Gene sequence constructs for the treatment of central nervous system disorders

Abstract

The present invention provides a gene sequence construct for treating central nervous system diseases, in which a vector is constructed and expressed by auto-processing, and tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), etc. are expressed. The proteins are linked to each other via an auto-processing unit (APU), and the vector is targeted and introduced into target cells using a viral vector to ultimately produce efficiently expressed, independently functional tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), etc. for the prevention or treatment of Parkinson's disease, Alzheimer's disease, and other neurodegenerative diseases.

Description

[Technical field]

[0001] The present invention relates to the field of gene therapy, in particular to gene sequence constructs for the treatment of central nervous system diseases, which may be used for the prevention or treatment of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases. [Background technology]

[0002] Parkinson's disease (PD) is a neurodegenerative disease characterized by the loss of dopaminergic neurons in the substantia nigra, which reduces midbrain dopamine levels. Parkinson's disease affects approximately 1% of the world's population aged 55 years or older, and the number of patients continues to increase with the aging of society. The common treatment for Parkinson's disease is the oral administration of levodopa, a precursor of dopamine, which can alleviate symptoms to some extent. However, with the development of the disease, levodopa treatment is not satisfactory.

[0003] Gene therapy has a unique advantage in the treatment of Parkinson's disease, and by targeting and transmitting dopamine synthesis genes to the striatum, dopamine can be synthesized and released in the striatum, thereby making the treatment of Parkinson's disease more effective. Tyrosine is catalyzed by tyrosine hydroxylase (TH) to synthesize levodopa, and then aromatic amino acid decarboxylase (AADC) converts levodopa to dopamine. TH requires tetrahydrobiopterin as a coenzyme, but tetrahydrobiopterin is synthesized by GTP-cyclohydrolase 1 (GCH1), so dopamine can be efficiently synthesized by the expression of TH, AADC and GCH1 (Azzouz M et al., 2002. J Neurosci. 22(23):10302-12. JNeurosci B et al., 2009. Sci Transl Med. 1(2):2).

[0004] In 2014, a lentiviral vector based on the Equine Infectious Anemia Virus (EIAV) containing three major dopamine synthase enzymes linked by two internal ribosome entry sites (IRES) has shown good results in phase I / II clinical trials (Palfi S et al., 2014. Lancet. 383(9923):1138-46.). However, this method has many problems, such as the fact that expressing three genes with IRES always results in unbalanced expression. Therefore, Stewart HJ et al. replaced the IRES element with a linker peptide to generate a fusion protein containing two or more of the three enzyme activities required for dopamine synthesis (tewart HJ et al., 2016. Hum Gene Ther Clin Dev. 27(3):100-10.). However, in the natural state, the three proteins TH, AADC and GCH1 are expressed in the form of independent proteins, and the fusion protein may affect the efficiency of dopamine synthesis. Therefore, finding a new protein-coupled expression method, selecting an appropriate vector to introduce into target cells and express them efficiently remains a problem to be solved in the treatment of Parkinson's disease. Summary of the Invention [Problem to be solved by the invention]

[0005] In response to the shortcomings of conventional treatment techniques, the present invention aims to construct and express vectors by auto-processing, and express tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), and neural growth factor, etc., and then bind the proteins together by an auto-processing unit (APU), and then target and deliver them to target cells by a viral vector, ultimately producing highly expressed and independently functional tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), etc. for the treatment of Parkinson's disease. [Means for solving the problem]

[0006] The present invention includes the following: A gene sequence construct for treating a central nervous system disease, the construct being a nucleotide sequence related to the treatment of a central nervous system disease, which is linked by an automated processing unit (APU); Preferably, the nucleotide sequences related to the treatment of central nervous system diseases in the gene sequence construct for the treatment of central nervous system diseases are two or more selected from tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), and nervous system growth factor nucleotide sequences; At least two of the nucleotide sequences are bound by an automated processing unit (APU), the automated processing unit (APU) comprising an N-terminal autoprocessing structural domain and / or a C-terminal autoprocessing structural domain; Preferably, the nervous system growth factor is nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), neurotrophic factor (NGF), nutrition Neuroprotective factor-3 (NT-3), nutrition Neurotransmitter-4 / 5 (NT-4 / 5), nutritionneurotrophic factor-6 (NT-6), ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF) and the GDNF family of molecules (naturally occurring analogs of GDNF, neurturin, persephin and artemin); Preferably, the gene sequence construct for treating central nervous system diseases comprises tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), At least two of the nucleotide sequences are combined by an automated processing unit (APU); Preferably, the N-terminal autoprocessing domain comprises an intein, a B-type bacterial intein-like domain (BIL), a furin sequence, or a derivative thereof; Preferably, the C-terminal autoprocessing structural domain comprises a 2A peptide or a 2A-like peptide, Preferably, the 2A peptide or 2A-like peptide in the gene sequence construct for treating central nervous system diseases is 2A peptide (F2A) derived from foot and mouth disease virus; Buta Tessho These include a virus-derived 2A peptide (P2A), an insect virus-derived 2A peptide (T2A), and an equine rhinitis virus-derived 2A peptide (E2A).

