Method for producing cells carrying a specific DNA deletion in one of the homologous chromosomes

Abstract

It was found that DNA greater than 100bp can be deleted at one of homologous chromosomes by generating a plurality of nicks in a DNA region in the vicinity of a specific site of the homologous chromosomes.

Description

[Technical field]

[0001] The present invention relates to a method for producing a cell having a specific DNA deletion in one of homologous chromosomes by utilizing a site-specific nickase, and to a method for evaluating the homologous recombination function of a cell using the DNA deletion as an indicator. [Background technology]

[0002] With the emergence of programmable nucleases such as TALENs and CRISPR-Cas systems, genome editing technology is currently spreading rapidly. Cas proteins form a complex with guide RNA, and this complex binds to a target site on the genome that has a sequence complementary to the guide RNA, and cuts both strands of DNA. TALENs, a genome editing technology from the previous generation, is a fusion protein of a TALE protein that targets DNA and a nuclease that cuts DNA (mainly FokI), but like the CRISPR-Cas system, it causes double-stranded breaks in DNA at target sites on the genome.

[0003] When this double-stranded DNA break is repaired by non-homologous end joining, nucleotide insertion or deletion (indel) occurs, and gene knockout can be achieved by frameshift or the like. On the other hand, when donor DNA serving as a repair template is introduced from outside the cell, gene knock-in can be achieved by homologous recombination between the genome and the donor DNA. In this gene knock-in, not only DNA insertion but also substitution or deletion of one to several nucleotides can be achieved.

[0004] However, from the viewpoint of genome homeostasis, genome editing using programmable nucleases has a major problem. One of them is the occurrence of unintended gene mutations due to double-stranded DNA breaks. In somatic cells, repair by non-homologous end joining is more dominant than repair by homologous recombination, so that unintended mutations (indels) are more likely to occur at the target site where double-strand breaks have been made by genome editing systems than knock-in by repair templates. Therefore, in addition to cells in which the intended knock-in has been achieved and cells in which no changes in gene sequence have occurred, a considerable number of cells in which unintended mutations have occurred due to non-homologous end joining are included in the cell population in which genome editing has been performed. Also, at the single-cell level, even if one of the autosomal alleles is knocked in as planned, the other may have an unintended mutation. It has also been reported that programmable nucleases can generate DNA double-strand breaks and cause genome mutations even in DNA sequences (off-targets) that are highly similar to the target sequence.

[0005] Therefore, the present inventors have developed a method that can suppress the occurrence of unintended mutations (indels) due to non-homologous end joining by inducing homologous recombination by single-stranded DNA cleavage using a nickase-type Cas9 in which one of the two nuclease sites of Cas9 is inactivated, compared to conventional methods using double-stranded DNA cleavage. One of these is a genome editing method using a tandem nicking method in which two nicks are inserted into the target genome and one into a donor plasmid containing a repair template using a nickase (Non-Patent Document 1, Patent Document 1). The present inventors have also further developed this method and developed a combination of single nicks in the target gene and donor plasmid (SNGD method) in which one nick is inserted into the target genome and one nick is inserted into a donor plasmid containing a repair template (Patent Document 1).

[0006] On the other hand, genome editing also has the problem of random integration of donor DNA used as a repair template into the genome. Therefore, the present inventors have also developed a method of genome editing using a homologous chromosome originally present in a cell as a repair template (Patent Document 2). According to this genome editing, when a heterozygous mutation or compound heterozygous mutation exists in a chromosome in a cell, by inducing homologous recombination between the homologous chromosomes, the mutation existing in the other homologous chromosome can be repaired to a normal sequence using one homologous chromosome that does not have the mutation as a repair template.

[0007] In order to treat diseases in which the gene product from a mutant allele inhibits the function of the gene product from a normal allele among heterozygous mutations present in chromosomes, in addition to restoring the normal sequence using homologous recombination, it is also possible to specifically delete the DNA region containing the mutation.

[0008] For this reason, there is a need to develop a method for efficiently deleting a specific DNA region on one of the homologous chromosomes while suppressing the occurrence of unintended mutations. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] JP 2018-11525 A [Patent Document 2] International Publication No. 2020 / 100361 [Non-patent literature]

[0010] [Non-Patent Document 1] Nakajima K, et al., Genome Res. 28, 223-230, 2018 Summary of the Invention [Problem to be solved by the invention]

[0011] The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a method for efficiently causing a specific DNA deletion in one of homologous chromosomes without performing double-stranded DNA breaks and without using an exogenous donor DNA. Another object of the present invention is to provide a method for evaluating the homologous recombination function of a cell using the DNA deletion as an indicator. [Means for solving the problem]

[0012] When a heterozygous mutation exists in a gene in a cell, the gene mutation present in one of the homologous chromosomes (called "chromosome A") is not present in the other homologous chromosome (called "chromosome B"). If the DNA region containing the mutation on chromosome A can be specifically deleted, it becomes possible to treat a disease caused by the mutation.

[0013] The present inventors introduced single-stranded DNA breaks in various manners around the mutation site of a homologous chromosome, and found that it is possible to efficiently delete a DNA region of more than 100 bp from chromosome A by generating nicks on both DNA strands or the same DNA strand at multiple locations in the DNA region near the mutation site of chromosome A, and generating a nick in chromosome B at one location corresponding to the location where a nick is generated in chromosome A (examples of nick introduction in this embodiment are shown in Figures 2 and 4). Furthermore, the present inventors found that it is possible to efficiently delete a DNA region of more than 100 bp from chromosome A even when a nick is not generated in chromosome B in the above embodiment (examples of nick introduction in this embodiment are shown in Figures 3 and 5). Furthermore, the present inventors found that it is possible to improve the efficiency of deletion of a DNA region by using cells in which the function of a gene involved in homologous recombination (for example, each FANC gene) is suppressed.

[0014] According to the principle of the method of the present invention, it is possible to delete more than 100 bp of DNA in only one of the homologous chromosomes by targeting the bases that differ between the homologous chromosomes. In addition, based on the fact that suppression of the homologous recombination function in cells improves the efficiency of DNA deletion, it is also possible to evaluate the homologous recombination function in cells using the DNA deletion as an indicator.

[0015] The present invention is based on these findings and, more specifically, provides the following:

[0016] (1) A method for producing a cell having a DNA deletion specific to chromosome A in a homologous chromosome consisting of chromosome A and chromosome B, comprising the steps of: The method includes introducing a combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to a specific site into a cell having a different base between homologous chromosomes at the specific site, A method in which the combination of site-specific nickases makes single-stranded breaks at multiple locations in the DNA region near the specific site in chromosome A, and the single-stranded breaks are single-stranded breaks on both DNA strands or on the same DNA strand in the nearby DNA region, and makes single-stranded breaks in chromosome B at one location corresponding to the location where the single-stranded break occurs in chromosome A, or does not make single-stranded breaks at the corresponding location.

[0017] (2) The method according to (1), wherein a cell having a different base between homologous chromosomes at a specific site in the homologous chromosome is a cell in which the function of the FANC gene is suppressed.

