Bispecific antisense oligonucleotides for dystrophin exon skipping

Abstract

The present invention provides splice-switching compounds with improved properties that enhance their suitable clinical application in treating, alleviating, preventing, and / or delaying neuromuscular disorders, particularly DMD.

Description

[Technical field]

[0001] The present invention relates to the field of antisense oligonucleotides, more particularly splice switching oligonucleotides, for the treatment of genetic disorders, more particularly neuromuscular disorders.The present invention relates in particular to the use of oligonucleotide-based compounds with improved characteristics that enhance their clinical applicability as further defined herein. [Background technology]

[0002] Antisense oligonucleotides (AONs) are in (pre)clinical development for numerous diseases and conditions, such as cancer, inflammatory conditions, cardiovascular diseases, and neurodegenerative and neuromuscular disorders. Their mechanism of action is directed towards various targets, such as RNaseH-mediated degradation of target RNA in the nucleus or cytoplasm, splice regulation (exon inclusion or skipping) in the nucleus, or translation inhibition due to steric hindrance of ribosomal subunit binding in the cytoplasm. Splice regulatory, or splice switching, oligonucleotides (SSOs) were first reported for the correction of aberrant splicing in human β-globin pre-mRNA (Dominski and Kole, 1993) and have currently been implicated in a number of diseases including, but not limited to, cystic fibrosis (CFTR gene, Friedman et al., 1999), breast cancer (BRCA1 gene, Uchikawa et al., 2007), prostate cancer (FOLH1 gene, Williams et al., 2006), inflammatory diseases (IL-5R alpha and MyD88 genes, Karras et al., 2001, Vickers et al., 2006), ocular albinism type 1 (OA1 gene, Vetrini et al., 2006), ataxia telangiectasia (ATM gene, Du et al., 2007), nevoid basal cell carcinoma syndrome (PTCH1 gene, Uchikawa et al., 2008), and gliomas with glaucoma (GIA1 gene, Uchikawa et al., 2009). al.,2007), methylmalonic acidemia (MUT gene, Rincon et al.,2007), preterm labor (COX-2 gene, Tyson-Capper et al.,2006), atherosclerosis (APOB gene, Khoo et al.,2007), propionic acidemia (PCCA and PCCB genes, Rincon et al.,2007), leukemia (c-myc and WT1 genes, Renshaw et al.,2004, Giles et al.,1999), dystrophic epidermolysis bullosa (COL7A1 gene, Goto et al.,2006), familial hypercholesterolemia (APOB gene, Disterer et al.,2013), laser-induced choroidal neovascularization and corneal graft rejection (KDR gene, Uehara et al.,2013), hypertrophic cardiomyopathy (MYBPC3 gene, Gedicke-Hornung et al.,2013), Usher syndrome (USH1C gene, Lentz et al.,2013), Fukuyama congenital muscular dystrophy (FKTN gene, Taniguchi-Ikeda et al.,2011), laser-induced choroidal neovascularization (FLT1 gene, Owen et al.,2012), cancer (STAT3 and bcl-X genes, Zammarchi et al.,2011, Mercatante et al.,2002), and Hutchinson-Gilford progeria (LMNA gene, Osorio et al.,2011), Miyoshi myopathy (DYSF gene, Wein et al.,2010), spinocerebellar ataxia type 1 (ATXN1 gene, Gao et al.,2013). Splice-switching AONs are currently being investigated for various genetic disorders, such as Alzheimer's disease / FTDP-17 tauopathy (MAPT gene, Peacey et al., 2012), myotonic dystrophy (CLC1 gene, Wheeler et al., 2007), and Huntington's disease (Evers et al., 2014). However, splice-switching AONs have been most widely used in the treatment of the neuromuscular disorder Duchenne muscular dystrophy (DMD).

[0003] Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophies. DMD is a severe, fatal neuromuscular disorder that requires wheelchair assistance before the age of 12 years, and patients usually die of respiratory or cardiac failure before the age of 13 years. It is caused by a reading frameshift deletion (about 67%) or duplication (about 7%) or point mutation (about 25%) of one or more exons in the 2.24 Mb DMD gene that results in the absence of functional dystrophin. BMD is also caused by a mutation in the DMD gene that maintains the open reading frame and produces a semi-functional dystrophin protein, generally resulting in a much milder phenotype and a longer life span. In the past decade, specific modifications of splicing to restore the disrupted reading frame in the transcript have been devised as a promising treatment for DMD (van Ommen et al., 2008; Yokota et al., 2007; van Deutekom et al., 2007; Goemans et al., 2011; Voit et al., 2014; Cirak et al., 2011). The use of highly sequence-specific splice-switching antisense oligonucleotides (AONs) that bind to the exon adjacent to or containing the mutation and interfere with its splicing signal can induce skipping of that exon during processing of the DMD pre-mRNA. Although a truncated transcript is generated, the open reading frame is restored and a protein similar to that found in BMD patients is produced. AON-induced exon skipping offers a mutation-specific and therefore personalized therapeutic approach to DMD patients. Skipping of certain exons may be therapeutic for many patients with various mutations, as well as most of the mutation clusters around exons 45-55. Skipping of exon 51 applies to the largest subset of patients (approximately 13%), including those with deletions of exons 45-50, 48-50, 50, or 52.The applied AONs are chemically modified to resist endonucleases, exonucleases, and RNaseH, as well as to promote RNA binding and duplex stability. To induce corrective exon skipping for DMD, various AON chemistries, such as 2'-O-methyl phosphorothioate RNA (2OMePS; Voit et al., 2014), phosphorodiamidate morpholino (PMO; Cirak et al., 2011), tricycloDNA (tcDNA; Goyenvalle et al., 2015), and peptide nucleic acid (PNA; Gao et al., 2015), are currently being investigated. Although AONs are generally poorly internalized into healthy muscle fibers, the dystrophin deficiency in activated satellite cells and DMD, characterized by damaged and highly permeable fiber membranes, and the resulting pathology, do indeed promote good internalization. In a study of the dystrophin-deficient mdx mouse model, 2'-O-methyl phosphorothioate RNA oligonucleotides indeed demonstrated up to 10-fold higher uptake in various muscle groups compared to wild-type mice (Heemskerk et al., 2010). Results of clinical studies using both 2'-O-methyl phosphorothioate RNA and phosphorodiamidate morpholino AONs in DMD patients have confirmed the presence of AONs in muscle biopsies, but the levels of de novo dystrophin after treatment remain limited, and developments continue in the field of oligonucleotides with improved characteristics that increase the therapeutic index and clinical applicability. Summary of the Invention [Problem to be solved by the invention]

[0004] The clinical efficacy of systemically administered AONs, such as splice-switching AONs, depends on several factors, such as route of administration, biostability, biodistribution, tissue distribution, uptake by target cells, and routing to the desired subcellular location (nucleus), etc. In part, this invention demonstrates that two AONs of the invention can be linked to result in a compound that exhibits improved characteristics for the potential treatment of genetic disorders such as DMD. [Means for solving the problem]

[0005] compound In a first aspect, the present invention provides a compound comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, preferably for use as a medicament, more preferably for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD), and even more preferably for inducing skipping of exon 51 of dystrophin pre-mRNA, as described herein below, wherein the first antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO: 3, and the second antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO: 4, wherein SEQ ID NOs: 3 and 4 are located within exon 51 of dystrophin pre-mRNA. Preferably, the first and second antisense oligonucleotides of the compound of the present invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. Preferably, the exon 51 of dystrophin pre-mRNA is of human origin and represented by the nucleotide sequence of SEQ ID NO:2.

[0006] In the context of the present invention, SEQ ID NO: 3 represents a first ESE and / or ERS sequence and SEQ ID NO: 4 represents a second ESE and / or ERS sequence within exon 51 of the dystrophin pre-mRNA. Throughout this application, unless otherwise stated, the first ESE and / or ERS and the second ESE and / or ERS are distinct, and preferably the first ESE and / or ERS and the second ESE and / or ERS are represented by distinct SEQ ID NOs.

[0007] In the context of the present invention, "distinct" ESE and / or ERS sequences are located in different regions within exon 51 of the dystrophin pre-mRNA, i.e., the ESE and / or ERS sequences only partially overlap each other within the exon, are adjacent to each other (no nucleotides separating both ESE and / or ERS sequences), or at least one nucleotide, preferably five nucleotides, separate both ESE and / or ERS sequences within the exon. The term "overlapping" is defined herein to include an overlap of one or more nucleotides, preferably the overlap does not include more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides, more preferably more than 5 nucleotides. Thus, the term "overlapping" may be defined herein as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the length of the shortest sequence of said first and second ESE and / or ERS, preferably the overlap is 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1%, more preferably less than 20%, even more preferably less than 10%. Alternatively, "distinct" ESE and / or ERS sequences may be represented by nucleotide sequences that are not 100% identical. Preferably, a first ESE and / or ERS and a second ESE and / or ERS are distinct if their nucleotide sequences do not completely overlap. More preferably, a first ESE and / or ERS and a second ESE and / or ERS are distinct if their corresponding nucleotide sequences do not overlap or only partially overlap. The term "partially overlapping" is defined herein to include an overlap of one or more nucleotides, preferably the overlap does not include more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides, more preferably more than 5 nucleotides.Thus, the term "overlapping in part" may be defined herein as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the length of the shortest sequence of the first and second ESE and / or ERS, preferably the overlap is 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1%, more preferably less than 20%, and even more preferably less than 10%.

[0008] In the context of the present invention, in a preferred embodiment, the oligonucleotides present in the compound of the present invention are "distinct" (antisense) oligonucleotides, preferably represented by nucleotide sequences that overlap with less than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides. Preferably, the nucleotide sequences of the first and second antisense oligonucleotides of the compound of the present invention are represented by distinct SEQ ID NOs. Alternatively, the length of the overlapping sequence between the "distinct" (antisense) oligonucleotides is preferably less than 60%, 50%, 40%, 30%, 20%, 10%, 5%, or 0% of the length of the shortest (antisense) oligonucleotide. In this context, the "distinct" (antisense) oligonucleotides are preferably represented by non-overlapping nucleotide sequences.

[0009] Preferably, the "distinct" (antisense) oligonucleotides are those that bind to, target, hybridize, or are complementary to or overlapping non-overlapping sequences. More preferably, the "distinct" (antisense) oligonucleotides are those that bind to, target, hybridize, or are complementary to or overlapping distinct ESE and / or ERS sequences within the same exon of the dystrophin pre-mRNA. ESE and ERS sequences have been identified to regulate specific and efficient splicing of constitutive and alternative exons and are therefore splicing elements / motifs.

[0010] Wherever the word "oligonucleotide" is used throughout this application, it may be substituted with "antisense oligonucleotide" as defined herein, and vice versa, unless otherwise indicated. Additionally, the words "oligonucleotide" or "antisense oligonucleotide" may be substituted with "first and / or second oligonucleotide" or "first and / or second antisense oligonucleotide" throughout this application, unless otherwise indicated.

[0011] It should be understood that when such an oligonucleotide is complementary, it can also be reverse complementary. In this application, the term "complementary" includes both forward complementary sequences and reverse complementary sequences, if the context makes it clear to the skilled artisan. Thus, when "an oligonucleotide is complementary to a target sequence", it means that the oligonucleotide is reverse complementary to the target sequence because the sequence of the oligonucleotide is the reverse complement of the target sequence, unless otherwise specified. When "an antisense oligonucleotide is complementary to a target sequence", it means that the antisense oligonucleotide is complementary to the target sequence because the sequence of the antisense oligonucleotide is the reverse of the target sequence, unless otherwise specified.

[0012] In the context of the present invention, the first and second antisense oligonucleotides are "linked to each other by a linking moiety" means that the antisense oligonucleotides are linked together via a linking moiety (as described in the section entitled "linking moiety"), thus forming a conjugate (or compound) that includes the first and second antisense oligonucleotides and the linking moiety.In the context of the present invention, "compound" has the same meaning in this context and is therefore interchangeable with "conjugate" throughout the specification.Therefore, the compound according to the present invention is preferably different from the mixture or set of the first and second antisense oligonucleotides, in that both antisense oligonucleotides are present as separate molecules, i.e., are not linked to each other by a linking moiety.

[0013] In an embodiment, the present invention provides a conjugate or compound, preferably for use as a medicament, more preferably for treating, preventing and / or delaying Duchenne Muscular Dystrophy (DMD), comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, wherein the first antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO: 3, and the second antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO: 4, where SEQ ID NOs: 3 and 4 are located within exon 51 of dystrophin pre-mRNA. Preferably, the first and second antisense oligonucleotides are distinct, as defined herein above.

[0014] In the context of the present invention, said first antisense oligonucleotide (AON) of the compound is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO: 3, i.e. is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of one or more further ESE and / or ERS sequence(s) that are distinct from the first ESE and / or ERS sequence(s) corresponding to SEQ ID NO: 3 and are located within exon 51 of the dystrophin pre-mRNA, preferably for use as a medicament, more preferably for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD).

[0015] In the context of the present invention, the second antisense oligonucleotide (AON) of the compound is complementary to, binds to, targets, hybridizes or overlaps with at least a portion of SEQ ID NO: 4, i.e., the second antisense oligonucleotide is preferably distinct from the second ESE and / or ERS corresponding to SEQ ID NO: 4 and is complementary to, binds to, targets, hybridizes or overlaps with at least a portion of one or more further ESE and / or ERS sequence(s) located within exon 51 of the dystrophin pre-mRNA for use as a medicament, more preferably for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD).

[0016] Dystrophin exons Throughout this application, unless otherwise stated, the first ESE and / or ERS and the second ESE and / or ERS are located within exon 51 of the dystrophin pre-mRNA, the first ESE and / or ERS being represented by SEQ ID NO: 3 and the second ESE and / or ERS being represented by SEQ ID NO: 4. Thus, the compounds of the invention are preferably for skipping exon 51 of the dystrophin pre-mRNA.

[0017] Preferably, said exon 51 of the dystrophin pre-mRNA is of human origin and is represented by the following nucleotide sequence: 5'-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAAGGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGCUCUGGCAGAUUUCAACC GGGCUUGGACAGAACUUACCGACUGGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGUGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG-3' (SEQ ID NO: 2).

[0018] First and second antisense oligonucleotides of the compound In an embodiment of the invention, each of the first and second antisense oligonucleotides of the compound of the invention is complementary to, binds to, targets to, hybridizes to or overlaps with a distinct exon splicing enhancer (ESE) and / or exon recognition sequence (ERS) sequence of dystrophin exon 51, the first antisense oligonucleotide is complementary to, binds to, targets to, hybridizes to or overlaps with SEQ ID NO: 3, and the second antisense oligonucleotide is complementary to, binds to, targets to, hybridizes to or overlaps with SEQ ID NO: 4. Preferably, the first and second antisense oligonucleotides of the compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. Unless otherwise indicated throughout this application, it is also contemplated that a compound may comprise or consist of a first and a second antisense oligonucleotide linked to each other by a linking moiety, wherein the nucleotide sequences of the first and second antisense oligonucleotides are at least 90%, 95%, 96%, 97%, 98%, or 99% identical to each other, and wherein the first and second oligonucleotides are complementary to, bind to, target, hybridize to, or overlap at least a portion of two or more different ESEs within the same exon. Preferably, the first and second antisense oligonucleotides of a compound of the invention are not represented by the same nucleotide sequence.

[0019] ESE sequences facilitate the spliceosome to recognize the authentic splice sites (Cartegni et al., 2002; and Cartegni et al., 2003). A subgroup of splicing factors, also known as SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF, to the (broadly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2 / ASF, SC35, SRp40, and SRp55) have been analyzed in detail, and these results have been incorporated into ESE-Finder, a web-based resource that predicts potential binding sites for these SR proteins (Cartegni et al., 2002; and Cartegni et al., 2003). An alternative software package for identifying ESE sequences is RESCUE-ESE (Fairbrother et al., 2002; and Fairbrother et al., 2004).

[0020] One of skill in the art will understand that an ESE sequence and an ERS sequence may refer to different elements, i.e., different sequences within an exon, although in some cases an ESE sequence and an ERS sequence may refer to the same sequence.

[0021] Throughout this application, unless otherwise noted, the terms "ESE", "ERS", and "ESE and / or ERS" may be used interchangeably throughout this application.

[0022] Preferably, the "ESE and / or ERS" sequences are predicted by ESE finder (Cartegni et al., 2002; and Cartegni et al., 2003) and / or RESCUE-ESE (Fairbroter et al., 2002; and Fairbroter et al., 2004). As defined herein, an ESE is a splicing motif whose functionality is experimentally confirmed or verified, preferably using a first or second antisense oligonucleotide that binds to, targets, hybridizes to, or overlaps at least a portion of the ESE. The same definition applies to an ERS. The functionality of the ESE and / or ERS can also be verified using a compound of the invention, in which a first or second antisense oligonucleotide binds to, targets, hybridizes to, or overlaps at least a portion of the ESE and / or ERS.

[0023] Preferably, the first and second antisense oligonucleotides of the compound of the invention are each 8-37 nucleotides in length, more preferably 10-33 nucleotides in length, even more preferably 16-22 nucleotides in length, and most preferably 18-22 nucleotides in length. However, the length of the first and second oligonucleotides is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 nucleotides in length. In the context of the present invention, the length of the first antisense oligonucleotide may be the same as or different from the length of the second antisense oligonucleotide. Thus, in a preferred embodiment, the present invention provides a compound in which the first antisense oligonucleotide is complementary to, binds to, targets to, hybridizes to, or overlaps with at least a portion of SEQ ID NO:3, and the second antisense oligonucleotide is complementary to, binds to, hybridizes to, or overlaps with at least a portion of SEQ ID NO:4, and the length of at least a portion of SEQ ID NO:3 is 4, 5, 6, 7, 8, 9, 10, or 11 nucleotides, preferably at least 8 nucleotides, more preferably at least 10 nucleotides, and the length of at least a portion of SEQ ID NO:4 is 4, 5, or 6 nucleotides, preferably at least 5 nucleotides. In a more preferred embodiment, at least a portion of SEQ ID NO:3 corresponds to the entire sequence of SEQ ID NO:3, and / or at least a portion of SEQ ID NO:4 corresponds to the entire sequence of SEQ ID NO:4. Preferably, the first and second antisense oligonucleotides of the compound of the present invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0024] Preferably, the compound of the present invention is provided, wherein the first antisense oligonucleotide is represented by a nucleotide sequence that comprises or consists of a sequence that is complementary to, can bind to, target, hybridize or overlap at least a portion of SEQ ID NO: 3, and the second antisense oligonucleotide is represented by a nucleotide sequence that comprises or consists of a sequence that is complementary to, can bind to, target, hybridize or overlap at least a portion of SEQ ID NO: 4. Preferably, the first and second antisense oligonucleotides of the compound are distinct as defined above, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. The binding, targeting or hybridizing portion is at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or 98%, and up to 100% of the length of the first and / or second oligonucleotide. The first and second oligonucleotides of the compound of the present invention can be represented by a nucleotide sequence, which comprises a sequence that binds to, targets, hybridizes, or is complementary to or overlaps with at least a portion of SEQ ID NO: 3 or 4, as defined herein, and an additional flanking sequence. Several types of flanking sequences can be used. Preferably, the flanking sequence is used to modify the binding of a protein to the oligonucleotide, or to modify the thermodynamic properties of the oligonucleotide, more preferably to modify the target RNA binding affinity. In another preferred embodiment, the additional flanking sequence is complementary to a sequence of the dystrophin pre-mRNA that is not present in the exon. Such a flanking sequence can preferably bind to or target a sequence that includes or consists of the branch point and / or splice site acceptor or donor consensus sequence of the exon.In a preferred embodiment, such flanking sequences are capable of binding to or targeting sequences comprising or consisting of sequences of an intron of the dystrophin pre-mRNA adjacent to said exon.

[0025] The term (reverse) complementarity is used herein to refer to a stretch of nucleic acid that can hybridize to another stretch of nucleic acid under physiological conditions. In general, the antisense strand is said to be complementary to the corresponding sense strand. In this context, the antisense oligonucleotide is complementary to its target. Hybridization conditions are defined later in this specification. Therefore, it is not absolutely necessary that all bases in the region of complementarity can pair with bases of the opposite strand. For example, when designing an antisense oligonucleotide, for example, residues that do not base pair with bases of the complementary strand may be incorporated. If the stretch of nucleotides can hybridize to the complementary portion under intracellular conditions, some mismatches may be tolerated.

[0026] In a preferred embodiment, the complementary portion of the first and / or second antisense oligonucleotide of the compound (either in an open structure, i.e., a region of the dystrophin pre-mRNA exon that is not hybridized to a region of the dystrophin pre-mRNA exon, or in a closed structure, i.e., a region of the dystrophin pre-mRNA exon that is hybridized to a region of the dystrophin pre-mRNA exon) comprises at least three, more preferably at least four consecutive nucleotides. The complementary regions are preferably designed such that, when combined, they are specific for the exons of the pre-mRNA. Such specificity depends on the actual sequence of other (pre)mRNAs in the system, and therefore may be made with complementary regions of various lengths. The risk that one or more other pre-mRNAs will be able to hybridize to the oligonucleotide decreases as the oligonucleotide becomes larger. It is clear that antisense oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compound of the invention) that contain mismatches in the region of complementarity but retain the ability to hybridize to the target region(s) of the pre-mRNA can be used in the present invention. However, preferably, at least the complementary portions do not contain such mismatches, as they generally exhibit better efficiency and higher specificity than oligonucleotides that have such mismatches in one or more complementary regions. High hybridization strength (i.e., an increased number of interactions with the opposite strand) is believed to be advantageous in increasing the efficiency of the process of interfering with the splicing mechanism of the system.

[0027] Preferably, the compound of the invention comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety as disclosed herein above induces the skipping of exon 51 of the dystrophin pre-mRNA as defined herein. In an embodiment of the first and / or second antisense oligonucleotide of the compound suitable for inducing single exon skipping, the complementarity with the region targeted by a given dystrophin exon is 90-100%. Typically, this allows for one or two mismatch(es) in an oligonucleotide of 20 nucleotides, or one to four mismatches in an oligonucleotide of 40 nucleotides. Thus, one, two, three, four, five mismatches may occur in an oligonucleotide of 10-50 nucleotides. Preferably, zero, one or two mismatches are present in an oligonucleotide of 10-50 nucleotides. In oligonucleotides of 10-33 nucleotides, there may be 0, 1, 2 or 3 mismatches, preferably 0, 1 or 2. In oligonucleotides of 16-22 nucleotides, there may be 0, 1 or 2 mismatches, preferably 0 or 1 mismatch.

[0028] The structures (i.e., open and closed structures) have been best analyzed in the context of pre-mRNAs in which exons are present. Such structures can be analyzed in real RNA. However, at present, structural modeling programs can be used to predict the secondary structure of RNA molecules very successfully (at the lowest energy cost). Examples of suitable programs include, but are not limited to, RNA structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003). Given a nucleotide sequence, a person skilled in the art can predict the structure with exons with reasonable reproducibility. Providing such modeling programs with both the exon sequence and the adjacent intron sequence as described above gives the best predictions. In general, it is not necessary to model the entire pre-mRNA structure.

[0029] The open and closed structures involving the oligonucleotides (i.e. the first and / or second oligonucleotides of the compound) are preferably adjacent to each other. In this way, annealing of the oligonucleotide to the open structure is believed to induce the opening of the closed structure, at which annealing then proceeds. This action causes the previously closed structure to assume a different conformation. However, if a potential (latent) splice acceptor and / or donor sequence is present within the target exon, it will generate a new exon inclusion signal that defines a different (neo)exon, i.e. an exon with a different 5' end, a different 3' end, or both. This type of activity is within the scope of the present invention, since it excludes the target exon (exon 51) from the mRNA. The presence of a new exon in the mRNA that contains a part of the target exon does not change the fact that the target exon itself is excluded. The inclusion of a neoexon can be seen as a rare side effect. When exon skipping is used to restore (part of) a disrupted dystrophin open reading frame resulting from a mutation, there are two possibilities: on the one hand, the neoexon is functional in restoring the reading frame, whereas in the other case, the reading frame is not restored. When selecting compounds containing oligonucleotides for restoring the dystrophin reading frame by exon skipping, it is of course self-evident to select only those compounds containing such oligonucleotides that actually result in exon skipping that restores the dystrophin open reading frame under these conditions, regardless of the presence or absence of the neoexon.

[0030] In an embodiment, the present invention provides a compound, wherein the first antisense oligonucleotide is represented by a nucleotide sequence having at least 95% identity with a continuous stretch of at least 4, 5, 6, 7, 8, 9, 10 or 11 nucleotides, preferably at least 8 nucleotides, more preferably at least 10 nucleotides, most preferably all nucleotides of SEQ ID NO: 5, and the second antisense oligonucleotide is represented by a nucleotide sequence having at least 95% identity with a continuous stretch of at least 4, 5 or 6 nucleotides, preferably at least 5 nucleotides, more preferably all nucleotides of SEQ ID NO: 6. Preferably, the first and second antisense oligonucleotides of the compound of the present invention are distinct as defined herein above, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. The SEQ ID NOs. 5 and 6 represent the reverse complement sequences of SEQ ID NOs. 3 and 4, respectively. The contiguous stretch may be interrupted by one, two, three, four or more gaps, so long as the percentage of identity over the entire region is at least 95%, preferably at least 96%, 97%, 98%, 99% or 100%, more preferably at least 97%.

[0031] In a preferred embodiment, the present invention provides a compound comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, the first antisense oligonucleotide being represented by a nucleotide sequence comprising or consisting of any one of SEQ ID NOs: 14-197 or a fragment thereof, and the second antisense oligonucleotide being represented by a nucleotide sequence comprising or consisting of any one of SEQ ID NOs: 198-398 or a fragment thereof. Preferably, the first and second antisense oligonucleotides of the compound of the present invention are distinct, more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. Each of the first and / or second oligonucleotides of the compound may have any of the chemical entities described herein below, or a combination thereof.

[0032] Therefore, the first oligonucleotide of the compound of the present invention is preferably selected from SEQ ID NOs: 14 to 197, i.e., SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 , 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 1 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 6, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196 or 197, or SEQ ID NO: 14 ~197, i.e., SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197. More preferably, said first oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 14, 15, 16, 17 or 18, even more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably SEQ ID NO: 14, or represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 14, 15, 16, 17 or 18, even more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably a fragment of SEQ ID NO: 14. The second oligonucleotide of the compound of the present invention is preferably SEQ ID NO: 198 to 398, i.e., SEQ ID NO: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249,250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 3 13, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344 4, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375 , 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398, or a nucleotide sequence comprising or consisting of any one of SEQ ID NOs: 198 to 398, i.e., SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222 2, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253 , 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284,285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 3 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398. More preferably, the second oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 198, 199, 200 or 201, even more preferably SEQ ID NO: 198 or 199, most preferably SEQ ID NO: 198, or a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 198, 199, 200 or 201, even more preferably SEQ ID NO: 198 or 199, most preferably SEQ ID NO: 198. Preferably, the first and second antisense oligonucleotides of the compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. Each of the first and / or second oligonucleotides of the compound may have any of the chemical entities described herein below, or a combination thereof.

[0033] Throughout this application, unless otherwise specified, a "fragment of a SEQ ID NO" preferably refers to a nucleotide sequence comprising or consisting of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive nucleotides of said SEQ ID NO, more preferably at least 10 consecutive nucleotides. Thus, a "fragment of a SEQ ID NO" preferably refers to a nucleotide sequence comprising or consisting of said SEQ ID NO, wherein less than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 consecutive nucleotides are deleted, preferably less than 10 consecutive nucleotides, even more preferably less than 5 consecutive nucleotides are deleted. Alternatively, a "fragment of a SEQ ID NO" preferably refers to a nucleotide sequence comprising or consisting of an amount of contiguous nucleotides from said SEQ ID NO, which amount of contiguous nucleotides is at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the length of said SEQ ID NO. Thus, a "fragment of a SEQ ID NO" preferably refers to a nucleotide sequence comprising or consisting of said SEQ ID NO, which amount of contiguous nucleotides is deleted, which amount is at least 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% or less than 1%, preferably less than 20%, more preferably less than 10% of the length of said SEQ ID NO.

[0034] Preferably, the fragment of said SEQ ID NO: has dystrophin pre-mRNA exon 51 skipping activity.

[0035] In another preferred embodiment, the present invention provides a compound comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, wherein the first antisense oligonucleotide has a homology ratio of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 95%, more preferably at least 99%, to any one of SEQ ID NOs: 14 to 197, preferably SEQ ID NOs: 14, 15, 16, 17, or 18, more preferably SEQ ID NOs: 14, 15, 16, or 17, even more preferably SEQ ID NO: 14 or 15, and most preferably SEQ ID NO: 14. The second antisense oligonucleotide is represented by a nucleotide sequence comprising or consisting of a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 95%, more preferably at least 97%, identity to any one of SEQ ID NOs: 198 to 398, preferably SEQ ID NOs: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably SEQ ID NO: 198. Preferably, the first and second antisense oligonucleotides of the compound of the present invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs. Preferably, the first and / or second antisense oligonucleotides have dystrophin pre-mRNA exon 51 skipping activity.

