefit, demonstrating the importance of preconditioning in ACT. However, preconditioning is associated with significant toxicity, limiting the cohort of subjects suitable for ACT. In some examples, immune cells for ACT may be modified to express cytokines, such as IL2, as a payload using the SREs of the present invention, reducing the need for preconditioning.

[0329] In some embodiments, the immune cells in the ACT are dendritic cells, CD8 + T cells and CD4 + The immune stimulatory cells may be T cells, such as T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), lymphokine-activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof. In other embodiments, the immune stimulatory cells for ACT may be generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). In some embodiments, autologous or allogeneic immune cells are used for ACT.

[0330] In some embodiments, NK cells modified to express the compositions may be used in ACT. Activation of NK cells induces perforin / granzyme-dependent apoptosis in target cells. Activation of NK cells also induces the secretion of cytokines such as IFN-γ, TNF-α, and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and potentiate adaptive immune responses through upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs) (reviewed in Vivier et al., Nat. Immunol., 2008, 9(5):503-510).

[0331] NK cells can also be genetically reprogrammed to circumvent NK cell inhibitory signals upon interaction with tumor cells. For example, NK cells can be genetically modified using CRISPR, ZFN, or TALEN to silence inhibitory receptors, thereby enhancing the anti-tumor capabilities of NK cells.

[0332] Immune cells can be isolated and expanded ex vivo using various methods known in the art. For example, methods for isolating and expanding cytotoxic T cells are described in U.S. Patent Nos. 6,805,861 and 6,531,451; U.S. Patent Publication No. US20160348072A1; and International Patent Publication No. WO2016168595A1, the contents of each of which are incorporated herein by reference in their entirety. NK cell isolation and expansion are described in U.S. Patent Publication Nos. US20150152387A1, U.S. Patent No. 7,435,596; and Oyer, JL (2016). Cytotherapy. 18(5):653-63, the contents of each of which are incorporated herein by reference in their entirety. Specifically, human primary NK cells may be expanded in the presence of feeder cells, such as a bone marrow cell line genetically modified to express membrane-bound IL15, IL21, IL12, and 4-1BBL.

[0333] In some examples, a subpopulation of immune cells may be enriched for ACT. Methods for enriching immune cells are described in International Patent Publication No. WO2015039100A1. In another example, B and T lymphocyte attenuator marker (BTLA)-positive T cells may be used to enrich for anti-cancer reactive T cells as described in U.S. Patent No. 9,512,401 (the contents of each of which are incorporated herein by reference in their entirety).

[0334] In some embodiments, immune cells for ACT may be depleted of select subpopulations to enhance T cell proliferation. For example, immune cells may be depleted of Foxp3+ T lymphocytes to minimize anti-tumor immune responses using methods set forth in U.S. Patent Publication No. US20160298081A1, the contents of which are incorporated herein by reference in their entirety.

[0335] In some embodiments, immune cells may be enriched for FOXP3+ cells to enrich for T cells important for immune tolerance and to reduce graft-versus-host disease.

[0336] In some embodiments, activation and proliferation of T cells for ACT is achieved by antigen stimulation with a chimeric antigen receptor (CAR) transiently expressed on the cell surface. Such activation methods are set forth in International Patent Publication No. WO2017015427, the contents of which are incorporated herein by reference in their entirety.

[0337] In some embodiments, immune cells may be activated by antigens associated with antigen-presenting cells (APCs). In some embodiments, APCs may be dendritic cells, macrophages, or B cells, which may be antigen-specific or non-specific. APCs may be autologous or allogeneic in organs. In some embodiments, APCs may be artificial antigen-presenting cells (aAPCs), such as cell-based aAPCs or cell-free aAPCs. Cell-based aAPCs may be selected from either genetically modified allogeneic cells, such as human erythroleukemia cells, or xenogeneic cells, such as mouse fibroblasts and Drosophila cells. Alternatively, APCs may be cell-free, in which case the antigen or costimulatory domain is presented on a synthetic surface, such as latex beads, polystyrene beads, lipid vesicles, or exosomes.

[0338] In some embodiments, cells of the present invention, particularly T cells, may be expanded using artificial cell platforms. In one embodiment, mature T cells may be generated using artificial thymic organoids (ATOs) as described by Seet CS et al. 2017. Nat Methods. 14, 521-530, the contents of which are incorporated herein by reference in their entirety. ATOs are based on a stromal cell line expressing delta-like canonical notch ligand (DLL1). In this method, stromal cells and hematopoietic stem and progenitor cells are aggregated by centrifugation and placed on cell culture inserts at an air-liquid interface to generate organoid cultures. ATO-derived T cells exhibit a naive phenotype, a diverse T cell receptor (TCR) repertoire, and TCR-dependent functions.

[0339] In some embodiments, T cells of the present invention may be isolated from peripheral blood by a process known as apheresis, which separates lymphocytes from plasma, platelets, and RBCs, as well as granulocytes. A semi-automated elutriation device may be used to further separate lymphocytes from monocytes in peripheral blood cells. T cells may also be enriched by magnetic selection using anti-CD3 / CD28 beads. In one embodiment, an additional step using a plastic adhesive surface may be utilized to deplete monocytes from PBMCs. Methods for T cell enrichment are disclosed in Stroncek DF et al. (2017) Journal of Translational Medicine. 15:59; the contents of which are incorporated by reference in their entirety.

[0340] In some embodiments, adoptive cell therapy is performed by autologous transplantation, in which cells are derived from a subject in need of treatment and, after isolation and processing, are administered to the same subject. In other examples, ACT may involve allogeneic transplantation, in which cells are isolated and / or prepared from a donor subject other than the recipient subject who will ultimately receive the cell therapy. The donor and recipient subjects may be genetically identical or similar, or express the same HLA class or subtype.

[0341] In some embodiments, multiple immunotherapeutic agents delivered to immune cells (e.g., T cells and NK cells) for ACT may be controlled by the same biological circuit system. In one example, a cytokine such as IL2 and caspase 9 are linked to the same hDHFR destabilization domain. Expression of IL2 and caspase 9 is simultaneously regulated using TMP. In other embodiments, multiple immunotherapeutic agents delivered to immune cells (e.g., T cells and NK cells) for ACT may be controlled by different biological circuit systems. In one example, a cytokine such as IL2 and a caspase 9 construct are linked to different DDs of two separate effector modules and can be separately regulated using different stimuli. In another example, a suicide gene and a CAR construct may be linked to two separate effector modules.

[0342] Following gene regulation using the SREs, biological circuits, and compositions of the present invention, the cells are administered to a subject in need thereof. Methods for administering cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, methods for adoptive T cell therapy are described, for example, in U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; U.S. Patent No. 4,690,915 to Rosenberg; and Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85. See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10):928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1):84-9; Davila et al. (2013) PLoS ONE 8(4):e61338; the contents of each of which are incorporated herein by reference in their entirety.

[0343] In some embodiments, immune cells for ACT may be engineered to express one or more immunotherapeutic agents that promote immune cell activation, infiltration, proliferation, survival, and anti-tumor function.

[0344] In some embodiments, with the overall goal of further improving tumor killing in cancer patients, immune cells used in adoptive cell transfer can be genetically engineered to improve their in vivo persistence, cytotoxicity, tumor targeting ability, and homing ability to disease sites. One example is introducing an effector module of the invention containing a cytokine, such as gamma cytokine (IL2), into immune cells to promote immune cell proliferation and survival. Transduction of cells with a cytokine gene (e.g., gamma cytokine IL2) can expand immune cells without the addition of exogenous cytokine, and cytokine-expressing NK cells have enhanced tumor cytotoxicity.

[0345] In some embodiments, biological circuits, their components, SREs, or effector modules can be utilized to prevent T cell exhaustion. As used herein, "T cell exhaustion" refers to the gradual and progressive loss of T cell function caused by chronic T cell activation. T cell exhaustion is a major factor limiting the efficacy of antiviral and antitumor immunotherapy. Exhausted T cells have reduced proliferation and cytokine production, as well as high rates of apoptosis and high surface expression of multiple inhibitory receptors. T cell activation leading to exhaustion can occur in the presence or absence of antigen.

