Heart failure responsive enhancer polynucleotide and expression vector containing said enhancer polynucleotide

Abstract

The present invention addresses the problem of providing a polynucleotide which can be inserted into an expression vector and can enhance the transcriptional activity of a predetermined promoter under heart failure.　The problem is solved by means of an enhancer polynucleotide including a polynucleotide comprising a sequence having at least 80% identity with a sequence represented by SEQ ID NO: 1 or a polynucleotide comprising a sequence having at least 80% identity with a sequence represented by SEQ ID NO: 2, wherein the enhancer polynucleotide responds to heart failure (where the enhancer polynucleotide excludes a polynucleotide having the same sequence as a sequence represented by SEQ ID NO: 13 and a polynucleotide having the same sequence as a sequence represented by SEQ ID NO: 12).

Description

[Technical field]

[0001] Disclosed herein are heart failure responsive enhancer polynucleotides, expression vectors comprising said enhancers, compositions for gene therapy, and compositions for preventing and / or treating heart failure. [Background technology]

[0002] Heart failure generally refers to a pathological condition in which the function of the heart is reduced due to various causes such as myocardial infarction, ischemic heart disease such as angina pectoris, cardiomyopathy, hypertension, etc. Currently, atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and its precursor protein proBNP, etc. are known as biomarkers for diagnosing such heart failure (Non-Patent Document 1). By measuring these markers, it is possible to know whether a patient has heart failure or the severity of the condition.

[0003] Patent Document 1 and Non-Patent Document 2 disclose a non-human transgenic animal into which an expression control gene region of a gene encoding ANP and / or BNP induced by heart failure and a base sequence containing a reporter gene are introduced. In Patent Document 1 and Non-Patent Document 2, the expression control gene region of a gene encoding ANP and / or BNP induced by heart failure is referred to as the CR9 region. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2015-084764 A [Non-patent literature]

[0005] [Non-Patent Document 1] LSNielsen,etal.,;EurJHeartFail, 6 (2004), pp. 63-70 [Non-Patent Document 2] Matsuoka K, et al. :FASEB J., 28 (4) (2014), pp. 1870-9., doi: 10.1096 / fj.13-245522. Epub 2014 Jan 3. Summary of the Invention [Problem to be solved by the invention]

[0006] In recent years, gene therapy has been applied clinically one after another. In gene therapy, the most important issue is to express a gene required for therapy in a target cell or disease-specific manner in a living body. Furthermore, cell-specific viral vectors and the like have been developed for gene therapy, but the length of polynucleotide that can be inserted into a viral vector may be limited. For this reason, when a target gene to be inserted into a viral vector is large, it is necessary to shorten the transcriptional regulatory region and other regions that express the target gene as much as possible.

[0007] An objective of the present invention is to provide a polynucleotide that can be inserted into an expression vector and that can enhance the transcription activity of a specific promoter under conditions of heart failure. [Means for solving the problem]

[0008] As a result of extensive research, the present inventors have found an enhancer sequence that is more responsive to heart failure than the CR9 region reported in Non-Patent Document 2.

[0009] The present invention has been completed based on this finding, and includes the following aspects.

[0010] Section 1. A polynucleotide having a sequence having 80% or more identity with the sequence represented by SEQ ID NO:1, or A polynucleotide having a sequence having 80% or more identity with the sequence represented by SEQ ID NO: 2; wherein the enhancer polynucleotide is responsive to heart failure (provided that the enhancer polynucleotide excludes a polynucleotide having an identical sequence to the sequence represented by SEQ ID NO: 13 and a polynucleotide having an identical sequence to the sequence represented by SEQ ID NO: 12). Section 2. An enhancer polynucleotide comprising a polynucleotide having a sequence having 80% or more identity to the sequence represented by SEQ ID NO:1 has a sequence having 70% or more identity to the sequence represented by SEQ ID NO:4, or An enhancer polynucleotide comprising a polynucleotide having a sequence having 80% or more identity to the sequence represented by SEQ ID NO: 2, and a sequence having 70% or more identity to the sequence represented by SEQ ID NO: 7. An enhancer polynucleotide according to item 1. Section 3. (1) a sequence having 80% or more identity with the sequence represented by SEQ ID NO:1, or (2) a sequence having 80% or more identity with the sequence represented by SEQ ID NO:2; The enhancer polynucleotide according to Item 1 or 2, wherein the sequence is represented by SEQ ID NO:3. Section 4. moreover, A polynucleotide having a sequence having 90% or more identity with the sequence represented by SEQ ID NO:5, or A polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:8; The enhancer polynucleotide of any one of claims 1 to 3, comprising: Section 5. The enhancer polynucleotide comprises: A: (1) a polynucleotide comprising a sequence having 80% or more identity to the sequence represented by SEQ ID NO:1; (2) a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:5; linked directly or via an adapter, B: (3) a polynucleotide comprising a sequence having 80% or more identity to the sequence represented by SEQ ID NO: 2; (4) a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:8; linked directly or via an adapter, The length of the adaptor is 10 nucleotides or less when expressed in terms of the number of nucleotides in a single-stranded polynucleotide. An enhancer polynucleotide according to any one of items 1 to 4. Section 6. Item 2. The enhancer polynucleotide according to Item 1, wherein the total length of the enhancer polynucleotide is 200 nucleotides or less when expressed in terms of the number of nucleotides in a single-stranded polynucleotide. Section 7. An enhancer polynucleotide comprising a polynucleotide consisting of the sequence set forth in SEQ ID NO: 10 or SEQ ID NO: 11, said enhancer polynucleotide being responsive to heart failure. Section 8. 8. An enhancer polynucleotide having a reverse complementary sequence to the enhancer polynucleotide of any one of claims 1 to 7, wherein the enhancer polynucleotide is responsive to heart failure. Section 9. Item 9. An expression vector comprising a promoter polynucleotide and an enhancer polynucleotide described in any one of items 1 to 8, wherein the promoter polynucleotide is linked such that the transcriptional activity of the promoter polynucleotide is enhanced by the enhancer polynucleotide. Section 10. A composition for gene therapy comprising a polynucleotide in which a target polynucleotide is incorporated into the expression vector according to Item 9 in an expressible manner. Section 11. Item 11. The composition according to item 10, for preventing and / or treating heart failure. Section 12. A polynucleotide comprising an sgRNA sequence that binds to a polynucleotide consisting of a sequence represented by SEQ ID NO: 1, a sequence represented by SEQ ID NO: 2, a sequence represented by SEQ ID NO: 4, a sequence represented by SEQ ID NO: 5, a sequence represented by SEQ ID NO: 7, or a sequence represented by SEQ ID NO: 8, or a polynucleotide consisting of a complementary sequence thereof; or A composition for preventing and / or treating heart failure, comprising a vector capable of expressing a crRNA that binds to a polynucleotide consisting of a sequence represented by SEQ ID NO: 1, a sequence represented by SEQ ID NO: 2, a sequence represented by SEQ ID NO: 4, a sequence represented by SEQ ID NO: 5, a sequence represented by SEQ ID NO: 7, or a sequence represented by SEQ ID NO: 8, or a polynucleotide consisting of a complementary sequence thereof. Section 13. Item 13. A kit for preventing and / or treating heart failure, comprising the composition according to item 12. Effect of the Invention

[0011] The objective of the present invention is to provide a polynucleotide that can be inserted into an expression vector and that can enhance the transcription activity of a specific promoter under conditions of heart failure. [Brief description of the drawings]

