Method and device for inducing disease resistance in plants, and disease resistance inducer in plants

Abstract

[Problem] To provide a method for inducing plant disease resistance, a device for inducing plant disease resistance, and an agent for inducing plant disease resistance, which are capable of inducing systemic resistance without hindering the plant growth, in a relatively easy and inexpensive manner, and with little burden on the environment. [Solution] Disease resistance is induced by projecting a gas that contains dinitrogen pentaoxide onto a plant. In particular, it is preferable to produce dinitrogen pentaoxide using a plasma with air as a raw material, and to project a gas containing the dinitrogen pentaoxide onto the plant.

Description

[Technical field]

[0001] The present invention relates to a method for inducing disease resistance in a plant, an apparatus for inducing disease resistance in a plant, and a disease resistance inducer in a plant. [Background technology]

[0002] Plants have defense mechanisms against attacks by pathogens such as fungi, bacteria, and viruses, as well as damage caused by pests, etc. Among these defense mechanisms, two types of defense responses that induce resistance throughout the plant's entire body are known: systemic acquired resistance (SAR) and induced systemic resistance (ISR) (see, for example, Patent Documents 1 and 2).

[0003] SAR mainly induces resistance against pathogens, and salicylic acid (SA) is involved in signal transduction. On the other hand, ISR mainly induces resistance against damage such as herbicide damage, and jasmonic acid (JA) and ethylene (ET) are involved in signal transduction. In order to induce resistance using SAR or ISR, methods using various compounds have been proposed (see, for example, Patent Document 1 or 2). In addition, a method of inducing a defense response of SAR using ozone has also been proposed (see, for example, Non-Patent Document 1).

[0004] In addition, the ISR defense response involves the release of Ca from leaf cells and tissues damaged by herbivory, etc. 2+It is known that signals (injury information) are transmitted throughout the body through the phloem, and that even in distant healthy organs, jasmonic acid, a plant hormone, is synthesized, activating the systemic defense mechanism (see, for example, Non-Patent Document 2). In addition, the metabolic pathways related to the systemic defense mechanism include antimicrobial peptide production activated by jasmonic acid (JA) and ethylene (ET) and the tryptophan metabolic pathway, and genes related to each of these pathways include PDF1.2, ORA59, PAD3, CYP71A12, NIT2, and WRKY26 (see, for example, Non-Patent Document 3).

[0005] The present inventors have also developed an injection device and a sterilization and extermination method that uses plasma to generate active species such as OH radicals and peroxynitrite (HOONO) and sprays a liquid containing the generated active species, thereby sterilizing and exterminating pathogens and pests attached to plants, soil, fertilizer, etc., without using agricultural chemicals (see, for example, Patent Documents 3 to 6). These devices and methods do not induce resistance in plants, but directly sterilize and exterminate pathogens and pests. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. WO2016 / 006351 [Patent Document 2] JP 2017-61460 A [Patent Document 3] Patent No. 5909831 [Patent Document 4] International Publication No. WO2018 / 043468 [Patent Document 5] JP 2019-40863 A [Patent Document 6] JP 2020-130085 A [Non-patent literature]

[0007] [Non-Patent Document 1] YOGESH K. SHARMA et al., “Ozone-induced responses in Arabidopsis thaliana: The role of salicylic acid in the accumulation of defense-related transcripts and induced resistance”, Proc. Natl. Acad. Sci. USA, May 1996, Vol. 93, p. 5099-5104 [Non-Patent Document 2] Masatsugu Toyota et al., “Glutamate triggers long-distance, calcium-based plant defense signaling”, Science, 2018, 361, p.1112-1115 [Non-Patent Document 3] Frerigmann et al., “Regulation of pathogen-triggered tryptophan metabolism in Arabidopsis thaliana by MYB transcription factors and indole glucosinolate conversion products”, Molecular Plant, 2016, 9, p.682-695 Summary of the Invention [Problem to be solved by the invention]

[0008] In the method of inducing the defense response of SAR or ISR using various compounds as described in Patent Documents 1 and 2, there is a problem that the cost and labor required to produce the compounds are high. In addition, there is a problem that some compounds remain in the environment and cause a large burden on the environment. In the method of inducing the defense response of SAR using ozone as described in Non-Patent Document 1, the response to ozone is intense, so that there is a problem that the damage to the plant is large, for example, the leaves irradiated with ozone wither, and there is a high risk of inhibiting the growth of the plant.

[0009] The present invention has been made with attention to these problems, and aims to provide a method and device for inducing disease resistance in plants, which can induce systemic resistance relatively easily and inexpensively without inhibiting plant growth and which has a small environmental impact, as well as a disease resistance inducer in plants. [Means for solving the problem]

[0010] In order to achieve the above object, the method of the present invention for inducing disease resistance in a plant is characterized in that disease resistance is induced by irradiating a plant with a gas containing dinitrogen pentoxide (N2O5).

[0011] The device for inducing disease resistance in a plant according to the present invention is characterized in that it is capable of irradiating a plant with a gas containing dinitrogen pentoxide so as to induce disease resistance.

[0012] The method for inducing disease resistance in a plant according to the present invention preferably comprises generating the dinitrogen pentoxide using plasma using air as a raw material and irradiating the plant with the gas containing the dinitrogen pentoxide. The device for inducing disease resistance in a plant according to the present invention preferably comprises a dinitrogen pentoxide generating unit arranged to be capable of generating the dinitrogen pentoxide using plasma using air as a raw material and arranged to be capable of irradiating the plant with the gas containing dinitrogen pentoxide generated in the dinitrogen pentoxide generating unit.

