Methods for identifying eukaryotic species based on whole genome analysis and uses thereof

Abstract

The present application discloses a method for identifying the species of eukaryotic samples based on whole genome analysis, and its use, in which the species of the sample to be detected is identified by a species-specific target sequence obtained by screening. The species identification method of the present invention has good specificity, high sensitivity and good repeatability, and can achieve rapid species identification without relying on large-scale specialized equipment.

Description

[Technical field]

[0001] The present application relates to the technical field of eukaryotic species identification, and in particular to a method for eukaryotic species identification based on whole genome analysis and uses thereof. [Background technology]

[0002] Species identification accompanies the entire history of human development and is closely related to natural exploration, social development and scientific research. Although humans have not yet been able to identify all life forms on Earth, the continuous development of identification methods is enhancing our understanding and realization of other life forms. A large number of scientific researchers are constantly involved in identifying and classifying species that are diverse, widely distributed, complex and difficult to distinguish. In the early stages, species identification is mainly based on the phenotypes of species, such as morphological characteristics, chemical composition, etc., but due to the fact that phenotypes are affected by factors such as environment, growth stage, etc., phenotypes cannot reflect the fundamental reasons for differences between species. During this period, continuous improvements in DNA sequencing technology in reading and accuracy have facilitated the sequencing and analysis of species at the level of the whole genome. With the explosive growth in the number of species with whole genome data, species identification strategies based on whole genome analysis become possible. As a carrier of all the genetic information of a species, the whole genome reveals the fundamental reasons for which a species is distinguished from other species and exhibits specificity. Therefore, new identification methods based on the whole genome also represent the future development direction for species identification. At the same time, the rapid development of bioinformatics and the identification foundation of molecular biology also provide strong support for achieving species identification based on whole genome data. With the continuous development of molecular biological identification methods such as DNA barcode technology, different DNA barcodes that can be used within a certain scope have been found. Meanwhile, with the continuous iteration of sequencing technology and the development of computer hardware and software, genome analysis capabilities have also been greatly enhanced, both of which provide strong support for achieving species identification at the level of the whole genome.

[0003] Gene editing is a genetic engineering tool used to artificially modify the genome of an organism. This technology currently mainly uses the following nucleases: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated proteins (CRISPR / Cas). The CRISPR / Cas system is a new generation of genome editing technology that can recognize specific sequences to achieve the purpose of site-specific editing. Jennifer A. Doudna, Feng Zhang and Jin Wang have successively developed methods such as DETECTR, SHERLOCK and HOLMES, and successfully applied them to genome editing in viruses, bacteria and eukaryotes. For example, in the field of plant biotechnology, gene editing procedures are primarily used to manipulate plant genomes as novel breeding techniques to develop plant varieties with novel properties (see, for example, Kangquan Yin et al., Progress and prospects in plant genome editing, Nature Plants, 3, 17107 (2017)).

[0004] At present, the prior art is mainly to screen sequences that can distinguish specific species in specific gene functional regions. Because the gene database available for screening is small, the target sequences that can be obtained are very limited, and the specificity of the target sequences is insufficient, and it is prone to off-target errors, etc., and cannot fully meet the needs of identifying different species. In particular, it is difficult to meet the needs of identifying related species that have very similar or even identical sequences in a specific region. The whole genome, which contains all the genetic information of an organism, is an ideal database for species identification. Screening for species-specific sequences and their detection by whole genome alignment is the future development direction for species identification. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kangquan Yin et al., Progress and prospects in plant genome editing, Nature Plants, 3, 17107 (2017) Summary of the Invention [Means for solving the problem]

[0006] For this purpose, the present application proposes a method for identifying eukaryotic species based on whole genome analysis. The method of the present application (hereinafter also referred to as the GA method) finds a specific target sequence library based on genome analysis that can accurately identify a species, in particular satisfy the distinction between the species to be identified and related species, and can accurately identify specific sequences through the use of various detection means including (but not limited to) genome editing, sequencing, etc., thereby achieving accurate identification of the species. Compared with the prior art, the GA method of the present application screens and obtains a specific target sequence library that is present only in this species in bulk from the entire genome of a species through the method of bioinformatics analysis, and also takes into account the risk of errors such as off-target, improves the accuracy of species identification, and finally achieves an accurate judgment on the identification of eukaryotic species.

[0007] The present application provides a method for identifying a eukaryotic species based on whole genome analysis, comprising: i) constructing a small fragment genomic library based on the complete genome sequence of the identified species; ii) selectively screening the sequences in the small fragment genome library to obtain an extensive library of candidate target sequences based on the need for subsequent detection, or according to the whole genome annotation file and species sequence information contained in a database, etc.; iii) aligning the sequences in the small fragment genome library or the comprehensive candidate target sequence library with the whole genome sequence of a related species, and selecting specific sequences that are only present in the identified species based on the whole genome sequence of a related species of the identified species to construct a specific target sequence library; iv) performing species identification of the eukaryotic sample based on the selected specific target sequence; The method includes obtaining genomic DNA of a plurality of eukaryotic samples to be detected, detecting whether the genomic DNA contains a sequence in the specific target sequence library, and determining the identity of the sample to be detected and the species to be identified. If a sequence in the specific target sequence library is detected, the plurality of eukaryotic samples are determined to have an identity with the species to be identified, and if a sequence in the specific target sequence library is not detected, the plurality of eukaryotic samples are determined to have no identity.