[0346] In some embodiments, an effector module of the invention useful for immunotherapy may be placed under the transcriptional control of the T cell receptor alpha locus constant (TRAC) locus in a T cell. Eyquem et al. showed that expression of a CAR from the TRAC locus prevents T cell exhaustion and accelerated T cell differentiation caused by excessive T cell activation (Eyquem J. et al (2017) Nature. 543(7643):113-117; the contents of which are incorporated herein by reference in their entirety).

[0347] In some embodiments, the payloads of the invention may be used in conjunction with antibodies or fragments that target T cell surface markers associated with T cell depletion, including, but not limited to, CTLA-1, PD-1, TGIT, LAG-3, 2B4, BTLA, TIM3, VISTA, and CD96.

[0348] T cells specific to a particular tumor antigen may be subjected to chronic antigen exposure. Persistent antigen expression leads to the expression of immune checkpoints, resulting in the exhaustion of allogeneic antigen-specific T cells. Constant expression of the chimeric antigen receptor of the present invention may result in chronic interaction with the antigen, leading to exhaustion. The compositions disclosed herein may be used to prevent T cell exhaustion by regulating surface CAR expression using stimulation specific to the present invention. In one embodiment, the SRE of the present invention may be used to achieve pulsatile expression of the composition of the present invention. As used herein, "pulsatile" refers to multiple payload expression at spaced time intervals. Generally, upon administration of a stimulus, payload expression increases, resulting in a first pulse; following the ebb and flow of the stimulus, payload expression decreases, representing the interval between the first and subsequent exposures to the stimulus, after which the second exposure to the stimulus begins.

[0349] Also provided herein are methods for preventing or reversing T cell depletion in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition comprising at least one effector module. In some embodiments, the effector module comprises a stimulus response element (SRE) operably linked to at least one immunotherapeutic agent, such that the SRE responds to a stimulus and regulates the expression and / or function of the immunotherapeutic agent, thereby preventing or reversing T cell depletion. In some embodiments, the immunotherapeutic agent may be a chimeric antigen receptor. Examples of chimeric antigen receptors include, but are not limited to, a GD2 CAR, a BCMA CAR, a CD33 CAR, a Her2 CAR, an ALK CAR, a CD22 CAR, or a CD276 CAR. In some embodiments, the CAR may be a bispecific CAR comprising an extracellular domain that recognizes at least one antigen, such as GD2, BCMA, CD33, Her2, ALK, CD22, or CD276. In some embodiments, the methods described herein may comprise pulsatile administration of a composition of the invention to prevent T cell depletion. In some instances, the addition of a stimulus can reverse T cell depletion, while in other instances, the withdrawal of a stimulus can reverse T cell depletion.

[0350] In some embodiments, the compositions of the invention may be used to alter the TIL (tumor infiltrating lymphocyte) population in a subject. In one embodiment, any of the payloads described herein may be used to alter the ratio of CD4-positive cells to the CD8-positive population. In some embodiments, TILs may be sorted ex vivo and engineered to express any of the cytokines described herein. The payloads of the invention may be used to expand the CD4 and / or CD8 population of TILs and enhance TIL-mediated immune responses.

[0351] 2. Cancer vaccines In some embodiments, the biological circuits, effector modules, payloads of interest (immunotherapeutics), vectors, cells, and compositions of the present invention may be used in combination with cancer vaccines. In one aspect, dendritic cells are engineered to express the compositions of the present invention and used as cancer vaccines.

[0352] In some embodiments, cancer vaccines can include peptides and / or proteins derived from tumor-associated antigens (TAAs). Such strategies can be used to induce an immune response in a subject, which in some instances can be a cytotoxic T lymphocyte (CTL) response. Peptides used in cancer vaccines can also be modified to match the mutation profile of the subject. For example, EGFR-derived peptides with mutations matching those found in subjects in need of treatment have been successfully used in patients with lung cancer (Li F et al. (2016) Oncoimmunology. Oct 7;5(12):e1238539; the contents of which are incorporated herein by reference in their entirety).

[0353] In one embodiment, the cancer vaccine of the present invention may be a superagonist TAA-derived modified peptide ligand (APL). These are mutant peptide ligands that deviate from the native peptide sequence by one or more amino acids, activating specific CTL clones more effectively than native epitopes. These changes may allow the peptide to better bind to restricted class I MHC molecules or interact better with the TCR of a given tumor-specific CTL subset. APLs may be selected using the methods described in U.S. Patent Publication No. US20160317633A1, the contents of which are incorporated herein by reference in their entirety.

[0354] Relapse of hematologic malignancies is a major cause of treatment failure after allogeneic hematopoietic stem cell transplantation (HCT). The Wilms' tumor (WT1) gene product is a tumor-associated antigen expressed in acute leukemia and other hematologic malignancies, with limited expression in normal tissues. The compositions of the present invention may be co-administered with a dendritic cell vaccine loaded with donor-derived WT1 peptide to prevent disease relapse after immunotherapy (Shah NN et al. (2016) Biol Blood Marrow Transplant. 22(12):2149-215; the contents of which are incorporated herein by reference in their entirety).

[0355] 3. Combination treatment In some embodiments, it may be desirable to combine compositions, vectors, and cells of the invention for administration to a subject. Compositions of the invention comprising different immunotherapeutic agents may be combined or combined with known immunotherapeutic agents to enhance immunotherapy.

[0356] In some embodiments, it may be desirable to combine the compositions of the present invention with an adjuvant to enhance the potency and longevity of the antigen-specific immune response. Adjuvants used as immunostimulatory agents in combination therapy include biological molecules or delivery vehicles that deliver antigens. By way of non-limiting example, the compositions of the present invention may be combined with biological adjuvants such as cytokines, Toll-like receptors, bacterial toxins, and / or saponins. In other embodiments, the compositions of the present invention may be combined with a delivery vehicle. Exemplary delivery vehicles include polymer microspheres, immunostimulatory complexes, emulsions (oil-in-water or water-in-oil), aluminum salts, liposomes, and virosomes.

[0357] In some embodiments, immune effector cells engineered to express the biological circuits, effector modules, DDs and payloads of the present invention may be used in combination with biological adjuvants as described herein.

[0358] In some embodiments, immune effector cells engineered to express the biological circuits, effector modules, DDs, and payloads of the present invention may be used in combination with cancer vaccines.

[0359] In some embodiments, an effector module comprising a cytokine may be used in combination with an effector module encoding a safety switch or a regulatory switch.

[0360] In some embodiments, the methods of the present invention may involve the use of a composition of the present invention in combination with other agents effective in treating cancer, infectious diseases, and other immunodeficiency disorders, such as anti-cancer agents. As used herein, the term "anti-cancer agent" refers to any agent that can negatively affect cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the rate of proliferation of cancer cells, reducing the incidence or number of metastases, shrinking tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response to cancer cells or tumors, preventing or inhibiting the progression of cancer, or extending the lifespan of a subject with cancer.

[0361] In some embodiments, the anti-cancer agent or therapy may be a chemotherapy agent or radiation therapy, an immunotherapy agent, surgery, or any other therapeutic agent that can be used in combination with the present invention to improve the therapeutic efficacy of the treatment.

[0362] In some embodiments, the compositions of the present invention may be used in combination with immunotherapeutic agents other than the therapies of the present invention described herein, for example, antibodies specific for some target molecule on the surface of tumor cells.