[0018] (3) The method according to (1) or (2), wherein the base that differs between homologous chromosomes is a base at a mutation site.

[0019] (4) The method according to any one of (1) to (3), wherein the site-specific nickase is a CRISPR-Cas system.

[0020] (5) A kit for use in the method according to (1), comprising: In a cell having a different base between homologous chromosomes at a specific site in the homologous chromosome, the method comprises the steps of: A kit in which the combination of site-specific nickases makes single-stranded breaks at multiple locations in the DNA region near the specific site in chromosome A, and the single-stranded breaks are single-stranded breaks on both DNA strands or on the same DNA strand in the nearby DNA region, and in chromosome B, makes a single-stranded break at one location corresponding to the location of the single-stranded break in chromosome A, or does not make a single-stranded break at the corresponding location.

[0021] (6) The kit according to (5), wherein the cell having a different base between homologous chromosomes at a specific site of the homologous chromosome is a cell in which the function of the FANC gene is suppressed.

[0022] (7) A method for evaluating a homologous recombination function of a cell, comprising the steps of: The method includes introducing a combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to a specific site into a cell having a base difference between the homologous chromosomes, the cell being composed of chromosome A and chromosome B, and detecting a DNA deletion specific to chromosome A that is generated thereby, the combination of site-specific nickases in chromosome A causes single-strand breaks at multiple sites in the DNA region adjacent to the specific site, and the single-strand breaks are on both DNA strands or on the same DNA strand in the DNA region adjacent to the specific site, and in chromosome B causes single-strand breaks at one site corresponding to the site where the single-strand break occurs in chromosome A, or does not cause single-strand breaks at the corresponding site; A method in which the homologous recombination function of the cell is evaluated as being suppressed if the frequency of DNA deletion specific to chromosome A is higher than that of the control.

[0023] (8) The method according to (7), wherein the cell is a cancer cell.

[0024] (9) The method according to (7) or (8), wherein the site-specific nickase is a CRISPR-Cas system.

[0025] (10) A kit for use in the method according to (7), In a cell having a specific site in a homologous chromosome consisting of chromosome A and chromosome B, which has a different base between the homologous chromosomes, the combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to the specific site, A kit in which the combination of site-specific nickases makes single-stranded breaks at multiple locations in the DNA region near the specific site in chromosome A, and the single-stranded breaks are single-stranded breaks on both DNA strands or on the same DNA strand in the nearby DNA region, and in chromosome B, makes a single-stranded break at one location corresponding to the location of the single-stranded break in chromosome A, or does not make a single-stranded break at the corresponding location. Effect of the Invention

[0026] According to the present invention, it is possible to efficiently induce DNA deletion specific to one of the homologous chromosomes. In the method of the present invention, since double-stranded DNA cleavage is not performed, unintended mutations are unlikely to occur throughout the genome including chromosome B. In addition, since no foreign donor DNA is used, the problem of random integration of donor DNA does not occur. Therefore, even when the present invention is applied to medical treatment such as gene therapy, it is highly safe. In addition, according to the present invention, the homologous recombination function of cells can be evaluated using DNA deletion specific to one of the homologous chromosomes as an index. [Brief description of the drawings]

[0027] [Figure 1] 1 is a conceptual diagram (one example) of the method of the present invention. The base at target site a in chromosome A is different from the base at target site b in chromosome B. In this example, a nick is generated at one site on each of the DNA strands in the region adjacent to target site a in chromosome A, and a nick is generated at one site in chromosome B that corresponds to the site where a nick is generated in chromosome A. This results in a deletion of a DNA fragment in chromosome A. [Diagram 2]FIG. 1 shows an example of an embodiment (first embodiment of the present invention) in which a nick is generated in each of the DNA strands in a region near the target site a of chromosome A, and a nick is generated in chromosome B at a site corresponding to the site where a nick is generated in chromosome A. [Diagram 3] FIG. 1 shows an example of an embodiment (second embodiment of the present invention) in which, in the method of the present invention, one nick is generated in each of the DNA strands in the region near the target site a in chromosome A, and no nick is generated in chromosome B at a site corresponding to the site where a nick is generated in chromosome A. [Figure 4] FIG. 1 shows an example of an embodiment (third embodiment of the present invention) in which, in the method of the present invention, two nicks are generated on the same DNA strand in a region adjacent to target site a of chromosome A, and a single nick is generated in chromosome B at a position corresponding to the position where a nick is generated in chromosome A. [Diagram 5] FIG. 1 shows an example of an embodiment (fourth embodiment of the present invention) in which two nicks are generated on the same DNA strand in the region adjacent to target site a of chromosome A, and no nicks are generated in chromosome B at positions corresponding to the positions where nicks are generated in chromosome A. [Figure 6A] 1 shows the positional relationship between the PCR product and nicks obtained using PCR primer set L-AS15s or PCR primer set L-AS15s. (a) shows nicks of PCR primer set L-AS15s, sgRNA TKex4_20s, and sgRNA AS15, (b) shows nicks of PCR primer set L-AS15s, sgRNA TKex4_20s, and sgRNA S8, (c) shows nicks of PCR primer set L-AS15l, sgRNA TKex4_20s, and sgRNA AS15, and (d) shows nicks of PCR primer set L-AS15l, sgRNA TKex4_20s, and sgRNA S8. The nicks in (a) and (c) are examples of the embodiment shown in FIG. 2 (first embodiment of the present invention), and the nicks in (b) and (d) are examples of the embodiment shown in FIG. 4 (third embodiment of the present invention). [Figure 6B]Electrophoretic images of cell clones in which DNA deletions occurred were identified using the PCR primer set L-AS15s. (a) shows the results of introducing nicks with sgRNA TKex4_20s and sgRNA AS15, and (b) shows the results of introducing nicks with sgRNA TKex4_20s and sgRNA S8. [Figure 6C] This is a graph showing the percentage of cell clones in which a deletion of 600 bp or more was detected only in one homologous chromosome. Each experiment was performed in triplicate using 94 clones. [Figure 7A] 1 shows the positional relationship between PCR products and nicks obtained using the PCR primer set L-TKex57. (a) shows nicks in the PCR primer set L-TKex57 and sgRNA TKex5_m4s and sgRNA TKex7_105s, and (b) shows nicks in the PCR primer set L-TKex57 and sgRNA TKex5_m4s and sgRNA TKex7_mut121s. The nicks in (a) are an example of the embodiment shown in FIG. 4 (the third embodiment of the present invention), and the nicks in (b) are an example of the embodiment shown in FIG. 5 (the fourth embodiment of the present invention). [Figure 7B] This is a graph showing the percentage of cell clones in which a deletion of 500 bp or more was detected only in one homologous chromosome. Each experiment was performed in triplicate using 94 clones. [Figure 8A] 1 shows the positional relationship between the PCR product obtained using PCR primer set L-S14 and the nicks in PCR primer set L-S14, sgRNA S14, and sgRNA TKex4_20s. The nicks in this figure are an example of the embodiment shown in FIG. 4 (the third embodiment of the present invention). [Figure 8B] Electrophoretic images of cell clones with DNA deletions identified using PCR primer set L-S14. (a) shows the results of introducing nicks into FANCA mutant cells with sgRNA TKex4_20s and sgRNA S14, and (b) shows the results of introducing nicks into parent TK6261 cells with sgRNA TKex4_20s and sgRNA S14. [Figure 8C]1 is a graph showing the percentage of cell clones in which a deletion of 1000 bp or more was detected only in one homologous chromosome. Each experiment was performed in triplicate using 94 clones. [Figure 9A] Electrophoretic images of cell clones in which DNA deletions occurred, using PCR primer set L-S14. (a) The top shows the results of introducing nicks with sgRNA TKex4_20s and sgRNA S14 in cells in which FANCS protein was eliminated by auxin induction, and the bottom shows the results in cells without auxin induction (control). (b) The top shows the results of introducing nicks with sgRNA TKex4_20s and sgRNA S14 in cells in which FANCD1 protein was eliminated by auxin induction, and the bottom shows the results in cells without auxin induction (control). [Figure 9B] This is a graph showing the percentage of cell clones in which a deletion of 1000 bp or more was detected only in one homologous chromosome. (a) shows the results for cells in which FANCS protein was lost by auxin induction (AUX(+)) or cells without auxin induction (AUX(-)) (control). (b) shows the results for cells in which FANCD1 protein was lost by auxin induction (AUX(+)) or cells without auxin induction (AUX(-)) (control). 94 clones were used for each experiment, and the experiment was performed in triplicate. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] 1. Method and kit for producing cells having DNA deletions The present invention provides a method for producing a cell having a DNA deletion specific to chromosome A in a homologous chromosome consisting of chromosome A and chromosome B.