[0036] Each of the first and / or second oligonucleotides of a compound may have any of the chemistries described herein below, or combinations thereof.

[0037] In an embodiment, the present invention therefore provides a compound for skipping exon 51, preferably comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, said first antisense oligonucleotide being: i) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 7 5, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 1 29, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196 or 197, preferably SEQ ID NO: 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably SEQ ID NO: 14 or ii) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 1 30, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 201, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 20B, 20C, 20D, 20E, 20F, 20G, 20H, 20I, 20I, 20I, 2 8, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196 or 197, preferably SEQ ID NO: 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably a fragment of SEQ ID NO: 14, or iii) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 , 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 1 09, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192 , 193, 194, 195, 196 or 197, preferably SEQ ID NO: 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably SEQ ID NO: 14, with 1, 2, 3, 4 or 5 additional nucleotides; iv) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 7 8, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196 or 197, preferably SEQ ID NO: 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably SEQ ID NO: 14, from which 1, 2, 3, 4 or 5 nucleotides have been deleted, or v) SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 8 6, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 5, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197, preferably 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 95%, or at least 97% identity to SEQ ID NO: 14, and / or said second antisense oligonucleotide comprises: i) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 30 8, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397 or 398, preferably SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably SEQ ID NO: 198, or ii) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364 , 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397 or 398, preferably SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, most preferably a fragment of SEQ ID NO: 198, or iii) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 3 13, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 3 71, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397 or 398, preferably SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably SEQ ID NO: 198 plus 1, 2, 3, 4 or 5 nucleotides, or iv) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 2 54, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 3 13, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 3 71, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397 or 398, preferably SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably SEQ ID NO: 198 from which 1, 2, 3, 4 or 5 nucleotides have been deleted, or v) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 22 7, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258 , 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289 , 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 3 84, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397 or 398, preferably SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 95%, or at least 97% identity to SEQ ID NO: 198, orIt is represented by the nucleotide sequence of the same sequence.

[0038] Preferably, the first and second antisense oligonucleotides of a compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0039] The "1, 2, 3, 4 or 5 additional nucleotides" may be present 5' and / or 3' to a given SEQ ID NO.

[0040] The "one, two, three, four, or five deleted nucleotides" may be nucleotides that are deleted 5' and / or 3' of a given SEQ ID NO.

[0041] Each of said first and / or second oligonucleotides of the compound may have any of the chemical entities described herein below or combinations thereof. Also in this regard, as defined herein above, one or two mismatch(es) are possible in an oligonucleotide of 20 nucleotides, or one to four mismatches in an oligonucleotide of 40 nucleotides. Thus, in an oligonucleotide of 10 to 33 nucleotides, there may be zero, one, two or three mismatches, preferably zero, one or two mismatches, as defined herein above. In an oligonucleotide of 16 to 22 nucleotides, there may be zero, one or two mismatches, preferably zero or one mismatch.

[0042] In an embodiment, the compound of the invention is preferably for skipping exon 51 of dystrophin pre-mRNA. In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the invention are interchangeable.

[0043] In a preferred embodiment, the compound of the present invention is preferably for skipping exon 51 of dystrophin pre-mRNA and comprises or consists of a first antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 14, 15, 16, 17 or 18, more preferably SEQ ID NO: 14, 15, 16 or 17, even more preferably SEQ ID NO: 14 or 15, most preferably SEQ ID NO: 14, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 198, 199, 200 or 201, more preferably SEQ ID NO: 198 or 199, even more preferably SEQ ID NO: 198, wherein the first and second antisense oligonucleotides are linked to each other by a linking moiety (as described in the section entitled "Linking Moiety"), preferably the linking moiety is triethylene glycol (TEG) or hexaethylene glycol (HEG).

[0044] The sequence number 14 is represented by the sequence GGUAAGUUCUGUCCAAGC, the sequence number 15 is represented by the sequence GUAAGUUCUGUCCAAGCC, the sequence number 16 is represented by the sequence AGUCGGUAAGUUCUGUCC, the sequence number 17 is represented by the sequence CUGUCCAAGCCCGGUUGA, the sequence number 18 is represented by the sequence UAAGUUCUGUCCAAG, the sequence number 198 is represented by the sequence UCAAGGAAGGCAUUUCU, the sequence number 199 is represented by the sequence UCAAGGAAGGCAUUUCUAG, the sequence number 200 is represented by the sequence UCAAGGAAGUGGCAU, and the sequence number 201 is represented by the sequence GAAGAUGGCAUUUCU.

[0045] In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the present invention are interchangeable. Thus, preferred compounds of the present invention are: i) SEQ ID NO: 16175 (GGUAAGUUCUGUCCAAGCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16176 (UCAAGGAAGAUGGCAUUUCUnGGUAAGUUCUGUCCAAGC), where the linking portion represented by n is a TEG linker, or ii) SEQ ID NO: 16177 (GGUAAGUUCUGUCCAAGCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16178 (UCAAGGAAGAUGGCAUUUCUnGGUAAGUUCUGUCCAAGC), wherein the linking portion represented by n is a HEG linker, or iii) SEQ ID NO: 16179 (GGUAAGUUCUGUCCAAGCnUCAAGGAAGAUGGCAUUUCUAG), or SEQ ID NO: 16180 (UCAAGGAAGAUGGCAUUUCUAGnGGUAAGUUCUGUCCAAGC), wherein the linking portion represented by n is a TEG linker, or iv) SEQ ID NO: 16181 (GGUAAGUUCUGUCCAAGCnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16182 (UCAAGGAAGAUGGCAUUUCUAGnGGUAAGUUCUGUCCAAGC), wherein the linking portion represented by n is a HEG linker, or v) SEQ ID NO: 16183 (GUAAGUUCUGUCCAAGCCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16184 (UCAAGGAAGAUGGCAUUUCUnGUAAGUUCUGUCCAAGCC), where the linking portion represented by n is a TEG linker, or vi) SEQ ID NO: 16185 (GUAAGUUCUGUCCAAGCCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16186 (UCAAGGAAGAUGGCAUUUCUnGUAAGUUCUGUCCAAGCC), wherein the linking portion represented by n is a HEG linker, or vii) SEQ ID NO: 16187 (GUAAGUUCUGUCCAAGCCnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16188 (UCAAGGAAGAUGGCAUUUCUAGnGUAAGUUCUGUCCAAGCC), where the linking portion represented by n is a TEG linker; or viii) SEQ ID NO: 16189 (GUAAGUUCUGUCCAAGCCnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16190 (UCAAGGAAGAUGGCAUUUCUAGnGUAAGUUCUGUCCAAGCC), wherein the linking portion represented by n is a HEG linker; or ix) SEQ ID NO: 16191 (AGUCGGUAAGUUCUGUCCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16192 (UCAAGGAAGAUGGCAUUUCUnAGUCGGUAAGUUCUGUCC), wherein the linking portion represented by n is a TEG linker, or x) SEQ ID NO: 16193 (AGUCGGUAAGUUCUGUCCnUCAAGGAAGAUGGCAUUUCU), or SEQ ID NO: 16194 (UCAAGGAAGAUGGCAUUUCUnAGUCGGUAAGUUCUGUCC), wherein the linking portion represented by n is a HEG linker, or xi) SEQ ID NO: 16195 (AGUCGGUAAGUUCUGUCCnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16196 (UCAAGGAAGAUGGCAUUUCUAGnAGUCGGUAAGUUCUGUCC), where the linking portion represented by n is a TEG linker; or xii) SEQ ID NO: 16197 (AGUCGGUAAGUUCUGUCCnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16198 (UCAAGGAAGAUGGCAUUUCUAGnAGUCGGUAAGUUCUGUCC), wherein the linking moiety represented by n is a HEG linker, or xiii) SEQ ID NO: 16199 (CUGUCCAAGCCCGGUUGAnUCAAGGAAGAUGGCAUUUCU) or SEQ ID NO: 16200 (UCAAGGAAGAUGGCAUUUCUnCUGUCCAAGCCCGGUUGA), wherein the linking portion represented by n is a TEG linker, or xiv) SEQ ID NO: 16201 (CUGUCCAAGCCCGGUUGAnUCAAGGAAGAUGGCAUUUCU) or SEQ ID NO: 16202 (UCAAGGAAGAUGGCAUUUCUnCUGUCCAAGCCCGGUUGA), wherein the linking portion represented by n is a HEG linker, or xv) SEQ ID NO: 16203 (CUGUCCAAGCCCGGUUGAnUCAAGGAAGAUGGCAUUUCUAG), or SEQ ID NO: 16204 (UCAAGGAAGAUGGCAUUUCUAGnCUGUCCAAGCCCGGUUGA), wherein the linking portion represented by n is a TEG linker, or xvi) SEQ ID NO: 16205 (CUGUCCAAGCCCGGUUGAnUCAAGGAAGAUGGCAUUUCUAG) or SEQ ID NO: 16206 (UCAAGGAAGAUGGCAUUUCUAGnCUGUCCAAGCCCGGUUGA), wherein the linking portion represented by n is a HEG linker, or xvii) SEQ ID NO: 16207 (UAAGUUCUGUCCAAGnUCAAGGAAGAUGGCAU), or SEQ ID NO: 16208 (UCAAGGAAGAUGGCAUnUAAGUUCUGUCCAAG), wherein the linking moiety represented by n is a TEG linker, or xviii) SEQ ID NO: 16209 (UAAGUUCUGUCCAAGnUCAAGGAAGAUGGCAU), or SEQ ID NO: 16210 (UCAAGGAAGAUGGCAUnUAAGUUCUGUCCAAG), wherein the linking portion represented by n is a HEG linker, or xix) SEQ ID NO: 16211 (UAAGUUCUGUCCAAGnGAAGAUGGCAUUUCU), or SEQ ID NO: 16212 (GAAGAUGGCAUUUCUnUAAGUUCUGUCCAAG), wherein the linking portion represented by n is a TEG linker, or xx) SEQ ID NO: 16213 (UAAGUUCUGUCCAAGnGAAGAUGGCAUUUCU), or SEQ ID NO: 16214 (GAAGAUGGCAUUUCUnUAAGUUCUGUCCAAG), the linking portion represented by n being a HEG linker.

[0046] More preferred compounds of the invention are represented by any one of SEQ ID NOs: 16175, 16176, 16179, 16180, 16183, 16184, 16187, 16188, 16191, 16192, 16195, 16196, 16199, 16200, 16203, and 16204 (TEG linker) or any one of SEQ ID NOs: 16177, 16178, 16181, 16182, 16185, 16186, 16189, 16190, 16193, 16194, 16197, 16198, 16201, 16202, 16205, and 16206 (HEG linker).

[0047] Even more preferred compounds of the invention are represented by any one of 16191, 16192, 16195, 16196, 16199, 16200, 16203 and 16204 (TEG linker) or any one of SEQ ID NOs: 16193, 16194, 16197, 16198, 16201, 16202, 16205 and 16206 (HEG linker).

[0048] Even more preferred compounds of the present invention are represented by any one of SEQ ID NOs: 16175, 16176, 16179, 16180, 16183, 16184, 16187 and 16188 (TEG linker) or any one of SEQ ID NOs: 16177, 16178, 16181, 16182, 16185, 16186, 16189 and 16190 (HEG linker).

[0049] The most preferred compounds of the invention are represented by SEQ ID NO: 16175 or 16176 (TEG linker) or SEQ ID NO: 16177 or 16178 (HEG linker).

[0050] A preferred first and / or second AON of the compound of the present invention is one in which the first and / or second oligonucleotide induces dystrophin pre-mRNA splicing modulation, preferably the pre-mRNA splicing modulation changes the protein production or composition, preferably includes exon skipping or exon inclusion, most preferably the pre-mRNA splicing modulation includes exon skipping. This pre-mRNA splicing modulation is preferably used in the context of a therapeutic application as defined hereinafter. Splicing of the pre-mRNA occurs via two successive transesterification reactions involving the branch point of an intron and the splice site of the adjacent intron.

[0051] The purpose of pre-mRNA splicing modulation is to alter the production of a protein, most often an RNA-encoded protein. This production can be altered through an increase or decrease in the level of said production. This production can also be altered by changing the composition of the protein actually produced, for example when pre-mRNA splicing is modulated to include or exclude one or more exons, and in proteins with different amino acid sequences. Preferably, such proteins with different amino acid sequences have more function, better function, or at least one altered property than the protein produced as a result of the disease or condition.

[0052] In the case of DMD, the ultimate goal is to apply pre-mRNA splicing modulation to skip one or more specific exons of dystrophin pre-mRNA, restore the open reading frame of the transcript, and induce the expression of a short but (superior) functional dystrophin protein, thus preventing the progression of the disease.Therefore, in a preferred embodiment, the present invention provides a compound that induces pre-mRNA splicing modulation, which alters the production of proteins associated with Duchenne muscular dystrophy (DMD).

[0053] In a preferred embodiment, the compounds of the present invention are used to induce exon skipping of dystrophin pre-mRNA in cells, organs, tissues and / or individuals. In a more preferred embodiment, the compounds of the present invention are used to skip exon 51 of dystrophin pre-mRNA. Exon skipping leads to a mature dystrophin mRNA that does not contain the skipped exon, and thus allows the expression of a shorter protein product. The skipping of exon 51 is preferably induced with the compounds of the present invention, in which a first AON binds to a first exon splicing enhancer (ESE), the nucleotide sequence of the first ESE being represented by SEQ ID NO:3, and a second AON binds to a second exon splicing enhancer (ESE), the nucleotide sequence of the second ESE being represented by SEQ ID NO:4.

[0054] Preferably, the first and second antisense oligonucleotides of a compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0055] Throughout this application, unless otherwise indicated, the term "bind" can be substituted with "complementary," "target," "hybridize," "overlap," and / or "target."

[0056] As defined herein, DMD pre-mRNA preferably refers to the pre-mRNA of the DMD gene encoding dystrophin protein. Mutated DMD pre-mRNA corresponds to the pre-mRNA of DMD patients with a mutation compared to the wild-type DMD pre-mRNA of unaffected humans, resulting in reduced levels or lack of functional dystrophin (DMD). DMD pre-mRNA is also referred to as dystrophin pre-mRNA. DMD gene is also referred to as dystrophin gene. Dystrophin and DMD may be used interchangeably throughout this application.

[0057] By patient, it is preferably meant a patient who has DMD, as defined hereinafter, or who is predisposed to developing DMD due to his / her genetic background. In the case of DMD patients, the oligonucleotide used preferably corrects a single mutation present in the patient's DMD gene, producing a protein that looks like a BMD protein: the protein is preferably a functional or semi-functional dystrophin, as defined hereinafter.

[0058] As defined herein, functional dystrophin is preferably wild-type dystrophin corresponding to the protein having the amino acid sequence identified in SEQ ID NO: 1. As defined herein, semi-functional dystrophin is preferably a BMD-like dystrophin having a binding domain acting at its N-terminal portion (the first 240 amino acids at the N-terminus), a cysteine-rich domain (amino acids 3361-3685), and a C-terminal domain (the last 325 amino acids at the C-terminus), each of which corresponds to a protein present in wild-type dystrophin, as known to those skilled in the art. The amino acids shown herein correspond to the amino acids of wild-type dystrophin as represented by SEQ ID NO: 1. In other words, functional or semi-functional dystrophin is a dystrophin that exhibits the activity of wild-type dystrophin, at least to some extent. By "at least to a certain extent" is preferably meant at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the corresponding activity of wild-type functional dystrophin. In this context, the activity of functional dystrophin is preferably binding to actin and the dystrophin-associated glycoprotein complex (DGC or DAPC) (Ehmsen J et al., 2002).

[0059] Association of dystrophin with actin and the DGC or DAPC complexes can be visualized either by co-immunoprecipitation using total protein extracts or by immunofluorescence analysis of cross sections using different antibodies reactive with different members of the complexes as seen in control (non-DMD) biopsies from suspected dystrophic muscles before and / or after treatment, as known to those skilled in the art.

[0060] Individuals or patients suffering from Duchenne muscular dystrophy generally have a mutation in the gene encoding dystrophin (DMD gene or dystrophin gene) that prevents the synthesis of the complete protein, i.e., a premature stop codon prevents the synthesis of the C-terminus. In Becker muscular dystrophy, the dystrophin gene also contains a mutation compared to the wild type, but generally the mutation does not result in a premature stop codon and generally synthesizes the C-terminus. As a result, functional or semi-functional dystrophin protein is synthesized that has at least the same activity in kind, but not necessarily in the same amount, as the wild type protein. The genome of BMD patients generally contains the N-terminal portion (first 240 amino acids at the N-terminus), the cysteine-rich domain (from amino acids 3361 to 3685), and the C-terminal domain (last 325 amino acids at the C-terminus), but in most cases encodes a dystrophin protein whose central rod domain is shorter than that of wild-type dystrophin (Monaco et al., 1988). Antisense oligonucleotide-induced exon skipping for the treatment of DMD generally aims to overcome premature termination in the pre-mRNA by skipping exons in the central rod domain-shaped domain, correcting the open reading frame and allowing synthesis of the remainder of the dystrophin protein, including the C-terminus, although the protein is nevertheless somewhat smaller due to the smaller rod domain. In a preferred embodiment, an individual with DMD treated with a compound defined herein provides a dystrophin that exhibits, at least to some extent, the activity of wild-type dystrophin. More preferably, the functional or semi-functional dystrophin is the dystrophin of an individual with BMD if the individual is or is suspected of being a Duchenne patient: generally, the dystrophin can interact with both actin and the DGC or DAPC, but its central rod domain can be shorter than that of wild-type dystrophin (Monaco et al., 1988). The central rod domain of wild-type dystrophin contains 24 spectrin-like repeats.For example, the central rod domain of the dystrophin provided herein can contain 5-23, 10-22, or 12-18 spectrin-like repeats and can bind to actin and to the DGC.

[0061] The compounds of the present invention may be used to assess the alleviation of one or more symptoms of Duchenne muscular dystrophy in an individual by any of the following assays: prolonged time to loss of ambulation, improved muscle strength, improved ability to lift weights, improved time to rise from floor, improved 9 meter walking time, improved time to climb 4 steps, improved lower limb functional grade, improved lung function, improved cardiac function, and improved quality of life. Each of these assays is known to those skilled in the art. For example, Manzur et al., (2008) provides a detailed description of each of these assays. For each of these assays, the presence or absence of detectable improvement or prolongation of the parameters measured by the assay preferably means that the use of the compounds of the present invention alleviates one or more symptoms of Duchenne muscular dystrophy in an individual. A detectable improvement or prolongation is a statistically significant improvement or prolongation, as described in Hodgetts et al., (2006). Alternatively, alleviation of one or more symptom(s) of Duchenne muscular dystrophy may be assessed by measuring improved muscle fiber function, integrity, and / or survival. In a preferred method, one or more symptom(s) of a DMD patient is alleviated and / or one or more characteristic(s) of one or more muscle cells from a DMD patient are improved. Such symptoms or characteristics may be assessed at the cellular level, tissue level, or may be assessed by the patient themselves.

[0062] Reduction in one or more characteristics of muscle cells from a patient may be assessed by any of the following assays of myoblasts or muscle cells from a patient: reduced calcium uptake by muscle cells, reduced collagen synthesis, changes in morphology, changes in lipid biosynthesis, reduced oxidative stress, and / or improved muscle fiber function, integrity, and / or survival. These parameters are typically assessed using immunofluorescence and / or histochemical analysis of cross-sections of muscle biopsies.

[0063] Improved muscle fiber function, integrity, and / or survival may be assessed using at least one of the following assays: a detectable decrease in blood creatine kinase, a detectable decrease in muscle fiber necrosis in a biopsy cross-section of a muscle suspected to be dystrophic, and / or a detectable increase in muscle fiber diameter uniformity in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to those of skill in the art.

[0064] Creatine kinase can be detected in the blood as described in Hodgetts et al., (2006). A detectable decrease in creatine kinase can mean a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater decrease compared to the concentration of creatine kinase in the same DMD patient before treatment.

[0065] A detectable reduction in muscle fiber necrosis is preferably assessed in muscle biopsies, more preferably using biopsy cross sections, as described in Hodgetts et al. (2006). A detectable reduction in necrosis may be a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more reduction in the area of ​​identified necrosis using biopsy cross sections. The reduction is measured relative to necrosis assessed in the same DMD patient prior to treatment.

[0066] A detectable increase in muscle fiber diameter uniformity is preferably assessed in muscle biopsy cross-sections, more preferably as described in Hodgetts et al. (2006). The increase is measured relative to the muscle fiber diameter uniformity in the same DMD patient prior to treatment.

[0067] Preferably, the compounds of the invention are capable of providing the individual with a functional or semi-functional dystrophin protein and at least somewhat reducing the production of abnormal dystrophin protein in the individual.

[0068] In the context of the present invention, providing an individual with a functional or semi-functional dystrophin protein means increasing the production of functional or semi-functional dystrophin protein, as defined herein above. Increased production of functional or semi-functional dystrophin mRNA or functional or semi-functional dystrophin protein preferably means an increase of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200% or more, detectable by RT-digital droplet PCR (mRNA) (Verheul et al., 2016), immunofluorescence (Beekman et al., 2014), Western blot or capillary Western immunoassay (Wes; Beekman et al., 2018) analysis (protein) compared to the initial amount of functional or semi-functional mRNA or functional or semi-functional dystrophin protein. In the context of the present invention, the initial amount is the amount of functional or semi-functional mRNA or functional or semi-functional dystrophin protein at which a compound of the present invention is used to initiate induction of exon skipping in dystrophin pre-mRNA in a cell, organ, tissue and / or individual.

[0069] By reducing the production of abnormal dystrophin mRNA or abnormal dystrophin protein, it is preferably meant that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of abnormal dystrophin mRNA or abnormal dystrophin protein is still detectable by RT-PCR (mRNA) or immunofluorescence or Western blot analysis (protein). In the context of the present invention, the initial amount is the amount of abnormal dystrophin mRNA or abnormal dystrophin protein at the time of initiating induction of exon skipping in dystrophin pre-mRNA in cells, organs, tissues and / or individuals using the compounds of the present invention. Abnormal dystrophin mRNA or protein is also referred to herein as less functional or non-functional dystrophin mRNA or protein (compared to wild-type functional dystrophin protein as defined herein above). A non-functional dystrophin protein is preferably a dystrophin protein that is unable to bind to actin and / or members of the DGC protein complex. A non-functional dystrophin protein or dystrophin mRNA generally does not have or encode a dystrophin protein with an intact C-terminus of the protein. Detection of functional or semi-functional dystrophin mRNA or protein can be performed as for abnormal dystrophin mRNA or protein.

[0070] Once DMD patient is provided with functional or semi-functional dystrophin protein, at least part of the cause of DMD is eliminated.Therefore, it is expected that DMD symptoms will then be at least partially alleviated or the rate at which symptoms worsen will be reduced, thereby resulting in slower decline.Increasing skipping frequency also increases the level of functional or semi-functional dystrophin protein produced in muscle cells of DMD individuals.

[0071] Within the scope of the present invention, the first and / or second oligonucleotide of the compound of the present invention may comprise a functional equivalent of the oligonucleotide. By functional equivalent of the oligonucleotide, it is preferably meant an oligonucleotide as defined herein (i.e. the first and / or second antisense oligonucleotide present in the compound of the present invention) in which one or more nucleotides have been replaced and the activity of the functional equivalent is retained at least to some extent. Preferably, the activity of the oligonucleotide comprising the functional equivalent of the oligonucleotide provides functional or semi-functional dystrophin. Thus, preferably, the activity of the oligonucleotide comprising the functional equivalent of the oligonucleotide is evaluated by quantifying the amount of functional or semi-functional dystrophin. Preferably, functional or semi-functional dystrophin is defined herein as dystrophin that can bind to actin and members of the DGC (or DAPC) protein complex. The activity of the functional equivalent of an oligonucleotide is preferably evaluated by RT-digital droplet PCR and sequencing (at the RNA level; for detecting specific exon skipping (DMD)) or by immunofluorescence, Western blot or capillary Western immunoassay (Wes) analysis (at the protein level; for detecting protein repair). The activity is preferably retained at least to some extent if it represents at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% or more of the corresponding activity of the oligonucleotide from which it is derived. Throughout this application, when the word "oligonucleotide" is used, it may be replaced by its "functional equivalent" as defined herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0072] Chemical Modification of the First and / or Second Antisense Oligonucleotides of the Compound In the context of the present invention, it is to be understood that the first and / or second oligonucleotide of the compound comprises or consists of any chemical modification described in this paragraph ("Chemical Modification of the First and / or Second Antisense Oligonucleotide of the Compound"), and has an exon skipping activity at least as good as that of the unmodified counterpart described in this paragraph ("First and / or Second Antisense Oligonucleotide of the Compound"), and preferably, the exon skipping activity is greater than that of the unmodified counterpart. Thus, the first and / or second oligonucleotide comprises or consists of any chemical modification described in this paragraph ("Chemical Modification of the First and / or Second Antisense Oligonucleotide of the Compound"), and has an exon skipping activity at least as good as that of the compound without the chemical modification or combination thereof. Preferably, the exon skipping activity is greater than that of the compound without the chemical modification or combination thereof.

[0073] In an embodiment of the invention, said first and / or second antisense oligonucleotide of a compound comprises a 2'-substituted monomer, preferably a 2'-substituted RNA monomer. For the oligonucleotides described in this application, if the characteristics of the monomer are not defined and are not obvious from the context, they are inferred from the corresponding characteristics of the RNA monomer.

[0074] In a preferred embodiment, the first and / or second oligonucleotide of the compound is single-stranded. However, those skilled in the art will understand that single-stranded oligonucleotide can form an internal double-stranded structure. However, this oligonucleotide is still referred to as single-stranded oligonucleotide in the context of the present invention. Compared with double-stranded siRNA oligonucleotide, single-stranded oligonucleotide has several advantages: (i) its synthesis is considered to be simpler than two complementary siRNA strands; (ii) it can be chemically modified in a wide range, which can promote cellular uptake, increase (physiological) stability, and reduce potential common side effects; (iii) siRNA is more likely to cause non-specific effects (such as off-target genes) and excessive drug efficacy (e.g., effects that make efficacy and selectivity less controllable by treatment schedule or dose), and (iv) siRNA does not work well in the nucleus and cannot move toward introns.

[0075] The preferred first and / or second oligonucleotides of the compound of the invention are less than 38 nucleotides in length. The first and / or second oligonucleotides may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 nucleotides in length. Such oligonucleotides may also be identified as having 8 to 37 nucleotides. More preferably, the first and / or second oligonucleotides of the compound of the invention are 10 to 33 nucleotides in length. Even more preferably, the first and / or second oligonucleotides of the compound of the invention are 16, 17, 18, 19, 20, 21, or 22 nucleotides in length. Most preferably, the length of the first and / or second oligonucleotide of the compound of the invention is 18, 19, 20, 21 or 22 nucleotides and may be identified as an oligonucleotide having between 18 and 22 nucleotides.

[0076] Thus, in this aspect, the invention provides a method for the treatment of a leukemia, comprising administering to a patient a therapeutically effective amount of at least one antisense oligonucleotide comprising: i) at least one 2'-substituted monomer and optionally a phosphorothioate backbone linkage; and / or ii) 5-methylcytosine and / or 5-methyluracil bases, and / or iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0077] The compound of the present invention is preferably for use as a medicament for treating disease or condition through splice regulation, such as exon skipping or exon inclusion, both of which are forms of splice switching.Preferably, skip exon 51 of dystrophin pre-mRNA.More preferably, skip exon 51 of human dystrophin pre-mRNA.A preferred disease in this context is Duchenne muscular dystrophy (DMD).

[0078] Preferably, the monomers are or are derived from RNA monomers. Thus, in preferred compounds, the first and / or second antisense oligonucleotides comprise: i) at least one 2'-substituted monomer, preferably an RNA monomer or a 2'-O-substituted RNA monomer, and optionally a phosphorothioate backbone linkage, and / or ii) 5-methylcytosine and / or 5-methyluracil bases, and / or iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0079] Included in (i) above are oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compounds of the invention) that contain at least one 2'-substituted monomer, preferably a 2'-substituted RNA monomer, and that do not contain phosphorothioate backbone linkages. Such oligonucleotides can have a backbone that contains only phosphodiester linkages. Also included are oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compounds of the invention) that contain at least one 2'-substituted monomer, preferably a 2'-substituted RNA monomer, and one or more phosphorothioate backbone linkages. Also included are oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compounds of the invention) that do not contain any monomers other than the 2'-substituted RNA monomers and that contain only backbone linkages that are phosphorothioate backbone linkages. Also included are oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compounds of the invention) that do not contain any monomers other than the 2'-substituted RNA monomers and that contain only backbone linkages that are phosphodiester backbone linkages.