[0363] Exemplary chemotherapeutic agents include acivicin; aclarubicin; acodazole hydrochloride; acronine; adzelesin; aldesleukin; altretamine; ambomycin; amethanthrone acetate; amsacrine; anastrozole; anthramycin; asparaginase; asperlin, sulindac, curcumin; alkylating agents including: mechlorethamine, cyclophosphamide, ifosfamide, melphalan, and nitrogen mustards such as chlorambucil; carmustine (BCU), lomustine (CCNU), and semustine (methylCC Nitrosoureas such as triethylenemelamine (TEM), triethylene, thiophosphoramide (thiotepa), hexamethylmelamine (HMM, altretamine), and other methylmelamines; alkylsulfonates such as busulfan; triazines such as dacarbazine (DTIC); antimetabolites, e.g., folic acid analogs such as methotrexate and trimetrexate, 5-fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), pyrrolidine analogs such as 5-azacytidine, 2,2'-difluorodeoxycytidine, 6-mercaptopurine, 6-thioguanine, azathioprine, and 2'-deoxycoformycin (Pentos purine analogs such as tatin, erythrohydroxynonyl adenine (EHNA), fludarabine phosphate, and 2-chlorodeoxyadenosine (cladribine, 2-CdA); natural products, including paclitaxel, vinca alkaloids, e.g., vinblastine (VLB), vincristine, and vinorelbine, antimitotics such as taxotere, estramustine, and estramustine phosphate; epipodophyllotoxins such as etoposide and teniposide; antibiotics such as actimomycin D, daunomycin (rubidomycin), doxorubicin, mitoxantrone, idarubicin, bleomycin, plicamycin (mithramycin), mitomycin C, and actinomycin;Enzymes such as L-asparaginase, cytokines such as interferon (IFN)-γ, tumor necrosis factor (TNF)-α, TNF-β and GM-CSF, anti-angiogenic factors such as angiostatin and endostatin, inhibitors of FGF or VEGF, soluble forms of angiogenic factor receptors, including soluble VGF / VEGF receptors, platinum coordination complexes such as cisplatin and carboplatin, anthracenediones such as mitoxantrone, substituted ureas such as hydroxyurea, methylhydrazine derivatives such as N-methylhydrazine (MIFf) and procarbazine Adrenal cortical suppressants such as steroid derivatives, mitotane (o,p'-DDD) and aminoglutethimide; hormones and antagonists, including corticosteroid antagonists such as prednisone and equivalents, dexamethasone and aminoglutethimide; progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol equivalents; antiestrogens such as tamoxifen; androgens, including testosterone propionate and fluoxymesterone / equivalents antiandrogens such as flutamide, gonadotropin-releasing hormone analogs, and leuprolide; nonsteroidal antiandrogens such as flutamide; kinase inhibitors, histone deacetylase inhibitors, methylation inhibitors, proteasome inhibitors, monoclonal antibodies, oxidants, antioxidants, telomerase inhibitors, BH3 mimetics, ubiquitin ligase inhibitors, stat inhibitors, and other antiandrogens, such as imatinib mesylate (sold as Gleevac or Glivac) and erlotinib (an EGF receptor inhibitor), currently sold as Tarveca. Receptor tyrosine kinase inhibitors; antivirals such as oseltamivir phosphate, amphotericin B, and palivizumab; Sdi1 mimetics; semustine; senescence-derived inhibitor 1; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stipiamid; stromelysin inhibitors; sulfinosines; superactive vasoactive intestinal peptide antagonists; veraresol; veramine; verudines; verteporfin; vinorelbine; vinxartin; vitaxin; vorozole; zanoteron; zeniplatin; zilascorub;and zinostatin stimalamer; the PI3Kβ small molecule inhibitor, GSK2636771; the pan-PI3K inhibitor (BKM120); the BRAF inhibitors, vemurafenib (Zelboraf) and dabrafenib (Tafinlar); or analogs or derivatives and variants of any of the foregoing.

[0364] Radiotherapeutic agents and factors include radiation and waves that induce DNA damage, such as gamma irradiation, X-rays, UV irradiation, microwaves, electronic emissions, and radioisotopes. Therapy may be achieved by irradiating the localized tumor site with these forms of radiation. All of these factors most likely result in widespread DNA damage in DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. X-ray doses range from daily doses of 50-200 roentgens for prolonged periods (3-4 weeks) to single doses of 2000-6000 roentgens. Dose ranges for radioisotopes vary widely and depend on the half-life of the isotope, the strength and type of radiation emitted, and uptake by tumor cells.

[0365] In some embodiments, the chemotherapeutic agent may be an immunomodulatory agent such as lenalidomide (LEN). Recent studies have shown that lenalidomide can enhance the anti-tumor function of CAR-modified T cells (Otahal et al., Oncoimmunology, 2015, 5(4):e1115940). Some examples of anti-tumor antibodies include tocilizumab and siltuximab.

[0366] Other agents that may be used in combination with the compositions of the invention also include, but are not limited to, agents that affect the upregulation of cell surface receptors and their ligands (e.g., Fas / Fas ligand, DR4 or DR5 / TRAIL) and GAP junctions, cytostatic and differentiating agents, cell adhesion inhibitors such as focal adhesion kinase (FAK) inhibitors and lovastatin, or agents that sensitize hyperproliferative cells to apoptosis inducers such as the antibody C225.

[0367] The combination may include simultaneous or separate administration of the composition of the present invention and the other agent, or the immunotherapy may precede or follow the other agent / therapy by intervals ranging from minutes to days to weeks to months.

[0368] In some embodiments, the CAR-T cells of the present invention may be co-administered with a retinoid to eradicate myeloid-derived suppressor cells. Myeloid-derived suppressor cells (MDSCs) are a heterogeneous population of early myeloid progenitor cells, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. MDSCs have the ability to suppress both the cytotoxic activity of natural killer (NK) cells and NKT cells, as well as adaptive immune responses mediated by CD4+ and CD8+ T cells. Long AH et al. (2016) Cancer Immunol Res.;4(10):869-880 describes the co-treatment of CARs with all-trans retinoic acid (ATRA) for the successful treatment of solid tumors (the contents of which are incorporated by reference in their entirety).

[0369] As used herein, adjuvant therapy refers to treatment administered in addition to primary therapy to kill cancer cells, even when standard laboratory tests cannot detect the cancer. Experimental data have shown that lymphocyte depletion induced by cytotoxic regimens for cancer treatment can contribute to relapse. Adjuvant immunotherapy can minimize relapse to cancer immunotherapy. In some embodiments, adjuvant therapy can include coadministration of recombinant human interleukin-2 in combination with dendritic cells pulsed with tumor cell-derived peptides. In some embodiments, dendritic cells are pulsed with autologous tumor cell lysate and keyhole limpet hemocyanin (KLH). Immune cells may be further depleted of CD25-positive T cells. Interleukin-7 may also be coadministered as immunotherapy. In some embodiments, the monoclonal antibody 8H9, which interacts with a tumor cell surface antigen, may be used to eliminate the risk of reinjecting donor-derived tumor cells. Any of the adjuvant therapies set forth in Merchant et al. (2016), Clin Cancer Res. 1;22(13):3182-91, the contents of which are incorporated by reference in their entirety, may be utilized.

[0370] In some embodiments, the compositions of the present invention can be used in combination with a CXCR2 inhibitor or an anti-CXCR2 antibody. Highfill SL et al. (2014) found that CXCR2-positive MDSC cells limit the efficacy of immunotherapy through local immunosuppression (Highfill SL, et al. Sci Transl Med. 2014 May 21; 6(237):237ra67; the contents of which are incorporated herein by reference in their entirety).

[0371] 4.Disease The present invention provides a method for reducing tumor volume or tumor burden in a subject in need thereof, the method comprising introducing into the subject a composition of the present invention.

[0372] The present invention also provides a method for treating cancer in a subject, comprising administering to the subject an effective amount of immune effector cells genetically modified to express at least one effector module of the present invention.

[0373] cancer The pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention can be used to treat various cancers. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, as well as pathological conditions characterized by the growth of such malignant neoplasms. The cancer may be a tumor or a hematological malignancy, including, but not limited to, all types of lymphoma / leukemia, carcinoma, and sarcoma, such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, tailbone, testicles, thyroid, and uterus.

[0374] Types of carcinomas that may be treated with the compositions of the present invention include, but are not limited to, papilloma / carcinoma, choriocarcinoma, yolk sac tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, hemangioma, osteoma, chondroma, glioma, lymphoma / leukemia, squamous cell carcinoma, small cell carcinoma, undifferentiated large cell carcinoma, basal cell carcinoma, and undifferentiated sinonasal carcinoma.

[0375] Types of carcinomas that may be treated with the compositions of the present invention include, but are not limited to, soft tissue sarcomas, such as alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, angiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, as well as Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.