[0007] The auto-processed 2A peptide is most early derived from foot-and-mouth disease virus (FMDV). FMDV belongs to the genus Foot-and-Mouth Disease Virus of the small RNA virus family. The high-level structure that can be formed in the translation process of the protease 2A encoded by the FMDV genome sterically hinders the center of the ribosomal peptidyl transferase, and normal peptide chain bonds cannot be formed, but at the same time, the ribosome can continue to translate downstream proteins, thereby forming a proteolytic enzyme-like action that "cuts" two proteins in cis, one before and one after, and the other ... Buta TesshoViruses and the like also contain 2A peptides, and similar gene sequences with the function of 2A peptides have been found in insect viruses, C-type rotaviruses and trypanosoma-type repeat sequences. The autoprocessing sequence of 2A peptides or 2A-like peptides, like internal ribosome entry sites (IRES), is often used in multi-gene expression to achieve the purpose of independently expressing two or more non-fusion foreign proteins. Compared with IRES, 2A peptides or 2A-like peptides have obvious advantages in the construction of multi-gene expression vectors, for example, 2A peptides or 2A-like peptides are small and have a good expression balance of the upstream and downstream genes linked by the 2A element. The present invention uses the autoprocessing peptide P2A to bind three proteins, TH, AADC and GCH1, to obtain independent and efficient expression of the three proteins.

[0008] A viral vector genome, comprising any one of the gene sequence constructs for treating a central nervous system disease described above; The viral vector includes a lentiviral vector or an adeno-associated viral vector.

[0009] A lentiviral vector system comprising a genome containing a gene sequence construct for the treatment of a central nervous system disease as described above, and one or more nucleotide sequences encoding gag and pol proteins and nucleotide sequences of other necessary viral packaging components.

[0010] A biological preparation comprising any of the above gene sequence constructs, the biological preparation being used for the treatment and / or prevention of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases. A biological preparation comprising any of the above gene sequence constructs, the biological preparation further comprising a construct viral vector system comprising the above gene sequence and other necessary viral packaging components, the biological preparation being formed by adding a pharma- ceutically acceptable vector or diluent to the viral particle, for use in the preparation of a drug for producing dopamine in the body, and for the treatment and / or prevention of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases.

[0011] Specifically, the gene sequence construct comprises two or more nucleotide sequences selected from tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), and aromatic amino acid dopa decarboxylase (AADC), At least two of the nucleotide sequences are linked by an automated processing unit (APU).

[0012] A gene sequence construct is selected, comprising tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), and aromatic amino acid dopa decarboxylase (AADC) nucleotide sequences, and at least two of the nucleotide sequences are combined by an automated processing unit (APU), and the gene sequence comprises the following construction scheme: T.H. -APU- CH1 -APU- AADC, T.H. -APU- CH1 -他の配列- AADC, T.H. -他の配列- CH1 -APU- A.A.D.C., T.H. -APU- AADC -APU- CH1, TH -他の配列- AADC -APU- CH1, TH -APU- AADC -他の配列- CH1, CH1 -APU- T.H. -APU- AADC, CH1 -APU- T.H. -他の配列- AADC;CH1 -他の配列- T.H.-APU -A.A.D.C., CH1 -APU- AADC -APU- TH, CH1 -APU- AADC -他の配列- TH, CH1 -他の配列- AADC -APU- T.H., AADC -APU- T.H. -APU- CH1, AADC -APU- T.H. -他の配列- CH1, AADC -他の配列- T.H. -APU- CH1, AADC -APU- CH1 -APU- TH;AADC -APU- CH1 -他の配列- T.H., A.A.D.C. -他の配列- CH1 -APU- T.H.