[0012] [Figure 1] The design of the CR9 region knockout mouse (KO) is shown. [Diagram 2] (A) The expression levels of ANP mRNA in four wild-type mice and four KO mice. (B) The expression levels of BNP mRNA in four wild-type mice and four KO mice. [Diagram 3] (A) The results of echocardiography of sham mice and KO mice are shown. (B) Macroscopic findings of the hearts of sham mice and KO mice are shown. (C) Heart weights of sham mice and KO mice without or with TAC treatment are shown. [Figure 4] The reporter vector design is shown. [Diagram 5] The design of the reporter vector in which the CR9 region was deleted in increments of 30 bp is shown. [Figure 6]The luciferase activity of each deletion reporter vector is shown. [Figure 7] The enhancer activity sites in the CR9 region determined from each deletion reporter vector are shown. [Figure 8] 1 shows the design of a reporter vector having an enhancer sequence according to Example 1. [Figure 9] 1 shows a comparison between the reporter vector having the enhancer sequence of Example 1 and other reporter vectors. [Figure 10] An alignment of the mouse and human CR9 regions is shown. [Figure 11] 1 shows the design of a reporter vector having an enhancer sequence according to Example 2. [Figure 12] 1 shows a comparison between the reporter vector having the enhancer sequence of Example 2 and other reporter vectors. [Figure 13] Enhancer activity when 10 bp were deleted in the range of mouse CR9:120 bp (191-250 / 311-370). (A) shows the design of the construct used in the Luciferase assay. (B) shows the enhancer activity of each construct. [Figure 14] The enhancer activity of deletion mutants in which the 318-330 region, the 331-340 region, and the 341-350 region have been deleted by 4 bp each is shown. [Figure 15] Alignment of the mouse 331-342 region with the human 325-336 region is shown. [Figure 16] The enhancer activity is shown when using the 327-346 region containing the mouse 331-342 region sequence, and an enhancer sequence in which the 327-346 region is repeated three times in tandem. (A) shows the design of the construct used in the Luciferase assay. (B) shows the enhancer activity of each construct. [Figure 17]Enhancer activity of the BNP promoter vector containing the 186-244 region and the 305-365 region (also called HsCR9 120bp) in human cardiomyocytes. (A) shows the relative expression level of Nppb to that of GAPDH. (B) shows the relative expression level of Luciferase to that of GAPDH. [Figure 18] Images of luminescence from i. AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc-transfected mouse (upper row) and ii. AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc-transfected mouse (lower row) are shown. [Figure 19] 6 shows images of luminescence in the heart, liver, spleen, thymus, intestine, smooth muscle, and brain isolated from mice i. and ii., respectively. [Figure 20] iii. Images of luminescence from a mouse transfected with AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc (upper row) and iv. a mouse transfected with AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc (lower row). [Figure 21] 3. Photographs of luminescence in the heart, liver, spleen, thymus, intestine, smooth muscle, and brain isolated from mice iii and iv are shown. [Figure 22] The relative expression level of Luciferase mRNA to the amount of AAV6 DNA in the heart and liver isolated from each mouse (i. to iv.) is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] 1. Enhancer polynucleotides The first embodiment relates to an enhancer polynucleotide that responds to heart failure.Enhancer refers to a base sequence that can enhance the transcription activity of a given promoter.Therefore, enhancer polynucleotide refers to a polynucleotide that has the activity of enhancing the transcription activity of a given promoter. The nucleotide sequences represented by each SEQ ID NO: will be described later.

[0014] The enhancer polynucleotide according to the first embodiment includes an enhancer polynucleotide responsive to heart failure, comprising a polynucleotide having a sequence having 80% or more identity to the sequence shown in SEQ ID NO: 1. A sequence having 80% or more identity to the sequence shown in SEQ ID NO: 1 functions as an enhancer sequence responsive to heart failure in mammals, but functions particularly preferably in humans.

[0015] Moreover, the enhancer polynucleotide according to the first embodiment includes a polynucleotide consisting of a sequence having 80% or more identity to the sequence shown in SEQ ID NO: 2, and includes the enhancer polynucleotide that responds to heart failure. A sequence having 80% or more identity to the sequence shown in SEQ ID NO: 2 functions as an enhancer sequence that responds to heart failure in mammals, but functions particularly preferably in mice.

[0016] The identity to the sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 is not limited as long as it is responsive to heart failure. For example, the identity is 80% or more, preferably 83% or more, and more preferably 91% or more. The length of the sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 is 12 nucleotides when expressed as a single-stranded polynucleotide. The enhancer polynucleotide may contain substitution, insertion, and / or deletion of about 1 or 2 nucleotides among these 12 nucleotides. The substitution, insertion, and / or deletion of nucleotides may occur at any position among the 12 nucleotides.

[0017] An example of a sequence having 80% or more identity to the sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is the sequence shown in SEQ ID NO:3.

[0018] An enhancer polynucleotide comprising a polynucleotide having a sequence with 80% or more identity to the sequence represented by SEQ ID NO: 1 may comprise a polynucleotide having a sequence with 70% or more identity to the sequence represented by SEQ ID NO: 4. An enhancer polynucleotide comprising a polynucleotide having 80% or more identity to the sequence represented by SEQ ID NO: 1 preferably has an identity of 73% or more, 78% or more, 80% or more, 83% or more, 88% or more, 90% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% to the sequence represented by SEQ ID NO: 4. These lower limits of identity are supported in the Examples described below.

[0019] An enhancer polynucleotide comprising a polynucleotide having a sequence having 80% or more identity with the sequence represented by SEQ ID NO: 2 may comprise a polynucleotide having a sequence having 70% or more identity with the sequence represented by SEQ ID NO: 7. An enhancer polynucleotide comprising a polynucleotide having 80% or more identity with the sequence represented by SEQ ID NO: 2 preferably has an identity of 73% or more, 78% or more, 80% or more, 83% or more, 88% or more, 90% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% with the sequence represented by SEQ ID NO: 7. These lower limits of identity are supported in the Examples described below.

[0020] In this specification, an enhancer polynucleotide comprising a polynucleotide having an sequence having 80% or more identity to the sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 may be referred to as a first enhancer polynucleotide, and the sequence of the first enhancer polynucleotide may be referred to as a first enhancer sequence.

[0021] A polynucleotide having a sequence having 80% or more identity to the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 may be used as one unit, or multiple units may be linked and incorporated into the first enhancer polynucleotide as a tandem sequence. When multiple units are used, the polynucleotide having a sequence having 80% or more identity to the sequence shown in SEQ ID NO: 1 and the polynucleotide having a sequence having 80% or more identity to the sequence shown in SEQ ID NO: 2 may be the same or different.

[0022] Here, it is preferable that the first enhancer sequence does not include a polynucleotide having the same sequence as the sequence shown in SEQ ID NO:13, or a polynucleotide having the same sequence as the sequence shown in SEQ ID NO:12.

[0023] The length of the first enhancer polynucleotide is not limited as long as it is 10 nucleotides or more in terms of the number of nucleotides in a single-stranded polynucleotide. It is preferably 12 nucleotides or more. The length of the first enhancer polynucleotide is 100 nucleotides or less, 60 nucleotides or less, 59 nucleotides or less, 58 nucleotides or less, 50 nucleotides or less, or 40 nucleotides or less in terms of the number of nucleotides in a single-stranded polynucleotide. The upper limit and the lower limit of the length of the enhancer polynucleotide can be combined with each other.

[0024] The heart failure responsive enhancer polynucleotide may be a polynucleotide that includes a second enhancer sequence. The second enhancer sequence encodes a second enhancer polynucleotide.

[0025] In one embodiment, the second enhancer polynucleotide may include a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:5. The second enhancer polynucleotide preferably has 91% or more, 92% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the sequence represented by SEQ ID NO:5. The lower limit of these identities is supported in the Examples described below. In addition, the first to tenth sequences of the sequence represented by SEQ ID NO:5 preferably maintain 90% or more, or 100% identity. The second enhancer polynucleotide preferably includes a polynucleotide having 90% or more identity to the first to tenth sequences of the sequence represented by SEQ ID NO:5.

[0026] In one embodiment, the second enhancer polynucleotide may include a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:8. The second enhancer polynucleotide preferably has 91% or more, 92% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the sequence represented by SEQ ID NO:8. The lower limit of these identities is supported in the Examples described below. In addition, the first to tenth sequences of the sequence represented by SEQ ID NO:8 preferably maintain 90% or more, or 100% identity. The second enhancer polynucleotide preferably includes a polynucleotide having 90% or more identity to the first to tenth sequences of the sequence represented by SEQ ID NO:8.

[0027] Here, it is preferable that the second enhancer sequence also does not contain a polynucleotide having the same sequence as the sequence represented by SEQ ID NO:13, or a polynucleotide having the same sequence as the sequence represented by SEQ ID NO:12.

[0028] The length of the second enhancer polynucleotide is not limited as long as it is 56 nucleotides or more in terms of the number of nucleotides in a single-stranded polynucleotide. It is preferably 59 nucleotides or more. The length of the second enhancer polynucleotide is 100 nucleotides or less, or 65 nucleotides or less in terms of the number of nucleotides in a single-stranded polynucleotide. The upper limit and the lower limit of the length of the enhancer polynucleotide can be combined with each other.