[0376] By way of non-limiting example, carcinomas that may be treated include acute granulocytic leukemia, acute lymphocytic leukemia, acute myeloid leukemia, adenocarcinoma, adenosarcoma, adrenal carcinoma, adrenocortical carcinoma, anal carcinoma, anaplastic astrocytoma, angiosarcoma, appendix carcinoma, astrocytoma, basal cell carcinoma, B-cell lymphoma), bile duct carcinoma, bladder carcinoma, bone cancer, intestinal cancer, brain cancer, brain stem glioma, brain tumor, breast cancer, carcinoid tumor, cervical cancer, cholangiocarcinoma, chondrosarcoma, chronic lymphocytic leukemia, chronic myeloid leukemia, and leukemia. Myeloid leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous lymphoma, cutaneous melanoma, diffuse astrocytoma, ductal carcinoma in situ, endometrial cancer, ependymoma, epithelioid sarcoma, esophageal cancer, Ewing's sarcoma, extrahepatic bile duct cancer, eye cancer, fallopian tube cancer, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal cancer, gastrointestinal carcinoid cancer, common gastrointestinal stromal tumor, germ cell tumor, glioblastoma multiforme, glioma, hairy cell leukemia, head and neck cancer, hemangioendothelioma, Hodgkin's disease Lymphoma, Hodgkin's disease, Hodgkin's lymphoma, hypopharyngeal cancer, invasive ductal carcinoma, invasive lobular adenocarcinoma, inflammatory breast cancer, intestinal cancer, intrahepatic bile duct cancer, invasive breast cancer / invasive breast cancer, pancreatic islet cell carcinoma, jaw cancer, Kaposi's sarcoma, kidney cancer, laryngeal cancer, leiomyosarcoma, leptomeningeal metastasis, leukemia, lip cancer, liposarcoma, liver cancer, lobular carcinoma in situ, low-grade astrocytoma, lung cancer, lymph node cancer, lymphoma, male breast cancer, medullary carcinoma, medulloblastoma, melanoma, meningioma, melanocorticoid Kell cell carcinoma, mesenchymal chondrosarcoma, mesenchymoma, mesothelioma, metastatic breast cancer, metastatic melanoma, metastatic squamous cell cervical cancer, mixed glioma, oral cancer, mucinous carcinoma, mucosal melanoma, multiple myeloma, nasal cancer, nasopharyngeal carcinoma, cervical cancer, neuroblastoma, neuroendocrine tumor, non-Hodgkin's lymphoma, non-small cell lung cancer, oat cell carcinoma, eye cancer, intraocular melanoma, oligodendroglioma, oral cancer, oral cavity cancercancer), oropharyngeal cancer, osteogenic sarcoma, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian primary peritoneal cancer, ovarian sex cord stromal tumor, Paget's disease, pancreatic cancer, papillary cancer, sinus cancer, parathyroid cancer, pelvic cancer, penile cancer, peripheral nerve cancer, peritoneal cancer, pharyngeal cancer, pheochromocytoma, pilocytic astrocytoma, pineal tumor, pineoblastoma, pituitary cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis cancer, rhabdomyosarcoma, salivary gland cancer, The cancer may be sarcoma, osteosarcoma, soft tissue sarcoma, uterine sarcoma, sinus cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, spinal cancer, vertebral column cancer, spinal cancer, spinal tumor, squamous cell carcinoma, gastric cancer, synovial sarcoma, T-cell lymphoma), testicular cancer, pharyngeal cancer, thymoma / thymic cancer, thyroid cancer, tongue cancer, tonsillar cancer, transitional cell carcinoma, transitional cell carcinoma, triple-negative breast cancer, fallopian tube cancer, tubular carcinoma, ureteral cancer, urethral cancer, uterine adenocarcinoma, uterine cancer, uterine sarcoma, vaginal cancer, or vulvar cancer.

[0377] In some embodiments, the CARs of the present invention may be CARs useful for treating multiple myeloma, such as CS1 CARs, CD38 CARs, CD138 CARs, and BCMA CARs. In some embodiments, the CARs of the present invention may be CARs useful for treating acute myeloid leukemia, such as CD33 CARs, CD123 CARs, and CLL1 CARs. In some embodiments, the CARs of the present invention may be CARs useful for treating T-cell leukemia, such as CD5 CARs and CD7 CARs. In some embodiments, a CAR of the present invention may be a CAR useful for treating solid tumors, such as a mesothelin CAR, GD2 CAR, GPC3 CAR, Her2 CAR, EGFR CAR, Mucl CAR, EpCAM CAR, PD-L1 CAR, CEA CAR, Mucl6 CAR, CD133 CAR, CD171 CAR, CD70 CAR, CLD18 CAR, cMET CAR, EphA2 CAR, FAP CAR, folate receptor CAR, IL13Ra2 CAR, MG7 CAR, PSMA CAR, ROR1 CAR, and VEGFR2 CAR.

[0378] infectious disease In some embodiments, the biological circuits of the present invention may be used to treat infectious diseases. The biological circuits of the present invention may be introduced into cells suitable for adoptive cell transfer, such as macrophages, dendritic cells, natural killer cells, and / or T cells. The infectious diseases treated by the biological circuits of the present invention may be diseases caused by viruses, bacteria, fungi, and / or parasites. The IL15-IL15Ra payloads of the present invention may be used to enhance immune cell proliferation and / or immune cell persistence, which are useful for treating infectious diseases.

[0379] As used herein, "infectious disease" refers to a disease caused by any pathogen or agent that infects mammalian cells, preferably human cells, and causes a disease state, including bacteria, yeast, fungi, protozoa, mycoplasma, viruses, prions, and parasites. By way of example, (a) a viral disease, such as a disease resulting from infection with an adenovirus, a herpesvirus (e.g., HSV-I, HSV-II, CMV, or VZV), a poxvirus (e.g., an orthopoxvirus such as smallpox or vaccinia, or molluscum contagiosum), a picornavirus (e.g., a rhinovirus or an enterovirus), an orthomyxovirus (e.g., an influenza virus), a paramyxovirus (e.g., a parainfluenza virus, a mumps virus, a measles virus, and a respiratory syncytial virus (RSV)), a coronavirus (e.g., SARS), a papovavirus (e.g., a papillomavirus that causes genital warts, common warts, or plantar warts), a hepadnavirus (e.g., a hepatitis B virus), a flavivirus (e.g., a hepatitis C virus or a dengue virus), or a retrovirus (e.g., a lentivirus such as HIV). (b) Bacterial diseases, such as Escherichia, Enterobacter, Salmonella, Staphylococcus, Shigella, Listeria, Aerobacter, Helicobacter, Klebsiella, Proteus, Pseudomonas, Streptococcus, Chlamydia, Mycoplasma, Pneumococcal Diseases caused by infections with bacteria of the genera Ccus, Neisseria, Clostridium, Bacillus, Corynebacterium, Mycobacterium, Campylobacter, Vibrio, Serratia, Providencia, Chromobacterium, Brucella, Yersinia, Haemophilus, or Bordetella;(c) other infectious diseases such as chlamydia, fungal diseases including but not limited to candidiasis, aspergillosis, histoplasmosis, and cryptococcal meningitis, parasitic diseases including but not limited to malaria, Pneumocystis carnii pneumonia, leishmaniasis, cryptosporidiosis, and toxoplasmosis, as well as trypanosome infections and prion-related infections that cause human diseases such as Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, and kuru;

[0380] 5. Microbiome Changes in the composition of the microbiome can affect the action of anti-cancer therapies. Diverse communities of mutualistic, commensal, and pathogenic microorganisms exist at all environmentally exposed sites within the body, referred to herein as the "microbiome." Environmentally exposed sites of the body where the microbiome may reside include the skin, nasopharynx, oral cavity, respiratory tract, gastrointestinal tract, and reproductive system.

[0381] In some embodiments, natural or immunotherapeutic modified microbiomes may be used to improve the efficacy of anti-cancer immunotherapy. A method for using microbiomes to improve responsiveness to immunotherapeutic drugs has been described by Sivan et al. (Sivan A., et al. 2015. Science; 350:1084-9; the contents of which are incorporated herein by reference in their entirety). In other embodiments, microorganisms may be delivered together with the immunotherapeutic compositions of the present invention to improve the efficacy of immunotherapy.