[0008] In some preferred embodiments, in i), the entire genome sequence of the identified species is divided into (L-K+1) fragments of length K, a small fragment genome library is constructed, the copy number of each fragment therein is calculated, and then the genome location of each fragment is determined by aligning each fragment with the entire genome sequence to facilitate better sequence alignment in subsequent steps, where L represents the length of the entire genome sequence and K represents the length of the fragments in the library.

[0009] In some preferred embodiments, in i), the identified species may be any species in eukaryotes, for example from different kingdoms of organisms such as animals, plants, fungi, etc.

[0010] The entire genome sequences of the species identified herein can be obtained from known public databases or by whole genome sequencing by conventional methods.

[0011] In formula ii), sequences in a small fragment genome library are screened, allowing a wide range of candidate target sequences to be extracted from the entire genome of a specified species, rather than being limited to a specific region, so that the resulting target sequences are widely distributed, which subsequently contributes to eliminating risks such as off-targets.

[0012] In some preferred embodiments, in ii), PAM motifs are detected for each fragment in the small fragment genome library, sequences having PAM are extracted, and a comprehensive candidate target sequence library is constructed. The PAM (protospacer adjacent motif) in this specification can be determined by those skilled in the art based on the genome editing system used for the subsequent detection of specific sequences, for example, when using the CRISPR / Cas12a system for the subsequent detection, PAM of TTTV (SEQ ID NO: 10) at the 5' end or VAAA (SEQ ID NO: 11) at the 3' end can be selected.

[0013] In iii), preferably, before being aligned with the entire genome sequence of the related species, the sequences in the small fragment genome library or the broad candidate target sequence library can be aligned with multiple (e.g., all) known genome sequences of the identified species, and sequences that can exactly match the multiple known genome sequences of the identified species are screened from the small fragment genome library or the broad candidate target sequence library to construct a primary candidate target sequence library for the identified species. The primary candidate target sequence library is then aligned with the entire genome sequence of the related species, and sequences that are only present in the identified species are selected to construct a specific target sequence library.

[0014] In iii), it is preferable to select sequences that are present only in a specific species in a region with high intraspecies conservation and large interspecies differences to construct a specific target sequence library. Considering off-target effects, it is preferable to select sequences that have at least n base differences (n≧3) with the whole genome sequence of a related species (e.g., a similar (contaminant) substance). Preferably, the specificity of the target sequence can be further improved by increasing the n value, or target sequences within a predetermined number range can be screened by adjusting the n value.

[0015] In the present disclosure, in iii), preferably, a specific target sequence library can be constructed by selecting a plurality of different sequences that are present only in the identified species, to be used in the sample to be detected and subsequent experiments to determine the identity of the identified species.

[0016] In the present disclosure, the eukaryotic sample to be detected may be any eukaryotic sample, such as a sample from an animal, a plant, or a fungus. For example, the eukaryotic sample to be detected may be a sample from cordyceps (Ophiocordyceps sinensis), rheum (Rheum officinale), red deer (Cervus elaphus), cordyceps militaris, rheum palmatum, or reindeer (Rangifer tarandus). In some embodiments, the eukaryotic sample to be detected is a sample from a single species source or a mixture of samples from multiple species sources.

[0017] In some preferred embodiments, the identified species is Cordyceps sinensis of the kingdom Fungi, and in iii) the specific target sequence is the nucleotide sequence shown in SEQ ID NO:1. SEQ ID NO: 1: TTTGGGAGTGGTGACTCGATAATGA

[0018] In some preferred embodiments, the identified species is Rheum vulgare of the kingdom Plantae and in iii) the specific target sequence is the nucleotide sequence shown in SEQ ID NO:2. SEQ ID NO: 2: AATATGGTTATGTTATTATTAATAAA

[0019] In some preferred embodiments, the identified species is of the kingdom Animalia red deer and in iii) the specific target sequence is the nucleotide sequence shown in SEQ ID NO:3. SEQ ID NO: 3: TTTATGCACCTGATGATTTTCTACG

[0020] In the present disclosure, in iv), any detection technique / means known in the art for recognizing specific sequences can be used for detection. In some preferred embodiments, in iv), gene editing system and sequence recognition means such as sequencing can be used for detection to determine whether specific target sequences are present in the sample to be detected.

[0021] In some preferred embodiments, in iv), in order to make the detection easier and more direct while maintaining high sensitivity, a genome editing system, preferably a CRISPR / Cas system using fluorescent signal molecules (such as the CRISPR / Cas9 system, the CRISPR / Cas12a system, the CRISPR / Cas12b system, and the CRISPR / Cas13 system) is used for detection.

[0022] In the present disclosure, in iv), before detection, a tool library (such as a crRNA library and a primer library) matching a specific target sequence is pre-constructed based on different technologies (including but not limited to gene editing technology, sequencing technology, etc.) used in genomic DNA sequence detection. In a further preferred embodiment, in iv), a genome editing system is used for detection, and a tool library of CRISPR RNA (crRNA) and optional tracrRNA matching a specific target sequence is pre-constructed. In another preferred embodiment, in iv), sequencing is used for detection, and a tool library of primer pairs matching a specific target sequence is pre-constructed.