[0013] The method for inducing disease resistance in a plant according to the present invention is preferably carried out by the device for inducing disease resistance in a plant according to the present invention. The method for inducing disease resistance in a plant and the device for inducing disease resistance in a plant according to the present invention can induce a calcium ion response in plant cells by irradiating a plant with dinitrogen pentoxide. Furthermore, by irradiating a plant with dinitrogen pentoxide, expression of a resistance gene involved in resistance induction in a plant can be induced. This makes it possible to express the resistance gene even in sites distant from the site irradiated with dinitrogen pentoxide, thereby inducing a systemic ISR defense response, such as synthesizing jasmonic acid.

[0014] The method for inducing disease resistance in a plant and the device for inducing disease resistance in a plant according to the present invention can be used for any plant and can induce a defense response of ISR. In addition, the method for inducing disease resistance in a plant and the device for inducing disease resistance in a plant according to the present invention can induce disease resistance in the whole body without using pesticides by using dinitrogen pentoxide. In addition, since dinitrogen pentoxide is used, the irradiated leaves do not wither as in the case of ozone, and the growth of the irradiated plant is not inhibited. In addition, dinitrogen pentoxide that is not absorbed by the plant reacts quickly with water and is converted into nitrate ions with extremely low toxicity, so that the environmental load is small, and a safe and clean plant growth environment can be maintained without polluting the air or soil.

[0015] In the method and device for inducing disease resistance in a plant according to the present invention, it is preferable to irradiate the gas containing dinitrogen pentoxide under optimal conditions for the growth of each plant. In particular, since high humidity increases the possibility of causing damage to the plant, and low humidity reduces the effect of inducing resistance in the plant, it is preferable to irradiate the gas containing dinitrogen pentoxide at an appropriate humidity according to the plant species. The concentration of dinitrogen pentoxide in the gas to be irradiated is preferably 0.1 ppm to 1000 ppm, and preferably about 200 ppm or less, but it is preferable to select it appropriately depending on the plant species. The irradiation time is preferably 10 seconds to 1 hour, and particularly preferably within 5 minutes, but it is preferable to select it appropriately depending on the plant species.

[0016] The method and device for inducing disease resistance in plants according to the present invention may use dinitrogen pentoxide produced by any method or device, but it is preferable to use dinitrogen pentoxide produced by utilizing plasma using a gas containing nitrogen and oxygen, such as air, as the raw material gas. In particular, by generating dinitrogen pentoxide by utilizing plasma generated by atmospheric discharge using air as the raw material, systemic resistance can be induced relatively easily and inexpensively. The method and device for inducing disease resistance in plants according to the present invention can be used as a method and device for inducing a calcium ion response in plants, or a method and device for inducing a resistance gene in plants, respectively.

[0017] In the method and device for inducing disease resistance in plants according to the present invention, the resistance genes whose expression is induced by irradiation with nitrous oxide are preferably, for example, genes involved in the synthesis of jasmonic acid, genes for transcription factors associated with jasmonic acid signaling, antimicrobial peptide genes, and genes involved in the biosynthesis of the antimicrobial substance camalexin, such as JAZ5, JAZ7, OPR3, PDF1.2, ORA59, PAD3, CYP71A12, NIT2, and WRKY26. Induction of expression of these resistance genes can induce defense responses of the ISR, such as the synthesis of jasmonic acid.

[0018] The method for inducing disease resistance in a plant according to the present invention comprises: a NOx generation step of generating plasma using a gas containing nitrogen and oxygen as a raw material gas to generate nitrogen oxides; an ozone generation step of generating plasma using a gas containing nitrogen and oxygen or the gas after plasma generation in the NOx generation step as a raw material gas to generate ozone; a mixing step of generating the dinitrogen pentoxide by retaining the nitrogen oxides generated in the NOx generation step and the ozone generated in the ozone generation step in the same space for a predetermined time; and a dilution step of adding a gas containing nitrogen and oxygen, the humidity of which has been adjusted so that the water content after dilution is less than a predetermined amount, to the dinitrogen pentoxide generated in the mixing step to dilute the gas, and it is preferable that the gas containing dinitrogen pentoxide generated in the dilution step is irradiated to a plant.

[0019] The plant disease resistance inducing device of the present invention preferably comprises a NOx generation unit configured to generate plasma to generate nitrogen oxides using a gas containing nitrogen and oxygen as a raw material gas, an ozone generation unit configured to generate plasma to generate ozone using a gas containing nitrogen and oxygen or a gas after plasma generation in the NOx generation unit as a raw material gas, a mixing unit configured to generate the dinitrogen pentoxide by maintaining the nitrogen oxides generated in the NOx generation unit and the ozone generated in the ozone generation unit in the same space for a predetermined time, and a dilution unit that adds a gas containing nitrogen and oxygen, the humidity of which has been adjusted so that the water content after dilution is less than a predetermined amount, to the dinitrogen pentoxide generated in the mixing unit to dilute it, and is preferably configured to be able to irradiate the dinitrogen pentoxide-containing gas generated by the dilution unit to a plant.