[0382] 6. Tools and drugs for creating therapeutic drugs The present invention provides tools and agents that can be used to generate immunotherapeutic agents to reduce tumor volume or tumor burden in subjects in need thereof. A significant number of variables are involved in the production of therapeutic agents, including payload structure, cell type, method of gene transfer, method and time of ex vivo propagation, preconditioning, and tumor volume and type in the subject. Such parameters may be optimized using the tools and agents described herein.

[0383] cell line The present disclosure provides mammalian cells genetically modified with the compositions of the present invention. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include, but are not limited to, the human embryonic kidney cell line 293, the fibroblast cell line NIH 3T3, the human colorectal cancer cell line HCT116, the ovarian cancer cell line SKOV-3, the immortalized T cell lines Jurkat and SupT1, the lymphoma cell lines Raji, NALM-6, K562, HeLa, PC12, HL-60, NK cell lines (e.g., NKL, NK92, NK962, and YTS), REH, SEM, KOPN8, Daudi, Raji, and the like. In some examples, the cells are not immortalized cell lines but are cells obtained from an individual, referred to herein as primary cells. For example, the cells are T lymphocytes obtained from an individual. Other examples include, but are not limited to, cytotoxic cells, stem cells, peripheral blood mononuclear cells or progenitor cells obtained from an individual.

[0384] SRE, biological circuits, and cell line tracking In some embodiments, it may be desirable to track the compositions of the invention or cells modified with the compositions of the invention. Tracking may be achieved by using a payload such as a reporter moiety, which as used herein refers to any protein capable of generating a detectable signal in response to an input. Examples include alkaline phosphatase, β-galactosidase, chloramphenicol acetyltransferase, β-glucuronidase, peroxidase, β-lactamase, catalytic antibodies, bioluminescent proteins such as luciferase, and fluorescent proteins such as green fluorescent protein (GFP).

[0385] The reporter moiety may be used to monitor the response of the DD upon addition of a ligand corresponding to the DD. In other examples, the reporter moiety may be used to track cell survival, persistence, cell proliferation, and / or localization in vitro, in vivo, or ex vivo.

[0386] In some embodiments, a preferred reporter moiety may be a luciferase protein. In one embodiment, the reporter moiety is Renilla luciferase or firefly luciferase. Table 14 provides sequences of reporter moieties. The amino acid sequences in Table 14 may contain a stop codon, which may be added at the end of the amino acid sequence with " * " is shown in the table. [Table 14-1] [Table 14-2] [Table 14-3] [Table 14-4]

[0387] Animal models The usefulness and efficacy of the compositions of the present invention may be tested in an in vivo animal model, preferably a mouse model. The mouse model used may be a syngeneic mouse model in which mouse cells are modified with the compositions of the present invention and tested in mice of the same genetic background. Examples include the pMEL-1 and 4T1 mouse models. Alternatively, xenograft models in which human cells, such as tumor cells or immune cells, are introduced into immunodeficient mice may also be utilized in such studies. The immunodeficient mice used are CByJ.Cg-Foxn1 nu / J, B6;129S7-Rag1 tm1Mom / J, B6.129S7-Rag1 tm1Mom / J, B6.CB17-Prkdc scid / SzJ, NOD.129S7(B6)-Rag1 tm1Mom / J, NOD.Cg-Rag1 tm1Mom Prf1 tm1Sd z / Sz, NOD.CB17-Prkdc scid / SzJ, NOD.Cg-Prkdc scid B2m tm1Unc / J, NOD-scid IL2Rg null , nude (nu) mice, SCID mice, NOD mice, RAG1 / RAG2 mice, NOD-Scid mice, IL2rg null mice, b2m null mice, NOD-scid IL2rγ null mice, NOD-scid-B2m null mice, and HLA transgenic mice.

[0388] Cell assay In some embodiments, the effectiveness of the compositions of the present invention as immunotherapeutics may be evaluated using cellular assays. The expression level and / or identity of the compositions of the present invention may be determined according to any method known in the art for identifying proteins and / or quantifying protein levels. In some embodiments, such methods may include Western blotting, flow cytometry, and immunoassays.

[0389] Provided herein are methods for functionally characterizing cells expressing the SREs, biological circuits, and compositions of the present invention. In some embodiments, functional characterization may be performed on primary immune cells or immortalized immune cell lines and determined by the expression of cell surface markers. Examples of cell surface markers for T cells include, but are not limited to, CD3, CD4, CD8, CD14, CD20, CD11b, CD16, CD45, and HLA-DR, CD69, CD28, CD44, IFNγ, PD1, TIM3, and LAG3. Examples of cell surface markers for antigen-presenting cells include, but are not limited to, MHC class I, MHC class II, CD40, CD45, B7-1, B7-2, IFNγ receptor, IL2 receptor, ICAM-1, and / or Fcγ receptor. Examples of cell surface markers of dendritic cells include, but are not limited to, MHC class I, MHC class II, B7-2, CD18, CD29, CD31, CD43, CD44, CD45, CD54, CD58, CD83, CD86, CMRF-44, CMRF-56, DCIR, and / or Dectin-1; while in some cases, CD2, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD20, CD56, and / or CD57 are simultaneously absent. Examples of cell surface markers of NK cells include, but are not limited to, CCL3, CCL4, CCL5, CCR4, CXCR4, CXCR3, NKG2D, CD71, CD69, CCR5, phospho-JAK / STAT, phospho-ERK, phospho-p38 / MAPK, phospho-AKT, phospho-STAT3, granulysin, granzyme B, granzyme K, IL10, IL22, IFNg, LAP, perforin, and TNFa.

[0390] V. Delivery Methods and / or Vectors vector The present invention also provides vectors that package polynucleotides of the present invention encoding biological circuits, effector modules, SREs (DDs), and payload constructs, as well as combinations thereof. The vectors of the present invention may also be used to deliver the packaged polynucleotides to cells, localized tissue sites, or subjects. These vectors may be of any type, including DNA vectors, RNA vectors, plasmids, viral vectors, and particles. Viral vector technology is well known and is described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). Viruses useful as vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, herpes simplex viral vectors, retroviral vectors, oncolytic viruses, and the like.

[0391] Generally, a vector contains an origin of replication functional in at least one organism, a promoter sequence and convenient restriction endonuclease sites, as well as one or more selectable markers, such as drug resistance genes.

[0392] As used herein, a promoter is defined as a DNA sequence recognized by the cellular transcriptional machinery necessary to initiate specific transcription of a polynucleotide sequence of the present invention. A vector can contain a native or non-native promoter operably linked to a polynucleotide of the present invention. The selected promoter may be strong, weak, constitutive, inducible, tissue-specific, developmental stage-specific, and / or organism-specific. One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of a polynucleotide sequence operably linked to it. Another example of a preferred promoter is the elongation growth factor-1.α (EF-1.α) promoter. Other constitutive promoters, including but not limited to the simian virus 40 (SV40) promoter, mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV) promoter, long terminal repeat (LTR) promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, and Rous sarcoma virus promoter, as well as human gene promoters, including but not limited to the phosphoglycerate kinase (PGK) promoter, actin promoter, myosin promoter, hemoglobin promoter, ubiquitin C (Ubc) promoter, human U6 small nuclear protein promoter, and creatine kinase promoter, may also be used. In some examples, inducible promoters, such as, but not limited to, the metallothionine promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter, may be used. In some embodiments, the promoter may be selected from SEQ ID NOs: 220-222 and SEQ ID NO: 836.

[0393] In some embodiments, optimal promoters may be selected based on their ability to achieve minimal expression of the SRE and payload of the invention in the absence of a ligand, and detectable expression in the presence of a ligand.

[0394] Additional promoter elements, such as enhancers, may be used to regulate the frequency of transcription initiation. Such regions may be located 10 to 100 base pairs upstream or downstream of the initiation site. In some instances, two or more promoter elements may be used to activate transcription coordinately or independently.