[0023] In some preferred embodiments, the species identified is Cordyceps sinensis, and in iv) the following primer pair is used for detection: ITS4F: 5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID NO: 4) ITS5R: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 5)

[0024] In some preferred embodiments, the species identified is Rheum officinalis and in iv) the following primer pair is used for detection: Ro_1F: 5'-CCAAATTGCCCGAAGCCTATG-3' (SEQ ID NO: 6) Ro_1R: 5'-ATCGCTTTCCGACCCACAAT-3' (SEQ ID NO: 7)

[0025] In some preferred embodiments, the species identified is red deer and in iv) the following primer pair is used for detection: Ce_17F: 5'-AGCAGAAGTGATGGTTGCTG-3' (SEQ ID NO: 8) Ce_17R: 5'-AAGAATCCTAGGAAGAACTGGT-3' (SEQ ID NO: 9)

[0026] In a further preferred embodiment, thio modifications are selected at both ends of the primer sequence, which can further improve the amplification efficiency and detection sensitivity.

[0027] In the present disclosure, as an example, the desired genome editing system includes at least a room temperature amplification reagent, a buffer solution, a Cas protein, a crRNA, nuclease-free water, and a fluorescent signal molecule (such as a ssDNA fluorescent reporter gene). For example, the desired genome editing system is used for detection using the genomic DNA of the biological sample to be detected as a substrate. If the presence of a species-specific target sequence is identified, the reaction system generates fluorescence. If there is a significant difference between the measured fluorescence value and the blank control, the sample to be detected is determined to have identity with the identified species, and if there is no significant difference between the measured fluorescence value and the blank control, the sample to be detected is determined to not have identity with the identified species.

[0028] In the present disclosure, the room temperature amplification reagent may be any known amplification reagent selected by a person skilled in the art according to the actual situation, and the buffer and Cas protein may be determined according to the genome editing system used. Specifically, taking the CRISPR / Cas12a system as an example, the ERA amplification reagent, NEBuffer2.1 and Lba Cas12a (Cpf1) can be selected, and the fluorescent signal molecule Poly_C_FQ (5'-FAM-CCCCCCCCCC (SEQ ID NO: 12)-BHQ-3') can be selected. After adding crRNA, nuclease-free water and genomic DNA of the sample to be detected, the amplification reaction is carried out at the bottom of the tube, and the detection reagent (NEBuffer2.1, Lba Cas12a, crRNA and nuclease-free water) reacts on the tube cap. As an example, the detection is carried out using the CRISPR / Cas12a system with the reaction system shown in Table 1 below. After the reaction system is incubated at 40°C for 20 minutes, the detection reagent in the tube cap is precipitated to the bottom by a short centrifugation, all the reagents are thoroughly mixed, and incubated at room temperature for 10 minutes. 4 μL of Poly_C_FQ (400 nM) is mixed with the above system, then incubated at 37°C, and λ is measured by a microplate reader. ex 483nm / λ em The fluorescence values ​​are detected at 0, 3, 6, 9, 12, 15, 25, 35, 45 and 60 minutes at 535 nm (these wavelengths can be determined according to the selected fluorescent signal molecules). If there is a significant difference (P<0.01) between the detection result and the detection result of the blank control, it can be determined that the sample to be detected has identity with the identified species, and if there is no significant difference between the detection result and the detection result of the blank control, it can be determined that the sample to be detected does not have identity with the identified species.

[0029] [Table 1]

[0030] The above method can be used to identify the species of a eukaryotic sample in different application scenarios, which includes carrying out the above method on the species to be identified and determining the identity between the sample to be detected and the identified species based on the fluorescence detection result.

[0031] In one embodiment, the present application relates to the use of the above-mentioned species identification method in constructing a target sequence library for identifying eukaryotic species, wherein a species to be identified is selected, one or more specific target sequences of the identified species are obtained by screening with the above-mentioned species identification method, and the one or more specific target sequences of the identified species are combined to construct a target sequence library.

[0032] Alternatively, the present application provides a method for constructing a specific target sequence library for identification of eukaryotic species, comprising: a) selecting a species to be identified and screening one or more specific target sequences of the identified species according to the above-mentioned species identification method; b) combining one or more specific target sequences of the identified species to construct a specific target sequence library; The present invention relates to a method comprising the steps of:

[0033] Alternatively, the present application provides a method for constructing a tool library for detecting a particular specific target sequence of a eukaryotic species, comprising the steps of: A) selecting a specific species and constructing a target sequence library according to the method for constructing a specific target sequence library described above; B) constructing a tool library (including but not limited to crRNA library, primer library, etc.) that matches the specific target sequence based on the technology used for detection (which may include but is not limited to gene editing, sequencing technology, etc., according to the diversity of sequence detection methods); The present invention relates to a method comprising the steps of:

[0034] Alternatively, the present application provides a method for distinguishing Chinese medicinal substances from their corresponding analogue substances, comprising: I) using the above Chinese medicinal substances or similar substances as the species to be identified, and screening for specific target sequences according to the above species identification method; II) obtaining genomic DNA of the target pharmaceutical sample, detecting whether the genomic DNA contains the specific target sequence, thereby determining the identity of the target pharmaceutical sample with the Chinese medicinal material or analogous substance; The present invention relates to a method comprising the steps of:

[0035] Alternatively, the present application relates to a method for detecting the safety of a food, medicine or health product, comprising: 1) taking a food eukaryote, a pharmaceutical eukaryote, or a health product eukaryote as a species to be identified, and screening for a specific target sequence according to the above species identification method; 2) obtaining genomic DNA of the food, medicine or health product to be detected, detecting whether the genomic DNA contains the specific target sequence, and determining the identity between the eukaryotic sample and the identified species; Through this detection, food, medicine and health products derived from counterfeit and inferior biological species can be found, thereby ensuring the safety of food, medicine and health products.