[0029] The method of the present invention involves introducing into a cell having a base difference between homologous chromosomes at a specific site in the homologous chromosome, a combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to the specific site.

[0030] In the present invention, the "base that differs between homologous chromosomes" at a specific site of a homologous chromosome may be one base or multiple bases (base sequence). It may also be a mutation or a polymorphism. Examples of the mutation include substitution, deletion, insertion, or a combination thereof, and examples of the polymorphism include single nucleotide polymorphism and microsatellite polymorphism. The base may be present in a gene coding region or a gene non-coding region.

[0031] Furthermore, in the present invention, it is possible to cause a deletion of DNA containing a mutation or polymorphism at a specific site in a homologous chromosome, or to cause a deletion of the corresponding DNA in the other chromosome.

[0032] A typical application of the present invention from the viewpoint of medical usefulness is to delete DNA containing a heterozygous mutation in a human cell in order to treat or prevent a human disease caused by the heterozygous mutation. The heterozygous mutation to be treated or prevented is preferably, for example, a gain-of-function mutation or a dominant-negative mutation. Examples of "diseases caused by heterozygous mutations" include, but are not limited to, diseases caused by autosomal heterozygous mutations that are inherited in an autosomal dominant manner (e.g., OAS1 abnormalities in congenital immunodeficiency, severe congenital neutropenia due to ELANE mutations, chronic mucocutaneous candidiasis, hereditary motor, sensory, and autonomic neuropathy type IIC, postsynaptic slow channel congenital myasthenia, Parkinson's disease type 8, tubular aggregate myopathy, thyroid hormone insensitivity, hyper-IgE syndrome, Ehlers-Danlos syndrome, collagen disorders (osteogenesis imperfecta, dystrophic epidermolysis bullosa, type II collagen disorder, etc.), retinitis pigmentosa, achondroplasia, etc.) and triplet repeat diseases that are inherited in an autosomal dominant manner (e.g., Huntington's disease, spinocerebellar ataxia, tonic muscular dystrophy, Friedreich's ataxia, oculopharyngeal muscular dystrophy, etc.).

[0033] The "site-specific nickase" used in the present invention is not limited as long as it can cleave a single strand of DNA at a site-specific location on the genome, but a CRISPR-Cas system having a nickase-type Cas protein as a component is preferred. A Cas protein usually contains a domain involved in cleavage of a target strand (RuvC domain) and a domain involved in cleavage of a non-target strand (HNH domain), but a nickase-type Cas protein typically loses its cleavage activity due to a mutation in either of these two domains. In the case of spCas9 protein (Cas9 protein derived from S. pyogenes), such mutations include, for example, a mutation of the 10th amino acid (aspartic acid) from the N-terminus to alanine (D10A: a mutation in the RuvC domain), a mutation of the 840th amino acid (histidine) from the N-terminus to alanine (H840A: a mutation in the HNH domain), a mutation of the 863rd amino acid (asparagine) from the N-terminus to alanine (N863A: a mutation in the HNH domain), a mutation of the 762nd amino acid (glutamic acid) from the N-terminus to alanine (E762A: a mutation in the RuvCII domain), and a mutation of the 986th amino acid (aspartic acid) from the N-terminus to alanine (D986A: a mutation in the RuvCIII domain). In addition, Cas9 proteins of various origins are known (for example, WO2014 / 131833), and their nickase forms can be used. The amino acid sequence and nucleotide sequence of the Cas9 protein are registered in public databases, such as GenBank (http: / / www.ncbi.nlm.nih.gov) (e.g., accession number: Q99ZW2.1, etc.), and can be used in the present invention.

[0034] In addition, in the present invention, Cas proteins other than Cas9, such as Cpf1 (Cas12a), Cas12b, CasX (Cas12e), Cas14, etc., can also be used. For example, in AsCpf1 (Cas12), a mutation of the 1226th amino acid (arginine) from the N-terminus to alanine (R1226A: a mutation in the Nuc domain) can be used as a mutation in the nickase-type Cpf1 protein. The amino acid sequence of Cpf1 is registered in a public database, such as GenBank (http: / / www.ncbi.nlm.nih.gov) (for example, accession numbers: WP_021736722, WP_035635841, etc.).

[0035] As the protein constituting the CRISPR-Cas system, for example, one to which a nuclear localization signal has been added may be used.

[0036] In the CRISPR-Cas system, which has a nickase-type Cas protein as a component, the nickase-type Cas protein binds to a guide RNA to form a complex, which is targeted to a target DNA sequence and causes single-stranded DNA cleavage. In the CRISPR-Cas9 system, the guide RNA includes crRNA and tracrRNA, but in the CRISPR-Cpf1 system, tracrRNA is not required. The guide RNA in the CRISPR-Cas9 system may be a single-molecule guide RNA including crRNA and tracrRNA, or a two-molecule guide RNA consisting of a crRNA fragment and a tracrRNA fragment.

[0037] The crRNA contains a base sequence complementary to the target DNA sequence. The target DNA sequence is usually a base sequence consisting of 12 to 50 bases, preferably 17 to 30 bases, more preferably 17 to 25 bases, and is preferably selected from a region adjacent to a PAM (proto-spacer adjacent motif) sequence. Typically, site-specific cleavage of DNA occurs at a position determined by both the complementarity of base pairing between the crRNA and the target DNA sequence and the PAM present adjacent thereto.