[0080] Thus, in more preferred compounds, the first and / or second antisense oligonucleotides comprise: i) only 2'-substituted monomers, preferably RNA monomers or only 2'-O-substituted RNA monomers linked by phosphorothioate backbone and / or phosphodiester bonds, and / or ii) 5-methylcytosine and / or 5-methyluracil bases, and / or iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0081] As known to those skilled in the art, oligonucleotides, such as RNA oligonucleotides, generally consist of repeating monomers. Such monomers are most often nucleotides or nucleotide analogs. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate, and uridine monophosphate. They consist of a pentose sugar ribose, a 5'-linked phosphate group linked via a phosphate ester, and a 1'-linked base. The sugar connects the base and the phosphate, and is therefore often referred to as the scaffold of the nucleotide. Modifications at the pentose sugar are therefore often referred to as scaffold modifications. For severe modifications, the original pentose sugar may be entirely replaced with another moiety that similarly connects the base and the phosphate. Thus, although the pentose sugar is often the scaffold, it should be understood that the scaffold is not necessarily the pentose sugar.

[0082] The bases, also referred to as nucleobases, are typically adenine, cytosine, guanine, thymine, or uracil, or derivatives thereof. Cytosine, thymine, and uracil are pyrimidine bases and typically link to the scaffold via their 3'-nitrogen. Adenine and guanine are purine bases and typically link to the scaffold via their 9'-nitrogen.

[0083] A nucleotide is generally connected to an adjacent nucleotide by condensing its 5'-phosphate moiety to the 3'-hydroxyl moiety of an adjacent nucleotide monomer. Similarly, its 3'-hydroxyl moiety is generally connected to the 5'-phosphate of an adjacent nucleotide monomer. This forms a phosphodiester bond. The phosphodiester and the scaffold form an alternating copolymer. The base is grafted to this copolymer, i.e., the scaffold moiety. Due to this feature, the alternating copolymer formed by the linked monomers of an oligonucleotide is often referred to as the backbone of the oligonucleotide. Since the phosphodiester bonds connect adjacent monomers together, they are often referred to as backbone bonds. It should be understood that if the phosphate group is modified to be an analogous moiety such as phosphorothioate instead, such moiety is still referred to as the backbone bond of the monomer. This is referred to as a backbone bond modification. Thus, in general terms, the backbone of an oligonucleotide is composed of alternating scaffolds and backbone bonds.

[0084] Preferably, the first and / or second antisense oligonucleotide of the compound of the present invention comprises or consists of 2'-substituted phosphorothioate monomers, preferably 2'-substituted phosphorothioate RNA monomers, 2'-substituted phosphate RNA monomers, or 2'-substituted mixed phosphate / phosphorothioate RNA monomers. Such oligonucleotides comprise or consist of 2'-substituted RNA monomers connected or linked via phosphorothioate or phosphate backbone bonds or mixtures thereof. More preferably, such oligonucleotides consist of 2'-substituted phosphorothioate RNA monomers, 2'-substituted phosphate RNA monomers, or mixtures thereof. Preferably, the 2'-substituted RNA is 2'-F, 2'-O-methyl, or 2'-O-(2-methoxyethyl). The 2'-O-(2-methoxyethyl) moiety is often referred to as 2'-MOE. More preferably, the 2'-substituted RNA monomer is a 2'-O-methyl RNA monomer. Such chemical structures are known to those skilled in the art. In a preferred embodiment of this aspect, the compound of the present invention is provided, wherein the 2'-substituted monomer of the first and / or second oligonucleotide is a 2'-substituted RNA monomer, a 2'-F monomer, a 2'-amino monomer, a 2'-O-substituted monomer, a 2'-O-methyl monomer or a 2'-O-(2-methoxyethyl) monomer, preferably a 2'-O-methyl monomer. Preferably, the 2'-substituted monomer is a 2'-substituted RNA monomer, such as a 2'-O-methyl RNA monomer.

[0085] Throughout the application, oligonucleotides containing 2'-O-methyl monomers or 2'-O-methyl RNA monomers and phosphorothioate, phosphate, or mixed phosphate / phosphorothioate backbone linkages may be replaced with oligonucleotides containing 2'-O-methyl phosphorothioate RNA, 2'-O-methyl phosphate RNA, or 2'-O-methyl phosphate / phosphorothioate RNA, respectively.Throughout the application, oligonucleotides consisting of 2'-O-methyl RNA monomers linked by or connected through phosphorothioate, phosphate, or mixed phosphate / phosphorothioate backbone linkages may be replaced with oligonucleotides consisting of 2'-O-methyl phosphorothioate RNA, 2'-O-methyl phosphate RNA, or 2'-O-methyl phosphate / phosphorothioate RNA.

[0086] Furthermore, the first and / or second antisense oligonucleotide of the compound of the present invention preferably comprises base modifications that increase the binding affinity to the target strand, increase the melting temperature of the resulting duplex of the oligonucleotide with its target, and / or reduce the immunostimulatory effect, and / or increase the biostability, and / or improve the biodistribution, and / or tissue distribution, and / or cellular uptake and transport. In a more preferred embodiment, the first and / or second oligonucleotide comprises a 5-methylpyrimidine. The 5-methylpyrimidine is selected from 5-methylcytosine, and / or 5-methyluracil, and / or thymine, and the thymine is the same as 5-methyluracil. "Thymine" and "5-methyluracil" are interchangeable herein. The expression "oligonucleotide comprises 5-methylpyrimidine" means that at least one of the cytosine nucleobases of said oligonucleotide is modified by replacing the hydrogen at the 5-position of the pyrimidine ring with a methyl group, i.e., 5-substituted cytosine, and / or at least one of the uracil nucleobases of said oligonucleotide is modified by replacing the proton at the 5-position of the pyrimidine ring with a methyl group (i.e., 5-methyluracil). In the context of the present invention, the expression "replacement of the hydrogen at the 5-position of the pyrimidine ring with a methyl group" can be replaced by the expression "replacement of pyrimidine with 5-methylpyrimidine", where pyrimidine refers to only uracil, only cytosine, or both. Where the oligonucleotide comprises one, two, three, four, five, six, seven, eight, nine or more cytosines and / or uracils, at least one, two, three, four, five, six, seven, eight, nine or more cytosines and / or uracils, respectively, are so modified. It goes without saying that the invention is therefore only applicable to oligonucleotides which comprise at least one cytosine or uracil, respectively, in their sequence.

[0087] Preferably, the first and / or second antisense oligonucleotide of the compound of the present invention comprises at least one of either 5-methylcytosine base or 5-methyluracil base. In a preferred embodiment of the present invention, the first and / or second antisense oligonucleotide of the compound is provided, in which all cytosine bases are 5-methylcytosine bases and / or all uracil bases are 5-methyluracil bases. This relates to oligonucleotides that contain 5-methylcytosine but do not contain unsubstituted cytosine or uracil, oligonucleotides that contain 5-methyluracil but do not contain unsubstituted cytosine or uracil, and oligonucleotides that contain both 5-methylcytosine and 5-methyluracil but do not contain unsubstituted cytosine or uracil. It also relates to oligonucleotides that contain 5-methylcytosine but do not contain unsubstituted cytosine and further contain unsubstituted uracil, or oligonucleotides that contain 5-methyluracil but do not contain unsubstituted uracil and further contain unsubstituted cytosine. In a more preferred embodiment of the invention there is provided said first and / or second antisense oligonucleotide, wherein all cytosine bases are 5-methylcytosine.

[0088] When said first oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of a sequence represented by any one of SEQ ID NOs: 14 to 197 or a fragment thereof, as defined herein above, preferably at least one 5-methylcytosine and / or 5-methyluracil is comprised in said first oligonucleotide, more preferably all cytosine bases are 5-methylcytosine and / or all uracil bases are 5-methyluracil. Thus, preferred variants of said first oligonucleotide of the compound of the invention comprise or consist of a sequence represented by any one of SEQ ID NOs: 14 to 197 or a fragment thereof, as defined herein above: - all cytosine bases are 5-methylcytosine as represented by any one of SEQ ID NOs: 399 to 581, or - all uracil bases are 5-methyluracil represented by any one of SEQ ID NOs: 774 to 957, or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 1156-1338.

[0089] When said second oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of a sequence represented by any one of SEQ ID NOs: 198 to 398 or a fragment thereof, as defined herein above, preferably at least one 5-methylcytosine and / or 5-methyluracil is comprised in said second oligonucleotide, more preferably all cytosine bases are 5-methylcytosine and / or all uracil bases are 5-methyluracil. Thus, a preferred variant of said second oligonucleotide of the compound of the invention comprises or consists of a sequence represented by any one of SEQ ID NOs: 198 to 398 or a fragment thereof, as defined herein above: - all cytosine bases are 5-methylcytosine as represented by any one of SEQ ID NOs: 582 to 773, or - all uracil bases are 5-methyluracil represented by any one of SEQ ID NOs: 958 to 1155, or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 1339 to 1528.

[0090] In a more preferred embodiment, the compound of the present invention is preferably for skipping exon 51 of dystrophin pre-mRNA and comprises or consists of a first antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 399, 400, 401, 402 or 403, more preferably SEQ ID NO: 399, 400, 401 or 402, even more preferably SEQ ID NO: 399 or 400, most preferably SEQ ID NO: 399, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 582, 583, 584 or 585, more preferably SEQ ID NO: 582 or 583, even more preferably SEQ ID NO: 582, wherein the first and second antisense oligonucleotides are linked to each other by a linking moiety (as explained in the section entitled "Linking Moiety"), preferably the linking moiety is triethylene glycol (TEG) or hexaethylene glycol (HEG).

[0091] The sequence of SEQ ID NO: 399 is GGUAAGUUC * U.G.U.C. * C * A.A.G.C. * The sequence of SEQ ID NO: 400 is represented by the sequence GUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * The sequence represented by SEQ ID NO: 401 is the sequence AGUC * GGEAAGEnjC * 1JGUC * C * Therefore, SEQ ID NO: 402 is the sequence C * U.G.U.C. * C * A.A.G.C. * C * C * The sequence of SEQ ID NO: 403, represented by GGUUGA, is * U.G.U.C. * C * The sequence of SEQ ID NO: 582, represented by AAG, is *AAGGAAGAUGGC * AUUUC * The sequence of SEQ ID NO: 583, represented by U, is the sequence UC * AAGGAAGAUGGC * AUUUC * SEQ ID NO: 584 is represented by the sequence UC * AAGGAAGAUGGC * The sequence of SEQ ID NO: 585, represented by AU, is GAAGAUGGC * AUUUC * Represented by U, C * is 5-methylcytosine.

[0092] Throughout this application, unless otherwise noted, * means a 5-methylcytosine base.

[0093] In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the present invention are interchangeable. Thus, preferred compounds of the present invention are: i) sequence number 16215 (GGUAAGUUC * U.G.U.C. * C * A.A.G.C. * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16216 (UC * AAGGAAGAUGGC * AUUUC * UnGGUAAGUUC * U.G.U.C. * C * AAGC), the linking moiety represented by n is a TEG linker, or ii) SEQ ID NO: 16217 (GGUAAGUUC * U.G.U.C. * C * A.A.G.C. * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16218 (UC * AAGGAAGAUGGC* AUUUC * UnGGUAAGUUC * U.G.U.C. * C * A.A.G.C. * ), the linking moiety represented by n is a HEG linker, or iii) SEQ ID NO: 16219 (GGUAAGUUC * U.G.U.C. * C * A.A.G.C. * nUC * AAGGAAGAUGGC * AUUUC * UAG), or SEQ ID NO: 16220 (UC * AAGGAAGAUGGC * AUUUC * UAGnGGUAAGUUC * U.G.U.C. * C * A.A.G.C. * ), the linking moiety represented by n is a TEG linker, or iv) SEQ ID NO: 16221 (GGUAAGUUC * U.G.U.C. * C * A.A.G.C. * nUC * AAGGAAGAUGGC * AUUUC * UAG), or SEQ ID NO: 16222 (UC * AAGGAAGAUGGC * AUUUC * UAGnGGUAAGUUC * U.G.U.C. * C * A.A.G.C. * ), the linking moiety represented by n is a HEG linker; or v) sequence number 16223 (GUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16224 (UC *AAGGAAGAUGGC * AUUUC * UnGUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a TEG linker, or vi) SEQ ID NO: 16225 (GUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16226 (UC * AAGGAAGAUGGC * AUUUC * UnGUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a HEG linker, or vii) SEQ ID NO: 16227 (GUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * nUC * AAGGAAGAUGGC * AUUUC * UAG), or SEQ ID NO: 16228 (UC * AAGGAAGAUGGC * AUUUC * UAGnGUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a TEG linker, or viii) SEQ ID NO: 16229 (GUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * nUC *AAGGAAGAUGGC * AUUUC * UAG), or SEQ ID NO: 16230 (UC * AAGGAAGAUGGC * AUUUC * UAGnGUAAGUUC * U.G.U.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a HEG linker, or ix) SEQ ID NO: 16231 (AGUC * GGUAAGUUC * U.G.U.C. * C * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16232 (UC * AAGGAAGAUGGC * AUUUC * UnAGUC * GGUAAGUUC * U.G.U.C. * C * ), the linking moiety represented by n is a TEG linker, or x) SEQ ID NO: 16233 (AGUC * GGUAAGUUC * U.G.U.C. * C * nUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16234 (UC * AAGGAAGAUGGC * AUUUC * UnAGUC * GGUAAGUUC * U.G.U.C. * C * ), the linking moiety represented by n is a HEG linker, or xi) SEQ ID NO: 16235 (AGUC * GGUAAGUUC * U.G.U.C. * C * nUC* AAGGAAGAUGGC * AUUUC * UAG), or sequence number 16236 (UC * AAGGAAGAUGGC * AUUUC * UAGnAGUC * GGUAAGUUC * U.G.U.C. * C * ), the linking moiety represented by n is a TEG linker, or xii) SEQ ID NO: 16237 (AGUC * GGUAAGUUC * U.G.U.C. * C * nUC * AAGGAAGAUGGC * AUUUC * UAG), or sequence number 16238 (UC * AAGGAAGAUGGC * AUUUC * UAGnAGUC * GGUAAGUUC * U.G.U.C. * C * ), the linking moiety represented by n is a HEG linker, or xiii) SEQ ID NO: 16239 (C * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGAnUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16240 (UC * AAGGAAGAUGGC * AUUUC * UnC * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGA), the linking moiety represented by n is a TEG linker, or xiv) SEQ ID NO: 16241 (C * U.G.U.C.* C * A.A.G.C. * C * C * GGUUGAnUC * AAGGAAGAUGGC * AUUUC * U), or sequence number 16242 (UC * AAGGAAGAUGGC * AUUUC * UnC * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGA), the linking moiety represented by n is a HEG linker, or xv) SEQ ID NO: 16243 (C * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGAnUC * AAGGAAGAUGGC * AUUUC * UAG), or SEQ ID NO: 16244 (UC * AAGGAAGAUGGC * AUUUC * UAGnC * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGA), the linking moiety represented by n is a TEG linker, or xvi) SEQ ID NO: 16245 (C * U.G.U.C. * C * A.A.G.C. * C * C * GGUUGAnUC * AAGGAAGAUGGC * AUUUC * UAG), or sequence number 16246 (UC * AAGGAAGAUGGC * AUUUC * UAGnC *U.G.U.C. * C * A.A.G.C. * C * C * GGUUGA), the linking moiety represented by n is a HEG linker, or xvii) SEQ ID NO: 16247 (UAAGUUC * U.G.U.C. * C * AAGnUC * AAGGAAGAUGGC * AU), or sequence number 16248 (UC * AAGGAAGAUGGC * AUnUAAGUUC * U.G.U.C. * C * AAG), the linking moiety represented by n is a TEG linker, or xviii) SEQ ID NO: 16249 (UAAGUUC * U.G.U.C. * C * AAGnUC * AAGGAAGAUGGC * AU), or sequence number 16250 (UC * AAGGAAGAUGGC * AUnUAAGUUC * U.G.U.C. * C * AAG), the linking moiety represented by n is a HEG linker, or xix) sequence number 16251 (UAAGUUC * U.G.U.C. * C * AAGnGAAGAUGGC * AUUUC * U), or sequence number 16252 (GAAGAUGGC * AUUUC * UnUAAGUUC * U.G.U.C. * C * AAG), the linking moiety represented by n is a TEG linker, or xx) sequence number 16253 (UAAGUUC * U.G.U.C. * C * AAGnGAAGAUGGC* AUUUC * U), or sequence number 16254 (GAAGAUGGC * AUUUC * UnUAAGUUC * U.G.U.C. * C * AAG), the linking portion represented by n is a HEG linker; C * is 5-methylcytosine, which can be represented as:

[0094] More preferred compounds of the invention are represented by any one of SEQ ID NOs: 16215, 16216, 16219, 16220, 16223, 16224, 16227, 16228, 16231, 16232, 16235, 16236, 16239, 16240, 16243 and 16244 (TEG linker) or any one of SEQ ID NOs: 16217, 16218, 16221, 16222, 16225, 16226, 16229, 16230, 16233, 16234, 16237, 16238, 16241, 16242, 16245 and 16246 (HEG linker).

[0095] Even more preferred compounds of the present invention are represented by any one of SEQ ID NOs: 16231, 16232, 16235, 16236, 16239, 16240, 16243 and 16244 (TEG linker) or any one of SEQ ID NOs: 16233, 16234, 16237, 16238, 16241, 16242, 16245 and 16246 (HEG linker).

[0096] Even more preferred compounds of the present invention are represented by any one of SEQ ID NOs: 16215, 16216, 16219, 16220, 16223, 16224, 16227 and 16228 (TEG linker) or any one of SEQ ID NOs: 16217, 16218, 16221, 16222, 16225, 16226, 16229 and 16230 (HEG linker).

[0097] The most preferred compounds of the invention are represented by SEQ ID NO: 16215 or 16216 (TEG linker) or SEQ ID NO: 16217 or 16218 (HEG linker).

[0098] Thus, in another preferred embodiment, the compound of the present invention is preferably for skipping exon 51 of dystrophin pre-mRNA and comprises or consists of a first antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 774, 775, 776, 777 or 778, more preferably SEQ ID NO: 774, 775, 776 or 777, even more preferably SEQ ID NO: 774 or 775, most preferably SEQ ID NO: 774, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 958, 959, 960 or 961, more preferably SEQ ID NO: 958 or 959, even more preferably SEQ ID NO: 958, wherein the first and second antisense oligonucleotides are linked to each other by a linking moiety (as explained in the section entitled "Linking Moiety"), preferably the linking moiety is triethylene glycol (TEG) or hexaethylene glycol (HEG).

[0099] The sequence number 774 is represented by the sequence GGTAAGTTCTGTCCAAGC, the sequence number 775 is represented by the sequence GTAAGTTCTGTCCAAGC, the sequence number 776 is represented by the sequence AGTCGGTAAGTTCTGTCC, the sequence number 777 is represented by the sequence CTGTCCAAGCCCGGTTGA, the sequence number 778 is represented by the sequence TAAGTTCTGTCCAAG, the sequence number 958 is represented by the sequence TCAAGGAAGATGGCATTTCT, the sequence number 959 is represented by the sequence TCAAGGAAGATGGCATTTCTAG, the sequence number 960 is represented by the sequence TCAAGGAAGATGGCAT, and the sequence number 961 is represented by the sequence GAAGATGGCATTTCT, where T is 5-methyluracil.

[0100] Throughout this application, unless otherwise noted, T and U * Both refer to the base thymine or 5-methyluracil. It is obvious to those skilled in the art that thymine and 5-methyluracil are identical.

[0101] In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the present invention are interchangeable. Thus, preferred compounds of the present invention are: i) SEQ ID NO: 16255 (GGTAAGTTCTGTCCAAGCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16256 (TCAAGGAAGATGGCATTTCTnGGTAAGTTCTGTCCAAGC), where the linking portion represented by n is a TEG linker, or ii) SEQ ID NO: 16257 (GGTAAGTTCTGTCCAAGCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16258 (TCAAGGAAGATGGCATTTCTnGGTAAGTTCTGTCCAAGC), where the linking moiety represented by n is a HEG linker, or iii) SEQ ID NO: 16259 (GGTAAGTTCTGTCCAAGCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16260 (TCAAGGAAGATGGCATTTCTAGnGGTAAGTTCTGTCCAAGC), where n is a TEG linker; or iv) SEQ ID NO: 16261 (GGTAAGTTCTGTCCAAGCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16262 (TCAAGGAAGATGGCATTTCTAGnGGTAAGTTCTGTCCAAGC), where the linking portion represented by n is a HEG linker, or v) SEQ ID NO: 16263 (GTAAGTTCTGTCCAAGCCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16264 (TCAAGGAAGATGGCATTTCTnGTAAGTTCTGTCCAAGCC), where the linking portion represented by n is a TEG linker, or vi) SEQ ID NO: 16265 (GTAAGTTCTGTCCAAGCCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16266 (TCAAGGAAGATGGCATTTCTnGTAAGTTCTGTCCAAGCC), where the linking portion represented by n is a HEG linker, or vii) SEQ ID NO: 16267 (GTAAGTTCTGTCCAAGCCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16268 (TCAAGGAAGATGGCATTTCTAGnGTAAGTTCTGTCCAAGCC), where n is a TEG linker; or viii) SEQ ID NO: 16269 (GTAAGTTCTGTCCAAGCCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16270 (TCAAGGAAGATGGCATTTCTAGnGTAAGTTCTGTCCAAGCC), wherein the linking portion represented by n is a HEG linker, or ix) SEQ ID NO: 16271 (AGTCGGTAAGTTCTGTCCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16272 (TCAAGGAAGATGGCATTTCTnAGTCGGTAAGTTCTGTCC), where n is a TEG linker, or x) SEQ ID NO: 16273 (AGTCGGTAAGTTCTGTCCnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16274 (TCAAGGAAGATGGCATTTCTnAGTCGGTAAGTTCTGTCC), where the linking portion represented by n is a HEG linker, or xi) SEQ ID NO: 16275 (AGTCGGTAAGTTCTGTCCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16276 (TCAAGGAAGATGGCATTTCTAGnAGTCGGTAAGTTCTGTCC), where n is a TEG linker; or xii) SEQ ID NO: 16277 (AGTCGGTAAGTTCTGTCCnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16278 (TCAAGGAAGATGGCATTTCTAGnAGTCGGTAAGTTCTGTCC), wherein the linking portion represented by n is a HEG linker, or xiii) SEQ ID NO: 16279 (CTGTCCAAGCCCGGTTGAnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16280 (TCAAGGAAGATGGCATTTCTnCTGTCCAAGCCCGGTTGA), wherein the linking portion represented by n is a TEG linker, or xiv) SEQ ID NO: 16281 (CTGTCCAAGCCCGGTTGAnTCAAGGAAGATGGCATTTCT) or SEQ ID NO: 16282 (TCAAGGAAGATGGCATTTCTnCTGTCCAAGCCCGGTTGA), wherein the linking portion represented by n is a HEG linker, or xv) SEQ ID NO: 16283 (CTGTCCAAGCCCGGTTGAnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16284 (TCAAGGAAGATGGCATTTCTAGnCTGTCCAAGCCCGGTTGA), wherein the linking portion represented by n is a TEG linker, or xvi) SEQ ID NO: 16285 (CTGTCCAAGCCCGGTTGAnTCAAGGAAGATGGCATTTCTAG) or SEQ ID NO: 16286 (TCAAGGAAGATGGCATTTCTAGnCTGTCCAAGCCCGGTTGA), wherein the linking portion represented by n is a HEG linker, or xvii) SEQ ID NO: 16287 (TAAGTTCTGTCCAAGnTCAAGGAAGATGGCAT) or SEQ ID NO: 16288 (TCAAGGAAGATGGCATnTAAGTTCTGTCCAAG), where n is a TEG linker; or xviii) SEQ ID NO: 16289 (TAAGTTCTGTCCAAGnTCAAGGAAGATGGCAT) or SEQ ID NO: 16290 (TCAAGGAAGATGGCATnTAAGTTCTGTCCAAG), wherein the linking moiety represented by n is a HEG linker, or xix) SEQ ID NO: 16291 (TAAGTTCTGTCCAAGnGAAGATGGCATTTCT) or SEQ ID NO: 16292 (GAAGATGGCATTTCTnTAAGTTCTGTCCAAG), wherein the linking portion represented by n is a TEG linker, or xx) SEQ ID NO: 16293 (TAAGTTCTGTCCAAGnGAAGATGGCATTTCT) or SEQ ID NO: 16294 (GAAGATGGCATTTCTnTAAGTTCTGTCCAAG), wherein the linking portion represented by n is a HEG linker; T is 5-methyluracil.

[0102] More preferred compounds of the invention are represented by any one of SEQ ID NOs: 16255, 16256, 16259, 16260, 16263, 16264, 16267, 16268, 16271, 16272, 16275, 16276, 16279, 16280, 16283 and 16284 (TEG linker) or any one of SEQ ID NOs: 16257, 16258, 16261, 16262, 16265, 16266, 16269, 16270, 16273, 16274, 16277, 16278, 16281, 16282, 16285 and 16285 (HEG linker).

[0103] Even more preferred compounds of the present invention are represented by any one of SEQ ID NOs: 16271, 16272, 16275, 16276, 16279, 16280, 16283 and 16284 (TEG linker) or any one of SEQ ID NOs: 16273, 16274, 16277, 16278, 16281, 16282, 16285 and 16285 (HEG linker).

[0104] Even more preferred compounds of the invention are represented by any one of SEQ ID NOs: 16255, 16256, 16259, 16260, 16263, 16264, 16267 and 16268 (TEG linker) or any one of SEQ ID NOs: 16257, 16258, 16261, 16262, 16265, 16266, 16269 and 16270 (HEG linker).

[0105] The most preferred compounds of the invention are represented by SEQ ID NO: 16255 or 16256 (TEG linker) or SEQ ID NO: 16257 or 16258 (HEG linker).

[0106] Therefore, in another preferred embodiment, the compound of the present invention is preferably for skipping exon 51 of the pre-mRNA of dystrophin, and is preferably a first antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1156, 1157, 1158, 1159 or 1160, more preferably SEQ ID NO: 1156, 1157, 1158 or 1159, even more preferably SEQ ID NO: 1156 or 1157, most preferably SEQ ID NO: 1156, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 40, 1341 or 1342, more preferably SEQ ID NO: 1339 or 1340, and even more preferably SEQ ID NO: 1339, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1339, wherein the first and second antisense oligonucleotides are linked to each other by a linking moiety (as described in the section entitled "Linking Moiety"), preferably the linking moiety is triethylene glycol (TEG) or hexaethylene glycol (HEG).

[0107] The sequence of SEQ ID NO: 1156 is GGTAAGTTC * T.G.T.C. * C * A.A.G.C. * The sequence of SEQ ID NO: 1157 is represented by the sequence GTAAGTTC * T.G.T.C. * C* A.A.G.C. * C * The sequence number 1158 is represented by the sequence AGTC * GGTAAGTTC * T.G.T.C. * C * The sequence number 1159 is represented by the sequence C * T.G.T.C. * C * A.A.G.C. * C * C * The sequence SEQ ID NO: 1160, represented by GGTTGA, is * T.G.T.C. * C * The sequence number 1339, represented by AAG, is * AAGGAAGATGGC * ATTTC * The sequence number 1340, represented by T, is the sequence TC * AAGGAAGATGGC * ATTTC * The sequence number 1341 is represented by the sequence TC * AAGGAAGATGGC * The sequence of SEQ ID NO: 1342, represented by AT, is GAAGATGGC * ATTTC * Represented by T, C * is 5-methylcytosine and T is 5-methyluracil.