[0020] When using these nitrogen oxides and ozone, nitrogen oxides and ozone generated by plasma are kept in the same space for a predetermined time, and the nitrogen oxides and ozone are reacted to produce dinitrogen pentoxide. It is preferable to generate dinitrogen pentoxide at a high concentration so that the generated dinitrogen pentoxide is not decomposed into NO2 or NO3. At this time, irradiating plants with high concentrations of dinitrogen pentoxide may cause damage to plants, so by adding a gas containing nitrogen and oxygen to the generated dinitrogen pentoxide to dilute it, dinitrogen pentoxide can be irradiated at an optimal concentration for plants and can prevent damage to plants. Furthermore, since dinitrogen pentoxide is very sensitive to water, when diluting the generated dinitrogen pentoxide, a gas containing nitrogen and oxygen whose humidity has been adjusted so that the amount of water contained after dilution is less than a predetermined amount is added to the dinitrogen pentoxide to prevent dinitrogen pentoxide from reacting with water and changing into nitric acid. It is preferable that the predetermined amount is an amount of water that does not cause a reaction between dinitrogen pentoxide and water. The nitrogen oxides generated by the plasma are, for example, NO, NO2, and N2O.

[0021] In addition, when using these nitrogen oxides and ozone, if a gas containing nitrogen and oxygen is used as a raw material gas for generating ozone, the separately generated nitrogen oxides and ozone are collected in the same space and held for a predetermined time. In addition, if a gas obtained by generating nitrogen oxides using plasma is used as a raw material gas for generating ozone, the gas obtained by generating ozone contains nitrogen oxides and ozone, so the gas obtained by generating ozone is placed in one space and held for a predetermined time.

[0022] In addition, when using these nitrogen oxides and ozone, the method for inducing disease resistance in a plant according to the present invention may include a mixing step in which the gas containing nitrogen oxides generated in the NOx generation step and the gas containing ozone generated in the ozone generation step are introduced from an opening on one end side of a tube, and after a predetermined time has elapsed, the gas is discharged from an opening on the other end side of the tube. In the device for inducing disease resistance in a plant according to the present invention, the mixing section may have a tube, and the gas containing nitrogen oxides generated in the NOx generation section and the gas containing ozone generated in the ozone generation section may be introduced from an opening on one end side of the tube, and after the predetermined time has elapsed, the gas is discharged from an opening on the other end side of the tube. In this case, the nitrogen oxides and ozone are reacted inside the tube, and dinitrogen pentoxide generated by the reaction can be discharged from the opening on the other end side of the tube. It is preferable that the tube has a length and a diameter that can ensure a predetermined time for reaction so that the nitrogen oxides and ozone introduced from the opening on one end side react while passing through the inside of the tube.

[0023] The plant disease resistance inducer according to the present invention is characterized in that it comprises a gas containing dinitrogen pentoxide.

[0024] The plant disease resistance inducer according to the present invention is preferably used in the plant disease resistance induction method according to the present invention and the plant disease resistance induction device according to the present invention. The plant disease resistance inducer according to the present invention can induce a calcium ion response in plant cells by being irradiated with the plant. It can also induce the expression of a resistance gene in a plant. This makes it possible to express the resistance gene even in a site distant from the site irradiated with nitrous oxide, thereby inducing a systemic ISR defense response, such as synthesizing jasmonic acid.

[0025] In addition, since the plant disease resistance inducer of the present invention utilizes dinitrogen pentoxide, it can induce disease resistance throughout the whole body without using agricultural chemicals. Moreover, unlike ozone, the irradiated leaves do not wither and the growth of the irradiated plant is not inhibited. Furthermore, by using plasma made from air as a raw material for production, it is possible to induce systemic resistance relatively easily and inexpensively. The plant disease resistance inducer of the present invention can be used as a calcium ion response inducer in plants or a resistance gene inducer in plants. Effect of the Invention

[0026] According to the present invention, it is possible to provide a method for inducing disease resistance in plants, an apparatus for inducing disease resistance in plants, and a disease resistance inducer in plants, which can induce systemic resistance relatively easily and inexpensively without inhibiting plant growth and which has a small environmental impact. [Brief description of the drawings]

[0027] [Figure 1] FIG. 1 is a block diagram showing an apparatus for inducing disease resistance in a plant according to an embodiment of the present invention. [Diagram 2] FIG. 11 shows observation results relating to a method for inducing disease resistance in plants according to an embodiment of the present invention, showing (a) Arabidopsis thaliana before whole-body exposure to dry air, (b) Ca2+ signaling in Arabidopsis thaliana 60 seconds after exposure to dry air, (c) Arabidopsis thaliana before whole-body exposure to nitrous oxide, and (d) Ca2+ signaling in Arabidopsis thaliana 60 seconds after exposure to nitrous oxide. [Diagram 3] FIG. 11 shows the propagation of Ca2+ signals when a single leaf (the leaf surrounded by the dotted line in (a)) is irradiated with dinitrogen pentoxide using a method for inducing disease resistance in plants according to an embodiment of the present invention, and shows the observation results of (a) Arabidopsis immediately after irradiation, (b) 22 seconds after irradiation, (c) 1 minute 24 seconds after irradiation, (d) 2 minutes 27 seconds after irradiation, (e) 3 minutes 18 seconds after irradiation, and (f) 5 minutes 54 seconds after irradiation. [Figure 4]Figure 3 shows graphs showing the expression levels of (a) JAZ5, (b) JAZ7, and (c) OPR3 30 minutes after exposure to nitrous oxide and dry air (control group) in leaves in which Ca2+ signal propagation was observed using the method for inducing disease resistance in plants according to an embodiment of the present invention. [Diagram 5] FIG. 1 is a graph showing the time course of expression levels (relative expression to ACT2 gene) of (a) WRKY26, (b) CYP71A12, (c) PAD3, (d) NIT2, (e) ORA59, and (f) PDF1.2 when Arabidopsis thaliana was irradiated with dinitrogen pentoxide and dry air (comparison example) using a method for inducing disease resistance in plants according to an embodiment of the present invention. [Figure 6] FIG. 1 is a graph showing the amount of virus (accumulation of virus coat protein) two days after inoculation when Arabidopsis thaliana was irradiated with dinitrogen pentoxide and dry air (Comparative Example) and inoculated with a yellow strain of Cucumber mosaic virus (CMV) and when not inoculated (Mock) using a method for inducing disease resistance in a plant according to an embodiment of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Hereinafter, an embodiment of the present invention will be described with reference to the drawings and examples. 1 to 6 show a method for inducing disease resistance in a plant, an apparatus for inducing disease resistance in a plant, and a disease resistance inducer in a plant according to an embodiment of the present invention.