[0036] This application is a species-specific target sequence for identification of Cordyceps species, which is the nucleotide sequence set forth in SEQ ID NO:1; A species-specific target sequence for identifying the species of Rheum vulgare, which is the nucleotide sequence set forth in SEQ ID NO: 2; or A species-specific target sequence for identifying the species of red deer, which is the nucleotide sequence set forth in SEQ ID NO:3. The present invention relates to a species-specific target sequence that is

[0037] The present application provides a primer pair for amplifying a species-specific target sequence in a eukaryotic organism, comprising: A primer pair of Ro_1F: 5'-CCAAATTGCCCGAAGCCTATG-3' (SEQ ID NO: 6) and Ro_1R: 5'-ATCGCTTTCCGACCCACAAT-3' (SEQ ID NO: 7) when the eukaryote is Rheum vulgare; or Primer pair Ce_17F: 5'-AGCAGAAGTGATGGTTGCTG-3' (SEQ ID NO: 8) and Ce_17R: 5'-AAGAATCCTAGGAAGAACTGGT-3' (SEQ ID NO: 9) when the eukaryote is red deer The present invention relates to a primer pair comprising:

[0038] When the method described herein is used for species identification, the method can distinguish the identified species from its related species, and accurately achieves the accurate identification of eukaryotic organisms at the species level. This method can play a favorable role in the identification of Chinese medicinal substance analogues, food safety, and the safety of pharmaceutical and health products. This method has strong specificity, high sensitivity and good reproducibility, and can achieve rapid species identification of biological samples without relying on large-scale specialized equipment, and therefore has a wide range of application prospects.

[0039] In the following, exemplary embodiments of the present application are further described in combination with drawings to explain the objectives, technical features and technical effects of the solution of the present application, but the solution of the present invention may also have other undescribed features, advantages, etc. [Brief description of the drawings]

[0040] In order to more clearly illustrate the technical solutions or related technologies in the present disclosure, the drawings that are required to be used in the embodiments or related technology description are briefly introduced below. The following drawings are merely examples of the present disclosure, and the protection scope of the present application is not limited thereto.

[0041] [Figure 1] FIG. 1 is an exemplary flow chart illustrating the GA method of the present disclosure. [Diagram 2]FIG. 2 is a table showing information relating to candidate target sequences of different identified species from the kingdoms Fungi, Animalia and Planta. [Diagram 3] FIG. 3 shows the specific target sequences of Cordyceps sinensis, Rheum officinalis, and Red Deer and the crRNAs matched to each specific target sequence. [Figure 4] FIG. 4 is a diagram of the specificity analysis for specific target sequences of identified species. [Diagram 5] FIG. 5 shows the fluorescence detection results of Cordyceps sinensis samples (Panel A), Rheum officinalis samples (Panel B) and Red deer samples (Panel C) and their analogs. [Figure 6] FIG. 6 shows the sequencing detection results of red deer and its relative, reindeer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] The present application will be described in detail below with reference to examples, which are not intended to be any adverse limitation to the present application. The present disclosure has described the present application in detail and disclosed its specific embodiments. It will be apparent to those skilled in the art that various modifications and improvements can be made to the specific embodiments of the present application without departing from the spirit and scope of the present application.

[0043] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs, and their commonly understood meanings can be found, for example, in Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY, 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press (Cold Springs Harbor, NY, 1989); Current Protocols in Molecular Biology or Current Protocols in Immunology, John Wiley & Sons, New York, NY (2009); Perbal, A Practical Guide to Molecular Cloning (1984).

[0044] Unless the context clearly indicates otherwise, the term "or" is intended to include "and" and the term "and" is intended to include "or." Unless expressly stated otherwise, singular terms herein include their plural forms and plural terms herein include their singular forms.

[0045] Unless otherwise specified, the terms "comprise," "comprises," and "comprising," or equivalent phrases (such as "contain," "containing," "include," and "including") used herein are intended to be understood as open-ended expressions, including but not limited to, meaning that other unspecified elements, components, and steps may be included in addition to those already listed.

[0046] Unless otherwise specified, the term "complete genome" as used herein encompasses not only the entire genomic sequence of an organism, but also the genomes of organelles (such as the chloroplast genome). EXAMPLES

[0047] 1 shows an exemplary flow chart of the GA method of the present application. The GA method is further described by examples in combination with the specific processes of Cordyceps sinensis, Rheum officinalis, and Scutellaria baicalensis, but the scope of the present application is not limited thereto.

[0048] In the following examples, the experimental methods without specific conditions are carried out according to conventional conditions. Unless otherwise stated, the reagents, materials or devices used in the following examples without manufacturer are conventional products available on the market.

[0049] Example 1: Constructing a small fragment genomic library of Cordyceps sinensis and obtaining a wide range of candidate target sequences from it 1.1 Construction of a small fragment genomic library of Cordyceps sinensis The whole genome data of Cordyceps sinensis (assembly accession number: GCA_002077885.1), which was used as the identified species, was downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov), and the whole genome sequence of Cordyceps sinensis was divided into L-25+1 (L=whole genome sequence length) fragments of 25 bp length using Jellyfish (v1.1.12) to construct a small fragment genome library of Cordyceps sinensis.