[0029] Furthermore, as another embodiment, the enhancer polynucleotide responsive to heart failure may preferably comprise (1) a first enhancer polynucleotide and (2) a second enhancer polynucleotide.

[0030] When an enhancer polynucleotide responsive to heart failure comprises both a second enhancer polynucleotide and a first enhancer polynucleotide, the second enhancer polynucleotide and the first enhancer polynucleotide can be linked directly or via an adapter.

[0031] Either the first enhancer polynucleotide or the second enhancer polynucleotide may be upstream, but it is preferable that the second enhancer polynucleotide is upstream of the first enhancer polynucleotide. However, when the second enhancer polynucleotide and the first enhancer polynucleotide are linked via an adaptor, it is preferable that the second enhancer polynucleotide does not include a polynucleotide having the same sequence as the sequence represented by SEQ ID NO: 13 or a polynucleotide having the same sequence as the sequence represented by SEQ ID NO: 12. In particular, when the first enhancer polynucleotide is linked downstream of the second enhancer polynucleotide, it is preferable that the first enhancer polynucleotide does not include a polynucleotide having a sequence that is 95% or more identical to the sequence represented by SEQ ID NO: 6 or a polynucleotide having a sequence that is 95% or more identical to the sequence represented by SEQ ID NO: 9, which is linked immediately downstream of the second enhancer polynucleotide, and the first enhancer polynucleotide is linked immediately downstream of the polynucleotide.

[0032] When the first enhancer polynucleotide comprises a polynucleotide having a sequence with 80% or more identity to the sequence represented by SEQ ID NO: 1, the second enhancer polynucleotide preferably comprises a polynucleotide having a sequence with 90% or more identity to the sequence represented by SEQ ID NO: 5. In this case, it is preferable that the entire enhancer polynucleotide responsive to heart failure is not a polynucleotide having the same sequence as the sequence represented by SEQ ID NO: 13. In other words, it is preferable to exclude from the enhancer polynucleotide responsive to heart failure an embodiment in which a second enhancer polynucleotide having a sequence with 100% identity to the sequence represented by SEQ ID NO: 5, a polynucleotide represented by SEQ ID NO: 6, and a first enhancer polynucleotide having a sequence with 100% identity to the sequence represented by SEQ ID NO: 4 are directly linked in this order from the 5' side.

[0033] When the first enhancer polynucleotide comprises a polynucleotide having a sequence with 80% or more identity to the sequence represented by SEQ ID NO: 2, the second enhancer polynucleotide preferably comprises a polynucleotide having a sequence with 90% or more identity to the sequence represented by SEQ ID NO: 8. In this case, it is preferable that the entire enhancer polynucleotide responsive to heart failure is not a polynucleotide having the same sequence as the sequence represented by SEQ ID NO: 12. In other words, it is preferable to exclude from the enhancer polynucleotide responsive to heart failure an embodiment in which a second enhancer polynucleotide having a sequence with 100% identity to the sequence represented by SEQ ID NO: 8, a polynucleotide represented by SEQ ID NO: 9, and a first enhancer polynucleotide having a sequence with 100% identity to the sequence represented by SEQ ID NO: 7 are directly linked in this order from the 5' side.

[0034] When an adaptor is included between the second enhancer polynucleotide and the first enhancer polynucleotide, the length of the adaptor, expressed in terms of the number of nucleotides in a single strand, is preferably 80 nucleotides or less, 60 nucleotides or less, 40 nucleotides or less, 30 nucleotides or less, 20 nucleotides or less, 10 nucleotides or less, 8 nucleotides or less, 6 nucleotides or less, or 5 nucleotides or less.

[0035] The enhancer polynucleotide responsive to heart failure may be single-stranded or double-stranded.When the enhancer polynucleotide responsive to heart failure is single-stranded, it may be the same as the sequence of the enhancer polynucleotide responsive to heart failure shown above, or it may be the reverse complementary sequence to the sequence of the enhancer polynucleotide responsive to heart failure shown above.Preferably, the enhancer polynucleotide responsive to heart failure is double-stranded.

[0036] The total length of the enhancer polynucleotide responsive to heart failure, expressed as the number of nucleotides in a single strand, is preferably 200 nucleotides or less, 150 nucleotides or less, 130 nucleotides or less, 125 nucleotides or less, or 120 nucleotides or less. When the enhancer polynucleotide responsive to heart failure contains an adaptor, the length of the enhancer polynucleotide responsive to heart failure indicates the number of nucleotides including the adaptor.

[0037] As described below, the enhancer polynucleotide that responds to heart failure is used in combination with a polynucleotide containing a promoter sequence and a polynucleotide to be expressed. However, depending on the vector, the length of the polynucleotide that can be incorporated may be limited. For this reason, it is preferable that the enhancer polynucleotide is as short as possible.

[0038] The most preferred enhancer polynucleotide responsive to heart failure is a polynucleotide having the sequence shown in SEQ ID NO:10 or a polynucleotide having the sequence shown in SEQ ID NO:11.

[0039] The activity of an enhancer that responds to heart failure (hereinafter, simply referred to as "enhancer activity") can be evaluated by a reporter assay. For example, enhancer activity can be evaluated by comparing the reporter activity in a cell into which a reporter assay vector in which a reporter gene such as luciferase or β-galactosidase is incorporated in the downstream region of a specific promoter sequence is introduced with that in a cell into which an enhancer-added reporter assay vector in which an enhancer sequence is inserted in the upstream region or downstream region of the promoter sequence of the same vector as the reporter assay vector is introduced. If the reporter activity in a cell into which a reporter assay vector is introduced is set as a baseline (also referred to as a reference value), and the reporter activity (also referred to as an evaluation value) in a cell into which an enhancer-added reporter assay vector is introduced is higher than the baseline, it can be determined that there is enhancer activity. More specifically, if the evaluation value is 1.5 times or more, preferably 2 times or more, more preferably 2.5 times or more, and even more preferably 3 times or more higher than the reference value, it can be determined that there is enhancer activity.

[0040] The ability to respond to heart failure can be evaluated by exposing cardiomyocytes into which the enhancer-added reporter assay vector has been introduced in vitro to an environment simulating a state of heart failure. For example, the vector is transfected into cardiomyocytes cultured in two different wells, and adrenaline α such as phenylephrine is introduced into one of the wells. 1The reporter activity can be evaluated by comparing the reporter activity (also called the treated evaluation value) when the transgenic cardiomyocytes are exposed to a simulated environment of heart failure after addition of a receptor agonist or the like, with the reporter activity (also called the untreated evaluation value) of transgenic cardiomyocytes not exposed to a simulated environment of heart failure. If the treated evaluation value is at least two times, preferably at least three times, more preferably at least four times higher than the untreated evaluation value, it can be evaluated that the enhancer is responsive to heart failure.

[0041] Here, the reporter assay can be carried out according to a known method.

[0042] The predetermined promoter is not limited as long as it can express the target gene in the transfected cell. The predetermined promoter can be the promoter of the adjacent genes Nppa and Nppb encoding ANP and BNP, which are endogenous target promoters of the enhancer sequence (for example, a promoter consisting of the sequence represented by SEQ ID NO: 14 below). In addition, an exogenous promoter can be used as the predetermined promoter. Examples of exogenous promoters include a cytomegalovirus (CMV) promoter, a respiratory syncytial virus (RSV) promoter, a Simian virus 40 (SV40) promoter, an Elongation factor 1 (EF1)-α promoter, and a Troponin T (TnT) promoter. These promoters are preferably minimal promoters that do not have enhancers associated with these promoters.

[0043] It has been shown in Non-Patent Document 2 that the transcription activity of an exogenous promoter can be enhanced by the CR9 region (650 bp) of the adjacent genes Nppa and Nppb.

[0044] 2. Expression vectors and gene therapy compositions The third embodiment relates to an expression vector and a composition for gene therapy. The expression vector in this embodiment may contain the enhancer polynucleotide responsive to heart failure described in 1 above and the polynucleotide containing a specific promoter sequence described in 1 above. In the expression vector, the enhancer polynucleotide responsive to heart failure and the polynucleotide containing the promoter sequence can be linked so that the transcription activity of the polynucleotide containing the promoter sequence is enhanced by the enhancer polynucleotide responsive to heart failure.