[0395] Suitable vectors include vectors designed for propagation and amplification or expression, or both, such as plasmids and viruses. Vectors can be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), pBluescript series (Stratagene, La Jolla, CA), pET series (Novagen, Madison, WI), pGEX series (Pharmacia Biotech, Uppsala, Sweden), and pEX series (Clontech, Palo Alto, CA). Bacteriophage vectors such as λGT10, λGT11, λZapII (Stratagene), λEMBL4, and λNM1149 can also be used. Examples of plant expression vectors include pBI01, pBI101.2, pBI101.3, pBI121, and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM, and pMAMneo (Clontech). Recombinant expression vector can be a viral vector, for example, a retroviral vector or a lentiviral vector.In some embodiments, the vector can be a transposon.All of the vectors disclosed in International Patent Publication WO2014065961 can be used in the present invention (the contents of which are incorporated herein by reference in their entirety).

[0396] In some embodiments, the recombinant expression vector may include regulatory sequences, such as transcriptional and translational initiation and termination codons, that are specific to the type of host cell into which the vector is introduced.

[0397] 1. Lentiviral Vectors In some embodiments, lentiviral vectors / particles may be used as vehicles and delivery modes. Lentiviruses are a subgroup of viruses in the retroviridae family, named for the need for reverse transcription of the viral RNA genome into DNA prior to integration into the host genome. Therefore, the most important feature of lentiviral vehicles / particles is the integration of genetic material into the genome of target / host cells. Some examples of lentiviruses include human immunodeficiency viruses: HIV-1 and HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna-maedi virus, and caprine arthritis-encephalitis virus (CAEV).

[0398] Generally, the lentiviral particles that constitute gene delivery vehicles are replication-deficient (also known as "self-inactivating"). Lentiviruses can infect both dividing and non-dividing cells by entering through the intact host nuclear envelope (Naldini L et al., Curr. Opin. Biotechnol, 1998, 9:457-463). Recombinant lentiviral vehicles / particles have been generated by multiple attenuation of HIV pathogenicity genes, e.g., deletion of Env, Vif, Vpr, Vpu, Nef, and Tat genes to make the vector biologically safe. Similarly, lentiviral vehicles derived from, for example, HIV-1 / HIV-2, can mediate efficient delivery, integration, and long-term expression of transgenes in non-dividing cells. As used herein, the term "recombinant" refers to vectors or other nucleic acids containing both lentiviral and non-lentiviral retroviral sequences.

[0399] Lentiviral particles may be produced by co-expressing viral packaging elements and the vector genome itself in producer cells, such as human HEK293T cells. These elements are typically provided in three (second-generation lentiviral systems) or four (third-generation lentiviral systems) separate plasmids. Plasmids encoding lentiviral components, including the viral core (i.e., structural proteins) and enzymatic components, as well as the envelope protein(s), (called packaging systems), and a plasmid encoding the genome containing the exogenous transgene to be introduced into target cells, i.e., the vehicle itself (also called transfer vector), are co-transfected into producer cells. Typically, the plasmid or vector is contained in a producer cell line. The plasmid / vector is introduced into the producer cell line via transfection, transduction, or infection. Methods for transfection, transduction, or infection are well known to those skilled in the art. By way of non-limiting example, packaging and delivery constructs can be introduced into a producer cell line by calcium phosphate transfection, lipofection, or electroporation, followed by isolation of clones, typically using dominant selectable markers such as neo, DHFR, Gln synthetase, or ADA, and selection in the presence of the appropriate drug.

[0400] The producer cells produce recombinant viral particles containing the foreign gene, e.g., the effector module of the present invention. The recombinant viral particles are recovered from the culture medium and titered using standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to infect target cells.

[0401] Cells used to produce high-titer lentiviral particles include, but are not limited to, HEK293T cells, 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11:452-459), the FreeStyle™ 293 Expression System (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 10996):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110; the contents of each are incorporated herein by reference in their entirety).

[0402] In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or baculovirus gp64 envelope protein. VSV-G glycoprotein is particularly useful in the genus Vesiculovirus, including species such as Carajas virus (CJSV), Chandipura virus (CHPV), Coccoccus virus (COCV), Isfahan virus (ISFV), Maraba virus (MARAV), Pili virus (PIRYV), Vesicular stomatitis Alagoas virus (VSAV), Vesicular stomatitis Indiana virus (VSIV), and Vesicular stomatitis New Jersey virus (VSNJV), and / or grass carob rhabdovirus, BeAn157575 virus (BeAn157575), Botec virus (BTKV), Calchaqui virus (CQIV), El virus Americana virus (EV). The virus may be selected from strains tentatively classified in the genus Vesiculovirus as A), Grey Lodge virus (GLOV), Uronavirus (JURY), Klamath virus (KLAV), Quattavirus (KWAV), La Jolla virus (LJV), Malpes Spring virus (MSPV), Mount Elgon bat virus (MEBV), Perinetovirus (PERV), Pike fly rhabdovirus (PFRV), Porton virus (PORV), Radi virus (RADIV), Spring viremia of carp virus (SVCV), Tree shrew virus (TUPV), Ulcerative disease rhabdovirus (UDRV), and Yagbogdanova virus (YBV).The gp64 or other baculovirus env protein can be derived from Autographa californica nuclear polyhedrosis virus (AcMNPV), Anagrapha falcifera nuclear polyhedrosis virus, Bombyx mori nuclear polyhedrosis virus, Choristoneura fumiferana nuclear polyhedrosis virus, Orgyia pseudotsugata monocapsid nuclear polyhedrosis virus, Epiphyas postvittana nuclear polyhedrosis virus, Hyphantria cunea nuclear polyhedrosis virus, Galleria mellonella nuclear polyhedrosis virus, Dori virus, Thogoto virus, Antheraea pemyi nuclear polyhedrosis virus, or Batken virus.

[0403] Additional elements provided in the lentiviral particle may include a retroviral long terminal repeat (LTR) at either the 5' or 3' end, a retroviral transport element, optionally a lentiviral reverse response element (RRE), its promoter or active portion, and a locus control region (LCR) or its active portion. Other elements include a central polypurine tract (cPPT) sequence, which improves transduction efficiency in non-dividing cells, and a woodchuck hepatitis virus (WHP) post-transcriptional regulator (WPRE), which enhances transgene expression and increases titer. An effector module is ligated into the vector.

[0404] Methods for producing recombinant lentiviral particles are discussed in the art, for example, in U.S. Pat. Nos. 8,846,385; 7,745,179; 7,629,153; 7,575,924; 7,179,903; and 6,808,905; the contents of each of which are incorporated herein by reference in their entirety.

[0405] The lentiviral vector used may be selected from, but is not limited to, pLVX, pLenti, pLenti6, pLJM1, FUGW, pWPXL, pWPI, pLenti CMV puro DEST, pLJM1-EGFP, pULTRA, pInducer20, pHIV-EGFP, pCW57.1, pTRPE, pELPS, pRRL, and pLionII.

[0406] Lentiviral vehicles known in the art may also be used (see U.S. Patent Nos. 9,260,725; 9,068,199; 9,023,646; 8,900,858; 8,748,169; 8,709,799; 8,420,104; 8,329,462; 8,076,106; 6,013,516; and 5,994,136; International Patent Publication No. WO2012079000; the contents of each of which are incorporated herein by reference in their entirety).

[0407] 2. Retroviral vectors (γ-retroviral vectors) In some embodiments, retroviral vectors may be used to package and deliver the biological circuits, biological circuit components, effector modules, SREs, or payload constructs of the present invention. Retroviral vectors (RVs) allow transgenes to be permanently integrated into target cells. In addition to complex HIV-1 / 2-based lentiviral vectors, simple gamma retrovirus-based retroviral vectors have been widely used to deliver therapeutic genes and have been clinically proven as one of the most efficient and powerful gene delivery systems capable of transducing a wide range of cell types. Exemplary species of gamma retroviruses include murine leukemia virus (MLV) and feline leukemia virus (FeLV).