[0108] In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the present invention are interchangeable. Thus, preferred compounds of the present invention are: i) sequence number 16295 (GGTAAGTTC*TGTC*C*AAGC*nTC*AAGGAAGATGGC * ATTTC * T), or sequence number 16296 (TC * AAGGAAGATGGC * ATTTC * TnGGTAAGTTC * T.G.T.C. * C * A.A.G.C.* ), the linking moiety represented by n is a TEG linker, or ii) SEQ ID NO: 16297 (GGTAAGTTC * T.G.T.C. * C * A.A.G.C. * nTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16298 (TC * AAGGAAGATGGC * ATTTC * TnGGTAAGTTC * T.G.T.C. * C * A.A.G.C. * ), the linking moiety represented by n is a HEG linker, or iii) SEQ ID NO: 16299 (GGTAAGTTC * T.G.T.C. * C * A.A.G.C. * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16300 (TC * AAGGAAGATGGC * ATTTC * TAGnGGTAAGTTC * T.G.T.C. * C * A.A.G.C. * ), the linking moiety represented by n is a TEG linker, or iv) SEQ ID NO: 16301 (GGTAAGTTC * T.G.T.C. * C * A.A.G.C. * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16302 (TC * AAGGAAGATGGC * ATTTC * TAGnGGTAAGTTC * T.G.T.C. * C * A.A.G.C.* ), the linking moiety represented by n is a HEG linker, or v) SEQ ID NO: 16303 (GTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * nTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16304 (TC * AAGGAAGATGGC * ATTTC * TnGTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a TEG linker, or vi) SEQ ID NO: 16305 (GTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * nTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16306 (TC * AAGGAAGATGGC * ATTTC * TnGTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a HEG linker, or vii) SEQ ID NO: 16307 (GTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16308 (TC * AAGGAAGATGGC * ATTTC *TAGnGTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a TEG linker, or viii) SEQ ID NO: 16309 (GTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16310 (TC * AAGGAAGATGGC * ATTTC * TAGnGTAAGTTC * T.G.T.C. * C * A.A.G.C. * C * ), the linking moiety represented by n is a HEG linker, or ix) SEQ ID NO: 16311 (AGTC * GGTAAGTTC * T.G.T.C. * C * nTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16312 (TC * AAGGAAGATGGC * ATTTC * TnAGTC * GGTAAGTTC * T.G.T.C. * C * ), the linking moiety represented by n is a TEG linker, or x) Sequence number 16313 (AGTC * GGTAAGTTC * T.G.T.C. * C * nTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16314 (TC *AAGGAAGATGGC * ATTTC * TnAGTC * GGTAAGTTC * T.G.T.C. * C * ), the linking moiety represented by n is a HEG linker, or xi) SEQ ID NO: 16315 (AGTC * GGTAAGTTC * T.G.T.C. * C * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16316 (TC * AAGGAAGATGGC * ATTTC * TAGnAGTC * GGTAAGTTC * T.G.T.C. * C * ), the linking moiety represented by n is a TEG linker, or xii) SEQ ID NO: 16317 (AGTC * GGTAAGTTC * T.G.T.C. * C * nTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16318 (TC * AAGGAAGATGGC * ATTTC * TAGnAGTC * GGTAAGTTC * T.G.T.C. * C * ), the linking moiety represented by n is a HEG linker, or xiii) SEQ ID NO: 16319 (C * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGAnTC * AAGGAAGATGGC * ATTTC *T), or sequence number 16320 (TC * AAGGAAGATGGC * ATTTC * TnC * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGA), the linking moiety represented by n is a TEG linker, or xiv) SEQ ID NO: 16321 (C * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGAnTC * AAGGAAGATGGC * ATTTC * T), or sequence number 16322 (TC * AAGGAAGATGGC * ATTTC * TnC * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGA), the linking moiety represented by n is a HEG linker, or xv) SEQ ID NO: 16323 (C * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGAnTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16324 (TC * AAGGAAGATGGC * ATTTC * TAGnC * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGA), the linking moiety represented by n is a TEG linker, or xvi) SEQ ID NO: 16325 (C* T.G.T.C. * C * A.A.G.C. * C * C * GGTTGAnTC * AAGGAAGATGGC * ATTTC * TAG), or sequence number 16326 (TC * AAGGAAGATGGC * ATTTC * TAGnC * T.G.T.C. * C * A.A.G.C. * C * C * GGTTGA), the linking moiety represented by n is a HEG linker, or xvii) SEQ ID NO: 16327 (TAAGTTC * T.G.T.C. * C * AAGnTC * AAGGAAGATGGC * AT), or SEQ ID NO: 16328 (TC * AAGGAAGATGGC * ATnTAAGTTC * T.G.T.C. * C * AAG), the linking moiety represented by n is a TEG linker, or xviii) SEQ ID NO: 16329 (TAAGTTC * T.G.T.C. * C * AAGnTC * AAGGAAGATGGC * AT), or sequence number 16330 (TC * AAGGAAGATGGC * ATnTAAGTTC * T.G.T.C. * C * AAG), the linking moiety represented by n is a HEG linker, or xix) SEQ ID NO: 16331 (TAAGTTC * T.G.T.C. * C * AAGnGAAGATGGC * ATTTC* T), or SEQ ID NO: 16332 (GAAGATGGC * ATTTC * TnTAAGTTC * T.G.T.C. * C * AAG), the linking moiety represented by n is a TEG linker, or xx) SEQ ID NO: 16333 (TAAGTTC * T.G.T.C. * C * AAGnGAAGATGGC * ATTTC * T), or SEQ ID NO: 16334 (GAAGATGGC * ATTTC * TnTAAGTTC * T.G.T.C. * C * AAG), the linking portion represented by n is a HEG linker; C * is 5-methylcytosine and T is 5-methyluracil.

[0109] More preferred compounds of the invention are represented by any one of SEQ ID NOs: 16295, 16296, 16299, 16300, 16303, 16304, 16307, 16308, 16311, 16312, 16315, 16316, 16319, 16320, 16323 and 16324 (TEG linker) or any one of SEQ ID NOs: 16297, 16298, 16301, 16302, 16305, 16306, 16309, 16310, 16313, 16314, 16317, 16318, 16321, 16322, 16325 and 16326 (HEG linker).

[0110] Even more preferred compounds of the present invention are represented by any one of SEQ ID NOs: 16311, 16312, 16315, 16316, 16319, 16320, 16323 and 16324 (TEG linker) or any one of SEQ ID NOs: 16313, 16314, 16317, 16318, 16321, 16322, 16325 and 16326 (HEG linker).

[0111] Even more preferred compounds of the invention are represented by any one of SEQ ID NOs: 16295, 16296, 16299, 16300, 16303, 16304, 16307 and 16308 (TEG linker) or any one of SEQ ID NOs: 16297, 16298, 16301, 16302, 16305, 16306, 16309, 16310 (HEG linker).

[0112] The most preferred compounds of the invention are represented by SEQ ID NO: 16295 or 16296 (TEG linker) or SEQ ID NO: 16297 or 16298 (HEG linker).

[0113] In an embodiment, the compound of the present invention comprises or consists of a first and a second antisense oligonucleotide linked together by a linking moiety, the first and / or the second antisense oligonucleotide comprising a scaffold modification that increases the binding affinity to the target strand, increases the melting temperature of the duplex obtained from the first and / or the second oligonucleotide and its target, and / or reduces the immunostimulatory effect, and / or enhances the biostability, and / or improves the biodistribution, and / or tissue distribution, and / or cellular uptake and transport. Included in the present invention are scaffold modifications that result in bicyclic nucleic acid (BNA) monomers. Bicyclic scaffolds are generally pentose-derived scaffolds that have been chemically modified to conformationally restrict the scaffold and provide the improved effects described above. Examples of bicyclic scaffolds include scaffolds in which a first ring, such as a pentose ring, forms a spirane with an additional cyclic moiety, such that both rings share only one atom; scaffolds in which a first ring, such as a pentose ring, is fused with an additional cyclic moiety, such that both rings share two adjacent atoms; and scaffolds in which a first ring, such as a pentose ring, forms a bridged compound through a moiety that is connected to the first cyclic moiety by two non-adjacent atoms. Such non-adjacent atoms are referred to as bridgehead atoms. A bridged compound includes multiple rings, each of which overlaps over at least three atoms. A compound with two rings that overlap over only two atoms is a fused compound. In some bridged compounds, the smallest connection between the two bridgehead atoms is referred to as the bridging or bridge moiety. In other bridged compounds, when one ring is a characteristic ring, such as the pentose ring of a nucleotide, the moiety that is not constitutive of the characteristic ring is referred to as the bridge moiety. The nomenclature of bridged bicyclic compounds is context sensitive. [ka]

[0114] Bicyclic compounds can include additional rings. Bicyclic compounds are at least bicyclic, with two rings forming a spirane, fused or bridged system, or a combination thereof. The present invention does not include scaffold modifications in which two independent rings are linked via an acyclic linker so as not to form a spirane, fused or bridged compound. Preferred bicyclic compounds are fused or bridged compounds. In a more preferred embodiment, bicyclic nucleic acid monomers (BNAs) are bridged nucleic acid monomers. As described herein, both "bridged" and "bicyclic" nucleic acid monomers refer to nucleotides with modified scaffolds that enhance the melting temperature of the oligonucleotide to an RNA target compared to a non-BNA nucleotide-containing control oligonucleotide.

[0115] In a preferred embodiment, a compound of the invention is provided, wherein each occurrence of the bicyclic nucleic acid (BNA) scaffold modification in the first and / or second antisense oligonucleotide is independently selected from the group consisting of a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a 2'-thio-LNA monomer, a (2'-O,4'-C) cyclic ethyl (cEt) BNA monomer, a (2'-O,4'-C) cyclic methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomer, 2',4'-BNA NC(N-Bn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba LNA (cLNA) monomers, 3,4-dihydro-2H-pyran nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, heterocyclic bridged BNA monomers, amide bridged BNA monomers, urea bridged BNA monomers, sulfonamide bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicycloDNA (bcDNA) monomers, F-bcDNA monomers, tricycloDNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, 2'-amino-LNA-derived locked PMO monomers, and derivatives thereof are provided. The invention also includes the introduction of two or more distinct scaffold BNA modifications into the oligonucleotide. More preferably, each occurrence of the BNA scaffold modification is independently selected from the group consisting of a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a (2'-O,4'-C) cyclic ethyl (cEt) LNA monomer, a (2'-O,4'-C) cyclic methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomers, ethylene-bridged nucleic acid (ENA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, and derivatives thereof. Even more preferably, each occurrence of the BNA scaffold modification results in a locked nucleic acid (LNA) monomer.

[0116] Exemplary structures of monomers containing these BNA scaffold modifications are shown below, where B is a base as defined herein above, X is variable, X2 is a hydroxyl moiety or another 2'-substitution as defined herein above, and L is a backbone bond as defined herein above. In the literature, the names of such modifications are often arbitrary and do not follow uniform conversion, and the names provided below in this application are intended to refer to the structures provided below. For comparison, a cyclic scaffold of a conventional RNA monomer is first shown. In the structures shown below, the monomers are generally represented as 3'-end monomers. When chirality is not indicated, each enantiomer is referred to individually. The monomers resulting from the appearance of BNA scaffold modifications in the first and / or second antisense oligonucleotides of the compounds of the present invention are not limited to this type of monomer provided for illustrative purposes. Heteroatoms contained in the cyclic moiety can be replaced with other heteroatoms. [ka] [ka] [ka] [ka]

[0117] The following is a non-comprehensive summary of literature references for the BNA scaffold modifications mentioned above: cEt (2'-O,4'-C cyclic ethyl) LNA (doi:10.1021 / ja710342q), cMOE (2'-O,4'-C cyclic methoxyethyl) LNA (Seth et al., J. Org. Chem. 2010, 75, 1569-1581), 2',4'-BNA NC (NH), 2',4'-BNA NC(N-Me), ethylene-bridged nucleic acid (ENA) (doi:10.1093 / nass / 1.1.241), carba LNA (cLNA) (doi:10.1021 / jo100170g), DpNA (Osawa et al., J. Org. Chem., 2015, 80(21), pp.10474-10481), 2'-C-bridged bicyclic nucleotides (CBBN, e.g., as in WO2014 / 145356 (MiRagen Therapeutics)), heterocyclic bridged LNA (e.g., as in WO2014 / 126229 (Mitsuoka Y et al.)), amide bridged LNA (e.g., as in Yamamoto et al., Org. Biomol. Chem. 2015, 13, 3757), urea bridged LNA (e.g., Nishida et al., Chem. Commun. 2010, 46, 5283), sulfonamide-bridged LNA (e.g., as in WO2014 / 112463 (Obika S et al.,)), bicyclic carbocyclic nucleosides (e.g., as in WO2015 / 142910 (Ionis Pharmaceuticals)), TriNA (Hanessian et al., J. Org. Chem., 2013, 78(18), pp9064-9075), α-L-TriNA, bicyclic DNA (bcDNA) (Bolli et al., Chem Biol. Mar 1996;3(3):197-206), F-bcDNA (DOI:10.1021 / jo402690j), tricyclic DNA (tcDNA) (Murray et al., Nucl. Acids Res., 2012, 40, 13 6135-6143), F-tcDNA (doi:10.1021 / acs.joc.5b00184), oxetane nucleotide monomers (Nucleic Acids Res. 2004, 32, 5791-5799). For anything not mentioned above, see WO2011 / 097641 (ISIS / Ionis Pharmaceuticals) and WO2016 / 017422 (Osaka University), the entire contents of which are incorporated herein by reference.

[0118] Preferably, the first and / or second oligonucleotide of the compound of the present invention comprises an RNA monomer, since the RNA / RNA duplex is highly stable. It is preferred that the RNA oligonucleotide comprises modifications that provide additional properties to the RNA, such as resistance to endonucleases, exonucleases and RNaseH, increased hybridization ability, increased stability (e.g., in body fluids), increased or decreased mobility, increased activity, reduced toxicity, increased intracellular transport, increased cellular uptake, tissue specificity, etc. In addition, the mRNA complexed with the oligonucleotide is preferably not susceptible to RNaseH cleavage. Preferred modifications are identified as above.

[0119] Thus, the compounds of the present invention comprise or consist of a first and a second antisense oligonucleotide, wherein the first and / or the second antisense oligonucleotide comprise or consist of 2'-O-methyl phosphorothioate RNA monomers, preferably the first and / or the second AON further comprise a BNA, optionally with the presence of a 5-methylpyrimidine base (i.e., 5-methylcytosine and / or 5-methyluracil). Most preferably, the first and / or second oligonucleotide consists of 2'-O-methyl RNA monomers connected via a phosphorothioate or phosphate backbone, in which all of the cytosines and / or all of the uracils are independently replaced with 5-methylcytosine and / or 5-methyluracil, respectively, and at least one 2'-O-methyl scaffold is replaced with a BNA, preferably 1, 2, 3, 4, 5, 6, 7, 8 or 9 monomers are replaced with a BNA, more preferably 1, 2, 3, 4, 5, 6, 7, 8 or 9 monomers are replaced with a crosslinked nucleic acid scaffold modification, even more preferably 1, 2, 3, 4, 5, 6, 7, 8 or 9 monomers are replaced with an LNA. Preferably, the first and second antisense oligonucleotides of a compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0120] In a preferred embodiment of this aspect of the invention (i.e. chemical modification of the first and / or second antisense oligonucleotide of the compound), there is provided a compound of the invention, wherein said first and / or second oligonucleotide of the compound comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8 or 9 monomers of a bicyclic nucleic acid (BNA) scaffold modification, preferably a bridged nucleic acid scaffold modification, more preferably an LNA modification, and preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked by phosphorothioate backbone linkages, and / or all cytosine bases are 5-methylcytosines in said first and / or second oligonucleotide, and / or all uracil bases are 5-methyluracil bases in said first and / or second oligonucleotide, as hereinbefore described.

[0121] In these embodiments, it is preferred that at least one BNA scaffold modification is in the terminal monomer, preferably the 5'-terminal monomer, of the first and / or second oligonucleotide of the compound of the invention. Most preferably, both terminal monomers comprise a BNA scaffold. As such, a more preferred embodiment of this aspect provides the first and / or second oligonucleotide of the compound of the invention, in which at least one bicyclic nucleic acid (BNA) scaffold modification is in the terminal monomer of the first and / or second oligonucleotide, preferably the 5'-terminal monomer of the first and / or second oligonucleotide, more preferably the terminal monomer of both the first and / or second oligonucleotide. Other preferred embodiments require that the terminal monomer and each of its adjacent monomers comprise a BNA scaffold. In such cases, the first two monomers and / or the last two monomers of the first and / or second oligonucleotide of the compound of the invention, respectively, comprise a BNA scaffold. This can be combined in some way, for example, such that the first two monomers and the last two monomers, or the first two monomers and the last monomer all comprise a BNA scaffold. When the first and / or second oligonucleotide of the compound of the invention comprises a terminal monomer that comprises a BNA scaffold, the additional monomer with the BNA scaffold is preferably either at the other end or adjacent to the terminal monomer with the BNA scaffold.

[0122] A preferred embodiment of this aspect (i.e., chemical modification of the first and / or second antisense oligonucleotide of the compound) provides a compound of the invention, wherein the first and / or second oligonucleotide of the compound are: - a single BNA scaffold modification at the 5' end monomer, - a single BNA scaffold modification at the 3' end monomer, - two BNA scaffold modifications, one at the 5'-end monomer and the other at the 3'-end monomer; - two BNA scaffold modifications, one of each of the two monomers being closest to the 5' end; - two BNA scaffold modifications, one of each of the two monomers being closest to the 3' end; - 4 BNA scaffold modifications, one of each of two monomers being closest to the 5' end and one of each of two monomers being closest to the 3' end; and optionally there are 1, 2, 3, 4 or 5 further BNA scaffold modifications present, and preferably said first and / or second oligonucleotide of said compound comprises or consists of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or all cytosine bases are 5-methylcytosines in said first and / or second oligonucleotides, and / or all uracil bases are 5-methyluracil bases in said first and / or second oligonucleotides, as described herein above.

[0123] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably the 5'-terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably Alternatively, only the 5'-terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification, and preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of said first and / or second oligonucleotides of the compound of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 197 (first oligonucleotides), or SEQ ID NOs: 198 to 398 (first oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 1529 to 1712, preferably SEQ ID NOs: 1529, 1530, 1531, 1532, or 1533, more preferably SEQ ID NOs: 1529, 1530, 1531, or 1532, even more preferably SEQ ID NO: 1529 or 1530, most preferably SEQ ID NO: 1529 (first oligonucleotide); or any one of SEQ ID NOs: 1713 to 1913, preferably SEQ ID NOs: 1713, 1714, 1715, or 1716, more preferably SEQ ID NO: 1713 or 1714, even more preferably SEQ ID NO: 1713 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 3839 to 4021, preferably SEQ ID NOs: 3839, 3840, 3841, 3842 or 3843, more preferably SEQ ID NOs: 3839, 3840, 3841 or 3842, even more preferably SEQ ID NO: 3839 or 3840, most preferably SEQ ID NO: 3839 (first oligonucleotide), or by any one of SEQ ID NOs: 4022 to 4213, preferably SEQ ID NOs: 4022, 4023, 4024 or 4025, more preferably SEQ ID NO: 4022 or 4023, even more preferably SEQ ID NO: 4022 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 6089 to 6272, preferably SEQ ID NOs: 6089, 6090, 6091, 6092 or 6093, more preferably SEQ ID NOs: 6089, 6090, 6091 or 6092, even more preferably SEQ ID NO: 6089 or 6090, most preferably SEQ ID NO: 6089 (first oligonucleotide), or any one of SEQ ID NOs: 6273 to 6470, preferably SEQ ID NOs: 6273, 6274, 6275 or 6276, more preferably SEQ ID NO: 6273 or 6274, even more preferably SEQ ID NO: 6273 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 8381 to 8563, preferably SEQ ID NOs: 8381, 8382, 8383, 8384 or 8385, more preferably SEQ ID NOs: 8381, 8382, 8383 or 8384, even more preferably SEQ ID NO: 8381 or 8382, most preferably SEQ ID NO: 8381 (first oligonucleotide) or any one of SEQ ID NOs: 8564 to 8753, preferably SEQ ID NOs: 8564, 8565, 8566 or 8567, more preferably SEQ ID NO: 8564 or 8565, even more preferably SEQ ID NO: 8564 (second oligonucleotide).

[0124] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably the 3'-terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably Alternatively, only the 3'-terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification, and preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of the first and / or second oligonucleotides of the compounds of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 197 (first oligonucleotides), or any one of SEQ ID NOs: 198 to 398 (first oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 1914 to 2097, preferably SEQ ID NOs: 1914, 1915, 1916, 1917, or 1918, more preferably SEQ ID NOs: 1914, 1915, 1916, or 1917, even more preferably SEQ ID NO: 1914 or 1915, most preferably SEQ ID NO: 1914 (first oligonucleotide); or any one of SEQ ID NOs: 2098 to 2298, preferably SEQ ID NOs: 2098, 2099, 2100, or 2101, more preferably SEQ ID NO: 2098 or 2099, even more preferably SEQ ID NO: 2098 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 4214 to 4396, preferably SEQ ID NOs: 4214, 4215, 4216, 4217 or 4218, more preferably SEQ ID NOs: 4214, 4215, 4216 or 4217, even more preferably SEQ ID NO: 4214 or 4215, most preferably SEQ ID NO: 4214 (first oligonucleotide), or any one of SEQ ID NOs: 4397 to 4588, preferably SEQ ID NOs: 4397, 4398, 4399 or 4400, more preferably SEQ ID NO: 4397 or 4398, even more preferably SEQ ID NO: 4397 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 6471 to 6654, preferably SEQ ID NOs: 6471, 6472, 6473, 6474 or 6475, more preferably SEQ ID NOs: 6471, 6472, 6473 or 6474, even more preferably SEQ ID NO: 6471 or 6472, most preferably SEQ ID NO: 6471 (first oligonucleotide), or any one of SEQ ID NOs: 6655 to 6852, preferably SEQ ID NOs: 6655, 6656, 6657 or 6658, more preferably SEQ ID NO: 6655 or 6656, even more preferably SEQ ID NO: 6655 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 8754 to 8936, preferably SEQ ID NOs: 8754, 8755, 8756, 8757 or 8758, more preferably SEQ ID NOs: 8754, 8755, 8756 or 8757, even more preferably SEQ ID NO: 8754 or 8755, most preferably SEQ ID NO: 8754 (first oligonucleotide) or any one of SEQ ID NOs: 8937 to 9126, preferably SEQ ID NOs: 8937, 8938, 8939 or 8940, more preferably SEQ ID NO: 8937 or 8938, even more preferably SEQ ID NO: 8937 (second oligonucleotide).

[0125] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably both the 5'-end and the 3'-end monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably Alternatively, both and only the 5'- and 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of said first and / or second oligonucleotides of the compound of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 197 (first oligonucleotides), or any one of SEQ ID NOs: 198 to 398 (second oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 2299 to 2482, preferably SEQ ID NOs: 2299, 2300, 2301, 2302, or 2303, more preferably SEQ ID NOs: 2299, 2300, 2301, or 2302, even more preferably SEQ ID NO: 2299 or 2300, most preferably SEQ ID NO: 2299 (first oligonucleotide); or any one of SEQ ID NOs: 2483 to 2683, preferably SEQ ID NOs: 2483, 2484, 2485, or 2486, more preferably SEQ ID NO: 2483 or 2484, even more preferably SEQ ID NO: 2483 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 4589 to 4771, preferably SEQ ID NOs: 4589, 4590, 4591, 4592 or 4593, more preferably SEQ ID NOs: 4589, 4590, 4591 or 4592, even more preferably SEQ ID NO: 4589 or 4590, most preferably SEQ ID NO: 4589 (first oligonucleotide), or any one of SEQ ID NOs: 4772 to 4963, preferably SEQ ID NOs: 4772, 4773, 4774 or 4775, more preferably SEQ ID NO: 4772 or 4773, even more preferably SEQ ID NO: 4772 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 6853 to 7036, preferably SEQ ID NOs: 6853, 6854, 6855, 6856 or 6857, more preferably SEQ ID NOs: 6853, 6854, 6855 or 6856, even more preferably SEQ ID NO: 6853 or 6854, most preferably SEQ ID NO: 6853 (first oligonucleotide), or any one of SEQ ID NOs: 7037 to 7234, preferably SEQ ID NOs: 7037, 7038, 7039 or 7040, more preferably SEQ ID NO: 7037 or 7038, even more preferably SEQ ID NO: 7037 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 9127 to 9309, preferably SEQ ID NOs: 9127, 9128, 9129, 9130 or 9131, more preferably SEQ ID NOs: 9127, 9128, 9129 or 9130, even more preferably SEQ ID NO: 9127 or 9128, most preferably SEQ ID NO: 9127 (first oligonucleotide) or any one of SEQ ID NOs: 9310 to 9499, preferably SEQ ID NOs: 9310, 9311, 9312 or 9313, more preferably SEQ ID NO: 9310 or 9311, even more preferably SEQ ID NO: 9310 (second oligonucleotide).

[0126] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably both of the two 5'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably Only both of the two 5'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and preferably said first and / or second oligonucleotide comprise or consist of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of said first and / or second oligonucleotides of the compound of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 198 (first oligonucleotides), or any one of SEQ ID NOs: 198 to 398 (second oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 2684 to 2867, preferably SEQ ID NOs: 2684, 2685, 2686, 2687, or 2688, more preferably SEQ ID NOs: 2684, 2685, 2686, or 2687, even more preferably SEQ ID NO: 2684 or 2685, most preferably SEQ ID NO: 2684 (first oligonucleotide); or any one of SEQ ID NOs: 2868 to 3068, preferably SEQ ID NOs: 2868, 2869, 2870, or 2871, more preferably SEQ ID NO: 2868 or 2869, even more preferably SEQ ID NO: 2868 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 4964 to 5146, preferably SEQ ID NOs: 4964, 4965, 4966, 4967 or 4968, more preferably SEQ ID NOs: 4964, 4965, 4966 or 4967, even more preferably SEQ ID NO: 4964 or 4965, most preferably SEQ ID NO: 4964 (first oligonucleotide), or any one of SEQ ID NOs: 5147 to 5338, preferably SEQ ID NOs: 5147, 5148, 5149 or 5150, more preferably SEQ ID NO: 5147 or 5148, even more preferably SEQ ID NO: 5147 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 7235 to 7418, preferably SEQ ID NOs: 7235, 7236, 7237, 7238 or 7239, more preferably SEQ ID NOs: 7235, 7236, 7237 or 7238, even more preferably SEQ ID NO: 7235 or 7236, most preferably SEQ ID NO: 7235 (first oligonucleotide), or any one of SEQ ID NOs: 7419 to 7616, preferably SEQ ID NOs: 7419, 7420, 7421 or 7422, more preferably SEQ ID NO: 7419 or 7420, even more preferably SEQ ID NO: 7419 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 9500 to 9682, preferably SEQ ID NOs: 9500, 9501, 9502, 9503 or 9504, more preferably SEQ ID NOs: 9500, 9501, 9502 or 9503, even more preferably SEQ ID NO: 9500 or 9501, most preferably SEQ ID NO: 9500 (first oligonucleotide) or any one of SEQ ID NOs: 9683 to 9872, preferably SEQ ID NOs: 9683, 9684, 9865 or 9686, more preferably SEQ ID NO: 9683 or 9684, even more preferably SEQ ID NO: 9683 (second oligonucleotide).

[0127] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably both of the two 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably or, alternatively, both but not both of the two 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and, preferably, said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or, in said first and / or second oligonucleotide, all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of said first and / or second oligonucleotides of the compound of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 197 (first oligonucleotides) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 3069 to 3252, preferably 3069, 3070, 3071, 3072 or 3073, more preferably SEQ ID NOs: 3069, 3070, 3071 or 3072, even more preferably SEQ ID NO: 3069 or 3070, most preferably SEQ ID NO: 3069 (first oligonucleotide); or any one of SEQ ID NOs: 3253 to 3453, preferably SEQ ID NOs: 3253, 3254, 3255 or 3256, more preferably SEQ ID NO: 3253 or 3254, even more preferably SEQ ID NO: 3253 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 5339 to 5521, preferably SEQ ID NOs: 5339, 5340, 5341, 5342 or 5343, more preferably SEQ ID NOs: 5339, 5340, 5341 or 5342, even more preferably SEQ ID NO: 5339 or 5340, most preferably SEQ ID NO: 5339 (first oligonucleotide), or by any one of SEQ ID NOs: 5522 to 5713, preferably SEQ ID NOs: 5522, 5523, 5524 or 5525, more preferably SEQ ID NO: 5522 or 5523, even more preferably SEQ ID NO: 5522 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 7617 to 7800, preferably SEQ ID NOs: 7617, 7618, 7619, 7620 or 7621, more preferably SEQ ID NOs: 7617, 7618, 7619 or 7620, even more preferably SEQ ID NO: 7617 or 7618, most preferably SEQ ID NO: 7617 (first oligonucleotide), or any one of SEQ ID NOs: 7801 to 7998, preferably SEQ ID NOs: 7801, 7802, 7803 or 7804, more preferably SEQ ID NO: 7801 or 7802, even more preferably SEQ ID NO: 7801 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 9873 to 10055, preferably SEQ ID NOs: 9873, 9874, 9875, 9876 or 9777, more preferably SEQ ID NOs: 9873, 9874, 9875 or 9876, even more preferably SEQ ID NO: 9873 or 9874, most preferably SEQ ID NO: 9873 (first oligonucleotide) or any one of SEQ ID NOs: 10056 to 10245, preferably SEQ ID NOs: 10056, 10057, 10058 or 10059, more preferably SEQ ID NO: 10056 or 10057, even more preferably SEQ ID NO: 10056 (second oligonucleotide).