[0050] 1.2 Obtaining a wide range of candidate target sequences Sequences with PAM were extracted from the Cordyceps sinensis small fragment genome library constructed above (the 5' end of the PAM has TTTV (SEQ ID NO: 10) or the 3' end has VAAA (SEQ ID NO: 11)). After screening 3,432,386 candidate target sequences with PAM from the entire Cordyceps sinensis genome sequence and removing duplicates, 1,385,096 comprehensive candidate target sequences with PAM were obtained.

[0051] Example 2: Screening of Cordyceps specific target sequences for species identification 2.1 Screening for specific target sequences In the present disclosure, the target sequences were screened within the genome of the identified species, and priority was given to screening target sequences in regions with high intraspecies conservation and strong interspecies differences. The target sequences had mismatches of 3 or more bases with the corresponding sequences of related species. When there are multiple target sequences that simultaneously meet the above conditions, one or more target sequences with a higher copy number are preferably selected.

[0052] The specific screening steps were as follows: (1) Data preparation: Download all the disclosed genome sequences of Cordyceps sinensis and its analogue Cordyceps sinensis genome sequence from the NCBI database (https: / / www.ncbi.nlm.nih.gov); (2) Screening of Cordyceps sinensis primary candidate target sequences: Align the comprehensive candidate target sequences obtained in Example 1 with all the disclosed genome sequences of Cordyceps sinensis downloaded from the above database by using Bowtie (v1.1.0); A wide range of candidate target sequences are screened for sequences that can perfectly match all of the disclosed genome sequences of Cordyceps sinensis, and a primary candidate target sequence library of Cordyceps sinensis is constructed; (3) Screening of interspecies-specific candidate target sequences of Cordyceps sinensis: The primary candidate target sequence library obtained in (2) is aligned with the genome sequence of Cordyceps sinensis, an analogous substance, by using Bowtie (v1.1.0), and sequences that do not have mismatches of 3 bases or less with the analogous substance are screened from the primary candidate target sequence library as specific target sequences.

[0053] The specific target sequence obtained above was named Os_target (SEQ ID NO: 1) as shown in Figure 3. Specific analysis results of the specific target sequence in the analogue are shown in Figure 4.

[0054] 2.2 Design of crRNA that matches a specific target sequence According to the genome editing system (CRISPR / Cas12a system) and crRNA design principles used in the following experiments, a crRNA matching Os_target was designed as shown in Figure 3 and named Os_crRNA (sequence number 13).

[0055] Example 3: Identification of Cordyceps sinensis via GA In order to determine whether the specific target sequences of the identified species screened in Example 2 can specifically and accurately reflect the identity between the sample to be detected and the identified species, the species of the samples was then identified based on the genomic DNA of each of the Cordyceps sinensis samples and Cordyceps militaris samples and their mixtures.

[0056] 3.1 Genomic DNA extraction and amplification from Cordyceps sinensis and Cordyceps sanguinea samples Samples of Cordyceps sinensis (collected from Beijing) were taken, added to liquid nitrogen, and completely powdered, and then the total DNA of each sample was extracted using the TIANamp Genomic DNA kit according to the kit's instruction provided by TIANGEN. The integrity of the total DNA of each obtained sample was detected by 0.8% agarose gel electrophoresis, and then the purity and concentration were detected by Nanodrop 2000C spectrophotometer.

[0057] Meanwhile, genomic DNA of Cordyceps samples was extracted according to the above steps, and the integrity of the total DNA of each sample was detected by 0.8% agarose gel electrophoresis.

[0058] The target sequence of Cordyceps sinensis was located in the ITS region of its genome, so a universal primer for this region was used in the experiment. In order to improve the stability of the reaction, operations including but not limited to thio modification at both ends of the primer can be used, and the specific sequence information is as follows: ITS4F:5'-G * G * AAGTAAAAGTCGTAACAA * G * G-3' (SEQ ID NO: 4) ITS5R:5'-T * C * CTCCGCTTATTGATAT * G * C-3' (SEQ ID NO:5)

[0059] 3.2 Identification of target sample species based on genome editing technology The following groups were set up: Os group (Cordyceps sinensis sample group), Cm group (Cordyceps sinensis sample group), Os+Cm group (Cordyceps sinensis + Cordyceps sinensis sample group), and CK (blank control) group.

[0060] In the following reaction system for species identification, Os_crRNA was used as the crRNA, and the genomic DNA of each sample group (Cordyceps sinensis, Cordyceps militaris, or a mixture of these) extracted above was used as the DNA substrate for each sample group to be detected. The experiment was performed using EnGen Lba Cas12a (Cpf1) from NEB, and the total volume of the reaction system was 100 μL: 10 μL of 10×NEBuffer 2.1, 2 μL of Lba Cas12a (20 nM), 3.3 μL of crRNA (300 nM), 3 μL of DNA substrate (10 ng / μL), 47 μL of ERA amplification reagent, 4 μL of Poly_C_FQ (400 nM), and 30.7 μL of nucleus-free H2O.

[0061] The ERA amplification reagent and DNA substrate in the above reaction system were first added to the bottom of a 1.5 mL centrifuge tube. NEBuffer 2.1, Lba Cas12a, Os_crRNA and nuclease-free H2O were added to the inside of the tube cap and incubated at 40°C for 20 minutes, then the reagents in the tube cap were quickly transferred to the bottom of the tube by simple centrifugation or gravity, followed by continuing to incubate the mixture at 37°C for 10 minutes. Poly_C_FQ was then added to it and incubated at 37°C to obtain λ ex 483nm / λ em Fluorescence at 535 nm was detected using a microplate reader at 0, 3, 6, 9, 12, 15, 25, 35, 45 and 60 minutes, respectively.