[0045] The enhancer polynucleotide responsive to heart failure is not limited as long as it is operably linked to a polynucleotide containing a promoter sequence. The enhancer polynucleotide responsive to heart failure may be located upstream of the 5' side of the polynucleotide containing a promoter sequence, or may be located downstream of the 3' side of the polynucleotide containing a promoter sequence.

[0046] Furthermore, the expression vector may contain a target polynucleotide to be expressed. The target polynucleotide may have a sequence encoding a protein, microRNA, siRNA, etc. The target polynucleotide is preferably inserted into the expression vector such that the sequence encoded by the target polynucleotide is expressed by a polynucleotide including a promoter sequence and an enhancer polynucleotide.

[0047] The basic backbone of the expression vector is not limited as long as it can express the target polynucleotide by a polynucleotide containing a promoter sequence and an enhancer polynucleotide in mammalian cells. Examples of the basic backbone of the expression vector include a plasmid vector and a virus vector. Examples of the virus vector include a lentivirus vector, a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector (AAV vector). In the case of an AAV vector, the serotype may be any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11, but when infecting cardiomyocytes, it is preferable to use any of AAV1, AAV3, AAV4, AAV6, and AAV9.

[0048] The expression vector of this embodiment can be used as an active ingredient of a composition for gene therapy, particularly for heart disease, preferably heart failure.

[0049] The composition for gene therapy may contain, in addition to the expression vector, a carrier, if necessary. Examples of the carrier include transfection reagents containing polymers, lipids, magnets, etc.

[0050] When the gene therapy composition is administered to an individual, it can be administered systemically or locally. When administered systemically, it is preferably administered intravenously.

[0051] When the active ingredient is based on a viral vector, the gene therapy composition is administered systemically, for example, in an amount equivalent to 10 10 ~10 18 The dose can be adjusted to give 100 mg / day of 500 mg / kg.

[0052] When the active ingredient is based on a viral vector, the composition for gene therapy can be administered locally by injecting the composition into the target tissue using a syringe or a catheter. In the case of local administration, for example, the amount of the active ingredient is calculated as 1 cm of the target tissue. 2 Per 10 9 ~10 16 The dose can be adjusted to give 100 mg / day of 500 mg / kg.

[0053] When the active ingredient is based on a viral vector, the gene therapy composition can be administered once or multiple times, whether systemically or locally. When administered multiple times, the composition can be administered every two days, every four days, or every week. When administered multiple times, the composition can be administered 2, 5, 10, 15, 20, or 24 times.

[0054] When the active ingredient has a plasmid vector as a basic skeleton, the composition for gene therapy can be administered systemically at an amount of, for example, 0.1 to 1,000 mg / kg of body weight per day in an adult, calculated as the amount of the active ingredient. The vector can be linearized as necessary.

[0055] When the active ingredient is based on a plasmid vector, the gene therapy composition can be injected into the target tissue using a syringe or a catheter when it is administered locally. In this case, a nucleic acid delivery agent such as liposomes may be used in combination. In the case of local administration, for example, the amount of active ingredient is calculated as 1 cm of the target tissue. 2 The dosage can be 0.01 to 100 mg / day.

[0056] When the active ingredient is based on a plasmid vector, the gene therapy composition can be administered once or multiple times, whether systemically or locally. When administered multiple times, the composition can be administered every two days, every four days, or every week. When administered multiple times, the composition can be administered 2, 5, 10, 15, 20, or 24 times.

[0057] The gene therapy composition can be used to prevent and / or treat heart failure. Here, "prevention" refers to preventing the onset or recurrence of heart failure. "Treatment" includes improving heart failure and, even if heart failure has developed, maintaining it without exacerbation.

[0058] Myosin light chain kinase 3 (Mylk3) cDNA, ANP cDNA, BNP cDNA, and the like, which have a protective effect on cardiac function, can be introduced as the expression target polynucleotide into an expression vector for preventing and / or treating heart failure.

[0059] 3. Compositions and kits containing sgRNA or crRNA The fourth embodiment relates to a composition for preventing and / or treating heart failure, the composition comprising a single-stranded guide RNA (sgRNA) or a vector capable of expressing the sgRNA as an active ingredient. The composition can be used to activate an endogenous enhancer region.

[0060] The sgRNA can be designed to bind to a polynucleotide consisting of the sequence represented by SEQ ID NO: 1, the sequence represented by SEQ ID NO: 2, the sequence represented by SEQ ID NO: 4, the sequence represented by SEQ ID NO: 5, the sequence represented by SEQ ID NO: 7, or the sequence represented by SEQ ID NO: 8, or a polynucleotide consisting of a complementary sequence thereof. Candidate sequences provided by each manufacturer can be used as the sequence of the sgRNA.

[0061] The expression of the endogenous gene of interest can be enhanced by introducing the sgRNA or a vector capable of expressing the sgRNA into a cell together with a vector expressing the tetrameric herpes virus transcription activation domain VP16 (VP64), which is a transactivation domain, and a vector expressing an inactive Cas9 nuclease. Preferably, VP64 and the inactive Cas9 nuclease can be fused and expressed in the cell. The inactive Cas9 nuclease preferably has a D10A mutation in which the 10th aspartic acid is replaced with alanine and / or an N863A mutation in which the 863rd asparagine is replaced with alanine. Furthermore, when introducing the sgRNA or a vector capable of expressing the sgRNA and a vector expressing VP64 and an inactive Cas9 nuclease, it is preferable to introduce a vector expressing p65. Also, transcription factor p65 (p65) is preferably expressed in cells together with MS2 coat protein (MS2) and Heat Shock Transcription Factor 1 (HSF1), more preferably as an MS2-p65-HSF1 fusion protein. Inactive Cas9 nuclease may be expressed in cells together with VP64 and p65, together with Replication and Transcription activator (Rta).

[0062] Examples of the basic skeleton of a vector capable of expressing sgRNA, a vector expressing VP64 and an inactive Cas9 nuclease, and a vector expressing p65, MS2, and HSF1 include the basic skeletons described in 2. above.

[0063] A vector capable of expressing an sgRNA, a vector expressing VP64 and an inactive Cas9 nuclease, and a vector expressing p65, MS2, and HSF1 can be administered to an individual, for example, in comparable copy numbers.

[0064] The method for introducing each vector can be similar to that described in 2. above.

[0065] When sgRNA is administered systemically, for example, it can be administered so that the amount of active ingredient is 0.1 to 1,000 mg / kg of body weight of an adult per day. The vector can be linearized as necessary.

[0066] When administering sgRNA locally, the gene therapy composition can be injected into the target tissue using a syringe or catheter. In this case, a nucleic acid delivery reagent such as liposomes may be used in combination. In the case of local administration, for example, the amount of active ingredient is calculated as 1 cm of the target tissue. 2 The dosage can be 0.01 to 100 mg / day.

[0067] The number of administrations of sgRNA and each vector, whether systemic or local, can be single or multiple times. When multiple administrations are performed, administration can be repeated every 2 days, every 4 days, or every week. When multiple administrations are performed, administration can be 2, 5, 10, 15, 20, or 24 times.

[0068] Alternatively, instead of sgRNA or a vector capable of expressing the sgRNA, CRISPR RNA (crRNA) or a vector capable of expressing crRNA may be used. crRNA can be administered systemically or locally, preferably in a state hybridized with tracrRNA. It is preferable that the vector capable of expressing crRNA expresses tracrRNA together with crRNA or is combined with a vector expressing tracrRNA. When using crRNA, Rta may be used instead of HSF1. crRNA is also designed to bind to a polynucleotide consisting of a sequence represented by SEQ ID NO: 1, a sequence represented by SEQ ID NO: 2, a sequence represented by SEQ ID NO: 4, a sequence represented by SEQ ID NO: 5, a sequence represented by SEQ ID NO: 7, or a sequence represented by SEQ ID NO: 8, or a polynucleotide consisting of a complementary sequence thereof. The sequence of crRNA can be a candidate sequence provided by each manufacturer.

[0069] The composition contains nucleic acids such as sgRNA, crRNA, and tracrRNA, and expression vectors expressing sgRNA or crRNA as active ingredients, and may contain a carrier as necessary. Examples of the carrier include transfection reagents including polymers, lipids, magnets, etc.