[0038] In many CRISPR-Cas systems, the crRNA further contains a base sequence on the 3' side that can interact (hybridize) with the tracrRNA fragment. On the other hand, the tracrRNA contains a base sequence on the 5' side that can interact (hybridize) with a partial base sequence of the crRNA. The interaction of these base sequences causes the crRNA / tracrRNA (one or two molecules) to form a double-stranded RNA, which interacts with the Cas protein.

[0039] PAM differs depending on the type and origin of the Cas protein. Typical PAM sequences are, for example, 5′-NGG in the Cas9 protein from S. pyogenes (type II), 5′-CCN in the Cas9 protein from S. solfataricus (type I-A1), 5′-TCN in the Cas9 protein from S. solfataricus (type I-A2), 5′-TTC in the Cas9 protein from H. walsbyl (type IB), 5′-AWG in the Cas9 protein from E. coli (type IE), 5′-CC in the Cas9 protein from E. coli (type IF), and 5′-CC in the Cas9 protein from P. aeruginosa. In the Cas9 protein from S. eruginosa (IF type), it is "5'-CC", in the Cas9 protein from S. Thermophilus (II-A type), it is "5'-NNAGAA", in the Cas9 protein from S. agalactiae (II-A type), it is "5'-NGG", in the Cas9 protein from S. aureus, it is "5'-NGRRT" or "5'-NGRRN", in the Cas9 protein from N. meningitidis, it is "5'-NNNNGATT", and in the Cas9 protein from T. denticola, it is "5'-NAAAAC". In Cpf1, it is typically "5'-TTN" or "5'-TTTN". It is also possible to modify PAM recognition by modifying the protein (e.g., by introducing a mutation) (Benjamin, P. et al., Nature 523, 481-485 (2015); Hirano, S. et al., Molecular Cell 61, 886-894 (2016); Walton, RT et al., Science 368, 290-296 (2020)).

[0040] In the present invention, a site-specific nickase other than the CRISPR-Cas system can also be used. Examples of such site-specific nickases include artificial nucleases fused with an enzyme having nickase activity. Examples of artificial nucleases that can be used include TALE (transcription activator-like effector), ZF (zinc finger), and PPR (pentatricopeptide repeat). Examples of enzymes that can exhibit nickase activity by fusion with these artificial nucleases include TevI (Nat Commun. 2013;4:1762. doi: 10.1038 / ncomms2782). These artificial nucleases are targeted to a target DNA sequence by a DNA binding domain constructed by linking a module (peptide) that recognizes a specific base (or a specific base sequence), and the nickase fused to the DNA binding domain cleaves the DNA in a single strand. An appropriate spacer peptide may be introduced between the DNA binding domain and the nickase in the artificial nuclease.

[0041] In the present invention, in one of the homologous chromosomes (i.e., chromosome A), single-strand breaks are made at multiple locations in the DNA region adjacent to the specific site (base that differs between homologous chromosomes). In one embodiment, both DNA strands in the adjacent DNA region are single-stranded, and in another embodiment, single-strand breaks are made at multiple locations on the same DNA strand in the adjacent DNA region. Also, in the other homologous chromosome (i.e., chromosome B), single-strand breaks are made at one location corresponding to the location where single-strand breaks are made in chromosome A (hereinafter simply referred to as "corresponding location"), or single-strand breaks are not made at the corresponding location. Thus, the present invention includes the following embodiments.

[0042] First embodiment: In chromosome A, single-strand breaks are made in both DNA strands in the above-mentioned adjacent DNA regions, and in chromosome B, a single-strand break is made at one corresponding site (Figure 2).

[0043] Second embodiment: In chromosome A, single-strand breaks are made in both DNA strands in the above-mentioned adjacent DNA regions, whereas in chromosome B, no single-strand breaks are made at the corresponding sites (FIG. 3).

[0044] Third embodiment: In chromosome A, single-strand breaks are made at multiple sites in the same DNA strand in the above-mentioned adjacent DNA region, and in chromosome B, single-strand breaks are made at one corresponding site (Figure 4).

[0045] Fourth embodiment: In chromosome A, single-strand breaks are made at multiple sites in the same DNA strand in the above-mentioned adjacent DNA region, whereas in chromosome B, single-strand breaks are not made at the corresponding sites (FIG. 5).

[0046] Here, the "neighboring DNA region" is a region that is usually within 100,000 bases (e.g., within 10,000 bases, within 5,000 bases, within 2,000 bases, within 1,000 bases, within 600 bases) from a specific site. The distance between the nicks to be introduced is usually 100 bases or more (e.g., 200 bases or more, 300 bases or more, 500 bases or more, 700 bases or more, 1,000 bases or more, 1,500 bases or more). It is preferable that one of the nicks to be introduced into the chromosome is immediately adjacent to the specific site. Here, "immediately adjacent" is usually within 100 base positions, more preferably within 50 bases (e.g., within 40 bases, within 30 bases, within 20 bases, within 10 bases).

[0047] Specific examples of the embodiment include an embodiment in which single-stranded breaks are made in both DNA strands on either side of the specific site in chromosome A (2-1, 2-2, 2-7, and 2-8 in FIG. 2), an embodiment in which single-stranded breaks are made in one site on the same DNA strand on either side of the specific site (4-3 to 4-6 in FIG. 4), an embodiment in which single-stranded breaks are made in one site on both DNA strands on one side of the specific site (2-3 to 2-6 in FIG. 2), and an embodiment in which single-stranded breaks are made in two sites on the same DNA strand on one side of the specific site (4-1, 4-2, 4-7, and 4-8 in FIG. 4). In addition, other specific sites (bases different between homologous chromosomes) may be present in the DNA region near one specific site (FIGS. 3 and 5). In this case, by introducing nicks so as to sandwich multiple specific sites, DNA containing multiple specific sites can be deleted in chromosome A. In addition, the number of sites where single-stranded breaks are made in chromosome A may be three or more.

[0048] When single-strand cleavage is to be performed simultaneously at corresponding sites in two chromosomes constituting homologous chromosomes (i.e., chromosome A and chromosome B), the site-specific nickase that binds to the target DNA sequence in chromosome A may be designed to also bind to the corresponding DNA sequence in chromosome B. In this case, the target DNA sequence in chromosome A and the corresponding DNA sequence in chromosome B are typically the same DNA sequence.