[0029] As shown in FIG. 1, the plant disease resistance induction device 10 has a raw material gas introduction section 11, a raw material gas generation section 12, two flow rate control sections 13a and 13b, a NOx generation section 14, an ozone generation section 15, a mixing section 16, and a dilution section 17.

[0030] The raw material gas introduction section 11 is composed of a compressor, and is configured to compress air as raw material gas and send it to the raw material gas generation section 12. The raw material gas generation section 12 is configured to dehydrate the air sent from the raw material gas introduction section 11, so as to adjust the humidity. The raw material gas generation section 12 is configured to send the humidity-adjusted air to each of the flow rate control sections 13a, 13b and the dilution section 17. In a specific example shown in FIG. 1, the raw material gas generation section 12 adjusts the humidity of the introduced air to 1×10 15 cm -3 (about 40 ppm) or less. Although the raw material gas is made of air, gases other than air may be used as long as they contain nitrogen and oxygen.

[0031] The flow rate control unit 13a is connected to the raw material gas generation unit 12 and the NOx generation unit 14, and the flow rate control unit 13b is connected to the raw material gas generation unit 12 and the ozone generation unit 15. Each of the flow rate control units 13a and 13b is configured to be able to introduce air whose humidity has been adjusted in the raw material gas generation unit 12, adjust the flow rate and flow velocity, and supply the air to the NOx generation unit 14 or the ozone generation unit 15.

[0032] The NOx generating unit 14 is configured to generate plasma to generate nitrogen oxides using the air supplied from the flow rate control unit 13a as a raw material gas. At this time, by adjusting the input power to generate plasma at a temperature of 200°C or higher, nitrogen oxides such as NO, NO2, and N2O can be generated.

[0033] The ozone generator 15 is configured to generate plasma using the air supplied from the flow rate controller 13b as a raw material gas to generate ozone. At this time, the input power is adjusted to generate plasma at a temperature of 50° C. or less, thereby generating ozone.

[0034] The mixer 16 has a long, thin tube, and an opening at one end of the tube is connected to the NOx generator 14 and the ozone generator 15. The mixer 16 is configured to introduce the gas containing nitrogen oxides generated in the NOx generator 14 and the gas containing ozone generated in the ozone generator 15 into the inside of the mixer 16 and to discharge them from an outlet at the other end. The tube has a length and an inner diameter that allow time for the introduced nitrogen oxides and ozone to react while passing through the inside of the tube to generate dinitrogen pentoxide. In this way, the mixer 16 is capable of discharging dinitrogen pentoxide generated inside the tube from the outlet.

[0035] 1, the tube has a length of 5 m to 50 m and an inner diameter of 4 mm to 10 mm to ensure a time of 10 to 100 seconds for generating dinitrogen pentoxide. The tube is configured to pass nitrogen oxides and ozone through the tube at a temperature of 100° C. or less. The mixing section 16 only needs to ensure the time for generating dinitrogen pentoxide, and the time may be ensured by pressurizing or cooling the gas containing nitrogen oxides and the gas containing ozone.

[0036] The dilution section 17 is connected to the raw gas generation section 12 and the outlet of the mixer 16, and is provided to dilute the dinitrogen pentoxide generated in the mixer 16. The dilution section 17 has a dryer 17a and a flow rate control device 17b. The dryer 17a is configured to introduce air whose humidity has been adjusted in the raw gas generation section 12, and further dry the air so that the amount of moisture contained therein after dilution is less than a predetermined amount. The predetermined amount is the amount of moisture that does not cause a reaction between dinitrogen pentoxide and water. The flow rate control device 17b is configured to add the air dried by the dryer 17a to the dinitrogen pentoxide generated in the mixer 16 to dilute it. The dilution section 17 is capable of diluting dinitrogen pentoxide to a desired concentration by adjusting the flow rate and flow speed of the air.

[0037] The plant disease resistance inducer device 10 is provided so as to be capable of irradiating the plant with the dinitrogen pentoxide-containing gas produced by the dilution section 17. The dinitrogen pentoxide-containing gas produced in this manner constitutes the plant disease resistance inducer of the embodiment of the present invention. The components from the raw gas introduction section 11 to the dilution section 17 constitute the dinitrogen pentoxide generation section.