[0013] The APU is an automated processing unit, and other sequences include a linker peptide coding sequence (linker), an internal ribosome entry site (IRES), a promoter or an intein. The automated processing unit (APU) in this construct comprises a 2A peptide or a 2A-like peptide. The 2A peptide or 2A-like peptide in the gene sequence construct is a 2A peptide (F2A) derived from foot and mouth disease virus; Buta Tessho These include a virus-derived 2A peptide (P2A), an insect virus-derived 2A peptide (T2A), and an equine rhinitis virus-derived 2A peptide (E2A).

[0014] When the gene sequence construct includes a promoter, the promoter may be a constitutive promoter or a tissue-specific promoter, where constitutive promoters include the CMV promoter, the phosphoglycerate kinase promoter, or the thymidine kinase promoter, and tissue-specific promoters include the synapsin promoter, the CD68 promoter, the GFAP promoter, or other synthetic promoters.

[0015] Compared with the prior art, the present invention has the following advantages: 1. The present invention provides a new method for linking dopamine synthesis genes. Experimental research of the present invention shows that this method can improve the balance of target protein expression, increase the synthesis level of dopamine and its metabolites, and improve the therapeutic effect of anti-Parkinson's disease. 2. The present invention is the first to identify the expression of P2A autoprocessing peptides that bind to various proteins, and finally produces tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), and neural growth factor, which are stably expressed and have independent functions, and can provide a new strategy for the treatment and / or prevention of Parkinson's disease and other neurodegenerative diseases. [Brief description of the drawings]

[0016] In order to more clearly describe the technical solutions in the embodiments of the present invention or the prior art, the following briefly introduces drawings necessary for describing the embodiments or the prior art. Obviously, the drawings described below are only some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without creative labor.

[0017] [Figure 1] FIG. 1 is a schematic diagram of a gene sequence construct for Parkinson's disease gene therapy of the present invention. [Diagram 2] FIG. 1 is a schematic diagram of the structure of a construct of the present invention. [Diagram 3] FIG. 1 shows Western blot detection of aromatic amino acid dopa decarboxylase (AADC), GTP-cyclohydrolase I (GCH1), and tyrosine hydroxylase (TH) proteins after transduction of 293T cells. [Figure 4]FIG. 1 shows Western blot detection of aromatic amino acid dopa decarboxylase (AADC), GTP-cyclohydrolase I (GCH1), and tyrosine hydroxylase (TH) proteins after transduction of SH-SY5Y cells. [Diagram 5] FIG. 1 shows the results of HPLC detection of dopamine and DA production after virus transduction into SH-SY5Y cells.

[0018] In FIG. 1, the coding sequence expressing aromatic amino acid dopa decarboxylase (AADC), GTP-cyclohydrolase I (GCH1), and tyrosine hydroxylase (TH) is included, and the proteins are linked by the autoprocessing peptide P2A. After the gene is transcribed and translated and processed by the autoprocessing peptide, it can generate independent aromatic amino acid dopa decarboxylase (AADC-P2A), GTP-cyclohydrolase I (GCH1-P2A), and tyrosine hydroxylase (TH), and P2A is Buta Tessho This is the viral 2A autoprocessing peptide.

[0019] In Figure 2, AADC is aromatic amino acid dopa decarboxylase, GCH1 is GTP-cyclohydrolase I, TH is tyrosine hydroxylase, and P2A is Buta Tessho The 2A processing peptide of the virus; Synapsin, CMV, SV40 and PGK are all promoters.

[0020] In Figure 3, Blank is the virus-free transduction group, GFP:CMV promoter-EGFP viral transduction group, PD-1 is the Synapsin promoter-AADC-P2A-GCH1-P2A-TH viral transduction group, PD-2 is the CMV promoter-AADC-P2A-GCH1-P2A-TH viral transduction group, P:CMV promoter-AADC-SV40 promoter-TH-PGK promoter-GCH1 viral transduction group, Endo-TH is the endogenous TH of the cells, and Exo-TH is the exogenously overexpressed catalytic domain-only TH.

[0021] In Figure 4, Blank is the virus-free transduction group, GFP:CMV promoter-EGFP viral transduction group, PD-1 is the Synapsin promoter-AADC-P2A-GCH1-P2A-TH viral transduction group, PD-2 is the CMV promoter-AADC-P2A-GCH1-P2A-TH viral transduction group, P:CMV promoter-AADC-SV40 promoter-TH-PGK promoter-GCH1 viral transduction group, Endo-TH is the cell-intrinsic TH, and Exo-TH is the exogenously overexpressed catalytic domain-only TH.