[0070] The composition can be used to prevent and / or treat heart failure. The composition may be provided as a kit in combination with, for example, an expression vector expressing a fusion protein of VP64 and an inactive Cas9 nuclease and an MS2-p65-HSF1 fusion protein expression vector. The composition may be provided as a kit in combination with an expression vector expressing an inactive Cas9 nuclease-VP64-p65-Rta fusion protein. The kit can be used to prevent and / or treat heart failure. Here, "prevention" refers to preventing onset or recurrence. "Treatment" includes improving heart failure and maintaining heart failure without exacerbation even if heart failure has developed.

[0071] 4. Sequence Listing The sequences disclosed in this specification, SEQ ID NOs: 1 to 14, are shown below.

[0072] SEQ ID NO:1 (human 325-336) TGGACAATGAGG

[0073] Sequence number 2 (mouse 331-342) TGGGCAATGAGG

[0074] Sequence number 3 (general sequence) TGGNCAATGAGG (N is A, G, T, or C.)

[0075] SEQ ID NO:4 (human 305-365) AGGAAGCACGCTCACAATTC TGGACAATGAGG TCAGCCTGCAGGGCGCATGGGACCGCCCA (The underlined portion corresponds to SEQ ID NO: 1.)

[0076] SEQ ID NO:5 (human 186-244) GGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAA

[0077] SEQ ID NO:6 (human 245-304) AAAGACATTGGCGCCAACCGAGGCCTTGAAGAGGGGCTCTTCAGCACGGAATGTGACCCC

[0078] SEQ ID NO:7 (mouse 311-370) AGGAAGCGCTCCGGCGATCC TGGGCAATGAGG TCAGCAGGACCAATGGGACCCTCCACCT (The underlined portion corresponds to SEQ ID NO:2.)

[0079] SEQ ID NO:8 (mouse 191-250) GGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAA

[0080] SEQ ID NO:9 (mouse 251-310) AAAGACATTAGCACCAACCGAGGTCTAAGAGAGGGGCTCTTCAGCGCGGAATGTGACCCC

[0081] SEQ ID NO: 10 (Example 2: Human) GGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAAGAATTCAGGAAGCACGCTCACAATTCTGGACAATGAGGTCAGCCTGCAGGGCGCATGGGACCGCCCA

[0082] SEQ ID NO: 11 (Example 1: Mouse) GGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAAACTAGAGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCT

[0083] · SEQ ID NO: 12 (Mouse CR9) CTCATGGTGCCAGTTGCTGCCCTTGGCCAAAAACATGTCCTCTTCATCCAGCTTCATAAACACGGCAGGGACAGAACTTGCCACACCGAAACCCATACATGGTCTGGAGACTGCACACCAACTGGGATCACAGGGACGCGCAGGGGGTTCACCTCCTCCAAGGAAGAGGCAGGGATAGGAGTGAAACCAGGGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAAAAAGACATTAGCACCAACCGAGGTCTAAGAGAGGGGCTCTTCAGCGCGGAATGTGACCCCAGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCTCCCTTATGGTCACGTGGTGGTCATGGGGACCTCTCCCCGAGCCAGCTCTGGGGCTGTTTCCAACCACTTCCCGTGTACACCAAGCCAGGAAAGGCAAGCAGGCAGAGCTGCTGTCCGTGTAGGGCTGACCTTCTGGGCTGTGCCTTTTCTTTTTTGATTGTCCTCTGTGCTTTCTGTTCCATTCTCAGTTTAAGAGTGGGAGAGGAGGATGCTTGGAAGAGGCAGCCATCTTGGAACCTGGTGGTTTGGCCTGGGAGATAAACCAGGAAGGGCCTAGGAT

[0084] · SEQ ID NO: 13 (Human CR9) GTGCTGTGAGCTGCCCTCCCAGAGGTGAGTTCTCTGGGTCCTGCCACACAAAACACATGGCAGGGGCGTGGATCCCTACACCCAAACCCATACAAGGCCTTGGACCTGTGCTCACCAACTCAGATCACGGGGATGCAGGGGGTTCACCTTCTCCAAGGAAGGGCCAGGGACACAAGAGAAAACAGGGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAAAAAGACATTGGCGCCAACCGAGGCCTTGAAGAGGGGCTCTTCAGCACGGAATGTGACCCCAGGAAGCACGCTCACAATTCTGGACAATGAGGTCAGCCTGCAGGGCGCATGGGACCGCCCAATGGCCGGTGGGCATGGGCACCTCTCCCCCCGCCAGCCCCACCTGCAGAATGCTGGAACTGGCTCCAACCGCTTCCCGTCTGCACTGAGCCAGCGCAAGGGCGAGCGGACAGAGCCTCATGTTCCCGGTGCTGCTGCCCTTCCAGGCTGCCTTCCTTTTTTGACTGTCCTTTTGGCTTCTTATGCTTTTGGCTCCATTCTGGATGTGCGTCATGGGGTGGGATGCAGAAGCAGCAGCCAGCTTGGAGGCTGGTGTTCCCGGAGGCTGAGGGCGGGATGGGGGGAAATATGAACCAGGAAAGGGCCTGGTAT

[0085] · SEQ ID NO: 14 (Promoter sequence of mouse BNP) CCTGAGCTCAGCCGGCAGGAATGCAGCTGATAAATCAGAGATAACCCCACCCCTACTCCGTGAAAAGGTCTGGCCGGACACTCAGCCCCAGTATAAAAGGCAGAGGCACCGTTGTTGAAGACACCAGTGCACAAGCTGCTTGGGGAGGCGAGACAAGGGAGAACACGGCATCATTGCCTGGCCCATCGCTTCTGCGGC

[0086] ·SEQ ID NO: 15 (Mouse in FIGS. 10 and 15) ACACCGAAACCCATACATGGTCTGGAGACTGCACACCAACTGGGATCACAGGGACGCGCAGGGGGTTCACCTCCTCCAAGGAAGAGGCAGGGATAGGAGTGAAACCAGGGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAAAAAGACATTAGCACCAACCGAGGTCTAAGAGAGGGGCTCTTCAGCGCGGAATGTGACCCCAGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCTCCCTTATGGTCACGTGGTGGTCATGGGGACCTCTCCCCGAGCCAGCTCTGGGGCTGTTTCCAACCACTTCCCGTGTACACCAAGCCAGGAAAGGCAAGCAGGCAGAGCTGCTGTCCGTGTAGGGCTGACCTTCTGGGCTGTGCCTTTTCTTTTTTGATTGTCCTCTGTGCTT

[0087] ·SEQ ID NO: 16 (Human in FIGS. 10 and 15) ACACCCAAACCCATACAAGGCCTTGGACCTGGTGCTCACCAACTCAGATCACGGGGATGCAGGGGTTCACCTTCTCCAAGGAAGGGCCAGGGACACAAGAGAAAACAGGGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAAAAAGACATTGGCGCCAACCGAGGCCTTGAAGAGGGGCTCTTCAGCACGGAATGTGACCCCAGGAAG CACGCTCACAATTCTGGACAATGAGGTCAGCCTGCAGGGCGCATGGGACCGCCCAATGGCCGTGGGCATGGGCACCTCTCCCCCCGCCAGCCCCACCTGCAGAATGCTGGAACTGGCTCCAACCGCTTCCCGTCTGCACTGAGCCAGCGAGGGCGAGCGGACAGAGCCTCATGTTCCCGGTGCTGCTGCCCTTCCAGGCTGCCTTCCTTTTTTGACTGTCCTTTTGGCTT EXAMPLES

[0088] The present invention will be described in more detail below with reference to examples, but the present invention should not be construed as being limited to these examples.

[0089] All animal experiments in this example were performed in accordance with the Guide for the Care and Use of Laboratory Animals and with the approval of the Animal Experimentation Committee of Osaka University.

[0090] I. Experimental Example 1: Importance of the CR9 region in heart failure We generated knockout mice (KO mice) for the CR9 region (sequence number 12), which is one of the enhancers of the mouse natriuretic peptide (ANP / BNP) gene shown in sequence number 12, and investigated the importance of the CR9 region in heart failure.

[0091] 1. Generation of CR9 650bp KO mice CR9 KO mice were generated using the Cre-LoxP system. The design of the targeting vector for CR9 KO mice is shown in Figure 1. The generation of CR9 KO mice was entrusted to the Reproductive Engineering Unit, Animal Experimental Facility, Osaka University Medical School.