[0038] Next, the operation will be described. The method for inducing disease resistance in a plant according to the embodiment of the present invention is preferably implemented by a disease resistance induction device 10 in a plant. The method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention can induce a calcium ion response in the cells of the plant by irradiating the plant with dinitrogen pentoxide. In addition, the expression of a resistance gene involved in the induction of resistance in a plant can be induced by irradiating the plant with dinitrogen pentoxide. Examples of the resistance genes whose expression is induced include genes related to the synthesis of jasmonic acid, such as JAZ5, JAZ7, OPR3, PDF1.2, ORA59, PAD3, CYP71A12, NIT2, and WRKY26, genes of transcription factors related to jasmonic acid signals, antibacterial peptide genes, and genes involved in the biosynthesis of the antibacterial substance camalexin. This allows the resistance genes to be expressed even at sites away from the site irradiated with dinitrogen pentoxide, and induces a systemic ISR defense response, such as the synthesis of jasmonic acid.

[0039] The method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention can be used for any plant and can induce a defense response of ISR. In addition, the method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention can induce disease resistance in the whole body without using pesticides by using dinitrogen pentoxide. In addition, since dinitrogen pentoxide is used, the irradiated leaves do not wither as in the case of ozone, and the growth of the irradiated plant is not inhibited. In addition, dinitrogen pentoxide that is not absorbed by the plant reacts quickly with water and changes into nitrate ions with extremely low toxicity, so that the environmental load is small, and a safe and clean plant growth environment can be maintained without polluting the air or soil.

[0040] The method for inducing disease resistance in plants and the device 10 for inducing disease resistance in plants according to the embodiment of the present invention can produce dinitrogen pentoxide by reacting nitrogen oxide with ozone by keeping nitrogen oxide and ozone generated by plasma in the same space for a predetermined time. In addition, since dinitrogen pentoxide is generated using plasma generated by atmospheric discharge using air as a raw material, systemic resistance can be induced relatively easily and inexpensively. In addition, by generating dinitrogen pentoxide at a high concentration and then diluting it, it is possible to irradiate plants with dinitrogen pentoxide at an optimal concentration and prevent damage to the plants. In addition, by diluting with air whose humidity has been adjusted so that the amount of water contained after dilution is less than a predetermined amount, it is possible to prevent dinitrogen pentoxide from reacting with water and turning into nitric acid.

[0041] In the method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention, the NOx generating unit 14 generates plasma at a temperature of 200°C or higher, thereby efficiently dissociating nitrogen in the raw material gas and increasing the efficiency of nitrogen oxide generation by the plasma. In addition, in the ozone generating unit 15, the plasma is generated at a temperature of 50°C or lower, thereby increasing the efficiency of ozone generation by the plasma. In addition, in the method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention, the raw material gas generating unit 12 increases the humidity of the raw material gas to 1×10 15 cm -3 By adjusting the concentration to less than about 40 ppm, it is possible to produce high-concentration dinitrogen pentoxide.

[0042] In the method for inducing disease resistance in a plant and the device 10 for inducing disease resistance in a plant according to the embodiment of the present invention, it is preferable to irradiate the gas containing dinitrogen pentoxide under optimal conditions for the growth of each plant. In particular, since high humidity increases the possibility of causing damage to the plant, and low humidity reduces the effect of inducing resistance in the plant, it is preferable to irradiate the gas containing dinitrogen pentoxide at an appropriate humidity according to the plant species. For example, in the case of Arabidopsis thaliana, it is preferable to irradiate the gas containing dinitrogen pentoxide under optimal conditions for growth, that is, 23°C, humidity 50-60%, and day length 16 hours. In addition, the concentration of dinitrogen pentoxide in the gas to be irradiated is preferably 0.1 ppm-1000 ppm, and preferably about 200 ppm or less, but it is preferable to select it appropriately depending on the plant species. In addition, the irradiation time is preferably 10 seconds to 1 hour, and particularly preferably within 5 minutes, but it is preferable to select it appropriately depending on the plant species.

[0043] The method for inducing disease resistance in a plant and the device for inducing disease resistance in a plant 10 according to the embodiment of the present invention can also be used as a method for inducing a calcium ion response in a plant and a device for inducing a calcium ion response in a plant, or a method for inducing a resistance gene in a plant and a device for inducing a resistance gene in a plant. The produced gas containing dinitrogen pentoxide can also be used as a calcium ion response inducer in a plant or a resistance gene inducer in a plant.

[0044] Furthermore, in the plant disease resistance induction device 10, the ozone generation unit 15 may be disposed between the NOx generation unit 14 and the mixer 16. That is, as the raw material gas when generating ozone in the ozone generation unit 15, a gas after nitrogen oxides are generated by plasma may be used instead of air. In this case, since the gas after ozone generation contains ozone and nitrogen oxides generated in the NOx generation unit 14, dinitrogen pentoxide can be generated by putting the gas after ozone generation into a tube and holding it for a predetermined time. Furthermore, since only one flow rate control unit 13a, 13b is required, the manufacturing cost and operating cost of the device can be reduced. EXAMPLES

[0045] Using the plant disease resistance induction device 10 shown in FIG. 1, a plant is irradiated with nitrogen pentoxide, and Ca, which is injury information similar to damage caused by feeding or physical injury, is detected. 2+ In the experiment, we used Arabidopsis thaliana, and used a recombinant plant expressing the Arabidopsis calcium biosensor GCaMP to measure the calcium ion response. 2+ Live fluorescence observation of the green fluorescent GFP signal was performed as the signal increased.