[0022] In Figure 5, GFP is the GFP viral transduction group, and PD-2 is the CMV promoter-AADC-P2A-GCH1-P2A-TH viral transduction group. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The present invention will be described in more detail below with reference to examples. The following examples are provided to illustrate the present invention, but the present invention is not limited to the following examples.

[0024] Working Example: 1. Construction of various constructs as shown in Figure 2: KL0039 vector, artificially synthesized CMV enhancer-synapsin promoter-AADC-P2A-GCH1-P2A-TH and AADC-SV40 promoter-TH-PGK promoter-GCH1 sequences (wherein TH is truncated TH) are used, and the CMV enhancer-synapsin promoter-AADC-P2A-GCH1-P2A-TH is ligated into a pUC57 vector (pUC57-synapsin-AGT), where the KL0039 vector is a lentiviral transfer vector selected from existing lentiviral vectors or lentiviral vectors partially modified as necessary.

[0025] 1. Construction of PD1 vector Using the KL0039 vector as a template, Age-F+Sal-R is used to amplify the sequence between WPRE and cPPT, and the PCR product is collected by electrophoresis and purified. The primer sequences used are Age-F, i.e., CTGAGTGCCATTGGATGA caatcaacctctggattaca, and Sal-R, i.e., gattactattaataactactcacgcatgctcttctcca. At the same time, the pUC57-synapsin-AGT plasmid is enzymatically digested with AgeI and SalI, and a 4.1 kb band is collected. The collected and purified PCR product is ligated with the enzymatically digested synapsin-AGT fragment via T4 DNA ligase, and then transformed into DH5α competent cells. Several single clones are selected for PCR identification, and the positive clones are confirmed by sequencing.

[0026] 2. Construction of PD2 Vector Using the KL0039 vector as a template, amplify the CMV Promoter sequence using primers SnaBI-F, i.e., TCAGtacgtattagtcatcgctat, and SpeI-R, i.e., CGATactagtgagctctgcttatataga, and collect and purify the PCR product (245 bp) by electrophoresis. The CMV promoter and pUC57-Synapsin-AGT plasmid are simultaneously double-enzymatically digested with SnaBI and SpeI, and the CMV Promoter and pUC57-AGT fragments are respectively collected and purified, and then ligated by T4 DNA ligase and transformed into DH5α competent cells. Select monoclonal transformants for PCR identification. Confirm the positive clone by sequencing. This positive clone is named pUC57-CMV-AGT plasmid. Then, using the KL0039 vector as a template, amplify the sequence between WPRE and cPPT using Age-F+Sal-R, and collect and purify the PCR product by electrophoresis. The PCR product and pUC57-CMV-AGT plasmid are simultaneously double enzyme digested with AgeI and SalI, and the PCR product and CMV-AGT fragment are recovered by electrophoresis and purified. After being ligated by T4 DNA ligase, they are transformed into DH5α competent cells. Monoclonal transformants are selected for PCR identification. Positive clones are confirmed by sequencing.

[0027] 3. Vector construction: The AGT sequence of the PD2 vector was replaced with the sequence AADC-SV40 promoter-TH-PGK promoter-GCH1.

[0028] 4. The EGFP sequence was cloned into the GFP vector to replace the AGT sequence in the PD2 vector.

[0029] Evaluate the difference in target protein expression of different constructs after transduction of 293T and SH-SY5Y cells

[0030] 293T cell line was transfected instantly with lentivirus 4-plasmid system to package GFP (CMV promoter-EGFP), PD1 (synapsin promoter-AGT), PD2 (CMV promoter-AGT) lentivirus and positive control virus P (CMV promoter-AADC-SV40 promoter-TH-PGK promoter-GCH1) respectively. The initial viruses were purified, concentrated, diluted and transduced into 293T cells, and titers were measured by RT-PCR (WPRE / ALB). The titers of all constructs were similar, with a titer range of 3.4E+09TU / ml to +8.74E+09TU / ml.