[0062] Panel A of FIG. 5 shows the fluorescence detection results of each sample group to be detected. As shown in Panel A, the Os group produced a fluorescent signal, and the fluorescence value reached a maximum at 25 minutes and was maintained, which was statistically significantly different from the CK group (P<0.01). The Cm group was consistent with the CK group, and none of them produced a fluorescent signal, and the fluorescence value of the Cm group was not significantly different from that of the CK group (P>0.01). Meanwhile, the mixed sample group (i.e., the Os+Cm group) could also produce a strong fluorescent signal due to the inclusion of a Cordyceps sinensis sample, and its fluorescence value was statistically significantly different from that of the CK group (P<0.01). It can be seen that the method of the present invention can specifically and accurately reflect whether the sample to be detected has the identity of the identified species.

[0063] Example 4: Constructing a small fragment genomic library of Rheum vulgare and obtaining a wide range of candidate target sequences from it 4.1 Construction of a small fragment genomic library of Rheum vulgare The chloroplast genome data of Rheum vulgare, which was used as the species to be identified (assembly accession number: MZ998517), was downloaded from the NCBI database, and the chloroplast genome sequence of Rheum vulgare was divided into 25 bp fragments (L-25+1 fragments, L=chloroplast genome sequence length) using Jellyfish (v1.1.12) to construct a small fragment genome library of Rheum vulgare.

[0064] 4.2 Obtaining a wide range of candidate target sequences Sequences with PAM were extracted from the small fragment genomic library of Rheum sativum constructed above (PAM has TTTV (SEQ ID NO: 10) at the 5' end or VAAA (SEQ ID NO: 11) at the 3' end), and 7,995 candidate target sequences with PAM were screened from the entire genome sequence of Rheum sativum. After removing duplicates, 6,685 comprehensive candidate target sequences with PAM were obtained.

[0065] Example 5: Screening of specific target sequences in Rheum vulgare for species identification 5.1 Screening for specific target sequences (1) Data preparation: Download all the disclosed chloroplast genome sequences of Rheum sativum and its analogue Rheum sativum chloroplast genome sequences from the NCBI database; (2) Screening of Rheum sativum primary candidate target sequences: Align the comprehensive candidate target sequences obtained in Example 4 with all the disclosed chloroplast genome sequences of Rheum sativum downloaded from the above database by using Bowtie (v1.1.0), and align all the disclosed chloroplast genome sequences of Rheum sativum. (3) Screening of inter-species specific candidate target sequences of Rheum sativum: The primary candidate target sequence library obtained in (2) is aligned with the chloroplast genome sequence of Rheum sativum, which is an analogous substance, by using Bowtie (v1.1.0), and sequences that do not have a mismatch of 3 bases or less with the analogous substance are screened from the primary candidate target sequence library as specific target sequences.

[0066] The specific target sequence obtained above was named Ro_target (SEQ ID NO: 2) as shown in Figure 3. Specific analysis results of the specific target sequence in the analogue are shown in Figure 4.

[0067] 5.2 Design of crRNA that matches a specific target sequence According to the genome editing system (CRISPR / Cas12a system) and crRNA design principles used in the following experiments, a crRNA matching Ro_target was designed as shown in Figure 3 and named Ro_crRNA (sequence number 14).

[0068] Example 6: Identification of Rheum vulgare via GA In order to determine whether the specific target sequences of the identified species screened in Example 5 can specifically and accurately reflect the identity between the sample to be detected and the identified species, the species identification of the samples was then performed based on the genomic DNA of each of the Rheum palmatum sample and the Rheum sativum sample and their mixture.

[0069] 6.1 Genomic DNA extraction from Rheum sativum and Rheum sativum samples According to the method described in Example 3, genomic DNA of Rheum officinalis samples (collected from Mianning, Sichuan) and Rheum officinalis samples was extracted.

[0070] Based on the specific target sequence of Rheum vulgare obtained in Example 5, specific primers were designed, and the specific sequence information is as follows: Ro_1F: 5'-CCAAATTGCCCGAAGCCTATG-3' (SEQ ID NO: 6) Ro_1R: 5'-ATCGCTTTCCGACCCACAAT-3' (SEQ ID NO: 7)

[0071] 6.2 Identification of target sample species based on genome editing technology Groups Ro (group of Rheum vulgare samples), Rp (group of Rheum vulgare samples), Ro+Rp (group of Rheum vulgare + Rheum vulgare samples) and CK (blank control) were set. In the following reaction system for species identification, Ro_crRNA was used as the crRNA, and the genomic DNA of each group of samples (Rheum vulgare samples, Rheum vulgare samples or a mixture of these) extracted above was used as the DNA substrate for each sample group to be detected.

[0072] The species of the above samples was identified according to the operation steps and reaction conditions described in the section "3.2 Identification of the species of the sample to be detected based on genome editing technology" in Example 3.

[0073] Panel B of FIG. 5 shows the fluorescence detection results of each sample group to be detected. As shown in Panel B, the Ro group produced a fluorescent signal, and the fluorescence value reached a maximum at 25 minutes and was maintained, which was statistically significantly different from the CK group (P<0.01). The Rp group was consistent with the CK group, neither of them produced a fluorescent signal, and the fluorescence value of the Rp group was not significantly different from that of the CK group (P>0.01). Meanwhile, the mixed sample group (i.e., the Ro+Rp group) could also produce a strong fluorescent signal due to the inclusion of Rheum vulgare samples, and its fluorescence value was statistically significantly different from that of the CK group (P<0.01). It can be seen that the method of the present invention can specifically and accurately reflect whether the sample to be detected has the identity with the identified species.