[0408] In some embodiments, gamma retroviral vectors derived from mammalian gamma retroviruses, such as murine leukemia viruses (MLV), are recombinant. The MLV family of gamma retroviruses includes the subfamilies ecotropic, amphotropic, xenotropic, and polytropic. Ecotropic viruses can only infect mouse cells using the mCAT-1 receptor. Examples of ecotropic viruses are Moloney MLV and AKV. Amphotropic viruses infect mice, humans, and other species via the Pit-2 receptor. An example of an amphotropic virus is the 4070A virus. Xenotropic and polytropic viruses utilize the same (Xpr1) receptor but differ in their species tropism. Xenotropic viruses, such as NZB-9-1, can infect humans and other species but not mouse species, while polytropic viruses, such as focus-forming virus (MCF), can infect mice, humans, and other species.

[0409] Gamma retroviral vectors may be produced in packaging cells by co-transfecting cells with several plasmids, including a plasmid encoding the retroviral structural and enzymatic (gag-pol) polyproteins, a plasmid encoding the envelope (env) proteins, and a plasmid encoding a vector mRNA containing a polynucleotide encoding a composition of the invention, which are packaged into newly formed viral particles.

[0410] In some embodiments, recombinant gamma retroviral vectors are pseudotyped with envelope proteins from other viruses. Envelope glycoproteins are incorporated into the outer lipid layer of the viral particle and can enhance / alter cellular tropism. Exemplary envelope proteins include gibbon ape leukemia virus envelope protein (GALV) or vesicular stomatitis virus G protein (VSV-G), or simian endogenous retrovirus envelope proteins, or measles virus H and F proteins, or human immunodeficiency virus gp120 envelope protein, or coccoccus vesiculovirus envelope protein (see, e.g., U.S. Patent Application Publication No. 2012 / 164118; the contents of which are incorporated herein by reference in their entirety). In other embodiments, the envelope glycoproteins may be genetically modified to incorporate targeting / binding ligands into gamma retroviral vectors, including, but not limited to, peptide ligands, single-chain antibodies, and growth factors (Waehler et al., Nat. Rev. Genet. 2007, 8(8):573-587:573-587; the contents of which are incorporated herein by reference in their entirety). These engineered glycoproteins can retarget the vector to cells expressing the corresponding target moiety. In other embodiments, "molecular bridges" may be introduced to direct the vector to specific cells. Molecular bridges have dual specificity: one end can recognize viral glycoproteins, and the other end can bind to molecular determinants on the target cell. Such molecular bridges, such as ligand-receptor, avidin-biotin, and chemical conjugation, monoclonal antibodies, and engineered membrane fusion proteins, can attach viral vectors to target cells for transduction (Yang et al., Biotechnol. Bioeng., 2008, 101(2):357-368; and Maetzig et al., Viruses, 2011, 3, 677-713; the contents of each of which are incorporated herein by reference in their entirety).

[0411] In some embodiments, the recombinant gamma retroviral vector is a self-inactivating (SIN) gamma retroviral vector. The vector is replication-incompetent. SIN vectors may contain deletions within the 3'U3 region, which initially contains enhancer / promoter activity. Additionally, the 5'U3 region may be replaced with a strong promoter from cytomegalovirus or RSV (required for packaging cell lines), or with an internal promoter and / or enhancer element of choice. The selection of the internal promoter may be made according to the specific requirements for gene expression required for the particular purpose of the invention.

[0412] In some embodiments, polynucleotides encoding biological circuits, biological circuit components, effector modules, and SREs are inserted into the recombinant viral genome. Other components of the viral mRNA of a recombinant gamma retroviral vector may be modified by inserting or removing native sequences (e.g., inserting an IRES, inserting a heterologous polynucleotide encoding a polypeptide of interest or an inhibitory nucleic acid, shuffling a more effective promoter from a different retrovirus or virus in place of the wild-type promoter, etc.). In some examples, a recombinant gamma retroviral vector may contain a modified packaging signal, a primer binding site (PBS), and / or a 5'-enhancer / promoter element in the U3 region of the 5'-long terminal repeat (LTR), and / or a modified 3'-SIN element in the U3 region of the 3'-LTR. These modifications may increase titer and infectivity.

[0413] Gamma retroviral vectors suitable for delivering the biological circuit components, effector modules, SREs or payload constructs of the present invention may be selected from vectors disclosed in U.S. Patent Nos. 8,828,718; 7,585,676; 7,351,585; U.S. Patent Application Publication No. 2007 / 048285; PCT Patent Application Publication Nos. WO2010 / 113037; WO2014 / 121005; WO2015 / 056014; and EP Patent Nos. EP1757702; EP1757703 (the contents of each of which are incorporated herein by reference in their entirety).

[0414] 3. Adeno-associated viral vector (AAV) In some embodiments, polynucleotides of the invention may be packaged into recombinant adeno-associated virus (rAAV) vectors. Such vectors or viral particles may be designed to utilize any known serotype capsid or combination of serotype capsids. Serotype capsids may include capsids from any identified AAV serotype and its variants, such as AAV1, AAV2, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAVrhlO.

[0415] In one embodiment, the AAV serotype is selected from the group consisting of sequences set forth in U.S. Publication No. US20030138772, which is incorporated by reference herein in its entirety, including, but not limited to, AAV1 (SEQ ID NOs: 6 and 64 in US20030138772), AAV2 (SEQ ID NOs: 7 and 70 in US20030138772), AAV3 (SEQ ID NOs: 8 and 71 in US20030138772), AAV4 (SEQ ID NO: 63 in US20030138772), AAV5 (SEQ ID NO: 114 in US20030138772), AAV6 (SEQ ID NO: 6 in US20030138772), and AAV7 (SEQ ID NO: 6 in US20030138772). 5), AAV7 (SEQ ID NOs: 1-3 of US20030138772), AAV8 (SEQ ID NOs: 4 and 95 of US20030138772), AAV9 (SEQ ID NOs: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1-738 of SEQ ID NO: 81 of US20030138772) or a variant thereof. Non-limiting examples of variants include SEQ ID NOs: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, 101-113 of US20030138772, the contents of which are incorporated herein by reference in their entirety.

[0416] In one embodiment, the AAV serotype may have a sequence described in Pulicherla et al. (Molecular Therapy, 2011, 19(6):1070-1078), U.S. Patent Nos. 6,156,303; 7,198,951; U.S. Patent Publication Nos. US2015 / 0159173 and US2014 / 0359799; and International Patent Publication Nos. WO1998 / 011244, WO2005 / 033321, and WO2014 / 14422; the contents of each of which are incorporated by reference herein in their entirety.

[0417] AAV vectors include not only single-stranded vectors but also self-complementary AAV vectors (scAAV). scAAV vectors contain DNA that anneals together to form a double-stranded vector genome. By skipping second-strand synthesis, scAAV can be rapidly expressed in cells.

[0418] rAAV vectors may be produced in sf9 insect cells or in suspension cell cultures of human cells such as HEK293 cells by methods standard in the art, such as triple transfection.

[0419] One or more viral genomes packaged into the AAV capsids provided herein may encode a biological circuit, a component of a biological circuit, an effector module, an SRE, or a payload construct.

[0420] Such vectors or viral genomes may contain at least one or two ITRs (inverted terminal repeats), as well as certain regulatory elements required for expression from the vector or viral genome. Such regulatory elements are well known in the art and include, for example, promoters, introns, spacers, stuffer sequences, etc.

[0421] In some embodiments, more than one effector module or SRE (eg, DD) may be encoded in the viral genome.

[0422] 4. Oncolytic viral vectors In some embodiments, polynucleotides of the invention may be packaged into oncolytic viruses, such as vaccinia viruses, including viral particles of a thymidine kinase (TK)-deficient, granulocyte-macrophage (GM) colony-stimulating factor (CSF)-expressing, replication-competent vaccinia virus vector sufficient to induce oncolysis of tumor cells (e.g., U.S. Pat. No. 9,226,977; the contents of which are incorporated by reference in their entirety).

[0423] 5. Messenger RNA (mRNA) In some embodiments, the effector module of the present invention may be designed as a messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded polypeptide of interest. Such mRNA molecules may have any of the structural components or characteristics set forth in International Application No. PCT / US2013 / 030062, the contents of which are incorporated herein by reference in their entirety.