[0092] To delete the LoxP region, the mice were crossed with Cre-expressing mice.

[0093] 2. Phenotype of CR9 KO mice 2-1. Expression of ANP and BNP To observe the expression of ANP and BNP in CR9 KO mice, hearts were harvested from four 8-week-old wild-type (WT) mice and four CR9 KO mice, and RNA was extracted from the ventricles using RNA-Bee™.

[0094] The expression of ANP and BNP was evaluated by quantitative PCR. β-actin (Actb) was used as an endogenous control. SYBR™ Green Realtime PCR Master Mix was used for quantitative PCR.

[0095] The results are shown in Figure 2. In CR9 KO mice, the expression of both ANP and BNP was significantly reduced.

[0096] 2-2. Phenotype of CR9 KO mice in a heart failure model To evaluate the importance of the CR9 region under heart failure, we created a pressure overload heart failure model and observed the cardiac condition of CR9 KO mice and WT mice.

[0097] Transverse aortic coarctation (TAC) was performed on four 8-week-old WT mice and four 8-week-old CR9 KO mice. The outline of TAC is as follows. After entering the thoracic cavity from the second intercostal space at the left border of the sternum and exposing the aortic arch, the aortic arch was tied with a 7-0 suture along with a 27G needle between the innominate artery and the left internal carotid artery. The 27G needle was then carefully removed to create a 60-80% aortic stenosis. Another four 8-week-old WT mice and four 8-week-old CR9 KO mice underwent sham surgery. Five weeks after surgery, echocardiography and heart weight were measured.

[0098] The results of echocardiography are shown in Figure 3(A). In CR9 KO mice, the left ventricular end-diastolic and end-systolic dimensions were larger than in WT mice, and the left ventricular posterior wall was thicker. In addition, the left ventricular fractional shortening was significantly reduced in CR9 KO mice compared to WT mice. These results demonstrate that CR9 KO mice suffer from significant cardiac enlargement, hypertrophy, and reduced left ventricular wall motion under heart failure.

[0099] Figure 3(B) shows the macroscopic findings of the hearts excised from CR9 KO mice and WT mice that underwent TAC, and from CR9 KO mice and WT mice that underwent sham surgery. Figure 3(C) is a graph showing the weight of each heart as a ratio of heart weight to body weight. The hearts of CR9 KO mice that underwent TAC were larger than those of the other groups, even by macroscopic observation. Furthermore, the heart weight of CR9 KO mice that underwent TAC was also increased.

[0100] These results indicate that deletion of the CR9 region aggravates heart failure, and that the CR9 region is essential for suppressing the progression of heart failure.

[0101] II. Experimental Example 2: Analysis of the heart failure response region within the CR9 region 1. Search for heart failure responsive regions within the CR9 region The mouse CR9 region is a 650 bp region represented by the sequence below.

[0102] (SEQ ID NO:12)

[0103] To identify the more important region in the above sequence, vectors were constructed with enhancer regions deleted in 30-bp increments from 650 bp, and their transcriptional activity was evaluated.

[0104] 1-1. Construction of vector The mCMV promoter of pGreenFire Lenti-Reporter shown in Figure 4 was replaced with the BNP promoter (198 bp) shown in SEQ ID NO: 14. CR9 650 bp was inserted into the EcoRI / SpeI site of the multicloning site located upstream of the BNP promoter to create CR9 + BNP promoter + Luciferase Lentivector (hereinafter referred to as the "original vector"). Deletion Lentivectors were created by deleting the CR9 region by 30 bp each from the original vector. The created Deletion Lentivector is shown in Figure 5.

[0105] 1-2. Preparation of rat cardiomyocytes and Luciferase assay Hearts were removed from 1-day-old rats, and the cardiac tissue was treated overnight with trypsin solution cooled to 4°C. The cardiac tissue was then transferred to collagenase solution and incubated at 37°C. Cellular components were collected from the digested tissue, and the cells were transferred to a plate with medium containing 10% fetal bovine serum and left to stand for 70 minutes. This treatment caused the fibroblasts to adhere to the bottom of the plate, while the cardiomyocytes remained in the supernatant. The supernatant was collected, and the cardiomyocytes in the supernatant were seeded into a 96-well plate.

[0106] Rat cardiomyocytes were incubated for 24 hours at 37°C in CO 2 After culturing in an incubator, cardiomyocytes in separate wells were infected with each Deletion Lentivector having the defects shown in Figure 5. In addition, the original vector was also infected as a control. After 48 hours, phenylephrine (Sigma-Aldrich) was added to each well to a final concentration of 100 μM, and the cells were cultured for 72 hours. After the end of the culture, a luciferase assay was performed.

[0107] 1-3.Results The results of the luciferase assay are shown in Figure 6. The results of the luciferase assay are summarized in Figure 7. Deletion Lentivectors lacking the 191-250 region or the 311-370 region showed reduced reactivity to phenylephrine.

[0108] The sequences of the sequence region from base 191 to base 250 (SEQ ID NO: 8: hereinafter also referred to as the "191-250 region") and the region from base 311 to base 370 (SEQ ID NO: 7: hereinafter also referred to as the "311-370 region") in SEQ ID NO: 12 are shown below. The 191-250 region and the 311-370 region are shown in uppercase letters.

[0109] (SEQ ID NO:12)

[0110] 2. Verification of the functions of the 191-250 and 311-370 regions 2-1. Construction of a vector containing the enhancer polynucleotide of Example 1 In order to verify that the 191-250 region and the 311-370 region in the CR9 region are important for the expression of ANP and BNP, an enhancer polynucleotide (Example 1) was prepared in which the 191-250 region and the 311-370 region were artificially linked, and its enhancer activity was measured.

[0111] The 650 bp CR9 contained in the original vector prepared in II.1-1 above was replaced with an approximately 120 bp enhancer polynucleotide (Example 1) having the sequence shown below to prepare a 191-250 / 311-370 reporter vector. The lowercase letters indicate the restriction enzyme site connecting the 191-250 region and the 311-370 region.

[0112] GGAGCTATTTCGAGAAGGTGTCAAAGGCCGGAACACTAAAATTAGAGCCTTGGTTCCTAAactagAGGAAGCGCTCCGGCGATCCTGGGCAATGAGGTCAGCAGGACCAATGGGACCCTCCACCT (SEQ ID NO: 11)

[0113] Figure 8 shows a map of the 191-250 / 311-370 reporter vector.

[0114] To conduct comparative experiments, we prepared a BNP promoter vector in which the CR9 region was removed from the original vector, a 191-250 reporter vector in which the CR9 650bp contained in the original vector was replaced with only the 191-250 region, and a 311-370 reporter vector in which the CR9 650bp contained in the original vector was replaced with only the 311-370 region.

[0115] 2-2.Luciferase assay Luciferase assay was performed as in II.1-2. above. The results are shown in Figure 9. Luciferase activity was higher in the original vector than in the BNP promoter vector. The 191-250 / 311-370 reporter vector had higher luciferase activity than the original vector. The 311-370 reporter vector had activity equivalent to that of the original vector. On the other hand, the 191-250 reporter vector had enhancer activity similar to that of the BNP promoter vector, and was weak.

[0116] These results suggest that the enhancer activity of the BNP promoter is stronger when it contains both the 191-250 and 311-370 regions. The enhancer activity of the enhancer containing both the 191-250 and 311-370 regions is higher than that of CR9 650bp, although the nucleotide length of the enhancer is shorter than that of CR9 650bp.

[0117] III. Experimental Example 3: Analysis of heart failure response region within the CR9 region of the human ANP / BNP gene 1. CR9 region sequence of human ANP / BNP gene The human CR9 region is a 676 bp region represented by the sequence below.

[0118] gtgctgtgagctgccctcccagaggtgagttctctgggtcctgccacacaaaacacatggcaggggcgtggatccctacacccaaacccatacaaggccttggacctgtgctcaccaactcagatcacggggatgcagggggttcaccttctccaaggaagggccagggacacaagagaaaacagGGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAAaaagacattggcgccaaccgaggccttgaagaggggctcttcagcacggaatgtgaccccAGGAAGCACGCTCACAATTCTGGACAATGAGGTCAGCCTGCAGGGCGCATGGGACCGCCCAatggccggtgggcatgggcacctctccccccgccagccccacctgcagaatgctggaactggctccaaccgcttcccgtctgcactgagccagcgcaagggcgagcggacagagcctcatgttcccggtgctgctgcccttccaggctgccttccttttttgactgtccttttggcttcttatgcttttggctccattctggatgtgcgtcatggggtgggatgcagaagcagcagccagcttggaggctggtgttcccggaggctgagggcgggatggggggaaatatgaaccaggaaagggcctggtat(SEQ ID NO: 13)

[0119] Also shown in FIG. 10 is the alignment of the mouse CR9 region and the human CR9 region.