[0049] In the case where a site where a single-strand break is specifically generated in chromosome A in two chromosomes constituting a homologous chromosome, a site-specific nickase that binds to a target DNA sequence in chromosome A may be designed not to bind to a corresponding DNA sequence in chromosome B. In this case, the target DNA sequence in chromosome A and the corresponding DNA sequence in chromosome B are different DNA sequences. For example, if a target DNA sequence of the site-specific nickase is set so as to include a base at a specific site in chromosome A (a base that differs between homologous chromosomes), the target DNA sequence will be a different DNA sequence from the corresponding DNA sequence in chromosome B. When the site-specific nickase is a CRISPR-Cas system, a guide RNA may be designed to specifically bind to a target DNA sequence in chromosome A. In addition, when the site-specific nickase is an artificial nuclease fused with an enzyme having nickase activity, a DNA binding domain may be designed to have binding specificity for the target DNA sequence in chromosome A. In this embodiment, in terms of the design of the site-specific nickase, the site where the single strand is cleaved is usually within 100 base positions, more preferably within 50 base positions (e.g., within 40 base positions, within 30 base positions, within 20 base positions, within 10 base positions) from the above-mentioned specific site (the base that differs between homologous chromosomes).

[0050] In the present invention, by combining the above-mentioned site-specific nucleases, single-stranded cleavage of homologous chromosomes can be carried out in various patterns (examples are shown in Figs. 2 to 5).

[0051] In the present invention, when single-strand breaks are made in both strands of DNA in chromosome A (first and second embodiments of the present invention, Figs. 2 and 3), double-strand breaks may occur if the distance between the single-strand breaks is too close. Therefore, the distance between the single-strand breaks on different DNA strands is usually 100 bases or more, preferably 200 bases or more.

[0052] In the present invention, the combination of the site-specific nickases is introduced into cells. In the case of the CRISPR-Cas system, the "site-specific nickase" introduced into cells may be, for example, in the form of a combination of a guide RNA and a Cas protein, in the form of a combination of a guide RNA and a messenger RNA translated into a Cas protein, or in the form of a combination of a vector expressing them. The guide RNA may be modified (chemically modified, etc.) to suppress degradation. In the case of an artificial nuclease fused with an enzyme having nickase activity, it may be, for example, in the form of a protein, in the form of a messenger RNA translated into the protein, or in the form of a vector expressing the protein.

[0053] When the expression vector is used, it contains one or more regulatory elements operably linked to the DNA to be expressed. Here, "operably linked" means that the DNA is operably linked to the regulatory element. "Regulatory elements" include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences). Depending on the purpose, the regulatory element may be, for example, one that directs constitutive expression of DNA in various host cells, or one that directs expression of DNA only in specific cells, tissues, or organs. In addition, it may be one that directs expression of DNA only at a specific time, or one that directs expression of DNA that can be artificially induced. Examples of promoters include polIII promoters (e.g., U6 and H1 promoters), polII promoters (e.g., retroviral Rous sarcoma virus (RSV) LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter, and EF1α promoter), polI promoters, or combinations thereof. Those skilled in the art can select an appropriate expression vector depending on the type of cell to be introduced, etc.

[0054] The "cells" to which the method of the present invention is applied are not particularly limited, and various eukaryotic cells can be targeted, so long as they have homologous chromosomes.

[0055] "Eukaryotic cells" include, for example, animal cells, plant cells, algae cells, and fungal cells. Animal cells include, for example, mammalian cells, as well as fish, bird, reptile, amphibian, and insect cells.

[0056] The term "animal cells" includes, for example, cells constituting an individual animal, cells constituting organs and tissues extracted from an animal, and cultured cells derived from animal tissues. Specifically, for example, embryonic cells of each stage of embryo (for example, 1-cell stage embryo, 2-cell stage embryo, 4-cell stage embryo, 8-cell stage embryo, 16-cell stage embryo, morula stage embryo, etc.); stem cells such as induced pluripotent stem (iPS) cells, embryonic stem (ES) cells, and hematopoietic stem cells; and somatic cells such as fibroblasts, hematopoietic cells, neurons, muscle cells, bone cells, liver cells, pancreatic cells, brain cells, and kidney cells. To create genome-edited animals, oocytes after fertilization, i.e., fertilized eggs, can be used. Particularly preferably, the fertilized eggs are pronuclear stage embryos. For oocytes before fertilization, those that have been frozen and stored can be thawed and used.

[0057] In the present invention, the term "mammal" refers to a concept that includes humans and non-human mammals. Examples of non-human mammals include even-toed ungulates such as cows, wild boars, pigs, sheep, and goats, odd-toed ungulates such as horses, rodents such as mice, rats, guinea pigs, hamsters, and squirrels, lagomorphs such as rabbits, and carnivores such as dogs, cats, and ferrets. The non-human mammals may be livestock or companion animals (pets), or may be wild animals.

[0058] Examples of "plant cells" include cells of grains, oil crops, forage crops, fruits, and vegetables. Examples of "plant cells" include cells constituting an individual plant, cells constituting organs or tissues separated from a plant, and cultured cells derived from plant tissue. Examples of plant organs and tissues include leaves, stems, shoot tips (growing points), roots, tubers, tuberous roots, seeds, and calluses. Examples of plants include rice, corn, banana, peanut, sunflower, tomato, rapeseed, tobacco, wheat, barley, potato, soybean, cotton, and carnation.

[0059] As the cells used in the method of the present invention (particularly the third embodiment (FIG. 4) and the fourth embodiment (FIG. 5) of the present invention described below), it is preferable to use cells in which the function of the FANC gene is suppressed. Examples of the FANC gene include the FANCA gene as well as family genes such as the FANCB gene, the FANCC gene, the FANCD1 (BRCA2) gene, the FANCD2 gene, and the FANCS (BRCA1) gene. The nucleotide sequence of a typical human FANCA gene and the amino acid sequence of the protein encoded by the gene are listed in the database (accession numbers: NM_000135, NP_000126). The nucleotide sequence of a typical human FANCB gene and the amino acid sequence of the protein encoded by the gene are listed in the database (accession numbers: NM_001018113, NP_001018123). The nucleotide sequence of a typical human FANCC gene and the amino acid sequence of the protein encoded by the gene are listed in the database (accession numbers: NM_000136, NP_000127). The nucleotide sequence of the conventional FANCD1 gene and the amino acid sequence of the protein encoded by said gene are disclosed in the database (accession numbers: NM_000059, NP_000050), the nucleotide sequence of a typical human-derived FANCD2 gene and the amino acid sequence of the protein encoded by said gene are disclosed in the database (accession numbers: NM_001018115, NP_001018125), and the nucleotide sequence of a typical human-derived FANCS gene and the amino acid sequence of the protein encoded by said gene are disclosed in the database (accession numbers: NM_007294, NP_009225).

[0060] In the present invention, the mechanism of "suppressing the function of the FANC gene" may be suppression of the activity of the translation product (protein) of the gene or suppression of the expression of the gene. The activity of the translation product (protein) of the gene can be suppressed, for example, by introducing a mutation (deletion, substitution, insertion, etc.) into the gene or by treatment with an inhibitor.

[0061] Introduction of a mutation into the FANC gene can be carried out, for example, by using a genome editing system. Examples of genome editing systems include site-specific artificial nucleases such as CRISPR-Cas (e.g., CRISPR-Cas9), TALENs, and ZFNs that target the FANC gene. The gene is cut at the target site by the action of the genome editing system, and a mutation (such as deletion or insertion of a base) is introduced into the gene via the DNA repair mechanism of the cell. When a gene is deleted by introducing a mutation, the deletion may be a deletion of the entire gene or a partial deletion.