[0074] Example 7: Constructing a small fragment genomic library of red deer and obtaining long-range candidate target sequences from it 7.1 Construction of a small fragment genomic library of red deer The whole genome data of red deer (assembly accession number: GCA_910594005.1), which was used as the species to be identified, was downloaded from the NCBI database, and the whole genome sequence of red deer was divided into 25 bp long fragments (L-25+1, L=whole genome sequence length) using Jellyfish (v1.1.12) to construct a small fragment genome library of red deer.

[0075] 7.2 Obtaining a wide range of candidate target sequences Sequences with PAM were extracted from the red deer small fragment genome library constructed above (the 5' end of the PAM has TTTV (sequence number 10) or the 3' end has VAAA (sequence number 11)), and 121,153,505 candidate target sequences with PAM were screened from the entire red deer genome sequence. After removing duplicates, 94,378,541 comprehensive candidate target sequences with PAM were obtained.

[0076] Example 8: Screening of red deer specific target sequences for species identification 8.1 Screening for specific target sequences (1) Data preparation: Download all disclosed genome sequences of red deer and its analogous substance, reindeer genome sequence, from the NCBI database; (2) Screening of red deer primary candidate target sequences: Align the broad-range candidate target sequences obtained in Example 7 with all disclosed genome sequences of red deer downloaded from the above database using Bowtie (v1.1.0), screen the broad-range candidate target sequences for sequences that can perfectly match all disclosed genome sequences of red deer, and construct a primary candidate target sequence library of red deer; (3) Screening of red deer interspecies-specific candidate target sequences: Align the primary candidate target sequence library obtained in (2) with the analogous substance, reindeer genome sequence, using Bowtie (v1.1.0), and screen the primary candidate target sequence library for sequences that do not have a mismatch of 3 bases or less with the analogous substance as specific target sequences.

[0077] The specific target sequence obtained above was named Ce_target (SEQ ID NO: 3) as shown in Figure 3. Specific analysis results of the specific target sequence in the analogue are shown in Figure 4.

[0078] 8.2 Design of crRNA that matches a specific target sequence According to the genome editing system (CRISPR / Cas12a system) and crRNA design principles used in the following experiments, a crRNA matching Ce_target was designed as shown in Figure 3 and named Ce_crRNA (sequence number 15).

[0079] Example 9: Identifying red deer via GA In order to determine whether the specific target sequences of the identified species screened in Example 8 can specifically and accurately reflect the identity between the sample to be detected and the identified species, the species identification of the samples was then performed based on the genomic DNA of each of the red deer sample and the reindeer sample and their mixture.

[0080] 9.1 Genomic DNA extraction from red deer and reindeer samples According to the method described in Example 3, genomic DNA was extracted from red deer samples (red deer meat, collected from Fushun, Liaoning) and reindeer samples (reindeer meat).

[0081] Based on the specific target sequence of red deer obtained in Example 8, a specific primer was designed. In order to improve the stability of the reaction, the operation including but not limited to the thio modification at both ends of the primer can be used, and its specific sequence information is as follows: Ce_17F:5'-A * G * CAGAAGTGATGGTTGC * T * G-3' (SEQ ID NO: 8) Ce_17R:5'-A * A * GAATCCTAGGAAGAACTG * G * T-3' (SEQ ID NO: 9)

[0082] 9.3 Detecting samples based on specific target sequences using genome editing technology The following groups were set up: Ce group (red deer sample group), Rt group (reindeer sample group), Ce+Rt group (red deer+reindeer sample group), and CK (blank control). In the following species-specific reaction system, Ce_crRNA was used as the crRNA, and the genomic DNA of each sample group (red deer sample, reindeer sample, or a mixture of these) extracted above was used as the DNA substrate for each sample group to be detected.

[0083] The species of the above samples was identified according to the operation steps and reaction conditions described in the section "3.2 Identification of the species of the sample to be detected based on genome editing technology" in Example 3.

[0084] Panel C of FIG. 5 shows the fluorescence detection results of each sample group to be detected. As shown in Panel C, the Ce group produced a fluorescent signal, and the fluorescence value reached a maximum at 25 minutes and was maintained, which was statistically significantly different from the CK group (P<0.01). The Rt group was consistent with the CK group, neither of them produced a fluorescent signal, and the fluorescence value of the Rt group was not significantly different from that of the CK group (P>0.01). Meanwhile, the mixed sample group (i.e., the Ce+Rt group) could also produce a strong fluorescent signal due to the presence of red deer samples, and its fluorescence value was statistically significantly different from that of the CK group (P<0.01). It can be seen that the method of the present invention can specifically and accurately reflect whether the sample to be detected has the identity of the identified species.