[0046] First, when the whole body of Arabidopsis was irradiated with nitrogen pentoxide, the Ca 2+ In the experiment, the concentration of dinitrogen pentoxide in the irradiated gas was about 200 ppm or less, and the irradiation time was 10 seconds. For comparison, the whole body of Arabidopsis thaliana was irradiated with dry air under the same conditions, and the Ca 2+The state of Arabidopsis before irradiation and the Ca signal 60 seconds after the end of irradiation were also observed. 2+ The signal state is shown in FIG.

[0047] As shown in Figure 2, dry air irradiation increased the Ca 2+ No signal was observed, whereas irradiation with dinitrogen pentoxide produced Ca 2+ It was confirmed that a signal was generated. In addition, irradiation with dinitrogen pentoxide slowly increased Ca throughout the whole body. 2+ The generation of a signal was also observed.

[0048] Next, we examined the effect of nitrogen pentoxide on the Ca concentration in a single leaf of Arabidopsis thaliana. 2+ In the experiment, only one leaf of Arabidopsis thaliana (the leaf surrounded by the dotted line in Fig. 3(a)) was exposed to light and irradiated with dinitrogen pentoxide. The concentration of dinitrogen pentoxide in the irradiated gas was about 200 ppm or less, and the irradiation time was 10 seconds. The Ca signal was observed from immediately after irradiation until about 6 minutes later. 2+ The signal propagation is shown in Figure 3(a) to (f).

[0049] As shown in Fig. 3(b), after about 20 seconds, the Ca 2+ The activation of the signal (arrow in the figure) was confirmed. After that, as shown in Figure 3(c)-(f), the Ca 2+ It was observed that the signal (arrows in each figure) spread through the phloem to all leaves in the plant.

[0050] Next, in the experiment shown in Fig. 3, Ca 2+ To confirm that jasmonic acid (JA), a plant hormone, is synthesized by the signal, we performed an experiment to confirm the expression of genes related to jasmonic acid synthesis (JAZ5, JAZ7, OPR3). In this experiment, 30 minutes after irradiation with dinitrogen pentoxide, Ca 2+Messenger RNA was extracted and purified from leaves in which signal propagation was observed (not the leaves surrounded by the dotted line in Figure 3(a), but leaves that were not irradiated with nitrous oxide). Furthermore, cDNA was synthesized from the purified messenger RNA using reverse transcriptase, and the expression level of each gene was calculated as a relative value to the expression level of the UBQ10 gene using quantitative RT-PCR using synthetic primer DNA for three JA-related genes, JAZ5, JAZ7, and OPR3.

[0051] The sequences of the synthetic primer DNA used to analyze the expression levels of these JA-related genes are shown below. JAZ5 gene (AT1G17380: a gene that regulates the expression of JA-responsive genes) Forward sequence: TCATCGTTATCCTCCCAAGC Reverse sequence: CACCGTCTGATTTGATATGGG JAZ7 gene (AT2G34600: a gene that regulates the expression of JA-responsive genes) Forward sequence:GATCCTCCAACAATCCCAAA Reverse sequence: TGGTAAGGGAAGTTGCTTG OPR3 gene (AT2G06050: an enzyme gene involved in the biosynthesis of JA: 12-Oxophytodienoate reductase 3) Forward sequence: CGTTTTACACTCAAGATCCAGTTG Reverse sequence: ATTATCAAACTCAGAGGCGGG ·UBQ10 gene (AT4G05320: used for normalizing gene expression Housekeeping genes) Forward sequence: CACACTCCACTTGGTCTTGCGT Reverse sequence: TGGTCTTTCCGGTGAGAGTCTTCA

[0052] The expression levels of each gene obtained are shown in Figure 4 (a) to (c). For comparison, the expression levels of each gene were obtained 30 minutes after exposure to dry air on a single Arabidopsis leaf under similar conditions, and are shown in Figure 4 as a control. The experiment was also performed using three independent individuals, and Figure 4 shows the average values ​​and standard deviations for the three individuals.

[0053] As shown in Figure 4(a)-(c), it was confirmed that the genes JAZ5, JAZ7, and OPR3 related to the synthesis of jasmonic acid (JA) were expressed in leaves that were not exposed to nitrous oxide irradiation. It was also confirmed that the expression levels of each gene were significantly 3-5 times higher than those in leaves exposed to dry air.

[0054] From the above experimental results, it was found that irradiation with dinitrogen pentoxide increased the Ca 2+ It is believed that the signal is transmitted throughout the body through the phloem, and that jasmonic acid (JA), a plant hormone, is synthesized in distant healthy organs, leading to the induction of defense responses such as induced systemic resistance (ISR).

[0055] In addition, an experiment was also conducted in which ozone was irradiated instead of dinitrogen pentoxide, but it was confirmed that the leaves immediately curled after ozone irradiation and withered the next day. In contrast, when dinitrogen pentoxide was irradiated, the leaves did not curl and continued to grow without withering. EXAMPLES

[0056] Using the plant disease resistance induction device 10 shown in FIG. 1, plants were irradiated with dinitrogen pentoxide, and gene expression analysis was performed using RNA-seq and real-time PCR (qRT-PCR). In the RNA-seq analysis, Arabidopsis thaliana 5 weeks after sowing was irradiated with dinitrogen pentoxide once a day for 3 days. Each irradiation with dinitrogen pentoxide was performed for 20 seconds from a distance of 5 cm. The concentration of dinitrogen pentoxide in the irradiated gas was set to approximately 200 ppm or less. 24 hours after the last irradiation, fully expanded leaves were collected, total RNA was extracted, and RNA-seq analysis was performed. For comparison, RNA-seq analysis was also performed on a control group irradiated with dry air under the same conditions.