[0062] FANC inhibitors may be, for example, molecules that inhibit the single-stranded annealing activity or strand exchange activity of FANC (for the activity of FANC, see, for example, Benitez, A. et al., Mol Cell 16;71(4), 621-628(2018)).

[0063] "Suppression of the function of the FANC gene" can also be achieved by suppressing the expression of the gene. Suppression of the expression of the FANC gene may be suppression of the translation or transcription of the gene. Suppression of the translation of the FANC gene can be achieved, for example, by using double-stranded RNA (dsRNA) that binds to the transcription product of the FANC gene. Examples of double-stranded RNA include siRNA, shRNA (short haipin RNA), and miRNA. Suppression of the transcription of the FANC gene can be achieved, for example, by introducing a mutation into the expression control region of the FANC gene. The above-mentioned genome editing system that targets the expression control region can be used to introduce the mutation. Whether or not the expression of the FANC gene is suppressed can be evaluated at the translation level, for example, by an immunological measurement method using an antibody that binds to the translation product, and at the transcription level, for example, by RT-PCR or Northern blotting.

[0064] Molecules for suppressing the function of these FANC genes may be introduced into cells by themselves, or, if the molecule is a nucleic acid, DNA encoding the molecule (typically, a vector into which the DNA has been inserted) may be introduced into cells to express the molecule in the cells.

[0065] Molecules that suppress the function of site-specific nickase or the FANC gene can be introduced into cells by known methods, such as electroporation, microinjection, the DEAE-dextran method, lipofection, nanoparticle-mediated transfection, and virus-mediated nucleic acid delivery.

[0066] After being introduced into a cell, the combination of site-specific nickases causes single-strand breaks at multiple sites in the DNA region near the specific site of chromosome A, resulting in a deletion of DNA containing the specific site in the chromosome. According to the present invention, cells in which such DNA deletion has occurred can be produced with high efficiency. Here, "high efficiency" means preferably 3% or more, more preferably 5% or more, and particularly preferably 10% or more (e.g., 20% or more, 30% or more, 35% or more).

[0067] The present invention also provides a kit for use in the method of the present invention, comprising the combination of site-specific nickases. The kit may further comprise one or more additional reagents, including, but not limited to, a dilution buffer, a reconstitution solution, a washing buffer, a nucleic acid introduction reagent, a protein introduction reagent, and a control reagent (e.g., a control guide RNA). The kit may also include instructions for carrying out the method of the present invention.

[0068] 2. Method and kit for evaluating the homologous recombination function of cells The present invention also provides a method for assessing the homologous recombination function of a cell.

[0069] In the present invention, it was found that the efficiency of DNA region deletion was significantly improved by using cells in which the function of a gene involved in homologous recombination was suppressed, and therefore it is possible to evaluate the homologous recombination function in cells using the DNA deletion as an indicator.

[0070] The method of the present invention, similar to the above "1.", involves introducing into a cell having a specific site in a homologous chromosome consisting of chromosome A and chromosome B, a combination of site-specific nickases that cause single-stranded breaks in a DNA region adjacent to the specific site, and detecting the resulting DNA deletion specific to chromosome A.

[0071] The combination of site-specific nickases is such that, in chromosome A, single-strand breaks are made at multiple locations in the DNA region near the specific site, and the single-strand breaks are single-strand breaks on both DNA strands or on the same DNA strand in the nearby DNA region, and, in chromosome B, single-strand breaks are made at one location corresponding to the location where the single-strand break is made in chromosome A, or no single-strand breaks are made at the corresponding location.

[0072] A preferred combination of site-specific nickases is one in which, in chromosome A, single-strand breaks are made at multiple locations in the DNA region near the specific site, and the single-strand breaks are on the same DNA strand of the nearby DNA region, and, in chromosome B, single-strand breaks are made at a single location corresponding to the location of the single-strand break in chromosome A (third embodiment, FIG. 4); and one in which, in chromosome A, single-strand breaks are made at multiple locations in the DNA region near the specific site, and the single-strand breaks are on the same DNA strand of the nearby DNA region, and, in chromosome B, single-strand breaks are not made at a single location corresponding to the location of the single-strand break in chromosome A (fourth embodiment, FIG. 5).

[0073] The method of the present invention for evaluating the homologous recombination function of a cell can also be carried out in a mode in which, in a homologous chromosome consisting of chromosome A and chromosome B, single-strand breaks are made at multiple sites on the same DNA strand of chromosome A, and single-strand breaks are made in chromosome B at multiple sites corresponding to the sites of single-strand breaks made in chromosome A. In this case, the single-strand breaks do not necessarily have to be introduced into a DNA region adjacent to a base that differs between the homologous chromosomes, and can be introduced into any DNA region.

[0074] In the method of the present invention, when the frequency of DNA deletion specific to chromosome A is higher than that of the control, the cell is evaluated as having its homologous recombination function suppressed. Here, "higher than that of the control" means a frequency that is preferably at least twice that of the control, more preferably at least five times, and particularly preferably at least 10 times (e.g., at least 20 times). In terms of absolute frequency, the frequency is preferably at least 4%, more preferably at least 10%, and particularly preferably at least 20% (e.g., at least 40%) (see Example (2)(b), FIG. 9B). As a control, the frequency in cells in which the homologous recombination function is not suppressed can be used.

[0075] The inhibition of the homologous recombination function may be caused by, for example, the inhibition of the function of a gene involved in homologous recombination (for example, a gene mutation). Therefore, in a cell evaluated according to the present invention as having an inhibited homologous recombination function, the inhibition of the function of a gene involved in homologous recombination is suspected. An example of a gene involved in homologous recombination is the above-mentioned FANC gene.

[0076] Since suppression of homologous recombination function is known to cause cancer, the method of the present invention can be applied to various cancer cells (e.g., breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, etc.).

[0077] FANCS / FANCD1 (BRCA1 / BRCA2) is a gene responsible for hereditary early-onset breast cancer and ovarian cancer, and in cancer cells of breast cancer patients and ovarian cancer patients who do not have FANCS / FANCD1 mutations in the germline, functional abnormalities and reduced expression of FANCS / FANCD1 are often observed. Since functional abnormalities and reduced expression of FANCS / FANCD1 are caused not only by gene mutations but also by expression suppression due to promoter methylation, genetic testing alone is insufficient. The present invention can evaluate whether or not the homologous recombination function is suppressed, regardless of the cause of the suppression of the homologous recombination function, and in this respect is superior to conventional genetic testing. On the other hand, an evaluation system using a reporter gene can be used to evaluate the suppression of the homologous recombination function, but it is difficult to carry out such an evaluation system in patient-derived cancer cells. The method of the present invention is also superior in that it does not require a reporter gene and can use patient-derived cancer cells as they are.