[0128] When the first oligonucleotide and / or the second oligonucleotide of the compound of the invention comprises or consists of any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably the majority of the two 5'-terminal monomers and the majority of the two 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and any one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably or, alternatively, the majority of the two 5'-terminal monomers and only the majority of the two 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, and preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked by phosphorothioate backbone linkages, and / or, in said first and / or second oligonucleotide, all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil bases, as defined herein above. Thus, as defined herein above, preferred variants of said first and / or second oligonucleotides of the compound of the present invention, comprising or consisting of any one of SEQ ID NOs: 14 to 197 (first oligonucleotides) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotides), or fragments thereof, are represented by any one of SEQ ID NOs: 3454 to 3637, preferably SEQ ID NOs: 3454, 3455, 3456, 3457 or 3458, more preferably SEQ ID NOs: 3454, 3455, 3456 or 3457, even more preferably SEQ ID NO: 3454 or 3455, most preferably SEQ ID NO: 3454 (first oligonucleotide); or any one of SEQ ID NOs: 3638 to 3838, preferably SEQ ID NOs: 3638, 3639, 3640 or 3641, more preferably SEQ ID NO: 3638 or 3639, even more preferably SEQ ID NO: 3638 (second oligonucleotide). The preferred variant is: - all cytosine bases are 5-methylcytosine and are represented by any one of SEQ ID NOs: 5714 to 5896, preferably SEQ ID NOs: 5714, 5715, 5716, 5717 or 5718, more preferably SEQ ID NOs: 5714, 5715, 5716 or 5717, even more preferably SEQ ID NO: 5714 or 5715, most preferably SEQ ID NO: 5714 (first oligonucleotide), or any one of SEQ ID NOs: 5897 to 6088, preferably SEQ ID NOs: 5897, 5898, 5899 or 5900, more preferably SEQ ID NO: 5897 or 5898, even more preferably SEQ ID NO: 5897 (second oligonucleotide), or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 7999 to 8182, preferably SEQ ID NOs: 7999, 7800, 7801, 7802 or 7803, more preferably SEQ ID NOs: 7999, 7800, 7801 or 7802, even more preferably SEQ ID NO: 7999 or 7800, most preferably SEQ ID NO: 7999 (first oligonucleotide), or any one of SEQ ID NOs: 8183 to 8380, preferably SEQ ID NOs: 8183, 8184, 8185 or 8186, more preferably SEQ ID NO: 8183 or 8184, even more preferably SEQ ID NO: 8183 (second oligonucleotide), or - all cytosine bases are 5-methylcytosines and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 10246 to 10428, preferably SEQ ID NOs: 10246, 10247, 10248, 10249 or 10250, more preferably SEQ ID NOs: 10246, 10247, 10248 or 10249, even more preferably SEQ ID NO: 10246 or 10247, most preferably SEQ ID NO: 10246 (first oligonucleotide) or any one of SEQ ID NOs: 10429 to 10618, preferably SEQ ID NOs: 10429, 10430, 10431 or 10432, more preferably SEQ ID NO: 10429 or 10430, even more preferably SEQ ID NO: 10429 (second oligonucleotide).

[0129] Throughout this application, whenever a SEQ ID NO: contains a T or a U and that monomer contains a BNA scaffold modification, that monomer can optionally be substituted with a U or a T, respectively.

[0130] Throughout this application, BNA scaffold modification can always be used in oligonucleotides (i.e., the first and / or second antisense oligonucleotides present in the compounds of the present invention) unless otherwise stated. However, for ease of reading, this is not always spelled out exactly. Whenever an oligonucleotide (i.e., the first and / or second antisense oligonucleotides present in the compounds of the present invention) is described as comprising or consisting of only a certain type of monomer, and the presence of a BNA scaffold modification is described, this does not mean to exclude the presence of a BNA scaffold modification. For example, an oligonucleotide consisting of only 2'-O-methyl RNA monomers can nevertheless comprise a monomer with a BNA scaffold modification. This is self-evident from the context (e.g., even if an AON consists of only one monomer, it still comprises a BNA scaffold modification).

[0131] The oligonucleotide of the invention, i.e. the first and / or second oligonucleotide of the compound, preferably comprises at least one of either a 5-methylcytosine base or a 5-methyluracil base, preferably all cytosine bases are 5-methylcytosine bases and / or all uracil bases are 5-methyluracil bases, and said oligonucleotide preferably comprises at least one 2'-O-methyl phosphorothioate monomer, more preferably exclusively 2'-O-methyl phosphorothioate monomers, as defined herein above.

[0132] The first and second oligonucleotides of the compound of the invention each comprise a terminal monomer and a non-terminal monomer. In the context of the present application, a terminal monomer of the first and / or second oligonucleotide is defined as a monomer selected from the group consisting of a 5'-terminal monomer and a 3'-terminal monomer of the first and / or second oligonucleotide, as previously described in the present application. Briefly, a non-terminal monomer of the first and / or second oligonucleotide is defined as a monomer contained in the first and / or second oligonucleotide that is not defined as a terminal monomer. In the context of the present invention, the term "terminal monomer" refers to a terminal monomer of the first and / or second oligonucleotide of the compound of the invention, and does not refer to a terminal monomer of the entire compound, unless otherwise specified.

[0133] It will be apparent to one of skill in the art that both terminal and non-terminal monomers of the first oligonucleotide and / or second oligonucleotide of the compounds of the invention may contain BNA scaffold modifications.

[0134] In a preferred embodiment, there is provided a first and / or second oligonucleotide of the compound of the invention, said first and / or second oligonucleotide comprising or consisting of 1, 2, 3, 4, 5, 6, 7, 8 or 9 monomers, preferably 1, 2, 3, 4 or 5 monomers, comprising a bicyclic nucleic acid (BNA) scaffold modification, preferably a bridged nucleic acid scaffold modification, more preferably an LNA modification, preferably said first and / or second oligonucleotide comprising or consisting of 2'-O-substituted RNA monomers linked by phosphorothioate backbone linkages, and / or wherein in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosines and / or all uracil bases are 5-methyluracil (i.e. thymine), as defined herein above.

[0135] In an even more preferred embodiment, there is provided a first and / or second oligonucleotide of the compound of the invention, comprising: (i) the 5' terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification; or (ii) the 3' terminal monomer of said first and / or second oligonucleotide comprises a BNA scaffold modification; or (iii) the 5'-terminal monomer and the 3'-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification; or (iv) the two most 5' terminal monomers of said first and / or second oligonucleotides comprise a BNA scaffold modification; or (v) the majority of the two 3' terminal monomers of said first and / or second oligonucleotides comprise a BNA scaffold modification; or (vi) a majority of the two 5'-terminal monomers and a majority of the two 3'-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification; and the oligonucleotide comprises or consists of 1, 2, 3, 4 or 5 further non-terminal monomers, more preferably 1 or 2 further non-terminal monomers, comprising a BNA scaffold modification, the further non-terminal monomers preferably comprising adenosine, uracil and / or thymine bases; more preferably guanine, cytosine and / or 5-methylcytosine bases. Preferably, the BNA scaffold modification is preferably an LNA modification.

[0136] When the first and / or second oligonucleotide of the compound of the invention comprises or consists of a sequence as set forth in any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), preferably one or two non-terminal monomers comprise a BNA scaffold modification, and optionally one, two, three, four or five further monomers comprise a BNA scaffold modification, more preferably only one or two non-terminal monomers of said oligonucleotide comprise a BNA scaffold modification, preferably said first and / or second oligonucleotide comprises or consists of 2'-O-substituted RNA monomers linked by phosphorothioate backbone bonds, and / or in said first and / or second oligonucleotide all cytosine bases are 5-methylcytosine and / or all uracil bases are 5-methyluracil bases, as defined herein above. Preferably, the non-terminal monomers containing a BNA scaffold modification include an adenosine, uracil, and / or thymine base. More preferably, the non-terminal monomers containing a BNA scaffold modification include a guanine, cytosine, or 5-methylcytosine base.

[0137] Preferred variants of said first and / or second oligonucleotide of the compound comprise or consist of a sequence or a fragment thereof as defined herein above, as set forth in any one of SEQ ID NO: 14, 15, 16 or 17, preferably SEQ ID NO: 14 or 15, more preferably SEQ ID NO: 14 (first oligonucleotide); or any one of SEQ ID NO: 198 or 199, preferably SEQ ID NO: 198 (second oligonucleotide), wherein said non-terminal monomer comprising a BNA scaffold modification comprises a guanine base, a cytosine base or a 5-methylcytosine base. Thus, these preferred variants of the first and / or second oligonucleotide of the compound of the invention are: a) The oligonucleotide comprises only one monomer containing a BNA scaffold modification, the monomer being a non-terminal monomer containing a guanine or cytosine base, and the first and / or second oligonucleotide can be represented by any one of SEQ ID NOs: 10619 to 10625 (derived from SEQ ID NO: 14), 10626 to 10632 (derived from SEQ ID NO: 15), 10633 to 10640 (derived from SEQ ID NO: 16), or 10641 to 10650 (derived from SEQ ID NO: 17), preferably 10619 to 10625 or 10626 to 10632, more preferably 10619 to 10625 (first oligonucleotide), or 10766 to 10773 (derived from SEQ ID NO: 198), or 10774 to 10781 (derived from SEQ ID NO: 199), more preferably 10766 to 10773 (second oligonucleotide), and preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine represented by SEQ ID NO: 10838 to 10844 (derived from SEQ ID NO: 14), 10845 to 10851 (derived from SEQ ID NO: 15), 10852 to 10859 (derived from SEQ ID NO: 16), or 10860 to 10869 (derived from SEQ ID NO: 17), preferably 10838 to 10844, or 10845 to 10851, more preferably 10838 to 10844 (first oligonucleotide); or 10985 to 10992 (derived from SEQ ID NO: 198), or 10993 to 11000 (derived from SEQ ID NO: 199), more preferably 10985 to 10992 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil represented by SEQ ID NO: 11057 to 11063 (derived from SEQ ID NO: 14), 11064 to 11070 (derived from SEQ ID NO: 15), 11071 to 11078 (derived from SEQ ID NO: 16), or 11079 to 11088 (derived from SEQ ID NO: 17), preferably 11057 to 11063, or 11064 to 11070, more preferably 11057 to 11063 (first oligonucleotide); or 11204 to 11211 (derived from SEQ ID NO: 198), or 11212 to 11219 (derived from SEQ ID NO: 199), more preferably 11204 to 11211 (second oligonucleotide); or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 11276 to 11282 (derived from SEQ ID NO: 14), 11283 to 11289 (derived from SEQ ID NO: 15), 11290 to 11297 (derived from SEQ ID NO: 16), or 11298 to 11307 (derived from SEQ ID NO: 17), preferably 11276 to 11282, or 11283 to 11289, more preferably 11276 to 11282 (first oligonucleotide); or 11423 to 11430 (derived from SEQ ID NO: 198) or 11431 to 11438 (derived from SEQ ID NO: 199), more preferably 11423 to 11430 (second oligonucleotide); or b) comprising only two monomers containing a BNA scaffold modification, the monomers being non-terminal monomers containing a guanine or cytosine base, the first and / or second oligonucleotides being represented by any one of SEQ ID NOs: 10651 to 10671 (derived from SEQ ID NO: 14), 10672 to 10692 (derived from SEQ ID NO: 15), 10693 to 10720 (derived from SEQ ID NO: 16), or 10721 to 10765 (derived from SEQ ID NO: 17), preferably 10651 to 10671, or 10672 to 10692, more preferably 10651 to 10671 (first oligonucleotide), or 10782 to 10809 (derived from SEQ ID NO: 198), or 10810 to 10837 (derived from SEQ ID NO: 199), more preferably 10782 to 10809 (second oligonucleotide), and preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine represented by SEQ ID NO: 10870 to 10890 (derived from SEQ ID NO: 14), 10891 to 10911 (derived from SEQ ID NO: 15), 10912 to 10939 (derived from SEQ ID NO: 16), or 10940 to 10984 (derived from SEQ ID NO: 17), preferably 10870 to 10890, or 10891 to 10911, more preferably 10870 to 10890 (first oligonucleotide); or 11001 to 11028 (derived from SEQ ID NO: 198), or 11029 to 11056 (derived from SEQ ID NO: 199), more preferably 11001 to 11028 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil represented by SEQ ID NO: 11089 to 11190 (derived from SEQ ID NO: 14), 11110 to 11130 (derived from SEQ ID NO: 15), 11131 to 11158 (derived from SEQ ID NO: 16), or 11159 to 11203 (derived from SEQ ID NO: 17), preferably 11089 to 11109, or 11110 to 11130, more preferably 11089 to 11109 (first oligonucleotide); or 11220 to 11247 (derived from SEQ ID NO: 198), or 11248 to 11275 (derived from SEQ ID NO: 199), more preferably 11220 to 11247 (second oligonucleotide), or iii. All cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine, and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil represented by SEQ ID NO: 11308 to 11328 (derived from SEQ ID NO: 14), 11329 to 11349 (derived from SEQ ID NO: 15), 11350 to 11377 (derived from SEQ ID NO: 16), or 11378 to 11422 (derived from SEQ ID NO: 17), preferably 11308 to 11328, or 11329 to 11349, more preferably 11308 to 11328 (first oligonucleotide); or 11439 to 11466 (derived from SEQ ID NO: 198), or 11467 to 11494 (derived from SEQ ID NO: 199), more preferably 11439 to 11466 (second oligonucleotide).

[0138] When the first oligonucleotide and / or the second oligonucleotide of the compound of the present invention comprises or consists of a sequence represented by any one of SEQ ID NOs: 14 to 197 (first oligonucleotide) or any one of SEQ ID NOs: 198 to 398 (second oligonucleotide), the 5'-terminal monomer and / or the 3'-terminal monomer and / or the majority of the two 5'-terminal monomers and / or the majority of the two 3'-terminal monomers are BNA scaffold modified, preferably one or two non-terminal monomers are BNA scaffold modified, and optionally one , 2, 3, 4 or 5 further non-terminal monomers comprise a BNA scaffold modification, more preferably only one or two non-terminal monomers of said first and / or second oligonucleotide comprise a BNA scaffold modification, preferably said oligonucleotides comprise or consist of 2'-O-substituted RNA monomers linked with phosphorothioate backbone linkages, and / or all cytosine bases are 5-methylcytosine and / or all uracil bases are 5-methyluracil bases in said first and / or second oligonucleotide. Preferably, said non-terminal monomers comprising a BNA scaffold modification comprise an adenosine base, a uracil base or a thymine base. More preferably, said non-terminal monomers comprising a BNA scaffold modification comprise a guanine base, a cytosine base or a 5-methylcytosine base.

[0139] Preferred variants of said first and / or second oligonucleotide of the compound comprise or consist of a sequence as defined herein above as set forth in any one of SEQ ID NO: 14, 15, 16 or 17, preferably SEQ ID NO: 14 or 15, more preferably SEQ ID NO: 14 (first oligonucleotide) or any one of SEQ ID NO: 198 or 199, preferably SEQ ID NO: 198 (second oligonucleotide), or a fragment thereof, and preferably said non-terminal monomers comprising a BNA scaffold modification comprise an adenosine, uracil or thymine base, more preferably said non-terminal monomers comprising a BNA scaffold modification comprise a guanine, cytosine or 5-methylcytosine base. The most preferred variant of said first and / or second oligonucleotide of the compound is an oligonucleotide comprising a sequence comprising or consisting of any one of SEQ ID NO: 14, 15, 16 or 17, preferably SEQ ID NO: 14 or 15, more preferably SEQ ID NO: 14 (first oligonucleotide) or any one of SEQ ID NO: 198 or 199, preferably SEQ ID NO: 198 (second oligonucleotide), or a fragment thereof, wherein said non-terminal monomer comprising a BNA scaffold modification comprises a guanine base, a cytosine base or a 5-methylcytosine base, and a) The 5'-terminal monomer and one non-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 11495 to 11500 (derived from SEQ ID NO: 14), 11501 to 11507 (derived from SEQ ID NO: 15), 11508 to 11514 (derived from SEQ ID NO: 16), or 11515 to 11524 (derived from SEQ ID NO: 17), preferably 11495 to 11500, or 11501 to 11507, preferably 11495 to 11500 (first oligonucleotide); or 11627 to 11633 (derived from SEQ ID NO: 198), or 11634 to 11640 (derived from SEQ ID NO: 199), more preferably 11627 to 11633 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 11683 to 11688 (derived from SEQ ID NO: 14), 11689 to 11695 (derived from SEQ ID NO: 15), 11696 to 11702 (derived from SEQ ID NO: 16), or 11703 to 11712 (derived from SEQ ID NO: 17), preferably 11683 to 11688, or 11689 to 11695, more preferably 11683 to 11688 (first oligonucleotide); or 11815 to 11821 (derived from SEQ ID NO: 198), or 11822 to 11828 (derived from SEQ ID NO: 199), more preferably 11815 to 11821 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 11871 to 11876 (derived from SEQ ID NO: 14), 11877 to 11883 (derived from SEQ ID NO: 15), 11884 to 11890 (derived from SEQ ID NO: 16), or 11891 to 11900 (derived from SEQ ID NO: 17), preferably 11871 to 11876, or 11877 to 11883, more preferably 11871 to 11876 (first oligonucleotide); or 12003 to 12009 (derived from SEQ ID NO: 198), or 12010 to 12016 (derived from SEQ ID NO: 199), more preferably 12003 to 12009 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 12059 to 12064 (derived from SEQ ID NO: 14), 12065 to 12071 (derived from SEQ ID NO: 15), 12072 to 12078 (derived from SEQ ID NO: 16), or 12079 to 12088 (derived from SEQ ID NO: 17), preferably 12059 to 12064, or 12065 to 12071, more preferably 12059 to 12064 (first oligonucleotide); or 12191 to 12197 (derived from SEQ ID NO: 198), or 12198 to 12204 (derived from SEQ ID NO: 199), more preferably 12191 to 12197 (second oligonucleotide); or b) the 5'-terminal monomer and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 11525 to 11539 (derived from SEQ ID NO: 14), 11540 to 11560 (derived from SEQ ID NO: 15), 11561 to 11581 (derived from SEQ ID NO: 16), or 11582 to 11626 (derived from SEQ ID NO: 17), preferably 11525 to 11539 or 11540 to 11560, more preferably 11525 to 11539 (first oligonucleotide); or 11641 to 11661 (derived from SEQ ID NO: 198), or 11662 to 11682 (derived from SEQ ID NO: 199), more preferably 11641 to 11661 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 11713 to 11727 (derived from SEQ ID NO: 14), 11728 to 11748 (derived from SEQ ID NO: 15), 11749 to 11769 (derived from SEQ ID NO: 16), or 11770 to 11814 (derived from SEQ ID NO: 17), preferably 11713 to 11727, or 11728 to 11748, more preferably 11713 to 11727 (first oligonucleotide); or 11829 to 11849 (derived from SEQ ID NO: 198), or 11850 to 11870 (derived from SEQ ID NO: 199), more preferably 11829 to 11849 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 11901 to 11915 (derived from SEQ ID NO: 14), 11916 to 11936 (derived from SEQ ID NO: 15), 11937 to 11957 (derived from SEQ ID NO: 16), or 11958 to 12002 (derived from SEQ ID NO: 17), preferably 11901 to 11915, or 11916 to 11936, more preferably 11901 to 11915 (first oligonucleotide); or 12017 to 12037 (derived from SEQ ID NO: 198), or 12038 to 12058 (derived from SEQ ID NO: 199), more preferably 12017 to 12037 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NOs: 12089 to 12103 (derived from SEQ ID NO: 14), 12104 to 12124 (derived from SEQ ID NO: 15), 12125 to 12145 (derived from SEQ ID NO: 16), or 12146 to 12190 (derived from SEQ ID NO: 17), preferably 12089 to 12103, or 12104 to 12124, more preferably 12089 to 12103 (first oligonucleotide); or 12205 to 12225 (derived from SEQ ID NO: 198), or 12226 to 12246 (derived from SEQ ID NO: 199), more preferably 12205 to 12225 (second oligonucleotide); or c) The 3'-terminal monomer and one non-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 12247 to 12252 (derived from SEQ ID NO: 14), 12253 to 12258 (derived from SEQ ID NO: 15), 12259 to 12265 (derived from SEQ ID NO: 16), or 12266 to 12274 (derived from SEQ ID NO: 17), preferably 12247 to 12252 or 12253 to 12258, more preferably 12247 to 12252 (first oligonucleotide); or 12362 to 12368 (derived from SEQ ID NO: 198), or 12369 to 12376 (derived from SEQ ID NO: 199), more preferably 12362 to 12368 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 12426 to 12431 (derived from SEQ ID NO: 14), 12432 to 12437 (derived from SEQ ID NO: 15), 12438 to 12444 (derived from SEQ ID NO: 16), or 12445 to 12453 (derived from SEQ ID NO: 17), preferably 12426 to 12431, or 12432 to 12437, more preferably 12426 to 12431 (first oligonucleotide); or 12541 to 12547 (derived from SEQ ID NO: 198), or 12548 to 12555 (derived from SEQ ID NO: 199), more preferably 12541 to 12547 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NOs: 12605 to 12610 (derived from SEQ ID NO: 14), 12611 to 12616 (derived from SEQ ID NO: 15), 12617 to 12623 (derived from SEQ ID NO: 16), or 12624 to 12632 (derived from SEQ ID NO: 17), preferably 12605 to 12610, or 12611 to 12616, more preferably 12605 to 12610 (first oligonucleotide); or 12720 to 12726 (derived from SEQ ID NO: 198), or 12727 to 12734 (derived from SEQ ID NO: 199), more preferably 12720 to 12726 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 12784 to 12789 (SEQ ID NO: 14), 12790 to 12795 (derived from SEQ ID NO: 15), 12796 to 12802 (derived from SEQ ID NO: 16), or 12803 to 12811 (derived from SEQ ID NO: 17), preferably 12784 to 12789 or 12790 to 12795, more preferably 12784 to 12789 (first oligonucleotide); or 12899 to 12905 (derived from SEQ ID NO: 198), or 12906 to 12913 (derived from SEQ ID NO: 199), more preferably 12899 to 12905 (second oligonucleotide); or d) The 3'-terminal monomer and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 12275 to 12289 (derived from SEQ ID NO: 14), 12290 to 12304 (derived from SEQ ID NO: 15), 12305 to 12325 (derived from SEQ ID NO: 16), or 12326 to 12361 (derived from SEQ ID NO: 17), preferably 12275 to 12289 or 12290 to 12304, more preferably 12275 to 12289 (first oligonucleotide); or 12377 to 12397 (derived from SEQ ID NO: 198), or 12398 to 12425 (derived from SEQ ID NO: 199), more preferably 12377 to 12397 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 12454 to 12468 (derived from SEQ ID NO: 14), 12469 to 12483 (derived from SEQ ID NO: 15), 12484 to 12504 (derived from SEQ ID NO: 16), or 12505 to 12540 (derived from SEQ ID NO: 17), preferably 12454 to 12468, or 12469 to 12483, more preferably 12454 to 12468 (first oligonucleotide); or 12556 to 12576 (derived from SEQ ID NO: 198), or 12577 to 12604 (derived from SEQ ID NO: 199), more preferably 12556 to 12576 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 12633 to 12647 (derived from SEQ ID NO: 14), 12648 to 12662 (derived from SEQ ID NO: 15), 12663 to 12683 (derived from SEQ ID NO: 16), or 12684 to 12719 (derived from SEQ ID NO: 17), preferably 12633 to 12647, or 12648 to 12662, more preferably 12633 to 12647 (first oligonucleotide); or 12735 to 12755 (derived from SEQ ID NO: 198), or 12756 to 12783 (derived from SEQ ID NO: 199), more preferably 12735 to 12755 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 12812 to 12826 (derived from SEQ ID NO: 14), 12827 to 12841 (derived from SEQ ID NO: 15), 12842 to 12862 (derived from SEQ ID NO: 16), or 12863 to 12898 (derived from SEQ ID NO: 17), preferably 12812 to 12826, or 12827 to 12841, more preferably 12812 to 12826 (first oligonucleotide); or 12914 to 12934 (derived from SEQ ID NO: 198), or 12935 to 12962 (derived from SEQ ID NO: 199), more preferably 12914 to 12934 (second oligonucleotide); or e) The 5'-terminal monomer, the 3'-terminal monomer, and one non-terminal monomer of the first and / or second oligonucleotide contain a BNA scaffold modification and are represented by any one of SEQ ID NOs: 12963 to 12969 (derived from SEQ ID NO: 14), 12970 to 12976 (derived from SEQ ID NO: 15), 12977 to 12984 (derived from SEQ ID NO: 16), or 12985 to 12994 (derived from SEQ ID NO: 17), preferably 12963 to 12969 or 12970 to 12976, more preferably 12963 to 12969 (first oligonucleotide); or 13110 to 13117 (derived from SEQ ID NO: 198), or 13118 to 13125 (derived from SEQ ID NO: 199), more preferably 13110 to 13117 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 13182 to 13188 (derived from SEQ ID NO: 14), 13189 to 13195 (derived from SEQ ID NO: 15), 13196 to 13203 (derived from SEQ ID NO: 16), or 13204 to 13213 (derived from SEQ ID NO: 17), preferably 13182 to 13188, or 13189 to 13195, more preferably 13182 to 13188 (first oligonucleotide); or 13329 to 13336 (derived from SEQ ID NO: 198), or 13337 to 13344 (derived from SEQ ID NO: 199), more preferably 13329 to 13336 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 13401 to 13407 (derived from SEQ ID NO: 14), 13408 to 13414 (derived from SEQ ID NO: 15), 13415 to 13422 (derived from SEQ ID NO: 16), or 13423 to 13432 (derived from SEQ ID NO: 17), preferably 13401 to 13407, or 13408 to 13414, more preferably 13401 to 13407 (first oligonucleotide); or 13548 to 13555 (derived from SEQ ID NO: 198), or 13556 to 13563 (derived from SEQ ID NO: 199), more preferably 13548 to 13555 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 13620 to 13626 (SEQ ID NO: 14), 13627 to 13633 (derived from SEQ ID NO: 15), 13634 to 13641 (derived from SEQ ID NO: 16), or 13642 to 13651 (derived from SEQ ID NO: 17), preferably 13620 to 13626, or 13627 to 13633, more preferably 13620 to 13626 (first oligonucleotide); or 13767 to 13774 (derived from SEQ ID NO: 198), or 13775 to 13782 (derived from SEQ ID NO: 199), more preferably 13767 to 13774 (second oligonucleotide); or f) The 5'-terminal monomer, the 3'-terminal monomer, and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 12995 to 13015 (derived from SEQ ID NO: 14), 13016 to 13036 (derived from SEQ ID NO: 15), 13037 to 13064 (derived from SEQ ID NO: 16), or 13065 to 13109 (derived from SEQ ID NO: 17), preferably 12995 to 13015 or 13016 to 13036, more preferably 12995 to 13015 (first oligonucleotide); or 13126 to 13153 (derived from SEQ ID NO: 198), or 13154 to 13181 (derived from SEQ ID NO: 199), more preferably 13126 to 13153 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 13214 to 13234 (derived from SEQ ID NO: 14), 13235 to 13255 (derived from SEQ ID NO: 15), 13256 to 13283 (derived from SEQ ID NO: 16), or 13284 to 13328 (derived from SEQ ID NO: 17), preferably 13214 to 13234 or 13235 to 13255, more preferably 13214 to 13234 (first oligonucleotide); or 13345 to 13372 (derived from SEQ ID NO: 198), or 13373 to 13400 (derived from SEQ ID NO: 199), more preferably 13345 to 13372 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 13433 to 13453 (derived from SEQ ID NO: 14), 13454 to 13474 (derived from SEQ ID NO: 15), 13475 to 13502 (derived from SEQ ID NO: 16), or 13503 to 13547 (derived from SEQ ID NO: 17), preferably 13433 to 13453, or 13454 to 13474, more preferably 13433 to 13453 (first oligonucleotide); or 13564 to 13591 (derived from SEQ ID NO: 198), or 13592 to 13619 (derived from SEQ ID NO: 199), more preferably 13564 to 13591 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 13652 to 13672 (derived from SEQ ID NO: 14), 13673 to 13693 (derived from SEQ ID NO: 15), 13694 to 13721 (derived from SEQ ID NO: 16), or 13722 to 13766 (derived from SEQ ID NO: 17), preferably 13652 to 13672, or 13673 to 13693, more preferably 13652 to 13672 (first oligonucleotide); or 13783 to 13810 (derived from SEQ ID NO: 198), or 13811 to 13838 (derived from SEQ ID NO: 199), more preferably 13783 to 13810 (second oligonucleotide); or g) the two 5'-terminal monomers and one non-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 13839 to 13844 (derived from SEQ ID NO: 14), 13845 to 13851 (derived from SEQ ID NO: 15), 13852 to 13858 (derived from SEQ ID NO: 16), or 13859 to 13868 (derived from SEQ ID NO: 17), preferably 13839 to 13844 or 13845 to 13851, more preferably 13839 to 13844 (first oligonucleotide), or 13971 to 13977 (derived from SEQ ID NO: 198), or 13978 to 13984 (derived from SEQ ID NO: 199), more preferably 13971 to 13977 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 14027 to 14032 (derived from SEQ ID NO: 14), 14033 to 14039 (derived from SEQ ID NO: 15), 14040 to 14046 (derived from SEQ ID NO: 16), or 14047 to 14056 (derived from SEQ ID NO: 17), preferably 14027 to 14032, or 14033 to 14039, more preferably 14027 to 14032 (first oligonucleotide), or 14159 to 14165 (derived from SEQ ID NO: 198), or 14166 to 14172 (derived from SEQ ID NO: 199), more preferably 14159 to 14165 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 14215 to 14220 (derived from SEQ ID NO: 14), 14221 to 14227 (derived from SEQ ID NO: 15), 14228 to 14234 (derived from SEQ ID NO: 16), or 14235 to 14244 (derived from SEQ ID NO: 17), preferably 14215 to 14220, or 14221 to 14227, more preferably 14215 to 14220 (first oligonucleotide), or 14347 to 14353 (derived from SEQ ID NO: 198), or 14354 to 14360 (derived from SEQ ID NO: 199), more preferably 14347 to 14353 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NOs: 14403 to 14408 (derived from SEQ ID NO: 14), 14409 to 14415 (derived from SEQ ID NO: 15), 14416 to 14422 (derived from SEQ ID NO: 16), or 14423 to 14432 (derived from SEQ ID NO: 17), preferably 14403 to 14408, or 14409 to 14415, more preferably 14403 to 14408 (first oligonucleotide), or 14535 to 14541 (derived from SEQ ID NO: 198), or 14542 to 14548 (derived from SEQ ID NO: 199), more preferably 14535 to 14541 (second oligonucleotide); or h) the majority of the two 5'-terminal monomers and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 13869 to 13883 (derived from SEQ ID NO: 14), 13884 to 13904 (derived from SEQ ID NO: 15), 13905 to 13925 (derived from SEQ ID NO: 16), or 13926 to 13970 (derived from SEQ ID NO: 17), preferably 13869 to 13883 or 13884 to 13904, more preferably 13869 to 13883 (first oligonucleotide); or 13985 to 14005 (derived from SEQ ID NO: 198), or 14006 to 14026 (derived from SEQ ID NO: 199), more preferably 13985 to 14005 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 14057 to 14071 (derived from SEQ ID NO: 14), 14072 to 14092 (derived from SEQ ID NO: 15), 14093 to 14113 (derived from SEQ ID NO: 16), or 14114 to 14158 (derived from SEQ ID NO: 17), preferably 14057 to 14071, or 14072 to 14092, more preferably 14057 to 14071 (first oligonucleotide); or 14173 to 14193 (derived from SEQ ID NO: 198), or 14194 to 14214 (derived from SEQ ID NO: 199), more preferably 14173 to 14193 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 14245 to 14259 (derived from SEQ ID NO: 14), 14260 to 14280 (derived from SEQ ID NO: 15), 14281 to 14301 (derived from SEQ ID NO: 16), or 14302 to 14346 (derived from SEQ ID NO: 17), preferably 14245 to 14259, or 14260 to 14280, more preferably 14245 to 14259 (first oligonucleotide); or 14361 to 14381 (derived from SEQ ID NO: 198), or 14382 to 14402 (derived from SEQ ID NO: 199), more preferably 14361 to 14381 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 14433 to 14477 (derived from SEQ ID NO: 14), 14448 to 14468 (derived from SEQ ID NO: 15), 14469 to 14489 (derived from SEQ ID NO: 16), or 14490 to 14534 (derived from SEQ ID NO: 17), preferably 14433 to 14447, or 14448 to 14468, more preferably 14433 to 14447 (first oligonucleotide); or 14549 to 14569 (derived from SEQ ID NO: 198), or 14570 to 14590 (derived from SEQ ID NO: 199), more preferably 14549 to 14569 (second oligonucleotide); or i) the majority of the two 3'-terminal monomers and one non-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 14591 to 14596 (derived from SEQ ID NO: 14), 14597 to 14602 (derived from SEQ ID NO: 15), 14603 to 14609 (derived from SEQ ID NO: 16), or 14610 to 14618 (derived from SEQ ID NO: 17), preferably 14591 to 14596 or 14597 to 14602, more preferably 14591 to 14596 (first oligonucleotide); or 14706 to 14712 (derived from SEQ ID NO: 198), or 14713 to 14720 (derived from SEQ ID NO: 199), more preferably 14706 to 14712 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 14770 to 14775 (derived from SEQ ID NO: 14), 14776 to 14781 (derived from SEQ ID NO: 15), 14782 to 14788 (derived from SEQ ID NO: 16), or 14789 to 14797 (derived from SEQ ID NO: 17), preferably 14770 to 14775, or 14776 to 14781, more preferably 14770 to 14775 (first oligonucleotide); or 14885 to 14891 (derived from SEQ ID NO: 198), or 14892 to 14899 (derived from SEQ ID NO: 199), more preferably 14885 to 14891 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 14949 to 14954 (derived from SEQ ID NO: 14), 14955 to 14960 (derived from SEQ ID NO: 15), 14961 to 14967 (derived from SEQ ID NO: 16), or 14968 to 14976 (derived from SEQ ID NO: 17), preferably 14949 to 14954 or 14955 to 14960, more preferably 14949 to 14954 (first oligonucleotide); or 15064 to 15070 (derived from SEQ ID NO: 198), or 15071 to 15078 (derived from SEQ ID NO: 199), more preferably 15064 to 15070 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NOs: 15128 to 15133 (derived from SEQ ID NO: 14), 15134 to 15139 (derived from SEQ ID NO: 15), 15140 to 15146 (derived from SEQ ID NO: 16), or 15147 to 15155 (derived from SEQ ID NO: 17), preferably 15128 to 15133, or 15134 to 15139, more preferably 15128 to 15133 (first oligonucleotide); or 15243 to 15249 (derived from SEQ ID NO: 198), or 15250 to 15257 (derived from SEQ ID NO: 199), more preferably 15243 to 15249 (second oligonucleotide); or j) the majority of the two 3'-terminal monomers and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 14619 to 14633 (derived from SEQ ID NO: 14), 14634 to 14648 (derived from SEQ ID NO: 15), 14649 to 14669 (derived from SEQ ID NO: 16), or 14670 to 14705 (derived from SEQ ID NO: 17), preferably 14619 to 14633 or 14634 to 14648, more preferably 14619 to 14633 (first oligonucleotide); or 14721 to 14741 (derived from SEQ ID NO: 198), or 14742 to 14769 (derived from SEQ ID NO: 199), more preferably 14721 to 14741 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 14798 to 14812 (derived from SEQ ID NO: 14), 14813 to 14827 (derived from SEQ ID NO: 15), 14828 to 14848 (derived from SEQ ID NO: 16), or 14849 to 14884 (derived from SEQ ID NO: 17), preferably 14798 to 14812, or 14813 to 14827, more preferably 14798 to 14812 (first oligonucleotide); or 14900 to 14920 (derived from SEQ ID NO: 198), or 14921 to 14948 (derived from SEQ ID NO: 199), more preferably 14900 to 14920 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 14977 to 14991 (derived from SEQ ID NO: 14), 14992 to 15006 (derived from SEQ ID NO: 15), 15007 to 15027 (derived from SEQ ID NO: 16), or 15028 to 15063 (derived from SEQ ID NO: 17), preferably 14977 to 14991, or 14992 to 15006, more preferably 14977 to 14991 (first oligonucleotide); or 15079 to 15099 (derived from SEQ ID NO: 198), or 15100 to 15127 (derived from SEQ ID NO: 199), more preferably 15079 to 15099 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 15156 to 15170 (derived from SEQ ID NO: 14), 15171 to 15185 (derived from SEQ ID NO: 15), 15186 to 15206 (derived from SEQ ID NO: 16), or 15207 to 15242 (derived from SEQ ID NO: 17), preferably 15156 to 15170, or 15171 to 15185, more preferably 15156 to 15170 (first oligonucleotide); or 15258 to 15278 (derived from SEQ ID NO: 198), or 15279 to 15306 (derived from SEQ ID NO: 199), more preferably 15258 to 15278 (second oligonucleotide); or k) the majority of the two 5'-terminal monomers, the majority of the two 3'-terminal monomers, and one non-terminal monomer of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 15307 to 15311 (derived from SEQ ID NO: 14), 15312 to 15317 (derived from SEQ ID NO: 15), 15318 to 15323 (derived from SEQ ID NO: 16), or 15324 to 15332 (derived from SEQ ID NO: 17), preferably 15307 to 15311, or 15312 to 15317, more preferably 15307 to 15311 (first oligonucleotide); or 15409 to 15414 (derived from SEQ ID NO: 198), or 15415 to 15421 (derived from SEQ ID NO: 199), more preferably 15409 to 15414 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 15458 to 15462 (derived from SEQ ID NO: 14), 15463 to 15468 (derived from SEQ ID NO: 15), 15469 to 15474 (derived from SEQ ID NO: 16), or 15475 to 15483 (derived from SEQ ID NO: 17), preferably 15458 to 15462, or 15463 to 15468, more preferably 15458 to 15462 (first oligonucleotide); or 15560 to 15565 (derived from SEQ ID NO: 198), or 15566 to 15572 (derived from SEQ ID NO: 199), more preferably 15560 to 15565 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 15609 to 15613 (derived from SEQ ID NO: 14), 15614 to 15619 (derived from SEQ ID NO: 15), 15620 to 15625 (derived from SEQ ID NO: 16), or 15626 to 15634 (derived from SEQ ID NO: 17), preferably 15609 to 15613, or 15614 to 15619, more preferably 15609 to 15613 (first oligonucleotide); or 15711 to 15716 (derived from SEQ ID NO: 198), or 15717 to 15723 (derived from SEQ ID NO: 199), more preferably 15711 to 15716 (second oligonucleotide), or iii. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 15760 to 15764 (derived from SEQ ID NO: 14), 15765 to 15770 (derived from SEQ ID NO: 15), 15771 to 15776 (derived from SEQ ID NO: 16), or 15777 to 15785 (derived from SEQ ID NO: 17), preferably 15760 to 15764, or 15765 to 15770, more preferably 15760 to 15764 (first oligonucleotide); or 15862 to 15867 (derived from SEQ ID NO: 198), or 15868 to 15874 (derived from SEQ ID NO: 199), more preferably 15862 to 15867 (second oligonucleotide); or l) the majority of the two 5'-terminal monomers, the majority of the two 3'-terminal monomers, and the two non-terminal monomers of the first and / or second oligonucleotide comprise a BNA scaffold modification and are represented by any one of SEQ ID NOs: 15333 to 15342 (derived from SEQ ID NO: 14), 15343 to 15357 (derived from SEQ ID NO: 15), 15358 to 15372 (derived from SEQ ID NO: 16), or 15373 to 15408 (derived from SEQ ID NO: 17), preferably 15333 to 15342 or 15343 to 15357, more preferably 15333 to 15342 (first oligonucleotide); or 15422 to 15436 (derived from SEQ ID NO: 198), or 15437 to 15457 (derived from SEQ ID NO: 199), more preferably 15422 to 15436 (second oligonucleotide), preferably i. all cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine and are represented by SEQ ID NO: 15484 to 15493 (derived from SEQ ID NO: 14), 15494 to 15508 (derived from SEQ ID NO: 15), 15509 to 15523 (derived from SEQ ID NO: 16), or 15524 to 15559 (derived from SEQ ID NO: 17), preferably 15484 to 15493, or 15494 to 15508, more preferably 15484 to 15493 (first oligonucleotide); or 15573 to 15587 (derived from SEQ ID NO: 198), or 15588 to 15608 (derived from SEQ ID NO: 199), more preferably 15573 to 15587 (second oligonucleotide), or ii. all uracil bases of the first and / or second oligonucleotide are 5-methyluracil and are represented by SEQ ID NO: 15635 to 15644 (derived from SEQ ID NO: 14), 15645 to 15659 (derived from SEQ ID NO: 15), 15660 to 15674 (derived from SEQ ID NO: 16), or 15675 to 15710 (derived from SEQ ID NO: 17), preferably 15635 to 15644 or 15645 to 15659, more preferably 15635 to 15644 (first oligonucleotide); or 15724 to 15738 (derived from SEQ ID NO: 198), or 15739 to 15759 (derived from SEQ ID NO: 199), more preferably 15724 to 15738 (second oligonucleotide), or iii. All cytosine bases of the first and / or second oligonucleotide are 5-methylcytosine, and all uracil bases of the first and / or second oligonucleotide are 5-methyluracil, and are represented by SEQ ID NO: 15786 to 15795 (derived from SEQ ID NO: 14), 15796 to 15810 (derived from SEQ ID NO: 15), 15811 to 15825 (derived from SEQ ID NO: 16), or 15826 to 15861 (derived from SEQ ID NO: 17), preferably 15786 to 15795, or 15796 to 15810, more preferably 15786 to 15795 (first oligonucleotide); or 15875 to 15889 (derived from SEQ ID NO: 198), or 15890 to 15910 (derived from SEQ ID NO: 199), more preferably 15875 to 15889 (second oligonucleotide).