[0031] To study the expression levels of the target proteins, 293T cells are transduced with virus MOI=10 for each group, and SH-SY5Y cells are transduced with MOI=20, and cell lysates are collected for Western blot of AADC, GCH1 and TH after transduction for 72 hours, respectively. The results show that in 293T cells, low TH is detected for endogenous proteins, but AADC and GCH1 are not detected. All proteins are the same as expected. Compared with the blank transduction group without virus and the GFP virus transduction control group, the highest level of expression of all three proteins comes from the PD2 virus vector, and the AADC level of the P virus vector is the highest, while the other two proteins GCH1 and TH are basically undetectable. In the case of the PD1 virus vector, its promoter is the neuron-specific promoter Synapsin, so it is the same as expected, and none of the three target proteins are expressed in 293T cells (Figure 3). Furthermore, we detected the expression of the target proteins of the three different constructs in the neuronal SH-SY5Y cells, and both endogenous proteins TH and AADC were expressed, but GCH1 was not detected, and the molecular weights of all proteins are the same as expected. Consistent with the results of 293T cells, compared with the blank transduced group without virus and the GFP viral transduced control group, the highest level of expression of all three proteins still comes from the PD2 viral vector, with the highest level of AADC in the P viral vector, while the other two proteins GCH1 and TH are still essentially undetectable. In the case of the PD1 viral vector, only a small amount of expression of AADC and TH is seen, and GCH1 is essentially undetectable (Figure 4).

[0032] 3. Evaluate the difference in catecholamine production of different constructs after transduction of SH-SY5Y cells

[0033] DA in neurons is primarily converted to dihydroxyphenylacetic acid (DOPAC) by monoamine oxidase (MAO). We used lentiviral vectors to transduce two types of cells, SHSY5Y cells and 293T cells, and used mass spectrometry to detect the amount of dopamine produced in the supernatant of the transduced cells. After the virus was transduced into SH-SY5Y cells, the medium was replaced overnight, the culture was continued until the third day, the cell culture fluid was collected, centrifuged at 4500 rpm for 5 min, the culture supernatant was transferred to a 1.5 mL centrifuge tube, and stored in a -80 °C refrigerator for detection, after the virus was transduced into SH-SY5Y cells, the medium was replaced overnight, the cells were subcultured 1:10 after 2 days of culture, the medium was replaced with fresh medium containing 10 mM L-Tyrosine, the culture was continued until the next morning, the cell culture fluid was collected, centrifuged at 4500 rpm for 5 min, the culture supernatant was transferred to a 1.5 mL centrifuge tube, and stored in a -80 °C refrigerator for detection.

[0034] The method of detecting dopamine content in samples using mass spectrometry is as follows: take 500μL of cell culture medium, add an appropriate amount of internal standard, dilute and mix with 1mL of 50mM ammonium acetate as sample loading solution, activate with methanol, wash with 20mM ammonium acetate, acetonitrile:isopropanol (1:1), suction dry the cartridge, then elute with 2% formic acid acetonitrile solution, dry with nitrogen, dissolve the residue in 100μL of 0.1% FA, centrifuge at 15000r / min for 5min, take the supernatant and analyze with a machine (Angilent 1290UPLC-6470MS / MS detection system).

[0035] The results are shown in Figure 5, which shows that 293T cells and SH-SY5Y cells transduced with the KL-PD2 lentiviral vector significantly increased the production of dopamine in the cell supernatant due to the efficient and uniform expression of the three dopamine synthases.