[0078] Currently, a test method called MyChoice (Myriad) that combines the measurement of the frequency of genomic alterations characteristic of homologous recombination deficiency with the above-mentioned FANC gene (BRCA gene) mutation test has been put to practical use, and the use of drugs (PARP inhibitors) is judged based on the results of this test. Therefore, the evaluation of homologous recombination function in cancer cells by the method of the present invention can also be used to evaluate the effectiveness of anticancer drugs in patients.

[0079] The present invention also provides a kit for use in the method of the present invention, comprising the combination of site-specific nickases. The kit may further comprise one or more additional reagents, including, but not limited to, a dilution buffer, a reconstitution solution, a washing buffer, a nucleic acid introduction reagent, a protein introduction reagent, and a control reagent (e.g., a control guide RNA). The kit may also include instructions for carrying out the method of the present invention. EXAMPLES

[0080] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following examples.

[0081] Materials and Methods A. Material (1)TK6261 cells These are lymphoblastoid cells derived from TK6 cells. They contain allele A (chromosome A) with a loss-of-function frameshift due to a 1-bp insertion on exon 4 of the thymidine kinase 1 gene (chromosome 17), and allele B (chromosome B) with a loss-of-function frameshift due to an 8-bp deletion on exon 5 and a 1-bp insertion on exon 7 that does not affect function. (2) FANCA mutant TK6261 cells These cells were created by generating deletion mutations in both alleles of exon 27 of the FANCA gene in TK6261 cells, resulting in the loss of FANCA function. (3)TSCER2(TIR) ​​cells These are TK6-derived cells that are compound heterozygous for the thymidine kinase 1 (TK1) gene. The TK1 exon 4 mutation is shared with TK6261 cells. Upon addition of auxin, TIR1 is expressed and AID-tagged proteins are degraded. (4) FANCS protein-deficient TSCER2(TIR) ​​cells TSCER2(TIR)-FANCS AID / AID are cells that have been modified to express FANCS-AID by knocking in an auxin-inducible degron (AID) tag at the C-terminus of both alleles of the FANCS (BRCA1) gene. The expression of FANCS (BRCA1) protein can be abolished by adding auxin (AUX). (5) FANCD1 protein-deficient TSCER2(TIR) ​​cells TSCER2(TIR)-FANCD1 AID / AID are cells that have been modified to express FANCD1-AID by knocking in an auxin-inducible degron (AID) tag at the C-terminus of both alleles of the FANCD1 (BRCA2) gene. FANCD1 (BRCA2) protein expression can be abolished by adding auxin (AUX).

[0082] B. Method 0.9 μL of 1.0 mg / mL Cas9D10A mRNA (TriLink CleanCap Cas9 Nickase mRNA (5 moU)-(L-7207)), 0.45 μL of each of the two 100 nmol / mL sgRNAs, and 2.2 μL of Neon Transfection System R buffer were mixed, and 14 × 10 4 10 μL of TK6261 cells were mixed at 10 μL per cell. Electroporation was performed on 10 μL of this mixture using the Neon Transfection System under the conditions of Voltage 1500V, Width 10 ms, Pulse 3 pulses.

[0083] The sgRNAs used were as follows (name: target sequence. [ ] indicates PAM sequence). TKex4_20s: CGTCTCGGAGCAGGCAGGCG[GGG] / SEQ ID NO: 1 S8: AGCTTCCCATCTATACCTCC[TGG] / SEQ ID NO: 2 AS15: GAGGTAGGTTGATCTTGTGT[GGG] / SEQ ID NO:3 S14: TCCCACCGAAGGCCACACGC [CGG] / SEQ ID NO: 4 TKex5_mut4s: CTCGCAGAACTCCAGGGAAC [TGG] / SEQ ID NO: 5 TKex7_105s: CCCCTGGCTTTCCTGGCACT[GGG] / SEQ ID NO: 6 TKex7_mut121s: TGGCAGCCACGGCTTCCCCC [TGG] / SEQ ID NO: 7 In addition, TKex4_20s is an sgRNA that targets only exon 4 on allele A, S8 is an sgRNA that targets intron 4 of both alleles, AS15 is an sgRNA that targets intron 4 of both alleles, S14 is an sgRNA that targets intron 3 of both alleles, TKex5_mut4s is an sgRNA that targets only exon 5 on allele B, TKex7_105s is an sgRNA that targets exon 7 of both alleles, and TKex7_mut121s is an sgRNA that targets only exon 7 on allele B.

[0084] After electroporation, the cells were cultured overnight in 10% horse serum + 200 μg / ml sodium pyruvate / RPMI1640 medium at 37°C and 5% CO2, and then cultured in 5% horse serum + 200 μg / ml sodium pyruvate / RPMI1640 medium (basal medium) at 37°C and 5% CO2 for one week.

[0085] After culturing, the cells were sorted using FACS AriaIII (BD) onto a 96-well plate in which 200 μL of basic medium was dispensed per well, so that there was one cell per well. After culturing for about one week, 94 clones derived from one proliferated cell were collected, and genomic DNA was extracted using the Easy DNA Extraction Kit Version 2 (Kaneka). Separately, genomic DNA was extracted from cells that were continued to be cultured without sorting using the Cultured Cell Genomic DNA Extraction Kit VI (ANIMOS).

[0086] PCR was performed using DNA extracted from a single cell-derived clone as a template with KOD FX Neo (TOYOBO). Primer set L-AS15s was used in PCR designed to include the target sequences of sgRNA TKex4_20s, sgRNA S8, and sgRNA AS15 in the PCR product (total length about 2.1 kbp), primer set L-AS15l was used in PCR designed to include the target sequences of sgRNA TKex4_20s, sgRNA S8, and sgRNA AS15 in the PCR product (total length about 4.3 kbp), primer set L-S14 was used in PCR designed to include the target sequences of sgRNA TKex4_20s and sgRNA S14 in the PCR product (total length about 5.4 kbp), and primer set L-TKex57 was used in PCR designed to include the target sequences of sgRNA TKex5_mut4s, sgRNA TKex7_105s, and sgRNA TKex7_mut121s in the PCR product (total length about 1.9 kbp). The sequences of the primers used in PCR are as follows.

[0087] L-AS15s (Forward): GCCTTTCCCATAGGTGCTAACT / SEQ ID NO: 8 L-AS15s (Reverse): AACAAAACACACTCTGGAAGATGGAACC / SEQ ID NO: 9 L-AS151 (Forward): CACAAGGCACAGGACACACTGTTAG / SEQ ID NO: 10 L-AS15l (Reverse): AACAAAACACACTCTGGAAGATGGAACC / SEQ ID NO: 11 L-S14 (Forward): GAGTACTCGGGTTCGTGAACTT / SEQ ID NO: 12 L-S14 (Reverse): GCAGCTTCCCATCTATACCTCC / SEQ ID NO: 13 L-TKex57 (Forward): AAGCCTCACGTCTCAATAACC / SEQ ID NO: 14 L-TKex57 (Reverse): GCTTTAAGCAGACCAGTGGGTA / SEQ ID NO: 15 The PCR products were electrophoresed in a 0.9% TAE gel to visualize the base length of the PCR products.