[0424] Polynucleotides of the invention may be used in any manner, including, for example, those disclosed in Ribostem Limited, UK Patent Application No. 0316089.2, filed July 9, 2003, now abandoned; PCT Application No. PCT / GB2004 / 002981, filed July 9, 2004, published as WO2005005622; U.S. Patent Application National Stage Registration No. 10 / 563,897, filed June 8, 2006, published as US20060247195, now abandoned; and European Patent Application National Stage Registration No. EP2004743322, filed July 9, 2004, published as EP1646714, now withdrawn, all of which are incorporated by reference herein in their entireties;to BioNTech, PCT Application No. PCT / US2007 / 88060, filed December 19, 2007, published as WO20...

Claims

1. A polynucleotide encoding an effector module, the effector module comprising: (a) Stimulus response element (SRE); (b) at least one payload operably linked to said SRE; wherein the SRE comprises a destabilization domain (DD), and the DD comprises a human dihydrofolate reductase (hDHFR; SEQ ID NO:2) mutein having a Y122I mutation compared to SEQ ID NO:2; 1. A polynucleotide comprising a payload that is a chimeric antigen receptor (CAR) selected from a GD2 CAR, a Her2 CAR, a BCMA CAR, a CD33 CAR, an ALK CAR, a CD22 CAR, and a CD276 CAR.

2. The hDHFR DD is, compared with SEQ ID NO: 2, M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I 61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72 V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A1 07T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114 R, I115V, I115L, V116I, G117D, V121A, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135L, F1 35S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141 R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K158R, L1 59P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173 G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E, N186S,The polynucleotide of claim 1, further comprising at least one mutation selected from N186D, D187G, or D187N.

3. 3. The polynucleotide of claim 1 or 2, wherein the SRE is responsive to at least one stimulus, and the SRE is responsive to trimethoprim (TMP) and methotrexate (MTX).

4. 4. The polynucleotide of any one of claims 1 to 3, wherein the CAR comprises an extracellular targeting moiety, a transmembrane domain, an intracellular signaling domain, and one or more costimulatory domains.

5. The polynucleotide of any one of claims 1 to 4, wherein the CAR is a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.

6. 5. The polynucleotide of claim 4, wherein the extracellular targeting moiety is selected from an ALK targeting moiety comprising the amino acid sequences of SEQ ID NOs:242-257 and 422-429, a CD22 targeting moiety comprising the amino acid sequences of SEQ ID NOs:258-262 and 430-432, a CD276 targeting moiety comprising the amino acid sequences of SEQ ID NOs:263-270 and 433-436, a GD2 targeting moiety comprising the amino acid sequences of SEQ ID NOs:271-349 and 437-465, a CD33 targeting moiety comprising the amino acid sequences of SEQ ID NOs:350-357, a BCMA targeting moiety comprising the amino acid sequences of SEQ ID NOs:358-365, and a Her2 targeting moiety comprising the amino acid sequences of SEQ ID NOs:366-421 and 466-473.

7. The polynucleotide of any one of claims 1 to 6, wherein the effector module further comprises a signal sequence, a cleavage and / or processing function, a targeting and / or penetration signal, a tag, and / or one or more linker sequences.

8. A vector comprising the polynucleotide according to any one of claims 1 to 7, which is a viral vector or a plasmid.

9. A cell expressing a polynucleotide encoding an effector module as defined in any one of claims 1 to 7 and / or infected or transfected with a vector according to claim 8, comprising: (i) the cells are immune cells for adoptive cell transfer (ACT); (ii) the cell is a CD8+ T cell, a CD4+ T cell, a helper T cell, a natural killer (NK) cell, an NKT cell, a cytotoxic T lymphocyte (CTL), a tumor infiltrating lymphocyte (TIL), a memory T cell, a regulatory T (Treg) cell, a cytokine-induced killer (CIK) cell, a dendritic cell, a human embryonic stem cell, a mesenchymal stem cell, a hematopoietic stem cell, or a mixture thereof; and / or (iii) the cell is a T cell modified to express a chimeric antigen receptor (CAR). cell.

10. (i) a polynucleotide according to any one of claims 1 to 7; (ii) the vector of claim 8; or (iii) the cell of claim 9; and A pharmaceutical composition comprising a pharma- ceutically acceptable excipient.

11. A method for producing a modified cell, the method comprising introducing into a cell a polynucleotide according to any one of claims 1 to 7.

12. The expression, function, and / or level of the payload in the cell of claim 9 is A method of modulating in vivo or in vitro, the method comprising administering a stimulus to the cell, wherein the SRE responds to the stimulus, and the expression, function, and / or level of the payload is modulated in response to the stimulus.

13. 10. The use of a stimulus in the manufacture of a kit for regulating the expression, function, and / or level of a payload in a cell according to claim 9, wherein the stimulus response element (SRE) responds to the stimulus; the stimulus is a small molecule that binds to the SRE; and the expression, function, and / or level of the payload is regulated in response to the stimulus.

14. Use of a polynucleotide according to any one of claims 1 to 7, a vector according to claim 8, or a cell according to claim 9 in the manufacture of a medicament for the treatment of a disease.

15. A composition comprising a polynucleotide according to any one of claims 1 to 7, a vector according to claim 8 or a cell according to claim 9 for use in a method of treating a disease in a subject in need thereof, wherein the composition is administered to the subject in combination with a stimulation, wherein said SRE is responsive to said stimulus and expression of said payload is regulated in response to said stimulus, thereby treating said disease.

16. 10. Use of a polynucleotide according to any one of claims 1 to 7, a vector according to claim 8, or a cell according to claim 9, in the manufacture of a medicament for treating a disease in a subject in need thereof, wherein the polynucleotide, vector or cell is used in combination with a stimulus, wherein the stimulus response element (SRE) is responsive to the stimulus; the stimulus is a small molecule that binds to the SRE; and expression of the payload is regulated in response to the stimulus, thereby treating the disease.

17. 10. A composition comprising a polynucleotide according to any one of claims 1 to 7, a vector according to claim 8, or a cell according to claim 9, for use in a method of preventing or reversing T cell depletion in a subject in need thereof, said method comprising administering said composition to said subject, wherein said SRE responds to a stimulus to modulate the expression and / or function of said payload, thereby preventing or reversing T cell depletion.

18. 10. Use of a polynucleotide according to any one of claims 1 to 7, a vector according to claim 8, or a cell according to claim 9, in the manufacture of a medicament for preventing or reversing T cell depletion in a subject in need thereof, wherein the stimulus response element (SRE) is responsive to the stimulus; the stimulus is a small molecule that binds to the SRE; and expression and / or function of the payload is regulated in response to the stimulus, thereby preventing or reversing T cell depletion.

19. 10. An in vitro method of regulating expression, function, and / or levels of a payload in a cell according to claim 9, the method comprising administering a stimulus to the cell, wherein the stimulus response element (SRE) responds to the stimulus; the stimulus is a small molecule that binds to the SRE; and the expression, function, and / or levels of the payload are regulated in response to the stimulus.

20. A kit for regulating expression, function, and / or level of a payload in a cell, the kit comprising a polynucleotide described in any one of claims 1 to 7, a vector described in claim 8, or a cell described in claim 9, and a stimulus, wherein the stimulus response element (SRE) responds to the stimulus; the stimulus is a small molecule that binds to the SRE; and the expression, function, and / or level of the payload is regulated in response to the stimulus.

21. A composition comprising the polynucleotide according to any one of claims 1 to 7, the vector according to claim 8, or the cell according to claim 9 for treating a disease.

22. 10. A composition comprising the polynucleotide of any one of claims 1 to 7, the vector of claim 8, or the cell of claim 9 for treating a disease in a subject in need thereof, wherein the composition is used in combination with a stimulus, wherein the stimulus response element (SRE) is responsive to the stimulus; the stimulus is a small molecule that binds to the SRE; and expression of the payload is regulated in response to the stimulus, thereby treating the disease.

23. 10. A composition comprising the polynucleotide of any one of claims 1 to 7, the vector of claim 8, or the cell of claim 9 for preventing or reversing T cell depletion in a subject in need thereof, wherein the stimulus response element (SRE) is responsive to the stimulus; the stimulus is a small molecule that binds to the SRE; and expression and / or function of the payload is regulated in response to the stimulus, thereby preventing or reversing T cell depletion.

Images