[0036] It should be noted that in the specific examples described herein, the names of various substances or vectors may be different. All equivalent or simple modifications made according to the structure and principles described in the patent concept of the present invention are all within the scope of protection of the patent of the present invention. Those skilled in the art may make various modifications or supplements to the specific examples described, or substitute in a similar manner, but as long as they do not deviate from the structure of the present invention or go beyond the scope defined by the claims, they should all be included in the scope of protection of the present invention. The inventions described in the original claims of this application are listed below. [Invention 1] A gene sequence construct for treating a central nervous system disease, comprising: A gene sequence construct for the treatment of a central nervous system disease, characterized in that the construct is a nucleotide sequence related to the treatment of a central nervous system disease bound by an automated processing unit (APU). [Invention 2] A gene sequence construct for treating a central nervous system disease as described in Invention 1, characterized in that the automatic processing unit (APU) comprises an N-terminal automatic processing structural domain and / or a C-terminal automatic processing structural domain. [Invention 3] The N-terminal autoprocessing domain includes an intein, a B-type bacterial intein-like domain (BIL), a furin sequence, and derivatives thereof; A gene sequence construct for treating a central nervous system disease according to invention 2, characterized in that the C-terminal autoprocessing structural domain contains a 2A peptide or a 2A-like peptide. [Invention 4] A gene sequence construct for treating central nervous system diseases described in Invention 3, characterized in that the 2A peptide or 2A-like peptide includes a 2A peptide (F2A) derived from foot-and-mouth disease virus, a 2A peptide (P2A) derived from porcine rhinitis virus, a 2A peptide (T2A) derived from an insect virus, and a 2A peptide (E2A) derived from equine rhinitis virus. [Invention 5] The nucleotide sequence related to the treatment of a central nervous system disease includes two or more selected from tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC), and nervous system growth factor nucleotide sequences; A gene sequence construct for treating a central nervous system disease according to invention 1, characterized in that at least two of the nucleotide sequences are combined by an automated processing unit (APU). [Invention 6] The nervous system growth factors include nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), nerve growth factor-3 (NT-3), nerve growth factor-4 / 5 (NT-4 / 5), nerve growth factor-6 (NT-6), ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF) and the GDNF molecule family; A gene sequence construct for treating central nervous system diseases according to invention 5, characterized in that the GDNF molecule family includes naturally occurring analogues of GDNF, neural rank proteins, persephin and artemin. [Invention 7] The construct comprises tyrosine hydroxylase (TH), GTP-cyclohydrolase I (GCH1), and aromatic amino acid dopa decarboxylase (AADC); A gene sequence construct for treating a central nervous system disease according to invention 5, characterized in that at least two of the nucleotide sequences are linked by an automated processing unit (APU). [Invention 8] A viral vector genome, The viral vector genome comprises a gene sequence construct for treating a central nervous system disease according to any one of claims 1 to 7; The viral vector is characterized in that it comprises a lentivirus vector or an adeno-associated virus vector. [Invention 9] 1. A lentiviral vector system comprising: The lentiviral vector system is characterized in that it comprises a genome including a gene sequence construct for treating a central nervous system disease described in any one of Inventions 1 to 7. [Invention 10] A biological preparation comprising a gene sequence construct according to any one of claims 1 to 7 for use in the treatment and / or prevention of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases.

Claims

1. A gene sequence construct for treating a central nervous system disease, comprising: The construct comprises a plurality of nucleotide sequences related to the treatment of a central nervous system disorder, the plurality of nucleotide sequences includes a nucleotide sequence of a tyrosine hydroxylase (TH), a nucleotide sequence of a GTP-cyclohydrolase I (GCH1), and a nucleotide sequence of an aromatic amino acid decarboxylase (AADC); the nucleotide sequences of TH, GCH1 and AADC are linked by a nucleotide sequence encoding an automatic processing unit (APU) comprising a 2A peptide; and The construct comprises a constitutive promoter. A gene sequence construct for treating a central nervous system disease, comprising:

2. The gene sequence construct for treating central nervous system diseases as described in claim 1, characterized in that the 2A peptide comprises a 2A peptide derived from foot-and-mouth disease virus (F2A), a 2A peptide derived from porcine teschovirus (P2A), a 2A peptide derived from an insect virus (T2A), or a 2A peptide derived from equine rhinitis virus (E2A).

3. The gene sequence construct for treating a central nervous system disease according to claim 1, further comprising a nucleotide sequence for a nervous system growth factor.

4. The gene sequence construct for treating central nervous system diseases according to claim 3, characterized in that the nervous system growth factor comprises nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophic factor-3 (NT-3), neurotrophic factor-4 / 5 (NT-4 / 5), neurotrophic factor-6 (NT-6), ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), or GDNF molecule family.

5. 5. The gene sequence construct for the treatment of central nervous system diseases according to claim 4, wherein said GDNF family of molecules comprises naturally occurring analogues of GDNF, neurturin, persephin, or artemin.

6. A viral vector genome comprising a gene sequence construct for the treatment of a central nervous system disease according to any one of claims 1 to 5, The viral vector comprises a lentiviral vector or an adeno-associated viral vector. The viral vector genome.

7. A lentiviral vector system comprising a gene sequence construct for the treatment of a central nervous system disease according to any one of claims 1 to 5.

8. A biological preparation comprising a gene sequence construct according to any one of claims 1 to 5.

9. A gene sequence construct according to any one of claims 1 to 5, a viral vector genome according to claim 6, a lentiviral vector system according to claim 7 or a biological preparation according to claim 8 for use in the treatment and / or prevention of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases.

Images