[0120] In the human CR9 region, the region with high identity to the mouse 191-250 region was the 186-244 sequence region (SEQ ID NO: 5: hereinafter also referred to as the "186-244 region"). There were 5 base mismatches between the 191-250 region and the 186-244 region, and the identity was about 91.5%. In addition, in the human CR9 region, the portion with high identity to the mouse 311-370 region was the 305-365 sequence region (SEQ ID NO: 4: hereinafter also referred to as the "305-365 region"). There were 16 base mismatches between the 311-370 region and the 305-365 region, and the identity was about 73.8%. In the above sequence, the 186-244 region and the 305-365 region are shown in uppercase letters, and the other regions are shown in lowercase letters.

[0121] Figure 11 shows a map of the 186-244 / 305-365 reporter vector.

[0122] The 650 bp CR9 contained in the original vector prepared in II.1-1 above was replaced with an approximately 120 bp enhancer polynucleotide (Example 2) having the sequence shown below to prepare a 186-244 / 305-365 reporter vector. The lowercase letters indicate the restriction enzyme site connecting the 186-244 region and the 305-365 region.

[0123] GGAGCTATTTTGAGAAGGTGTCAAGGCTGGGACACTAAAATTAGAGGCTTGGTTCCTAAgaattcAGGAAGCACGCTCACAATTCTGGACAATGAGGTCAGCCTGCAGGGCGCATGGGACCGCCCA (SEQ ID NO: 10)

[0124] For comparative experiments, we also prepared the following reporter vectors: Hs 1-676 vector, in which the CR9 650 bp of the mouse original vector was replaced with human CR9 650 bp as shown in SEQ ID NO: 13; 186-244 reporter vector, in which the CR9 650 bp contained in the original vector was replaced with only the human 186-244 region; and 305-365 reporter vector, in which the CR9 650 bp contained in the original vector was replaced with only the human 305-365 region.

[0125] 2.Luciferase assay Luciferase assay was performed in the same manner as in II.1-2. above. The results are shown in Figure 12. The BNP promoter vector was used as a negative control for enhancer activity. The mouse 191-250 / 311-370 reporter vector was used as a positive control for enhancer activity. The Hs 1-676 vector showed higher luciferase activity than the 191-250 / 311-370 reporter vector. The 186-244 reporter vector showed the same luciferase activity as the 191-250 / 311-370 reporter vector. The 305-365 reporter vector showed higher luciferase activity than the 186-244 reporter vector. The 186-244 / 305-365 reporter vector showed the highest luciferase activity.

[0126] The above results indicate that the human CR9 region has higher enhancer activity than the mouse CR9 region. In particular, the enhancer polynucleotide of Example 2 was shown to have a higher enhancer activity.

[0127] IV. Experimental Example 4: Identification of enhancer sequences using deletion mutants Deletion mutants were generated by deleting 10 bp each from the 191-250 region and the 311-370 region of the reporter vector of Example 1 shown in Experimental Example 2. The design of the construct is shown in Figure 13(A). A luciferase assay was performed on each deletion mutant to evaluate its activity as an enhancer. The luciferase assay was performed in the same manner as in II.1-2. above.

[0128] The results are shown in Figure 13(B). Deletion of the 191-200 region, the 318-330 region, the 331-340 region, or the 341-350 region reduced the transcription activity. In particular, the reduction was remarkable in the deletion of the 331-340 region. Next, we generated deletion mutants with 4 bp deletions in the 318-330, 331-340, and 341-350 regions, and performed a luciferase assay to evaluate their enhancer activity.

[0129] The results of deletion mutants in which 4 bp were deleted from the 318-330 region, the 331-340 region, and the 341-350 region are shown in Figure 14. Decreased transcriptional activity was observed with the deletion of the 331-334 region, the 335-338 region, or the 339-342 region.

[0130] The region 331-342, in which enhancer activity was preserved by 4-bp deletion, is shown by a dashed line in Figure 15. This region shows a difference of only 1 bp between mouse and human, and is highly conserved.

[0131] Next, a construct was prepared in which the 327-346 region including the mouse 331-342 region sequence was inserted into the reporter vector instead of the sequence of Example 1, and a construct was prepared in which the sequence of the 327-346 region including the mouse 331-342 region sequence was inserted into the reporter vector instead of the sequence of Example 1, in which a sequence in which the sequence is repeated three times was inserted into the reporter vector. The design of each construct is shown in FIG. 16(A). Luciferase assay was performed on each construct to evaluate its activity as an enhancer. Luciferase assay was performed in the same manner as in II.1-2. above.

[0132] The results are shown in FIG. 16(B). MmBNPp indicates a reporter vector without an enhancer sequence. Mm120 indicates the construct of Example 1. Mm(327-346)×1 indicates a construct containing only one sequence of the 327-346 region. Mm(327-346)×3 indicates a construct containing three sequences of the 327-346 region in tandem. Mm(327-346)×1 showed slightly higher enhancer activity than Example 1. In addition, Mm(327-346)×3 showed higher activity than Mm(327-346)×1. Therefore, this region was considered to be the core of the enhancer activity. This region corresponds to the 325-336 region of the human CR9 region.

[0133] V. Experimental Example 5: Transcriptional activity of 186-244 / 305-365 reporter vector in hiPS-derived cardiomyocytes The enhancer activity of the BNP promoter vector containing the 186-244 region and the 305-365 region (also called HsCR9 120bp) in human cardiomyocytes was examined.

[0134] (1) Method The cells used in Experimental Example 3 were replaced with cardiomyocytes differentiated from human iPS cells and infected with a reporter vector, and the expression levels of Nppb, Luciferase, and GAPDH mRNA were measured by real-time RT-PCR. Specifically, 1 x 10 hiPS-derived cardiomyocytes were cultured in a 12-well plate. 5 Cells were seeded at 100 cells / well and 24 hours later, they were infected with two types of luciferase reporter lentivectors: (i) BNP promoter only and (ii) HsCR9 120bp +BNP promoter. 48 hours after seeding, cells were challenged with phenylephrine (100μM) for 24 hours. 72 hours after seeding, cells were harvested and RNA was extracted. Luciferase gene expression and endogenous Nppb gene expression were evaluated by quantitative PCR.

[0135] (2) Results The results are shown in Figure 17. Figure 17(A) shows the relative expression level of Nppb to that of GAPDH. Figure 17(B) shows the relative expression level of luciferase to that of GAPDH. In hiPS-derived cardiomyocytes infected with either lentivector, increased Nppb gene expression was observed upon phenylephrine loading. In the lentivector containing human CR9 120bp inserted, stronger luciferase expression was induced by phenylephrine loading.

[0136] These results demonstrated that the human CR9 120-bp enhancer sequence is responsive to heart failure in the myocardium.

[0137] VI. Experimental Example 6: Verification of cardiac-specific enhancer activity in vivo Four types of AAV6-BNP-T2A-Luciferase reporter vectors (120bp enhancer (+) or (-), cTnT promoter or BNP promoter) were administered to the CR9 KO mice generated in Experimental Example 1, and the cardiac specificity of luciferase expression and responsiveness to heart failure were evaluated by live imaging.

[0138] (1) Method 1) Vector Two types of AAV6-BNP-T2A-Luciferase reporter vectors were prepared, one with and one without the mouse enhancer polynucleotide (hereinafter, "MmCR9 120 bp") shown in Example 1 inserted therein. Furthermore, a cTnT promoter or a BNP promoter was inserted as a promoter sequence into each of these AAV6-BNP-T2A-Luciferase reporter vectors, thereby preparing a total of four types of AAV6-BNP-T2A-Luciferase reporter vectors as follows. i. AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc ii. AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc iii. AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc iv. AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc

[0139] 2) Gene transfer For CR9 KO mice, each AAV6-BNP-T2A-Luciferase reporter vector was injected at 1 × 10 11 The drug was administered intravenously via the orbital plexus so that the dose was vg.