[0085] Example 10: Species identification of red deer and reindeer samples based on sequencing techniques Based on the specific target sequence of red deer obtained in Example 8, in order to illustratively show that various different sequence detection techniques can be used to identify the species of eukaryotic samples, the primer pair Ce_17F and Ce_17R (SEQ ID NO: 8 and SEQ ID NO: 9) was used to specifically amplify the genomic DNA of the red deer sample and reindeer sample to be detected obtained in Example 9, and the amplification product was sequenced. The results, as shown in Figure 6, showed that if the sample to be detected matches the species to be identified, a sequence containing the specific target sequence can be obtained in the sequencing result, and if the sample to be detected does not match the species to be identified, the specific target sequence cannot be found in the sequencing result of the amplification product. It can be seen that the method of the present invention can specifically and accurately reflect whether the sample to be detected has identity with the species to be identified.

[0086] According to the results of the above Examples 3, 6, 9 and 10, it can be seen that the method of the present application can accurately identify the species of each group of samples including Cordyceps sinensis samples (fungus), Rheum officinalis samples (plant) and Red deer samples (animal), and can be used to clearly distinguish the quality products of medicinal substances (i.e. Cordyceps sinensis, Rheum officinalis and Red deer) from their respective common similar substances (i.e. Cordyceps sinensis, Rheum officinalis and Reindeer).

[0087] Those skilled in the art should understand that the discussion in any of the above examples is merely illustrative and is not intended to imply that the protection scope of the present disclosure is limited to these examples. Under the concept of the present disclosure, the technical features in the above examples or different examples can also be combined, the steps can be performed in any order, and there are many other modifications to the different aspects of the examples of the present disclosure described above, which are not provided in detail for conciseness. The embodiments of the present application are intended to encompass all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the examples of the present disclosure shall be included within the protection scope of the present disclosure.

[0088] All patents, patent applications, and other publications are expressly incorporated herein by reference for purposes of illustration and disclosure. These publications are provided solely for their disclosure prior to the filing date of this application. Any statement as to the date of these documents or representation as to the content is based on the information available to the applicant and does not constitute any admission as to the correctness of the dates or content of these documents. Moreover, any reference to these publications in this specification does not constitute an admission that the publications are part of the common knowledge in the art in any country.

Claims

1. A method for identifying a eukaryotic species based on whole genome analysis, comprising: i) dividing the entire genome sequence of a species to be identified into L-K+1 fragments of length K to construct a small fragment genome library based on the entire genome sequence of the species to be identified, calculating the copy number of each fragment in the small fragment genome library, and then determining the genomic location of each fragment by aligning each fragment with the entire genome sequence, where L represents the length of the entire genome sequence and K represents the length of the fragments in the library; ii) detecting a PAM motif for each fragment in the small fragment genome library, extracting sequences having PAM to construct a comprehensive candidate target sequence library, and obtaining a comprehensive candidate target sequence library, wherein the PAM is a PAM having a nucleotide sequence of SEQ ID NO: 10 at its 5' end or a nucleotide sequence of SEQ ID NO: 11 at its 3' end; iii) aligning the sequences in the comprehensive candidate target sequence library with the whole genome sequence of a related species, and selecting a plurality of different sequences that are present only in the identified species within a region with high intra-species conservation and large inter-species difference based on the whole genome sequence of the related species of the identified species to construct a specific target sequence library; iv) obtaining genomic DNA of a eukaryotic sample to be detected, identifying the species of the eukaryotic sample based on a sequence in the specific target sequence library, and detecting whether the genomic DNA contains the sequence in the specific target sequence library by using a CRISPR / Cas12a gene editing system, thereby determining the identity between the eukaryotic sample and the identified species, wherein before the detection, a crRNA matching the specific target sequence is pre-constructed based on the CRISPR / Cas12a gene editing system; A method comprising:

2. The method according to claim 1, wherein in i) and iv), the eukaryotic sample to be identified or detected is derived from an animal, a plant or a fungus.

3. 2. The method of claim 1, wherein the plurality of distinct sequences present only in the identified species are candidate target sequences that have at least n base differences from the entire genome sequence of the related species, where n is 3 or more.

4. The method according to claim 2 , wherein the eukaryotic sample to be detected is a sample from a single species or a mixture of samples from multiple species.

5. The method according to claim 4, wherein the eukaryotic sample to be detected is a sample derived from Cordyceps sinensis, Cordyceps militaris, Rheum officinalis, Rheum officinalis, red deer or reindeer.

6. The method of claim 1, wherein the identified species is Cordyceps sinensis, the specific target sequence is a nucleotide sequence set forth in SEQ ID NO: 1, and the crRNA matching the specific target sequence is set forth in SEQ ID NO:

13.

7. 2. The method of claim 1, wherein the identified species is Rheum vulgare, the specific target sequence is a nucleotide sequence set forth in SEQ ID NO:2, and the crRNA matching the specific target sequence is set forth in SEQ ID NO:

14.

8. 2. The method of claim 1, wherein the identified species is red deer, the specific target sequence is a nucleotide sequence set forth in SEQ ID NO: 3, and the crRNA matching the specific target sequence is set forth in SEQ ID NO:

15.

9. 1. A method for constructing a specific target sequence library for identification of eukaryotic species, comprising: a) selecting a species to be identified and screening one or more specific target sequences of said identified species according to the method of species identification of claim 1; b) combining the one or more specific target sequences of the identified species to construct the specific target sequence library; A method comprising:

10. 1. A method for constructing a tool library for detecting a particular specific target sequence of a eukaryotic species, comprising: A) selecting identified species and constructing said specific target sequence library according to the method of claim 9; B) constructing a tool library that matches the specific target sequence based on the technology used for the detection; wherein the technology used for the detection is gene editing using CRISPR / Cas12a, and the tool library is a crRNA library.

Images