[0140] In an even more preferred embodiment, when said first oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of the sequence represented by SEQ ID NO: 14, 15, 16, 17 or 18, or a fragment thereof, as defined herein above, one or more monomers of said nucleotide sequence comprise a BNA scaffold modification, a bridged nucleic acid scaffold modification, more preferably an LNA modification, as follows (see Tables 1 and 2): (i) Represented by SEQ ID NO: 14: Any one of SEQ ID NOs: 15911 to 15922, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 15977 to 15988; or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16043 to 16054; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 16109 to 16120; or - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 15977 to 15988; (ii) Represented by SEQ ID NO: 15: SEQ ID NO: 15923 or 15924, preferably: - all cytosine bases are 5-methylcytosine and are represented by SEQ ID NO: 15989 or 15990, or - all uracil bases are 5-methyluracil and are represented by SEQ ID NO: 16055 or 16056, or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 16121 or 16122; or - more preferably, all cytosine bases are 5-methylated and are represented by SEQ ID NO: 15989 or 15990; (iii) Represented by SEQ ID NO: 16: Any one of SEQ ID NOs: 15925 to 15934, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 15991 to 16000; or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16057 to 16066; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, and are represented by any one of SEQ ID NOs: 16123 to 16132; or - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 15991 to 16000; (iv) Represented by SEQ ID NO: 17: Any one of SEQ ID NOs: 15935 to 15945, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 16001 to 16011, or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16067 to 16077; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, represented by any one of SEQ ID NOs: 16133 to 16143; - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 16001 to 16011; (v) Represented by SEQ ID NO: 18: SEQ ID NO: 15946 or 15947, preferably: - all cytosine bases are 5-methylcytosine and are represented by SEQ ID NO: 16012 or 16013, or - all uracil bases are 5-methyluracil and are represented by SEQ ID NO: 16078 or 16079, or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, as represented by SEQ ID NO: 16144 or 16145; - more preferably, all cytosine bases are 5-methylated and are represented by SEQ ID NO: 16012 or 16013; And / or when said second oligonucleotide of the compound of the invention is represented by a nucleotide sequence comprising or consisting of the sequence represented by SEQ ID NO: 198, 199, 200 or 201, or a fragment thereof, as hereinbefore defined, one or more monomers of said nucleotide sequence comprise a BNA scaffold modification, a bridged nucleic acid scaffold modification, more preferably an LNA modification, as follows: (i) Represented by SEQ ID NO: 198: Any one of SEQ ID NOs: 15948 to 15962, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 16014 to 16028, or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16080 to 16094; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, represented by any one of SEQ ID NOs: 16146 to 16160; - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 16014 to 16028; (ii) Represented by SEQ ID NO: 199: Any one of SEQ ID NOs: 15963 to 15972, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 16029 to 16038, or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16095 to 16104; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, represented by any one of SEQ ID NOs: 16161 to 16170; - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 16029 to 16038; (iii) Represented by SEQ ID NO: 200: Any one of SEQ ID NOs: 15973 to 15975, preferably: - all cytosine bases are 5-methylcytosine and are represented by any of SEQ ID NOs: 16039 to 16041, or - all uracil bases are 5-methyluracil and are represented by any one of SEQ ID NOs: 16105 to 16107; or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, represented by any one of SEQ ID NOs: 16171 to 16173; - more preferably, all cytosine bases are 5-methylated and are represented by any one of SEQ ID NOs: 16039 to 16041; (iv) Represented by SEQ ID NO: 201: SEQ ID NO: 15976, preferably: - all cytosine bases are 5-methylcytosine and are represented by SEQ ID NO: 16042, or - all uracil bases are 5-methyluracil and are represented by SEQ ID NO: 16108, or - all cytosine bases are 5-methylcytosine and all uracil bases are 5-methyluracil, as represented by SEQ ID NO: 16174; - more preferably, all cytosine bases are 5-methylated and are represented by SEQ ID NO: 16042.

[0141] Preferably, the first and second antisense oligonucleotides of a compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0142] Said first and / or second oligonucleotide of the compound preferably comprises or consists of at least one 2'-O-substituted RNA monomer and optionally a phosphorothioate backbone linkage, more preferably 2'-O-substituted RNA monomers linked by phosphorothioate backbone linkages, as defined herein above.

[0143] Thus, in a more preferred embodiment, the present invention provides a compound for skipping exon 51, preferably comprising or consisting of a first and a second antisense oligonucleotide linked to each other by a linking moiety, said first antisense oligonucleotide being: i) SEQ ID NOs: 15911 to 15922, preferably 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NOs: 15923 or 15924, preferably 15989 or 15990 (derived from SEQ ID NO: 15), SEQ ID NOs: 15925 to 15934, preferably 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NOs: 15935 to 15945, preferably 16001 to 16011 (derived from SEQ ID NO: 17), or 15946 or 15947, preferably 16012 or 16013 (derived from SEQ ID NO: 18), or ii) any one fragment of SEQ ID NO: 15911 to 15922, preferably 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NO: 15923 or 15924, preferably 15989 or 15990 (derived from SEQ ID NO: 15), SEQ ID NO: 15925 to 15934, preferably 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NO: 15935 to 15945, preferably 16001 to 16011 (derived from SEQ ID NO: 17), or 15946 or 15947, preferably 16012 or 16013 (derived from SEQ ID NO: 18), or iii) a sequence in which one, two, three, four or five nucleotides are added to SEQ ID NOs: 15911 to 15922, preferably 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NOs: 15923 or 15924, preferably 15989 or 15990 (derived from SEQ ID NO: 15), SEQ ID NOs: 15925 to 15934, preferably 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NOs: 15935 to 15945, preferably 16001 to 16011 (derived from SEQ ID NO: 17), or 15946 or 15947, preferably 16012 or 16013 (derived from SEQ ID NO: 18); or iv) a sequence in which one, two, three, four or five nucleotides are deleted from SEQ ID NOs: 15911 to 15922, preferably 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NOs: 15923 or 15924, preferably 15989 or 15990 (derived from SEQ ID NO: 15), SEQ ID NOs: 15925 to 15934, preferably 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NOs: 15935 to 15945, preferably 16001 to 16011 (derived from SEQ ID NO: 17), or 15946 or 15947, preferably 16012 or 16013 (derived from SEQ ID NO: 18), or v) a nucleotide sequence which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 95%, more preferably at least 97%, identical to any one of SEQ ID NOs: 15911 to 15922, preferably 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NOs: 15923 or 15924, preferably 15989 or 15990 (derived from SEQ ID NO: 15), SEQ ID NOs: 15925 to 15934, preferably 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NOs: 15935 to 15945, preferably 16001 to 16011 (derived from SEQ ID NO: 17), or 15946 or 15947, preferably 16012 or 16013 (derived from SEQ ID NO: 18); is represented by a nucleotide sequence comprising or consisting of any one of: and / or, said second antisense oligonucleotide is: i) SEQ ID NOs: 15948 to 15962, preferably 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, preferably 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, preferably 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, preferably 16042 (derived from SEQ ID NO: 201), or ii) any one of SEQ ID NOs: 15948 to 15962, preferably 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, preferably 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, preferably 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, preferably 16042 (derived from SEQ ID NO: 201), or iii) SEQ ID NOs: 15948 to 15962, preferably 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, preferably 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, preferably 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, preferably 16042 (derived from SEQ ID NO: 201), with the addition of 1, 2, 3, 4, or 5 nucleotides; or iv) a sequence in which one, two, three, four or five nucleotides are deleted from SEQ ID NOs: 15948 to 15962, preferably 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, preferably 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, preferably 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, preferably 16042 (derived from SEQ ID NO: 201); or v) a nucleotide sequence which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 95%, more preferably at least 97%, identical to any one of SEQ ID NOs: 15948 to 15962, preferably 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, preferably 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, preferably 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, preferably 16042 (derived from SEQ ID NO: 201); A nucleotide sequence comprising or consisting of any one of: The first antisense oligonucleotide is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO:3, and the second antisense oligonucleotide is complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of SEQ ID NO:4, wherein SEQ ID NOs:3 and 4 are located within exon 51 of the dystrophin pre-mRNA.

[0144] Preferably, the first and second antisense oligonucleotides of a compound of the invention are distinct, and more preferably, the nucleotide sequences of the first and second antisense oligonucleotides are represented by distinct SEQ ID NOs.

[0145] The "1, 2, 3, 4 or 5 additional nucleotides" may be present 5' and / or 3' to a given SEQ ID NO.

[0146] The "one, two, three, four, or five deleted nucleotides" may be nucleotides deleted 5' and / or 3' of a given SEQ ID NO.

[0147] Also in this regard, it is permissible for an oligonucleotide of 20 nucleotides to have one or two mismatch(es) or for an oligonucleotide of 40 nucleotides to have one to four mismatches. For an oligonucleotide of 10 to 33 nucleotides, there may be zero, one, two or three mismatches, as defined herein above, preferably zero, one or two mismatches. For an oligonucleotide of 16 to 22 nucleotides, there may be zero, one or two mismatches, preferably zero or one mismatches.

[0148] Said first and / or second oligonucleotide of the compound preferably comprises or consists of at least one 2'-O-substituted RNA monomer and, optionally, a phosphorothioate backbone linkage, more preferably 2'-O-substituted RNA monomer linked by phosphorothioate backbone linkages, as defined herein above. Table 1: Preferred BNA modified sequences for the first and / or second antisense oligonucleotides of the compounds [Table 1] JPEG0007661218000007.jpg225149 JPEG0007661218000008.jpg216149 Table 2: More preferred BNA modified sequences for the first and / or second antisense oligonucleotides of the compounds [Table 2] JPEG0007661218000010.jpg191149 JPEG0007661218000011.jpg92149 JPEG0007661218000012.jpg130149

[0149] Thus, in a more preferred embodiment, the compound of the present invention is preferably for skipping exon 51 of dystrophin pre-mRNA and comprises or consists of a first antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 15980, 16145 or 16144, more preferably SEQ ID NO: 15980, and a second antisense oligonucleotide represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 16026, 16174, 16172 or 16171, more preferably SEQ ID NO: 16026, wherein the first and second antisense oligonucleotides are linked to each other by a linking moiety (as explained in the section entitled "Linking Moiety"), preferably the linking moiety is triethylene glycol (TEG) or hexaethylene glycol (HEG).

[0150] The sequence number 15980 is the sequence

number

number

number

number

number

number

number

[0151] In the context of the present invention, the positions of the first and second antisense oligonucleotides in the compound of the present invention are interchangeable. Thus, preferred compounds of the present invention are: i) SEQ ID NO: 16335

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

[0152] Even more preferred compounds of the invention are represented by SEQ ID NO: 16335 or 16336 (TEG linker) or SEQ ID NO: 16337 or 16338 (HEG linker).

[0153] In a preferred embodiment, the compound of the present invention is a compound with improved parameters compared to the corresponding mixture of the first and second antisense oligonucleotides linked in the compound (wherein the compound, the first and second antisense oligonucleotides are linked to each other by a linking moiety, but in the mixture, the first and second antisense oligonucleotides are not linked to each other), and preferably the concentration of the first and second antisense oligonucleotides in the mixture is the same as that of the compound of the present invention.In another preferred embodiment, the compound of the present invention is a compound with improved parameters compared to Drisapersen (SEQ ID NO: 7, i.e., UCAAGGAAGAUGGCAUUUCU, each RNA monomer is 2-O-methylated and the entire backbone is phosphorothioate) and / or Eteplirsen (SEQ ID NO: 8, i.e., CTCCAACATCAAGGAAGATGGCATTTCTAG, each monomer is modified to form phosphorodiamidate morpholino oligomers).

[0154] In this context, parameters may include: binding affinity and / or kinetics, exon skipping activity, biostability, (tissue) distribution, cellular uptake and / or transport and / or immunogenicity. Preferably, the improved parameter is an increase in exon skipping activity.

[0155] Exon skipping activity is preferably measured by analyzing total RNA isolated from compound / mixture treated muscle cell cultures or muscle tissues by reverse transcriptase quantification or digital droplet polymerase chain reaction (RT-qPCR or RT-ddPCR) (Spitali et al., 2013, Verheul et al., 2016) using DMD gene specific primers flanking the targeted exons. The proportion of short transcript fragments representing transcripts skipping the targeted exon relative to the total transcript is assessed (calculated as a percentage of oligonucleotide induced exon skipping). Shorter fragments may also be sequenced to determine the accuracy and specificity of the targeted exon skipping.

[0156] In certain embodiments, the RNA modulating activity may be an increase or decrease in the amount of a nucleic acid or a protein. In certain embodiments, such activity may be a change in the ratio of splice variants of a nucleic acid or a protein. The detection and / or measurement of antisense activity may be direct or indirect. In certain embodiments, antisense activity is assessed by observing changes in the phenotype of a cell or an animal.

[0157] As used herein, "modulation" can also refer to the disturbance of the quantity or quality of function or activity compared to the function or activity before modulation.For example, modulation includes either the change, increase (stimulation or induction) or decrease (inhibition or reduction) of dystrophin mRNA or protein as defined herein above.As a further example, modulation of expression includes disturbing the splice site selection of pre-mRNA processing, leading to the change in the amount of specific splice variants present compared to the condition that is not disturbed.

[0158] Biodistribution and biostability are preferably determined, at least in part, with a validated sandwich hybridization assay adapted from Straarup et al., 2010. In one embodiment, plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe complementary to one portion of the AON analyte. After separation, the DIG-labeled oligonucleotide is hybridized to the other portion of the AON analyte, followed by quantitative detection using a peroxidase linked anti-DIG antibody. Plasma oligonucleotide concentrations (μg / mL) are monitored over time to determine peak concentrations (C max ), time to peak concentration (T max ), area under the curve (AUC), and half-life will be evaluated. Tissue distribution will be assessed by measuring tissue sample concentrations (μg / g tissue) at the end of the study. Noncompartmental pharmacokinetic analysis will be performed using the Phoenix software package (WinNonlin module, version 6.4, Pharsight, Mountainview, Calif.).

[0159] Thus, compared to a corresponding mixture of a first and a second antisense oligonucleotide linked with a compound of the invention that differs only by the absence of a linking moiety (linking both AONs in the compound of the invention), i.e., the first and the second antisense oligonucleotide of the mixture have the same sequence and are modified in the same way as the first and the second antisense oligonucleotide of the compound of the invention, the preferred compounds of the invention have improved parameters, such as acceptable or reduced immunogenicity, and / or better biodistribution, and / or acceptable or improved RNA binding kinetics and / or thermodynamic properties. Each of these parameters can be assessed using assays known to those of skill in the art or, preferably, the assays disclosed herein.

[0160] Further chemical modifications of the first and / or second antisense oligonucleotides of the compound In the context of the present invention, it is to be understood that an oligonucleotide comprising or consisting of any of the chemical modifications described in this paragraph ("Further chemical modifications of the first and / or second antisense oligonucleotide of the compound") or any combination thereof has an exon skipping activity at least as good as its counterpart without these modification(s) described in the above paragraphs "First and second antisense oligonucleotide of the compound" and / or "Chemical modifications of the first and / or second antisense oligonucleotide of the compound", and preferably said exon skipping activity is greater than the activity of said counterpart without these modification(s). Thus, a compound of the present invention, in which said first and / or second antisense oligonucleotide comprises or consists of any of the chemical modifications described in this paragraph ("Further chemical modifications of the first and / or second antisense oligonucleotide of the compound"), has an exon skipping activity at least as good as said compound without these chemical modifications or any combination thereof. Preferably, the exon skipping activity is greater than the activity of the compound without the chemical modifications, or combinations thereof.

[0161] Below, other chemical structures and modifications of the first and / or second antisense oligonucleotides of the compounds of the invention are defined, which may be present in combination with the chemical structures already defined for said first and / or second oligonucleotides, i.e., with any phosphorothioate backbone linkages, with or without 5-methylcytosine and / or 5-methyluracil, with or without 2'-O-methyl monomers, and / or with at least one BNA scaffold modification.

[0162] In addition to the above-mentioned modifications, the first and / or second oligonucleotide of the compound of the present invention may contain further modifications, such as different types of nucleic acid monomers or nucleotides, as described below. Different types of nucleic acid monomers may be used to generate the first and / or second oligonucleotide. The first and / or second oligonucleotide may have at least one backbone and / or scaffold modification and / or at least one base modification compared to an RNA-based oligonucleotide.