[0057] Compared to the control group, genes whose expression was induced by nitrous oxide irradiation by more than two-fold and genes whose expression was suppressed by half or less were extracted. As a result, 1,304 genes whose expression was induced by more than two-fold and 1,209 genes whose expression was suppressed by half or less were confirmed. Gene ontology analysis suggested that jasmonic acid signaling was activated by nitrous oxide irradiation.

[0058] From the results of this RNA-seq, six genes, PDF1.2, ORA59, PAD3, CYP71A12, NIT2, and WRKY26, were selected as marker gene candidates for nitrous oxide irradiation. PDF1.2 is an antimicrobial peptide gene that is often used as a marker gene for jasmonic acid and ethylene. ORA59 is a gene involved in the expression control of PDF1.2. PAD3 is a gene involved in the biosynthesis of camalexin, an antimicrobial substance whose synthesis is induced by jasmonic acid. CYP71A12 is a gene involved in tryptophan metabolism upstream of PAD3. NIT2 is a gene involved in the biosynthesis of auxin, another plant hormone derived from tryptophan. WRKY26 is a gene known to be functionally redundant with WRKY33, a transcription factor that controls jasmonic acid signaling.

[0059] The results of RNA-seq analysis of each selected gene are shown in Table 1. As shown in Table 1, it was confirmed that the expression level of each selected gene was approximately 3 to 1,000 times higher ("At-N2O5-20s" in the table) than in the control group (dry air) due to irradiation with dinitrogen pentoxide.

[0060] [Table 1]

[0061] Next, expression analysis was performed for each selected gene by qRT-PCR. For qRT-PCR, Arabidopsis thaliana plants 5 weeks after sowing were irradiated with dinitrogen pentoxide for 20 seconds from a distance of 5 cm. Nitrogen pentoxide irradiation was performed only once. After irradiation, the entire aboveground part was collected 1, 3, 6, 12, 24, and 48 hours, and total RNA was extracted, followed by qRT-PCR. The ACT2 gene was used as a control for endogenous genes, and the expression level of each gene was calculated as a relative value to the expression level of the ACT2 gene (relative expression to ACT2 gene).

[0062] The sequences of the primers for each gene used in qRT-PCR are shown below. PDF1.2 gene (AT5G44420) PDF1.2-F2:ATGCATGCAAGAATCAGTGC PDF1.2-R1:AATACACACGATTTAGCACC ORA59 gene (AT1G06160) ORA59 F:ACAACACTTGTGGTTCTTGAGG ORA59 R:TAACACGGCCATCACATCTCTTC PAD3 gene (AT3G26830) PAD3 F:AGCCTTCTTTCAAGTTCTTCACC PAD3 R:CAGATATTTAGAAGCTGACTCCAAC CYP71A12 gene (AT2G30750) CYP71A12 q F:TAGACAGGATCAACGGTTTCAA CYP71A12 q R:TGGAATCCAATACTCTTCTCGC NIT2 gene (AT3G44300) NIT2 F2:CGTCAGTTCATGTCACTCCTATG NIT2 R2:TGGTTGTAGAATGTAGGGTAACAC WRKY26 gene (AT5G07100) 3015 WRKY26:CTGATGACGGCTACAATTGGC 3016 WRKY26:TGCATTTGAAGTAACTCCTCGG ACT2 gene (AT3G18780) Actin ACT2 F:GGTAACATTGTGCTCAGTGGTGG ACT2 R:GGTGCAACGACCTTAATCTTCAT

[0063] The calculated changes in the expression level of each gene over time are shown in Figure 5 (a) to (f). For comparison, the changes in the expression level of each gene over time when Arabidopsis thaliana was exposed to dry air under similar conditions were also calculated and shown in Figure 5. The experiment was performed using three independent individuals, and Figure 5 shows the average and standard deviation of the three individuals. The same experiment was performed independently twice, with similar results.

[0064] As shown in Figures 5(a) to (c), it was confirmed that WRKY26, CYP71A12, and PAD3 were transiently induced in the expression 1 to 3 hours after irradiation with dinitrogen pentoxide. In addition, as shown in Figure 5(d), it was confirmed that NIT2 was transiently induced in the expression, with the expression peaking 12 hours after irradiation. In addition, as shown in Figure 5(e), it was confirmed that ODR59 was induced in the expression 1 hour after irradiation, and the high expression level was maintained for at least 48 hours after irradiation. In addition, as shown in Figure 5(f), it was confirmed that PDF1.2 was induced in the expression 6 hours after irradiation, and the high expression level was maintained for at least 48 hours after irradiation.