[0140] 3) Evaluation After administration of each AAV6-BNP-T2A-Luciferase reporter vector, luciferase expression was evaluated over time by live imaging using IVIS Lumina II on days 13, 27, and 34.

[0141] The imaging device used was IVIS Lumina II™ (Caliper Life Sciences), and the analysis software used was Living Image 4.0 (Caliper Life Sciences). For imaging, the mice were anesthetized with isoflurane inhalation anesthetic solution™, and the hair on the neck, anterior chest, and abdomen was removed. The luminescent substrate D-luciferin (VivoGlo Luciferin In Vivo Grade™, Promega) was administered intravenously to the mice at 75 mg / kg, and the mice were fixed supine in the imaging device under anesthesia. Images were taken for 20 seconds starting 1 minute after administration of D-luciferin. To induce drug-induced heart failure, continuous subcutaneous administration of phenylephrine (75 mg / kg / day, osmotic minipump (Alzet, Cupertino, CA)) was started on day 34, and luciferase expression was evaluated by live imaging on days 48 and 60.

[0142] After euthanasia, the mice were explanted and imaged ex vivo, and DNA and RNA were extracted from the explants to assess the amount of AAV6 virus and luciferase expression by quantitative PCR.

[0143] (2) Results Figure 18 shows images of luminescence in mice (upper row) into which i. AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc was introduced and mice (lower row) into which ii. AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc was introduced. In Figure 18, strong luminescence was detected near the heart in mice into which AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc was introduced, but no luminescence was detected in mice into which AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc, which does not contain MmCR9 120bp, was introduced. In addition, Figure 19 shows images of luminescence in the heart, liver, spleen, thymus, intestine, smooth muscle, and brain excised from each mouse. Compared with AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc-transfected mice, AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc-transfected mice showed stronger luminescence. After drug-induced heart failure, the enhancement of luminescence by MmCR9 120b was particularly remarkable.

[0144] FIG. 20 shows images of luminescence in mice (upper) into which iii. AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc was introduced and mice (lower) into which iv. AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc was introduced. In FIG. 20, in mice into which AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc was introduced, strong luminescence was detected near the heart after drug-induced cardiac failure was induced, but in mice into which AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc not containing MmCR9 120bp was introduced, no luminescence was detected. In addition, FIG. 21 shows images of luminescence in the heart, liver, spleen, thymus, intestine, smooth muscle, and brain excised from each mouse. Compared with AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc-transfected mice, AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc-transfected mice showed stronger luminescence. After drug-induced heart failure, the enhancement of luminescence by MmCR9 120b was particularly remarkable.

[0145] Here, as shown in FIG. 19 and FIG. 21, luminescence was confirmed not only in the heart but also in the liver. To verify whether this indicates the action of the enhancer in the liver, the amount of AAV6 DNA and the expression level of Luciferase in the liver and heart were measured. The results are shown in FIG. 22. In FIG. 22, TnTp indicates organs from mice transfected with AAV6_(cTnT promoter)_nFLAG MmBNP_T2A_FLuc, 120-TnTp indicates organs from mice transfected with AAV6_MmCR9 120bp (cTnT promoter)_nFLAG MmBNP_T2A_FLuc, BNPp indicates organs from mice transfected with AAV6_(BNP promoter)_nFLAG MmBNP_T2A_FLuc, and 120-BNPp indicates organs from mice transfected with AAV6_MmCR9 120bp (BNP promoter)_nFLAG MmBNP_T2A_FLuc. The graph also shows the relative expression level of Luciferase mRNA versus the amount of AAV6 DNA.

[0146] In the 120-TnTp and 120-BNPp hearts (left ventricles), the relative expression of luciferase mRNA increased depending on the presence or absence of MmCR9 120bp (8-fold and 52-fold, respectively), but in the liver, luciferase mRNA expression was not detected. This suggests that the luminescence in the heart is due to enhancer-dependent expression of luciferase, whereas the luminescence in the liver is nonspecific and not enhancer-dependent.

[0147] The above results demonstrate that the enhancer polynucleotide according to the present invention exhibits heart-specific enhancer activity, and that the enhancer activity increases in response to heart failure.

Claims

1. A polynucleotide having a sequence having 80% or more identity with the sequence represented by SEQ ID NO:1, or A polynucleotide having a sequence having 80% or more identity with the sequence represented by SEQ ID NO: 2; wherein the enhancer polynucleotide is responsive to heart failure (provided that the enhancer polynucleotide excludes a polynucleotide having the same sequence as the sequence represented by SEQ ID NO:13 and a polynucleotide having the same sequence as the sequence represented by SEQ ID NO:12).

2. An enhancer polynucleotide comprising a polynucleotide having a sequence having 80% or more identity to the sequence represented by SEQ ID NO:1 has a sequence having 70% or more identity to the sequence represented by SEQ ID NO:4, or An enhancer polynucleotide comprising a polynucleotide having a sequence having 80% or more identity with a sequence represented by SEQ ID NO: 2, and a sequence having 70% or more identity with a sequence represented by SEQ ID NO:

7. The enhancer polynucleotide of claim 1.

3. (1) a sequence having 80% or more identity with the sequence represented by SEQ ID NO: 1, or (2) a sequence having 80% or more identity with the sequence represented by SEQ ID NO: 2; The enhancer polynucleotide according to claim 1 or 2, wherein the sequence is represented by SEQ ID NO:

3.

4. moreover, A polynucleotide having a sequence having 90% or more identity with the sequence represented by SEQ ID NO:5, or A polynucleotide having a sequence having 90% or more identity with the sequence represented by SEQ ID NO:8; The enhancer polynucleotide of claim 1 , comprising:

5. The enhancer polynucleotide comprises: A: (1) a polynucleotide comprising a sequence having 80% or more identity to the sequence represented by SEQ ID NO: 1; (2) a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:5; connected directly or via an adapter, B: (3) a polynucleotide comprising a sequence having 80% or more identity to the sequence represented by SEQ ID NO: 2; (4) a polynucleotide having a sequence having 90% or more identity to the sequence represented by SEQ ID NO:8; are connected directly or via an adapter, The length of the adaptor is 10 nucleotides or less when expressed in terms of the number of nucleotides in a single-stranded polynucleotide. An enhancer polynucleotide described in any one of claims 1 to 4.

6. The enhancer polynucleotide according to claim 1, wherein the total length of the enhancer polynucleotide is 200 nucleotides or less when expressed in terms of the number of nucleotides in a single-stranded polynucleotide.

7. An enhancer polynucleotide comprising a polynucleotide consisting of the sequence set forth in SEQ ID NO: 10 or SEQ ID NO: 11, said enhancer polynucleotide being responsive to heart failure.

8. 8. An enhancer polynucleotide having a reverse complementary sequence to the enhancer polynucleotide of any one of claims 1 to 7, wherein the enhancer polynucleotide is responsive to heart failure.

9. An expression vector comprising a polynucleotide comprising a promoter sequence and an enhancer polynucleotide described in any one of claims 1 to 8, wherein the enhancer polynucleotide is linked so that the transcriptional activity of the polynucleotide comprising the promoter sequence is enhanced by the enhancer polynucleotide.

10. A composition for gene therapy comprising a polynucleotide in which a target polynucleotide is incorporated in an expression vector according to claim 9 in an expressible manner.

11. The composition according to claim 10, for the prevention and / or treatment of heart failure.

12. A polynucleotide comprising an sgRNA sequence that binds to a polynucleotide consisting of a sequence represented by SEQ ID NO: 1, a sequence represented by SEQ ID NO: 2, a sequence represented by SEQ ID NO: 4, a sequence represented by SEQ ID NO: 5, a sequence represented by SEQ ID NO: 7, or a sequence represented by SEQ ID NO: 8, or a polynucleotide consisting of a complementary sequence thereof; or A composition for preventing and / or treating heart failure, comprising a polynucleotide consisting of the sequence represented by SEQ ID NO: 1, the sequence represented by SEQ ID NO: 2, the sequence represented by SEQ ID NO: 4, the sequence represented by SEQ ID NO: 5, the sequence represented by SEQ ID NO: 7, or the sequence represented by SEQ ID NO: 8, or a vector capable of expressing crRNA that binds to a polynucleotide consisting of a complementary sequence thereof.

13. A kit for preventing and / or treating heart failure comprising the composition of claim 12.

Images