[0163] Base modifications include modified forms of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, super-T, or, for example, Kumar et al. J.Org.Chem.2014,79,5047;Leszczynska et al. al. Org.Biol.Chem. 2014,12,1052), pyrazolo[1,5-a]-1,3,5-triazine C-nucleosides (e.g., as described in Lefoix et al. J.Org.Chem. 2014,79,3221), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, super G, super A, boronated cytosine (e.g., Niziol et al. Bioorg.Med.Chem. 2014,22,3906), pseudoisocytidine, C(Pyc) (e.g., Yamada et al. Org. Biomol. Chem. 2014, 12, 2255), and N4-ethylcytosine or derivatives thereof; 2 -Cyclopentylguanine (cPent-G), N 2 -Cyclopentyl-2-aminopurine (cPent-AP) and N 2-propyl-2-aminopurine (Pr-AP), carbohydrate-modified uracil (e.g., Kaura et al. Org. Lett. 2014, 16, 3308), amino acid-modified uracil (e.g., Guenther et al. Chem. Commun. 2014, 50, 9007); or derivatives thereof; and degenerate bases such as 2,6-difluorotoluene, or non-existent bases such as abasic sites, or universal bases (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose, or (azaribose) pyrrolidine derivatives in which the ring oxygen is replaced with a nitrogen). Examples of derivatives of Super A, Super G, and Super T can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences), the entire contents of which are incorporated herein by reference. cPent-G, cPent-AP, and Pr-AP have been shown to suppress immunostimulatory effects when incorporated into siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200). Examples of modified bases are described, for example, in WO2014 / 093924 (ModeRNA).

[0164] The first and / or second oligonucleotide of the compounds of the invention, depending on their length, may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 34, 35, 36, or 37 base modifications. The invention also encompasses the introduction of two or more distinct base modifications into the first and / or second oligonucleotide.

[0165] In addition to the BNA scaffold modifications already described, scaffold modifications can include 2'-O-alkyl or 2'-O-modified RNAs such as 2'-O-(substituted) alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O-(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl) (2'-AECM), 2'-O-(2-carboxyethyl), and carbamoyl derivatives (Yamada et al. al.Org.Biomol.Chem. 2014,12,6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy(DNA), 2'-O-(haloalkoxy)methyl (Arai K.et al.Bioorg.Med.Chem. 2014,12,6457). 2011,21,6285) For example, 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl, for example, 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2'-O-[2-(methylthio)ethyl] (2'-MTE) ), 2'-(ω-O-serinol); 2'-halo, e.g., 2'-F, FANA (2'-F arabinosyl nucleic acid), 2',4'-difluoro-2'-deoxy; carba- and aza-sugar modifications; 3'-O-substituted, e.g., 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl; 4'-substituted, e.g., 4'-aminomethyl-2'-O-methyl, or 4'-aminomethyl-2'-fluoro; 5'-substituted, e.g., 5'-methyl, or CNA (Ostergaard et al., ACS Chem. Biol.2014,22,6227); and derivatives thereof.

[0166] The first and / or second oligonucleotides of the compounds of the invention can comprise or consist of, depending on their length, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 scaffold modifications in addition to at least one BNA scaffold modification. The invention also encompasses the introduction of two or more distinct base modifications into the first and / or second oligonucleotides.

[0167] Other modifications include unlocked nucleic acid (UNA); cyclohexenyl nucleic acid (CeNA), F-CeNA, cyclohexanyl nucleic acid (CNA), ribo-cyclohexanyl nucleic acid (r-CNA), altritol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); and their derivatives. Examples of fluorinated nucleic acid analogs with furanose and non-furanose sugar rings are also included, for example, as described in Ostergaard et al. J. Org. Chem. 2014, 79, 8877.

[0168] The first and / or second oligonucleotide of the compound of the invention may comprise or consist of, depending on its length, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 scaffold modifications in addition to at least one BNA scaffold modification. In a preferred embodiment, the first and / or second oligonucleotide of the compound of the invention is fully 2'-O-methyl modified and comprises 1, 2, 3, 4, 5, 6, 7, 8, or 9 BNA scaffold modifications.

[0169] The first and / or second oligonucleotide of the compound of the present invention can include backbone bond modifications. Backbone bond modifications can be, but are not limited to, phosphodiester modifications present in RNA, such as phosphorothioates (PS), chiral pure phosphorothioates, phosphorodithioates (PS2), phosphonoacetates (PACE), phosphonoacetamides (PACA), thiophosphonoacetates (thioPACE), thiophosphonoacetamides, phosphorothioate prodrugs, H-phosphonates, methylphosphonates, methylphosphonothioates, methylphosphates, methylphosphorothioates, ethylphosphates, ethylphosphorothioates, boranophosphates, boranophosphorothioates, methylboranophosphates, methylboranophosphorothioates, methylboranophosphonates, methylboranophosphonothioates, phosphates, phosphotriesters, aminoalkylphosphotriesters, and derivatives thereof. Other modifications include phosphoramidite, phosphoramidate, N3'→P5' phosphoramidate, phosphorodiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methyleneformacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamide nucleic acid (TANA); and derivatives thereof. Examples of chiral pure phosphorothioate linkages are described, for example, in WO2014 / 010250 (WaVe Life Sciences). Also included are various salts, mixed salts, and free base forms, as well as 3'→3' and 2'→5' linkages.

[0170] The first and / or second oligonucleotide of the compounds of the invention, depending on their length, may comprise or consist of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 backbone bond modifications. The invention also encompasses the introduction of two or more distinct backbone modifications into the nucleotides.

[0171] In a preferred embodiment, the first and / or second oligonucleotide of the compound of the invention comprises at least one phosphorothioate modification. In a more preferred embodiment, the first and / or second oligonucleotide of the compound of the invention is fully phosphorothioate modified. In another preferred embodiment, the first and / or second oligonucleotide of the compound of the invention comprises at least one phosphate.

[0172] Other chemical modifications of the first and / or second oligonucleotide of the compound of the invention include replacing any one or more of the hydrogen atoms with deuterium or tritium, examples of which can be found, for example, in WO2014 / 022566 (Ased) or WO2015 / 011694 (Celgene).

[0173] With the advent of nucleic acid mimicking technology, it has become possible to create molecules that are similar in kind, but not necessarily in the same quantity, as the nucleic acid itself, and preferably have the same hybridization characteristics. Such functional equivalents are, of course, also suitable for use in the present invention.

[0174] Those skilled in the art will understand that not every scaffold, base and / or backbone may be modified in the same way, and several distinct modified scaffolds, bases and / or backbones may be combined into one single oligonucleotide.

[0175] connecting part In an embodiment of the invention, the linking moiety can be any type of moiety capable of linking (antisense) oligonucleotides to each other. The linking moiety can be hydrophilic, hydrophobic or amphiphilic. In the context of the present invention, a first and a second antisense oligonucleotide "linked to each other by a linking moiety" means that the first and the second antisense oligonucleotides are linked in a compound by a linking moiety to form a single compound, as defined herein, comprising or consisting of the first antisense oligonucleotide, the linking moiety and the second antisense oligonucleotide. The term "linking moiety" is interchangeable with "spacer" or "linker" throughout this application.

[0176] The link between the antisense oligonucleotide and the linking moiety may be a covalent bond, which may be achieved via a nucleotide bond that preferably comprises or consists of 1 to 50 nucleotides, more preferably 4 to 40 nucleotides.

[0177] In a preferred embodiment, the linking moiety or spacer comprises or consists of ethylene glycol monomers, ethylene glycol oligomers or ethylene glycol polymers (also known as polyethylene glycol, PEG). Preferably, the linking moiety comprises or consists of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 ethylene glycol monomers. More preferably, the linking moiety comprises or consists of 1-20, 3-15, 3-12, 3-10, 3-6, 6-20, 6-15, 6-12 or 6-10 ethylene glycol monomers. Even more preferably, the linking moiety comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 ethylene glycol monomers or ethylene glycol chains.

[0178] In another preferred embodiment, the linking moiety or spacer is selected from the following list: N-maleimidopropyloxysuccinimide ester (BMPS), succinimidyl 4-maleimidobutyrate (GMBS), DMSS (Sugo et al. J. Rel. 2016, 237, 1), succinimidyl 3-(2-pyridyldithio)propionate (SPDP), 4-succinimidyloxycarbonyl-α-methyl-(2-pyridyldithio)toluene (SMPT), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), sulfo-SMCC, succinimidyl 4-formylbenzamide (S-4FB), sulfo-S-4FB, S-Hydroxy-S ... Nic, ω-aminoalkanols (6-aminohexanol, 5-aminopentanol, 12-aminododecanol, etc.), ω-mercaptoalkanols (6-mercaptohexanol, etc.), ω-hydroxyalkanols (1,6-hexanediol, 1,12-dodecanediol, 1,2-ethanediol, 1,3-propanediol, etc.), amino acids (β-Ala, Gly, Pro, Hyp, Lys, Cys), dipeptides (Sugo et al., J. Control. Rel. 2016, 237, 1), tripeptides, tetrapeptides, pentapeptides, hexapeptides, heptapeptides, octapeptides, nonapeptides, decapeptides, or oligopeptides, piperazine, piperidine, p-aminobenzoyl, p-aminobenzyl carbamate, p-aminobenzyl carboxylate, abasic nucleotides (1,2-dideoxyribosyl, 1-deoxy-2-O-methylribosyl, 1-deoxyazaribosyl), and any one of their derivatives. Examples of linkers are also described, for example, in Leriche et al. Bioorg. Med. Chem. 2012, 20, 571, Saneyoshi et al. J. Org. Chem. 2017, 82, 1796, US 9,732,340, and US 9,790,494 (Translate Bio MA, Inc.).

[0179] In a more preferred embodiment, the linking moiety is diethylene glycol, triethylene glycol (TEG), tetraethylene glycol, pentaethylene glycol, or hexaethylene glycol (HEG). More preferably, the linking moiety is TEG or HEG.

[0180] Those skilled in the art understand that one or more linking moieties can be incorporated into the compound of the present invention.For example, the first and second antisense oligonucleotides of the compound can be linked to each other by incorporating a single hexaethylene glycol moiety or by incorporating two consecutive triethylene glycol moieties.However, a linking moiety that comprises or consists of one or more linking moieties is still referred to as "linking moiety" in the context of the present invention.

[0181] Also within the scope of the present invention is the use of modified PEGylations, where the (poly)ethylene glycol is chemically modified and / or attached thereto. In this way, the linking moiety acquires additional properties known in the art. For example, the linking moiety becomes cleavable or fluorescent. Examples of modified PEGylations include, but are not limited to, cleavable PEGylations, where the bond is a degradable (cleavable) bond. Examples include, for example, bonds that respond to pH, light, temperature, reducing or oxidizing environments, nucleophiles, synthetic reagents, enzymes, proteases, cathepsins, click-and-release reactions, or (other) external stimuli.

[0182] It is to be understood that the linker can be present as a single chemical moiety as described above, or as multiple instances of the same or different linker combinations that ultimately link the two oligonucleotides together.

[0183] Attachment of the linker to the first and / or second oligonucleotide of the compound of the invention may be achieved, for example, via an amide, carboxamide, ester, ether, thioether, thioester, thiol / maleimide, disulfide, phosphodiester, phosphate, phosphotriester, thiophosphodiester, thiophosphotriester, dithiophosphodiester, phosphorodiamidate, methyl phosphonate, phosphorylguanidine, phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, sulfone, sulfonamide, sulfoxide, sulfodioxide, carbamate, carbonate, urea, guanidine, amidine, hydroxamate, hydroxylamine, imine, xanthate, azide / alkyne, oxime, thiazolidine, azo, hydrazide, hydrazone.

[0184] PEGylation of nucleic acids, including (antisense) oligonucleotides, i.e. the attachment of (chemically activated) ethylene glycol chains, is well known to those skilled in the art. PEGylation can be performed at the -OH group of the 5'- and / or 3'-terminal monomers of the nucleic acid. This can be done directly or via a spacer (e.g. an aminoalkyl linker), e.g. by click chemistry, as known to those skilled in the art.

[0185] composition In a second aspect, there is provided a composition comprising a compound described in the section above entitled "Compounds."

[0186] In an embodiment of the invention, the composition comprises at least one excipient and / or the compound comprises at least one conjugated ligand that may further assist in enhancing the targeting and / or delivery of the composition and / or compound to and / or towards tissues and / or cells. The compositions described herein are referred to herein as compositions of the invention. The compositions of the invention may comprise one or more compounds of the invention. In the context of the invention, the excipient may be a separate molecule, but may also be a conjugated moiety. In the former case, the excipient may be a filler such as starch. In the latter case, the excipient may be, for example, a targeting ligand linked to the first and / or second oligonucleotide of the compound of the invention.

[0187] In a preferred embodiment, the composition is for use as a medicament. The composition is therefore a pharmaceutical composition. A pharmaceutical composition usually comprises a pharma- ceutical acceptable carrier, diluent, and / or excipient. In a preferred embodiment, the composition of the present invention comprises a compound as defined herein, and optionally further comprises a pharma- ceutical acceptable formulation, filler, preservative, solubilizer, carrier, diluent, excipient, salt, adjuvant, and / or solvent. Such pharma- ceutical acceptable carriers, fillers, preservatives, solubilizers, diluents, salts, adjuvants, solvents, and / or excipients are described, for example, in Remington: The Science and Practice of Pharmacy, 20th Edition Baltimore, MD: Lippincott Williams & Wilkins, 2000. The compounds described in the present invention may have at least one ionizable group. The ionizable group may be basic or acidic, charged, or neutral. The ionizable group may be present as an ion pair with a suitable counterion carrying the opposite charge(s). Examples of cationic counterions include sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions include chloride, bromide, iodide, lactate, mesylate, besylate, triflate, acetate, trifluoroacetate, dichloroacetate, tartrate, lactate, and citrate. Examples of counterions are described in, for example, Kumar, 2008, the entire contents of which are incorporated herein by reference.

[0188] The pharmaceutical composition may contain excipients capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and / or liposomes, which aid in enhancing the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, cellular uptake, and intracellular transport of the compound. Examples of nanoparticles include polymeric nanoparticles, (mixed) metal nanoparticles, carbon nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles, and peptide nanoparticles. Examples of nanoparticles and oligonucleotide combinations include spherical nucleic acids (SNAs), e.g., Barnaby et al. Cancer Treat. Res. 2015,166,23.

[0189] Preferred compositions include at least one excipient that may further assist in enhancing the targeting and / or delivery of the composition and / or compound to and / or to tissues and / or cells. A preferred tissue or cell is muscle tissue or muscle cell.

[0190] Many of these excipients are known in the art (see, e.g., Bruno, 2011) and may be categorized as a first type of excipient. Examples of the first type of excipient include polymers (e.g., polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g., spermine, spermidine, putrescine, cadaverine), chitosan, poly(amidoamine) (PAMAM), poly(esteramine), polyvinyl ether, polyvinylpyrrolidone (PVP), polyethylene glycol, polyvinyl ether ... PEG cyclodextrin, hyaluronic acid, colominic acid, and their derivatives), dendrimers (e.g., poly(amidoamine)), lipids {e.g., 1,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethyl ammonium chloride (DODAC), phosphatidylcholine derivatives [e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lyso-phosphatidylcholine derivatives [e.g., 1-stearoyl-2-lyso-sn-glycero- 3-phosphocholine (S-LysoPC)], sphingomyelin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracedylcarbamoylmethylacetamide (RPR209120), phosphoglycerol derivatives [e.g., 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na), phosphatidic acid derivatives [1,2-distearoyl-sn-glycero-3-phosphatidic acid, sodium salt (DSPA), phosphatidyle esters ... ethanolamine derivatives [e.g., dioleoyl-LR-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE),], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-Di-oleoyloxy-2-(6-carboxy-spermyl)-propylamide (DOSPER), (1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium (DMRIE), (N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (bL-arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride (AtuFECT01), N,N-dimethyl-3-aminopropane derivatives [e.g., 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1 ,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], proteins (e.g., albumin, gelatin, atelocollagen), and peptides (e.g., protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG). When used as separate compounds, the carbohydrates and carbohydrate clusters shown below are also suitable for use as excipients of the first type. ,

[0191] Another preferred composition may include at least one excipient categorized as a second type of excipient. The second type of excipient may include or contain a conjugate group as described herein to enhance targeting and / or delivery of the compositions and / or compounds of the present invention to and / or to tissues and / or cells, such as muscle tissue or muscle cells. The conjugate group may exhibit one or more different or identical ligands. Examples of conjugate group ligands include, for example, peptides, carbohydrates, or mixtures of carbohydrates (Han et al., Nature Communications, 2016, doi:10.1038 / ncomms10981; Cao et al., Mol. Ther. Nucleic Acids, 2016, doi:10.1038 / mtna.2016.46), proteins, small molecules, antibodies, polymers, and drugs. Examples of carbohydrate conjugate group ligands include glucose, mannose, galactose, maltose, fructose, N-acetylgalactosamine (GalNac), glucosamine, N-acetylglucosamine (GlcNAc), glucose-6 phosphate, mannose-6 phosphate, and maltotriose. Carbohydrates can be present in multiples, for example, as terminal groups in a dendritic or branched linker moiety that connects the carbohydrate to a component of the composition. Carbohydrates can also be included in a carbohydrate cluster moiety, such as a GalNAc cluster moiety. The carbohydrate cluster moiety can include a targeting moiety and, optionally, a conjugate linker. In some embodiments, the carbohydrate cluster moiety includes one, two, three, four, five, six, or more GalNAc groups.As used herein, "carbohydrate cluster" refers to a compound having one or more carbohydrate residues attached to a scaffold or linker group (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chem., 2003, (14): 18-29; Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, (47): 5798-5808). In this context, "modified carbohydrate" refers to any carbohydrate that has been subjected to one or more chemical modifications to a naturally occurring carbohydrate. As used herein, "carbohydrate derivative" refers to any compound that can be synthesized using a carbohydrate as a starting material or intermediate. As used herein, "carbohydrate" refers to a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. Both types of excipients may be combined together in one single composition as described herein.

[0192] One skilled in the art may select, combine and / or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver compounds for use in the present invention.

[0193] Such pharmaceutical compositions of the present invention may be administered to animals, preferably mammals, at a set time and at an effective concentration. More preferred mammals are humans. For use in the present invention, the compounds or compositions defined herein may be suitable for direct administration to cells, tissues, and / or organs in vivo of an individual suffering from or at risk of developing a disease or condition identified herein, and may be administered directly in vivo, ex vivo, or in vitro. Administration may be via local, systemic, and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, intraocular, intranasal, genitourinary, intradermal, transdermal, intraintestinal, intravitreal, intracavitary, intracerebral, intrathecal, epidural, or oral routes.

[0194] Preferably, such pharmaceutical compositions of the present invention may be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule, or softgel for oral delivery, or in the form of an aerosol or dry powder for delivery to the airways and lungs.

[0195] In another embodiment of the invention, the compound may be used together with another compound already known for use in treating the disease. Such compounds may be used to reduce inflammation, preferably muscle tissue inflammation, and / or improve, increase or restore cardiac function using supplemental compounds to improve muscle tissue fiber function, integrity and / or survival.

[0196] Examples include, but are not limited to, steroids, preferably (gluco)corticosteroids, steroid-like substances (preferably vamorolone (VBP15)), epicatechin, ACE inhibitors (preferably perindopril), and HDAC inhibitors (preferably gibinostat), angiotensin II type 1 receptor blockers (preferably losartan), angiotensin peptide (1-7) (preferably TXA127), tumor necrosis factor-alpha (TNFα) inhibitors, TGFβ inhibitors (preferably decorin), NF-kB inhibitors (preferably edasalonexent (CAT-1004)), human recombinant biglycan, a source of mIGF-1, a myostatin inhibitor (preferably PF-06252616 or RG6206), mannose-6-lysine, erythropoietin ... Examples of the combination include nicotinic acid, antioxidants (preferably idebenone), ion channel inhibitors, dantrolene, protease inhibitors, phosphodiesterase inhibitors (preferably PDE5 inhibitors such as sildenafil or tadalafil), anti-inflammatory and / or anti-fibrotic agents (preferably HT-100), utrophin modulators (preferably eztromide), metformin, creatine monohydrate (CrM), heparin, granulocyte colony-stimulating binding factor (GCSF) (preferably filgrastim), connective tissue growth factor (CTGF / CCN2) inhibitors (preferably FG-3019), calcium modulators (preferably AT-300), androgen receptor modulators (preferably DT-200), L-citrulline, and / or L-arginine. Such combination use may be sequential: each component is administered in a separate manner, possibly as a separate composition. Alternatively, the respective compounds may be used together in a single composition.

[0197] The compounds in the composition of the invention can also be provided separately, for example to allow for sequential administration of the active ingredients of the composition of the invention. In such a case, the composition of the invention is a combination of a compound comprising at least the compound of the invention, with or without a conjugated ligand, as described above, and at least one excipient.

[0198] method In a third aspect, there is provided a method for preventing, treating, curing, ameliorating and / or delaying a condition or disease as defined in the preceding sections in a cell (preferably a muscle cell), tissue (preferably muscle tissue) or organ of an individual, comprising administering a compound (as described in the section entitled "Compounds") or a composition (as described in the section entitled "Compositions") of the invention to the individual or subject in need thereof.

[0199] The compounds or compositions defined herein may be suitable for administration to cells (preferably muscle cells), tissues (preferably muscle tissues) and / or organs in vivo of an individual suffering from a disease defined herein or at risk of developing an inflammatory disorder, and may be administered in vivo, ex vivo or in vitro. The individual or subject in need is preferably a mammal, more preferably a human. Alternatively, the subject is not a human. Administration may be via local, systemic and / or parenteral routes, such as intravenous, subcutaneous, intranasal, intraocular, intraperitoneal, intrathecal, intramuscular, intracavity, genitourinary, intradermal, transdermal, intraintestinal, intravitreal, intracerebral, intrathecal, epidural or oral routes.

[0200] In another embodiment, in the method of the present invention, the concentration of the compound or composition is in the range of 0.01 nM to 1 μM. More preferably, the concentration used is 0.05 to 500 nM, or 0.1 to 500 nM, or 0.02 to 500 nM, or 0.05 to 500 nM, and even more preferably, 1 to 200 nM.

[0201] Dose ranges for the compounds or compositions of the invention are preferably designed based on ascending dose studies (in vivo use) in clinical trials where strict protocol requirements exist. Compounds defined herein may be used at doses ranging from 0.01 to 200 mg / kg, or 0.05 to 100 mg / kg, or 0.1 to 50 mg / kg, or 0.1 to 20 mg / kg, preferably 0.5 to 10 mg / kg.

[0202] The above-mentioned ranges of concentration or dosage of the compound or composition are preferred concentrations or dosages for in vitro or ex vivo use.Those skilled in the art will understand that depending on the identity of the compound used, the target cell to be treated, gene target and its expression level, the medium used, and the transfection and incubation conditions, the concentration or dosage of the compound used may be further changed or may need to be omitted.

[0203] In an embodiment of this aspect of the invention, there is provided a method for preventing, treating and / or delaying Duchenne muscular dystrophy (DMD), comprising administering to a subject a compound of the invention or a composition of the invention.

[0204] In another embodiment of the invention, a method of diagnosis is provided in which the compounds of the invention are radioactively or fluorescently labeled.

[0205] use In a fourth aspect, there is provided a compound (as described in the section entitled "Compounds") or a composition (as described in the section entitled "Compositions") for use as a medicament or part of a therapy, or preferably for use in applications in which the compound or composition exerts their activity intracellularly.

[0206] In a preferred embodiment, the compounds or compositions of the invention are for use as part of a medicament or therapy to prevent, delay, cure, ameliorate and / or treat Duchenne muscular dystrophy (DMD).

[0207] In a fifth aspect, there is provided the use of a compound (as described in the section entitled "Compounds") or a composition (as described in the section entitled "Compositions") in the manufacture of a medicament. Preferably, said use of a compound or composition in the manufacture of a medicament is for preventing, delaying, curing, ameliorating and / or treating Duchenne muscular dystrophy (DMD).

[0208] Third Antisense Oligonucleotide Another aspect of the present invention relates to an antisense oligonucleotide, i.e., a "third antisense oligonucleotide," which is not a compound of the present invention that comprises or consists of two antisense oligonucleotides linked together by a linking moiety, and in which a first antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to, or overlaps with at least a portion of SEQ ID NO:3, and a second antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to, or overlaps with at least a portion of SEQ ID NO:4, where SEQ ID NOs:3 and 4 are located within exon 51 of the dystrophin pre-mRNA. Said third antisense oligonucleotide, as defined herein, is preferably complementary to, binds to, targets, hybridizes to or overlaps with at least a portion of exon 51 of dystrophin pre-mRNA, preferably for use as a medicament, more preferably for treating, preventing and / or delaying Duchenne Muscular Dystrophy (DMD), more preferably for inducing skipping of at least a portion of exon 51 of dystrophin pre-mRNA. Preferably, said exon 51 of dystrophin pre-mRNA is of human origin and is represented by the nucleotide sequence of SEQ ID NO:2.

[0209] In a preferred embodiment of this aspect of the invention, the third antisense oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 16351 or 16352, or a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 16351 or 16352. SEQ ID NO: 16351 is represented by the sequence

number

number

number

number

[0210] In another preferred embodiment of this aspect of the invention, the third antisense oligonucleotide comprises or consists of a linking moiety (as described herein above in the section entitled "Linking Moiety" and which applies mutatis mutandis to the third antisense oligonucleotide) at the 5'-terminal monomer and / or the 3'-terminal monomer of the third antisense oligonucleotide.

[0211] The following embodiments explained in connection with the compounds of the invention (see above) also apply mutatis mutandis to said third antisense oligonucleotide: - "further chemical modification of the first and / or second antisense oligonucleotide of the compound"; "Composition"; and -"use".

[0212] definition In this specification and the claims, the verb "comprise" and its conjugations are used in a non-limiting sense to mean including the items following the word, but not excluding items not specifically recited. In addition, the verb "consisting of" can be substituted with "consisting essentially of," which means that the oligonucleotide or composition as defined herein may include additional component(s) other than those specifically specified, and the additional component(s) do not alter the unique characteristics of the invention. In addition, the association of the indefinite article "a" or "an" with an element does not exclude the possibility that there may be more than one element, unless there is a clear indication that one and only one element is required. The indefinite article "a" or "an" therefore generally means "at least one."

[0213] Each of the embodiments presented herein may be combined together unless otherwise specified. All patent and literature references cited herein are hereby incorporated by reference in their entirety.

[0214] Throughout this application, the words "bind", "target" and "hybridize" are used interchangeably when used in connection with antisense oligonucleotides that are complementary, preferably reverse complementary, to a portion of the pre-mRNA identified herein. In the context of the present invention, "hybridize" is used under physiological conditions in cells, preferably muscle cells, unless otherwise specified.

[0215] Where a structural formula or chemical name would be understood by one of skill in the art to have chiral centers, no chirality is indicated, but each chiral center is referred to individually as all three: the racemic mixture, the pure R enantiomer, and the pure S enantiomer.

[0216] Whenever a parameter of a substance is discussed in connection with the present invention, it is assumed that the parameter is determined, measured, or indicated under physiological conditions, unless otherwise indicated. Physiological conditions are known to those of skill in the art and include an aqueous solvent system, atmospheric pressure, a pH value between 6 and 8, a temperature ranging from room temperature to about 37° C. (about 20° C. to about 40° C.), and suitable concentrations of buffer salts or other components. It is understood that charge is often associated with equilibrium. A moiety that carries or is said to carry a charge is one that carries or is found in a state in which it carries more of such a charge than one that does not carry or does not carry such a charge. As such, one of skill in the art will understand that atoms shown to carry a charge in this disclosure may not carry a charge under certain conditions, and neutral moieties may carry a charge under certain conditions.

[0217] Generally, a substitution replaces a moiety that could be hydrogen with another moiety. Considering the carbon backbone of an organic molecule, an RNA monomer is essentially 2'-substituted because it has a hydroxyl moiety at its 2'-position. Thus, a DNA monomer is not 2'-substituted, and an RNA monomer can be viewed as a 2'-substituted DNA monomer. Then, when an RNA monomer is 2'-substituted, the substitution is either a 2'-OH or a 2'-H substitution. When an RNA monomer is 2'-O-substituted, the substitution is a H substitution at the 2'-OH moiety. By way of example, and not limitation, 2'-O-methyl RNA is a 2'-substituted monomer (-OMe replaces -H) and a 2'-substituted RNA monomer (-OMe replaces -OH) and a 2'-O-substituted RNA monomer (-Me replaces -H), while 2'-F RNA is a 2'-substituted RNA monomer (-F replaces -OH or H) and not a 2'-O-substituted RNA monomer (2'-O is no longer present or replaced). 2'-F RNA where the F substituted 2'-OH is 2'-F-2'-deoxy RNA and also 2'-F DNA.