[0065] These results confirmed that irradiation with nitrous oxide activated transcription factors related to jasmonic acid signaling, antimicrobial peptide genes, and the biosynthesis of the antimicrobial substance camalexin, etc. This is thought to induce the defense response of induced systemic resistance (ISR) and enhance disease resistance. EXAMPLES

[0066] Using the plant disease resistance induction device 10 shown in FIG. 1, an experiment was conducted to irradiate a plant with dinitrogen pentoxide and examine the effect of inhibiting viral proliferation. In the experiment, Arabidopsis thaliana 5 weeks after sowing was irradiated with dinitrogen pentoxide once a day for 3 days. Each irradiation with dinitrogen pentoxide was performed for 20 seconds from a distance of 5 cm. The concentration of dinitrogen pentoxide in the irradiated gas was set to approximately 200 ppm or less. 24 hours after the last irradiation, the fully expanded leaves were inoculated by friction with the yellow strain of cucumber mosaic virus (CMV). Two days after the inoculation with CMV, the amount of virus in the inoculated leaves was quantified by ELISA (Enzyme-Linked Immuno Sorbent Assay) using an anti-CMV coat protein antibody.

[0067] The quantified virus amount (accumulation of virus coat protein) is shown in Figure 6. For comparison, the virus amount was also quantified under similar conditions when Arabidopsis thaliana was exposed to dry air and inoculated with CMV, and when Arabidopsis thaliana was exposed to dry air but not inoculated with CMV (Mock), and these results are shown in Figure 6. The experiment was performed using six independent plants, and Figure 6 shows the average value and standard deviation of the six plants. The same experiment was performed independently three times, and similar results were obtained.

[0068] As shown in Figure 6, it was confirmed that the proliferation of CMV was significantly suppressed when plants were exposed to nitrous oxide compared to when plants were exposed to dry air. This suggests that exposure to nitrous oxide stimulates the plant's immune system and enhances disease resistance. [Explanation of symbols]

[0069] 10 Plant disease resistance induction device 11 Raw material gas inlet 12 Raw material gas generation section 13a,13b Flow control section 14 NOx generation section 15 Ozone generation unit 16 Mixing section 17 Dilution section 17a Dryer 17b Flow control device

Claims

1. A method for inducing disease resistance in a plant, comprising the step of inducing disease resistance in the plant by irradiating the plant with a gas containing dinitrogen pentoxide.

2. 2. The method for inducing disease resistance in a plant according to claim 1, wherein the dinitrogen pentoxide is generated by utilizing plasma using air as a raw material, and the plant is irradiated with the gas containing the dinitrogen pentoxide.

3. a NOx production process in which a gas containing nitrogen and oxygen is used as a raw material gas and plasma is generated to produce nitrogen oxides; an ozone generating step of generating plasma using a gas containing nitrogen and oxygen or the gas obtained after plasma generation in the NOx generating step as a raw material gas to generate ozone; a mixing step of generating the dinitrogen pentoxide by holding the nitrogen oxides generated in the NOx generating step and the ozone generated in the ozone generating step in the same space for a predetermined time; a dilution step of adding a gas containing nitrogen and oxygen, the humidity of which has been adjusted so that the amount of water contained therein after dilution is less than a predetermined amount, to the dinitrogen pentoxide produced in the mixing step to dilute the gas; The gas containing dinitrogen pentoxide produced in the dilution step is irradiated onto a plant.

3. The method for inducing disease resistance in a plant according to claim 1 or 2.

4. 1. An apparatus for inducing disease resistance in a plant, the apparatus being capable of irradiating a plant with a gas containing dinitrogen pentoxide so as to induce disease resistance.

5. a dinitrogen pentoxide generating unit that is capable of generating the dinitrogen pentoxide by utilizing plasma using air as a raw material; a gas containing dinitrogen pentoxide generated in the dinitrogen pentoxide generating unit is provided so as to be capable of irradiating the plant with the dinitrogen pentoxide-containing gas. The device for inducing disease resistance in plants according to claim 4.

6. a NOx generating unit configured to generate plasma using a gas containing nitrogen and oxygen as a raw material gas to generate nitrogen oxides; an ozone generating unit that is provided so as to be capable of generating ozone by generating plasma using a gas containing nitrogen and oxygen or a gas obtained after plasma generation in the NOx generating unit as a raw material gas; a mixing section configured to generate the dinitrogen pentoxide by holding the nitrogen oxides generated in the NOx generating section and the ozone generated in the ozone generating section in the same space for a predetermined time; a dilution section for adding a gas containing nitrogen and oxygen, the humidity of which has been adjusted so that the amount of water contained therein after dilution is less than a predetermined amount, to the dinitrogen pentoxide produced in the mixing section to dilute the gas; a dilution unit configured to irradiate a plant with the dinitrogen pentoxide-containing gas produced by the dilution unit; 6. The device for inducing disease resistance in a plant according to claim 4 or 5.

7. A method for inducing a calcium ion response in a plant, comprising: irradiating a plant with a gas containing dinitrogen pentoxide to induce a calcium ion response in the cells of the plant.

8. 1. A calcium ion response inducing device in a plant, characterized in that the device is configured to be capable of irradiating a plant with a gas containing dinitrogen pentoxide so as to induce a calcium ion response in the cells of the plant.

9. A method for inducing a resistance gene in a plant, comprising irradiating the plant with a gas containing dinitrogen pentoxide to induce expression of the resistance gene in the plant.

10. 1. An apparatus for inducing resistance genes in plants, comprising means for irradiating a plant with a gas containing dinitrogen pentoxide so as to induce expression of the resistance genes in the plant.

11. A plant disease resistance inducer comprising a gas containing dinitrogen pentoxide.

12. A calcium ion response inducer for plants, comprising a gas containing dinitrogen pentoxide.

13. A plant resistance gene inducer comprising a gas containing dinitrogen pentoxide.

Images