[0218] In the context of the present invention, a decrease or increase in the parameter to be evaluated means a change of at least 5% in the value corresponding to that parameter. More preferably, a decrease or increase in value means a change of at least 10%, even more preferably a change of at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90% or even 100%. In this latter case, it may be said that there is no longer a detectable value associated with the parameter.

[0219] The use of a substance as a medicament as described herein may also be interpreted as the use of that substance in the manufacture of a medicament. Similarly, whenever a substance is used for therapy or as a medicament, it may also be used for the manufacture of a medicament for therapy.

[0220] The word "about" or "approximately," when used in connection with a numerical value (e.g., about 10), preferably means that the value may be 0.1% more or less than the given value (of 10).

[0221] The compound or composition of the invention is preferably for use in the method or use of the invention.

[0222] Those of skill in the art will understand that throughout this application, the terms "BNA," "BNA scaffold," "BNA nucleotide," "BNA nucleoside," "BNA modification," or "BNA scaffold modification" may be substituted, as appropriate, with a conformationally constrained scaffold modification, a locked scaffold modification, a locked nucleotide, a locked nucleoside, a locked monomer, or a Tm-enhancing scaffold modification, or a high affinity modification, or the like.

[0223] "Sequence identity" is defined herein as the relationship between two or more nucleic acid (polynucleotide, nucleic acid, or nucleotide, or oligonucleotide) sequences, as determined by comparing the sequences. In preferred embodiments, sequence identity is calculated based on the full length of two given SEQ ID NOs, or a portion thereof. The portion preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NOs. In the art, "identity" also means the degree of sequence relatedness between nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

[0224] Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods for determining identity and similarity between two sequences include, for example, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1):387(1984)), BestFit, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410(1990). The BEASTX program is available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al., J. Mol. Biol. 215:403-410(1990). The well-known Smith Waterman algorithm may also be used to determine identity.

[0225] Preferred parameters for nucleic acid comparison include: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: Match=+10, Mismatch=0; Gap penalty: 50; Gap length penalty: 3. Available as the Gap program, Genetics Computer Group, Madison, WI. The above are the default parameters for nucleic acid comparison.

[0226] The hybridization conditions for nucleic acid molecules can have low stringency, medium stringency, or high stringency (Southern blotting procedure). Low stringency, medium stringency, or high stringency conditions refer to prehybridization and hybridization at 42° C. with 5×SSPE, 0.3% SDS, 200 pg / ml sheared and denatured salmon sperm DNA, and 25%, 35%, or 50% formamide for low stringency, medium stringency, or high stringency, respectively. The hybridization reaction is then washed three times with 2×SSC, 0.2% SDS at either 55° C., 65° C., or 75° C. for 30 minutes each.

[0227] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. [Brief description of the drawings]

[0228] [Figure 1]RT-ddPCR analysis shows synergistic effect of combinations of AONs targeting different sequence stretches, linked by TEG = triethylene glycol or HEG = hexaethylene glycol linkers, on exon 51 skipping efficiency in muscle cells from DMD patients with exon 48-50 deletion. Individual AONs were tested at 400 nM or 800 nM: AON mixtures consisted of individual AONs at 400 nM: and linked AONs were tested at 800 nM. The average exon 51 skipping rate was determined based on RNA samples of six plate wells, error bars indicate standard deviation. NT = untreated cells. [Diagram 2] RT-ddPCR analysis shows the synergistic effect of the combination of AONs targeting different ESE sequence stretches using SEQ ID NO: 15980 and 16026, where the AONs are linked with a HEG = hexaethylene glycol linker (compound represented by SEQ ID NO: 16338), on exon 51 skipping efficiency in the quadriceps muscle of del52hDMD / mdx mice. The skipping efficiency of the mixture of AONs containing SEQ ID NO: 15980 and 16026 at 4.05 μg / ml is higher than that of either AON alone at 8.1 μmol / kg. Molecules in which the AONs are physically linked with HEG (compound represented by SEQ ID NO: 16338) were even more efficient: at 2.7 μmol / kg, it was similar to the efficiency of the mixture at 8.1 μmol / kg. The average exon 51 skipping rate was determined based on RNA samples from 10 mice, and error bars indicate standard deviation. VEH=vehicle.

[0229]

number

number

number

number

number

number

[0230] Example 1 (in vitro) Materials and Methods compound All antisense oligonucleotides (AONs) (Table 3, Figure 1) have a phosphorothioate backbone with 2'-O-methyl monomers and at least one LNA (SEQ ID NO: 16353, 16026 and 15980), which is also given to the first and second AONs of the compounds of the present invention represented by SEQ ID NO: 16336, 16335, 16338 and 16337. AONs were synthesized on a 5 μmol scale using either an OP-10 synthesizer (GE / AKTA Oligopilot) or a MerMade 12 synthesizer (BioAutomation) by standard phosphoramidite protocols. TEG and HEG linkers in compounds of SEQ ID NO: 16336, 16335, 16338 and 16337 were introduced using the corresponding phosphoramidite building blocks and standard synthesis protocols. The AONs were cleaved in a two-step sequence, deprotected (DEA followed by concentrated NH4OH treatment), purified by anion exchange chromatography, desalted by size-exclusion chromatography, and lyophilized. Mass spectrometry confirmed the identity of all AONs, and purity (determined by UPLC-UV) was found to be acceptable (>80%) for all AONs. [Table 3]

[0231] Gymnotic uptake and cDNA synthesis Immortalized myoblasts derived from a DMD patient carrying an exon 48-50 deletion were cultured to confluence in 12-well plates. To induce myotube formation, growth medium was replaced on day 6 with low serum differentiation medium supplemented with 400 nM or 800 nM AONs (N=6) according to non-GLP standard operating procedures. Total RNA was then isolated and 1000 ng of RNA was used for input into cDNA synthesis using random hexamer primers.

[0232] Digital Droplet (dd) PCR Analysis A specific Taqman minor groove binder (MGB) assay for detecting dystrophin transcripts with and without exon 51 was designed (Table 4) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 1 μl of cDNA (for non-skipped transcripts) or 4 μl of cDNA (for skipped transcripts) in a 20 μl reaction volume using an annealing / extension temperature of 60° C. according to the manufacturer's instructions (BioRad). Data were presented as exon skipping percentage [N0 skipped / (N0 skipped+N0 non-skipped)]. * 100]. [Table 4] result Using a mixture of AONs targeting separate (represented by SEQ ID NOs: 16353 and 15980; or SEQ ID NOs: 16026 and 15980) sequence stretches in exon 51, we observed exon 51 skipping levels (up to 24%) higher than those of each of the individual (represented by SEQ ID NOs: 16353, 16026, or 15980) AONs: up to 5.7% higher for SEQ ID NO: 16026 (at 800 nM) (Figure 1). A mixture of AONs targeting the same sequence stretches in exon 51 (represented by SEQ ID NOs: 16353 and 16026) did not increase the exon 51 skipping efficiency (3.2%). Surprisingly, even higher levels of exon 51 skipping were observed when AONs targeting distinct sequence stretches of exon 51 (represented by SEQ ID NOs: 16026 and 15980) were used and linked to each other by triethylene glycol or hexaethylene glycol linkers (Figure 1). In this example, the AON of SEQ ID NO: 15980 was the most efficient compound linked to the 5' end of the AON of SEQ ID NO: 16026 (compounds represented by SEQ ID NOs: 16335 and 16337).

[0233] Example 2 (in vivo) Materials and Methods Mouse experiments The mouse experiments were performed in accordance with the National Institute of Health (NIH) guidelines for the care and use of laboratory animals. Del52hDMD / indx mice (Leiden University Medical Center, Veltrop et al., 2018; PLoS ONE 13(2):e0l93289) were randomly divided into groups (n=10) taking into account baseline body weight and male and female distribution. Mice were intravenously injected via the tail vein once weekly for a total of 12 weeks, starting at 5-6 weeks of age, with single antisense oligonucleotides represented by SEQ ID NO: 16026 or 15980 (at 2.7 or 8.1 μmol / kg), their mixture (4.05 μmol / kg, respectively), or the linked AON compound represented by SEQ ID NO: 16338 (2.7 μmol / kg). Ten days after the last AON injection, animals were sacrificed and tissue samples were harvested (after transcardial perfusion with PBS to remove blood from the tissues). Quadriceps tissue samples were snap frozen and stored at -80°C.

[0234] RNA isolation and cDNA synthesis Quadriceps tissue samples were ground in a MagNa Lyser using Lysing Matrix D Tubes (MP Biomedicals) and homogenized in 1 ml Nucleozol (Macherey Nagel). Total RNA was extracted from the homogenate according to the manufacturer's instructions. 1000 ng of total RNA was tested for cDNA synthesis. cDNA was generated in a 20 ml reaction using random hexamer primers and GoScript reverse transcriptase, incubated at 50°C for 40 minutes.

[0235] Digital Droplet PCR Analysis A specific Taqman minor groove binder (MGB) assay to detect dystrophin transcripts with and without exon 51 was designed (using Primer Express 3.0.1 software; Applied Biosystems) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 2 μl or 4 μl of cDNA in a 20 μl reaction volume using an annealing / extension temperature of 60°C according to the manufacturer's instructions (BioRad). Data were presented as exon skipping percentage [N0 skipped / (N0 skipped + N0 not skipped)]. * 100].

[0236] result The synergistic effect of the combination of AONs of SEQ ID NO: 15980 and SEQ ID NO: 16026 targeting different ESE sequence stretches on exon 51 skipping efficiency is demonstrated in an in vivo study in del52hDMD / mdx mice. These mice are deficient in dystrophin, the deficiency being based on the mdx mutation in exon 23 of the mouse DMD gene and the deletion of exon 52 of the human DMD gene on chromosome 5 (Veltrop et al. 2018). The effect is even greater with AONs linked by a linker such as HEG = hexaethylene glycol linker (compound represented by SEQ ID NO: 16338) (Figure 2). The skipping efficiency of a mixture containing AONs of SEQ ID NO: 15980 and SEQ ID NO: 16026 at 4.05 μmol / kg each is higher than the skipping efficiency of a single AON containing only one of them at 8.1 μmol / kg. These AONs physically linked with HEG (compound represented by SEQ ID NO: 16338) are even more efficient: 2.7 μmol / kg, as well as the mixture at 8.1 μmol / kg. Further embodiments are as follows. [Embodiment 1] A compound comprising first and second antisense oligonucleotides (AONs) linked together by a linking moiety, the first antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to, or overlaps with at least a portion of SEQ ID NO:3; the second antisense oligonucleotide (AON) is complementary to, binds to, targets, hybridizes to, or overlaps with at least a portion of SEQ ID NO:4; The compounds of SEQ ID NOs: 3 and 4 are located within exon 51 of the dystrophin pre-mRNA. [Embodiment 2] The compound of embodiment 1, wherein the linking moiety links the 3'-terminal monomer of the first AON to the 5'-terminal monomer of the second AON, or links the 5'-terminal monomer of the first AON to the 3'-terminal monomer of the second AON. [Embodiment 3] The compound of embodiment 1 or 2, wherein the linking moiety is a polyethylene glycol (PEG) linker, a triethylene glycol (TEG), or a hexaethylene glycol (HEG) linker. [Embodiment 4] The compound of embodiment 3, wherein the linking moiety is a triethylene glycol (TEG) or a hexaethylene glycol (HEG) linker. [Embodiment 5] The first antisense oligonucleotide is represented by a nucleotide sequence having at least 95% identity to a continuous stretch of at least 8 nucleotides of SEQ ID NO:5; The compound according to any one of embodiments 1 to 3, wherein the second antisense oligonucleotide is represented by a nucleotide sequence having at least 95% identity to a consecutive stretch of at least 5 nucleotides of SEQ ID NO:6. [Embodiment 6] the first antisense oligonucleotide comprising: i) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 1 27, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173 , 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197, or SEQ ID NO: 14, 15, 16, 17, or 18, or SEQ ID NO: 14, 15, 16, or 17, or SEQ ID NO: 14 or 15, or SEQ ID NO: 14, or ii) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 , 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1 28, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 203, 204, 205, 206, 207, 208, 209, 5, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197, or SEQ ID NO: 14, 15, 16, 17, or 18, or SEQ ID NO: 14, 15, 16, or 17, or SEQ ID NO: 14, or 15, or a fragment of SEQ ID NO: 14, or iii) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 , 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197, or SEQ ID NO: 14, 15, 16, 17, or 18, or SEQ ID NO: 14, 15, 16, or 17, or SEQ ID NO: 14, or 15, or a sequence comprising 1, 2, 3, 4, or 5 additional nucleotides to SEQ ID NO: 14, or iv) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180 , 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, or 197, or SEQ ID NO: 14, 15, 16, 17, or 18, or SEQ ID NO: 14, 15, 16, or 17, or SEQ ID NO: 14, or 15, or a sequence having 1, 2, 3, 4, or 5 nucleotides deleted from SEQ ID NO: 14, or v) SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 , 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 1 91, 192, 193, 194, 195, 196, or 197, or SEQ ID NO: 14, 15, 16, 17, or 18, or SEQ ID NO: 14, 15, 16, or 17, or SEQ ID NO: 14, or 15, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 95%, or at least 97% identity to SEQ ID NO: 14, and / or the second antisense oligonucleotide comprising: i) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 2 51, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361 , 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or, 398, or, SEQ ID NO: 198, 199, 200, or, 201, or, SEQ ID NO: 198, or, 199, or, SEQ ID NO: 198, or ii) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 25 1, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307 , 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398, or SEQ ID NO: 198, 199, 200, or 201, or SEQ ID NO: 198, or 199, or a fragment of SEQ ID NO: 198, or iii) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 2 53, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 31 1, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368 , 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398, or SEQ ID NO: 198, 199, 200, or 201, or SEQ ID NO: 198, or 199, or a sequence comprising 1, 2, 3, 4, or 5 additional nucleotides to SEQ ID NO: 198, or iv) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 2 53, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 31 1, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368 , 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398, or SEQ ID NO: 198, 199, 200, or 201, or SEQ ID NO: 198, or 199, or SEQ ID NO: 198 from which 1, 2, 3, 4, or 5 nucleotides have been deleted, or v) SEQ ID NOs: 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 31 8, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, or 398, or SEQ ID NO: 198, 199, 200, or 201, or SEQ ID NO: 198, or 199, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 95%, or at least 97% identity to SEQ ID NO: 198, 199, 200, or 201, 6. The compound according to any one of embodiments 1 to 5, which is represented by a nucleotide sequence comprising or consisting of any one of the following: [Embodiment 7] The compound according to any one of the preceding embodiments, wherein the length of each of the first and second antisense oligonucleotides is between 8 and 37 nucleotides. [Embodiment 8] The compound of embodiment 7, wherein each of the first and second antisense oligonucleotides is 16 to 22 nucleotides in length. [Embodiment 9] The compound of embodiment 7, wherein each of the first and second antisense oligonucleotides is 18 to 22 nucleotides in length. [Embodiment 10] The first and / or second antisense oligonucleotides are i) at least one 2'-substituted monomer and optionally a phosphorothioate backbone linkage; and / or ii) 5-methylcytosine and / or 5-methyluracil bases, and / or iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; The compound of any one of embodiments 1 to 9, comprising: [Embodiment 11] The compound of embodiment 10, wherein said first and / or second antisense oligonucleotides comprise only 2'-substituted monomers linked with phosphorothioate backbone linkages. [Embodiment 12] The compound of embodiment 10 or 11, wherein all cytosine bases are 5-methylcytosine bases and / or all uracil bases are 5-methyluracil bases of said first and / or second AON. [Embodiment 13] 13. The compound of any one of embodiments 10-12, wherein the first and / or second antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, or 9 monomers that comprise a bicyclic nucleic acid (BNA) scaffold modification, a bridged nucleic acid scaffold modification, or a locked nucleic acid (LNA) scaffold modification. [Embodiment 14] The compound of embodiment 13, wherein the first and / or second antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, or 9 monomers that comprise a crosslinked nucleic acid scaffold modification. [Embodiment 15] The compound of embodiment 13, wherein said first and / or second antisense oligonucleotide comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, or 9 monomers that comprise a locked nucleic acid (LNA) scaffold modification. [Embodiment 16] The first and / or second oligonucleotides are (i) A single BNA scaffold modification at the 5'-end monomer; (ii) a single BNA scaffold modification at the 3'-end monomer; (iii) two BNA scaffold modifications, one at the 5'-end monomer and one at the 3'-end monomer; (iv) two BNA scaffold modifications, one of each of the two monomers being closest to the 5'-end; (v) two BNA scaffold modifications, one of each of the two monomers being closest to the 3'-terminus; and (vi) four BNA scaffold modifications, one of each of two monomers being closest to the 5'-terminus and one of each of two monomers being closest to the 3'-terminus; comprising or consisting of a BNA modification selected from the group consisting of: The compound of embodiment 13, optionally wherein 1, 2, 3, 4, or 5 additional BNA scaffold modifications are present. [Embodiment 17] the first antisense oligonucleotide comprising: i) SEQ ID NO: 15911 to 15922, or 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NO: 15923, or 15924, or 15989, or 15990 (derived from SEQ ID NO: 15), SEQ ID NO: 15925 to 15934, or 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NO: 15935 to 15945, or 16001 to 16011 (derived from SEQ ID NO: 17), or 15946, or 15947, or 16012, or 16013 (derived from SEQ ID NO: 18), or ii) any one of SEQ ID NOs: 15911 to 15922, or 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NOs: 15923, or 15924, or 15989, or 15990 (derived from SEQ ID NO: 15), SEQ ID NOs: 15925 to 15934, or 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NOs: 15935 to 15945, or 16001 to 16011 (derived from SEQ ID NO: 17), or 15946, or 15947, or 16012, or 16013 (derived from SEQ ID NO: 18); or iii) a sequence in which one, two, three, four or five nucleotides are added to SEQ ID NO: 15911 to 15922, or 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NO: 15923, or 15924, or 15989, or 15990 (derived from SEQ ID NO: 15), SEQ ID NO: 15925 to 15934, or 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NO: 15935 to 15945, or 16001 to 16011 (derived from SEQ ID NO: 17), or 15946, or 15947, or 16012, or 16013 (derived from SEQ ID NO: 18); or iv) a sequence in which one, two, three, four or five nucleotides are deleted from SEQ ID NO: 15911 to 15922, or 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NO: 15923, or 15924, or 15989, or 15990 (derived from SEQ ID NO: 15), SEQ ID NO: 15925 to 15934, or 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NO: 15935 to 15945, or 16001 to 16011 (derived from SEQ ID NO: 17), or 15946, or 15947, or 16012, or 16013 (derived from SEQ ID NO: 18); or v) a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 15911 to 15922, or 15977 to 15988 (derived from SEQ ID NO: 14), SEQ ID NO: 15923, or 15924, or 15989, or 15990 (derived from SEQ ID NO: 15), SEQ ID NO: 15925 to 15934, or 15991 to 16000 (derived from SEQ ID NO: 16), SEQ ID NO: 15935 to 15945, or 16001 to 16011 (derived from SEQ ID NO: 17), or 15946, or 15947, or 16012, or 16013 (derived from SEQ ID NO: 18); and / or the second antisense oligonucleotide comprising: i) SEQ ID NO: 15948 to 15962, or 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NO: 15963 to 15972, or 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NO: 15973 to 15975, or 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, or 16042 (derived from SEQ ID NO: 201), or ii) any one of SEQ ID NOs: 15948 to 15962, or 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, or 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, or 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, or 16042 (derived from SEQ ID NO: 201); or iii) a sequence in which one, two, three, four or five nucleotides have been added to SEQ ID NOs: 15948 to 15962, or 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NOs: 15963 to 15972, or 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NOs: 15973 to 15975, or 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, or 16042 (derived from SEQ ID NO: 201); or iv) a sequence in which one, two, three, four, or five nucleotides are deleted from SEQ ID NO: 15948 to 15962, or 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NO: 15963 to 15972, or 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NO: 15973 to 15975, or 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976, or 16042 (derived from SEQ ID NO: 201); or v) a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 15948 to 15962 or 16014 to 16028 (derived from SEQ ID NO: 198), SEQ ID NO: 15963 to 15972 or 16029 to 16038 (derived from SEQ ID NO: 199), SEQ ID NO: 15973 to 15975 or 16039 to 16107 (derived from SEQ ID NO: 200), or SEQ ID NO: 15976 or 16042 (derived from SEQ ID NO: 201); 17. The compound of embodiment 16, wherein the compound is represented by a nucleotide sequence comprising or consisting of any one of: [Embodiment 18] A composition comprising a compound according to any one of embodiments 1 to 17. [Embodiment 19] A compound according to any one of embodiments 1 to 17 or a composition according to embodiment 18 for use as a medicament for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD) or for inducing skipping of exon 51 of dystrophin pre-mRNA. [Embodiment 20] The compound according to any one of embodiments 1 to 17 or the composition according to embodiment 18 for use as a medicament for inducing skipping of exon 51 of dystrophin pre-mRNA. [Embodiment 21] A method for preventing, treating, and / or delaying Duchenne muscular dystrophy (DMD), comprising administering to a subject a compound described in any one of embodiments 1-17 or a composition described in embodiment 18. [Embodiment 22] A method for skipping exon 51 of dystrophin pre-mRA, comprising administering to a subject a compound described in any one of embodiments 1 to 17 or a composition described in embodiment 18.

[0237] List of References Aartsma-Rus et al., Hum Mol Gen 2003;12(8):907-14. Arai K et al.Bioorg. Med. Chem. 2011, 21, 6285 Baltimore, MD: Lippincott Williams & Wilkins, 2000 Beekman etal., PLoS ONE 2014;9(9): e107494 Beekman et al., PLoS ONE 2018;13(4): e0195850 Bolli et al., Chem Biol. 1996 Mar;3(3):197-206 Braida C., et al, Human Molecular Genetics, 2010, vol 9: 1399-1412 Bruno, K., Advanced Drug Delivery Reviews 2011;63: 1210. Cao et al., Mol. Ther. Nucleic Acids, 2016, doi:10.1038 / mtna.2016.46 Cartegni L, et al, Nat Rev Genet 2002;3(4):285-98. Cartegni L, et al, Nucleic Acids Res 2003;31(13):3568-71 Cirak et al., Lancet 2011;378: 595-605. Diebold S.S., et.al., Eur J Immunol. 2006;Dec;36(12):3256-67. Disterer et al., Mol Ther 2013, 21(3):602-609 doi: 10.1021 / ja710342q doi: 10.1093 / nass / 1.1.241 doi: 10.1021 / jo100170g DOI: 10.1021 / jo402690j doi: 10.1021 / acs.joc.5b00184 Dominski and Kole, PNAS 1993, 90(18):8673-8677 Dorn and Kippenberger, Curr Opin Mol Ther 2008;10(1): 10-20 Du et al., PNAS 2007, 104(14):6007-12 Ehmsen J. et al, J. Cell Sci. 2002, 115 (Pt14): 2801-2803. Evers et al. PLoS ONE 2011, 6 (9) e24308 Evers et al., Nucleic Acid Ther 2014, 24(1):4-12 Fairbrother et al., Science 2002, 297(5583) : 1007-1013 Fairbrother et al., Nucleic Acids 2004, 32 : W187-190 Friedman et al., J Biol Chem 1999, 274(51):36193-36199 Gao et al., Cell Transplant 2008, 17(7):723-34 Gao et al., Mol Ther Nucleic Acids 2015, 4:e255 Gedicke-Hornung et al., EMBO Mol Med 2013, 5(7):1060-77 Giles et al., Antisense Nucleic Acid Drug Dev 1999, 9(2):213-20 Goemans et al., N Engl J Med. 2011;364(16):1513-22. Goto et al., J Invest Dermatol 2006, 126(12):2614-20 Goyenvalle et al., Nat Med 2015, 21(3):270-5 Han et al., Nature Communications, 2016, doi:10.1038 / ncomms10981 Hanessian et al., J. Org. Chem., 2013, 78 (18), pp 9064-9075 Heemskerk et al., Mol Ther 2010;18(6):1210-7. Hodgetts S., et al, Neuromuscular Disorders 2006;16: 591-602 Hua et al., Am J Hum Genet 2008, 82(4): 834-48 Hua et al., Nature 2011, 478(7367):123-6 Karras et al., Biochemistry 2001, 40(26):7853-9 Khoo et al., BMC Mol Biol 2007, 8;3 Krieg AM. et al., Nature 1995;374: 546-549. Krieg, A. M., Curr. Opin. Immunol. 2000;12: 35-43. Kumar L, Pharm. Technol. 2008, 3, 128 Lentz et al., Nat Med 2013, 19(3):345-350 Manzur A.Y. et al., Wiley publishers, 2008. The Cochrane collaboration. Mercatante et al., J Biol Chem 2002, 277(51):49374-82 Monaco A.P., et al. , Genomics 1988;2: 90-95. Murray et al., Nucl. Acids Res., 2012, Vol. 40, No. 13 6135-6143 Nishida et al. Chem. Commun. 2010, 46, 5283 Opalinska et al., Nucleic Acids Res., 2004, 32(19): 5791-5795 Osawa et al., J. Org. Chem., 2015, 80 (21), pp 10474-10481 Osorio et al., Sci Transl Med 2011, 3(106):106ra107 Owen et al., PLoS One 2012, 7(3):e33576 Peacey et al., NAR 2012, 40(19):9836-49 Peacock H et al. J. Am. Chem. Soc. 2011, 133, 9200 Popovic PJ. et al. J of Immunol 2006;177: 8701-8707. Remington: The Science and Practice of Pharmacy, 20th Edition. Renshaw et al., Mol Cancer Ther 2004, 3(11):1467-84 Rincon et al., Am J Hum Genet 2007, 81(6):1262-1270 Seth et al., J. Org. Chem. 2010, 75, 1569-1581 Spitali et al., FASEB J 2013, 27(12): 4909-4916 Taniguchi-Ikeda et al., Nature 2011, 478(7367):127-31 Tyson-Capper et al., Mol Pharmacol 2006, 69(3):796-804 Uchikawa et al., J Hum Genet 2007, 52(11):891-897 Uehara et al., FASEB J 2013, 27(1):76-85 van Deutekom et al., N Engl J Med. 2007;357(26):2677-86. van Ommen, van Deutekom, Aartsma-Rus, Curr Opin Mol Ther. 2008;10(2):140-9. Veltrop et al., 2018;PLoS ONE 13(2):e0193289 Verheul et al., 2016; PLoS ONE 11(9):e0162467 Vetrini et al., Hum Mutat 2006, 27(5):420-6 Vickers et al., J Immunol 2006, 176(6):3652-61 Voit et al., Lancet Neurol 2014, 13(10):987-96 Wagner, H., Adv. Immunol. 1999;73:329-368. Wein et al., Hum Mut 2010, 31(2):136-42 Wheeler et al., J Clin Invest 2007, 117(12):3952-7 Williams et al., Oligonucleotides 2006, 16(2):186-95 WO 2011 / 097641 (ISIS / Ionis Pharmaceuticals) WO 2014 / 112463 (Obika S et al.) WO 2014 / 126229 (Mitsuoka Y et al.) WO 2014 / 145356 (MiRagen Therapeutics) WO 2015 / 142910 (Ionis Pharmaceuticals) WO2016 / 017422 (Osaka University) According to Yamamoto et al. Org. Biomol. Chem. Rev. 2015, 13, Yokota, Duddy, Partidge, Myol Acts. 2007;26(3):179-84. Straarup et al., 2010;Nucleic Acids Res 38(20):7100-7111 Zammarchi et al., PNAS 2011, 108(43):17779-84 Zuker M., et al, Nucleic Acids Res. 2003;31(13):3406-15.

Claims

1. A compound comprising a first and a second antisense oligonucleotide (AON) linked to each other by a linking moiety, The first antisense oligonucleotide is represented by a nucleotide sequence consisting of SEQ ID NOs: 15911 to 15922 or 15977 to 15988; The compound, wherein the second antisense oligonucleotide is represented by a nucleotide sequence consisting of SEQ ID NOs: 15948 to 15962, or 16014 to 16028.

2. The compound of claim 1, wherein the linking portion links the 3'-terminal monomer of the first AON to the 5'-terminal monomer of the second AON, or links the 5'-terminal monomer of the first AON to the 3'-terminal monomer of the second AON.

3. 3. The compound of claim 1 or 2, wherein the linking moiety is a polyethylene glycol (PEG) linker, a triethylene glycol (TEG) linker, or a hexaethylene glycol (HEG) linker.

4. The compound of claim 3 , wherein the linking moiety is a triethylene glycol (TEG) or hexaethylene glycol (HEG) linker.

5. A composition comprising a compound according to any one of claims 1 to 4.

6. A compound according to any one of claims 1 to 4 or a composition according to claim 5 for use as a medicament for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD) or for inducing skipping of exon 51 of dystrophin pre-mRNA.

7. A compound according to any one of claims 1 to 4 or a composition according to claim 5 for use as a medicament for inducing skipping of exon 51 of dystrophin pre-mRNA.

Images