[0088] A portion of the PCR products showing deletions of several hundred bp or more were gel excised and purified, and DNA sequencing of the exon 4 region was performed.

[0089] First, PCR was performed using DNA extracted from a single cell-derived clone as a template with KOD plus neo (TOYOBO). Primer set S-EX4 was used for the 344 bp region (Exon 4 region) centered on the target sequence of sgRNA TKex4_20s, and primer set S-AS15 was used for the 297 bp region (S8 / AS15 region) centered on the target sequences of sgRNA S8 and sgRNA AS15.

[0090] S-EX4 (Forward): TTTCTGGACGAGGGCCTTTC / SEQ ID NO: 16 S-EX4 (Reverse): CTTCCAAGTCAGCGAGGGAAAA / SEQ ID NO: 17 S-AS15 (Forward): CCTCATGGTTCCTTTTGCTTG / SEQ ID NO: 18 S-AS15 (Reverse): GGTGGGAAAATCGCTTGAAT / SEQ ID NO: 19 The DNA sequence of the PCR product was then analyzed by Sanger sequencing. The sequences of the sequencing primers were as follows:

[0091] Exon 4 region: TGAACACTGAGCCTGCTT / SEQ ID NO: 20 S8 / AS15 region: CGTTTATTTTCTTGTTG / SEQ ID NO:21 [Example] (1) Analysis of the effect of nicking pattern on large-scale DNA deletion (a) When a combination of sgRNA TKex4_20s and sgRNA_AS15 and Cas9 was used as a known method to create two DNA double-strand breaks in allele A and one DNA double-strand break in allele B, the percentage of cells in which a deletion of 600 bp or more occurred in only one allele was 32.3% ± 5.4% (n = 94, triplicate experiments) (Figure 6C "TKex4_20s / AS15 (DSB)"). When a combination of sgRNA TKex4_20s and sgRNA_AS15 and Cas9D10A was used to create one nick in each DNA strand of allele A and one nick in the antisense strand of allele B, the rate of cells in which a deletion of 600 bp or more occurred in only one allele was 39.4% ± 2.8% (n = 94, triplicate experiments), which was equivalent to the method using two DNA double-strand breaks (Figure 6A(a), B(a), C "TKex4_20s / AS15 (Nick)"). On the other hand, when two nicks were made in tandem in the sense strand of allele A and one nick in the sense strand of allele B using a combination of sgRNA TKex4_20s and sgRNA_S8 and Cas9D10A, the frequency of deletions of 600 bp or more in only one allele was 0.35% ± 0.61% (n = 94, triplicate experiment), and the frequency of deletions was low (Figure 6A(b), B(b), C "TKex4_20s / S8(Nick)"). When nicks are used, it was shown that DNA deletions of several hundred bp are possible with high efficiency by generating nicks in both DNA double strands.

[0092] Of the 111 clones obtained using sgRNA TKex4_20s and sgRNA_AS15, and Cas9D10A, 100 clones were found to have only the wild-type sequence (sequence of allele B) detected by Sanger sequencing of the Exon 4 region. For the remaining 11 clones, PCR was performed using primer set L-AS15s, and PCR products showing deletions of several hundred bp or more were gel excised and purified. The DNA sequence of the exon 4 region contained in this PCR product was analyzed. It was confirmed that all 11 clones contained only the mutant sequence of exon 4 (sequence of allele A). These results indicated that the deletion occurred specifically in allele A, which had generated two nicks.

[0093] Sanger sequencing of the exon 4 and S8 / AS15 regions was performed in cells in which a deletion of >600bp was detected in only one allele. When the combination of sgRNA TKex4_20s and sgRNA_AS15 and Cas9D10A were used, no mutations were detected in either the Exon 4 or S8 / AS15 regions. On the other hand, when the combination of sgRNA TKex4_20s and sgRNA_AS15 and wild-type Cas9 were used, mutations were detected in 4.44±1.84% of cells in the Exon 4 region and 100±0.0% of cells in the S8 / AS15 region. These results show that it is very difficult to maintain the allele without deletion when DSB is used, but it is possible to maintain very high accuracy when nicks are used.

[0094] (b) When two tandem nicks were created in the sense strand of allele A and one nick in the sense strand of allele B in TK6261 cells using a combination of sgRNA TKex5_mut4s and sgRNA TKex7_105s and Cas9D10A, the percentage of cells in which a deletion of 500 bp or more occurred in only one allele was 0.71 ± 0.61% (n = 94, triplicate experiment) (Figure 7A(a), B "TKex5_mut4s / TKex7_105s"). On the other hand, when two tandem nicks were made in the sense strand of allele A and no nicks were made in allele B using a combination of sgRNA TKex5_mut4s and sgRNA TKex7_mut121s and Cas9D10A in TK6261 cells, the percentage of cells in which a deletion of 500 bp or more occurred in only one allele reached 2.84 ± 1.62% (n = 94, triplicate experiment) (Figure 7A (b), B "TKex5_mut4s / TKex7_mut121s"). This shows that when introducing a tandem nick into allele A, it is possible to significantly improve the occurrence rate of long deletions between nicks by not introducing a nick into allele B.

[0095] (2) Analysis of the effects of suppressing the function of the FANC gene (a) When two tandem nicks were made in the sense strand of allele A and one nick in the sense strand of allele B in FANCA-knocked TK6261 cells using a combination of sgRNA TKex4_20s and sgRNA_S14 and Cas9D10A, the percentage of cells in which a deletion of 1,000 bp or more occurred in only one allele reached 15.2% ± 2.68% (n = 94, triplicate experiment) (Fig. 8A, B(a), C "FANCA-deficient"). On the other hand, in TK62621 cells (parent cell line) expressing FANCA, the percentage of cells in which a deletion of 1,000 bp or more occurred was only 1.42% ± 0.61% (n = 94, triplicate experiment) (Fig. 8A, B(b), C "TK6261"). This indicates that it is possible to significantly improve the occurrence of long deletions between nicks by suppressing the function of FANCA.

[0096] (b) TSCER2(TIR) ​​cells, which can lose FANCS protein in an auxin-induced manner (TSCER2(TIR)-FANCS AID / AID ) and TSCER2(TIR) ​​cells that can lose FANCD1 protein in an auxin-induced manner (TSCER2(TIR)-FANCD1 AID / AID ) were nicked in the same manner as in (a) above. As a result, the percentage of cells in which a deletion of 1,000 bp or more occurred in only one allele was 45.4% ± 1.6% in the FANCS protein-lost cells and 47.5% ± 11.3% in the FANCD1 protein-lost cells (n = 94, triplicate experiments) (Figure 9A, B). The percentage of cells in which the FANCS protein was not lost without the addition of auxin and the FANCD1 protein was not lost was 1.77% ± 1.23%, and the percentage of cells in which the FANCD1 protein was not lost without the addition of auxin and the FANCD1 protein was not lost was 2.12% ± 1.06% (n = 94, triplicate experiments). This indicates that, like FANCA, it is possible to significantly increase the occurrence of long deletions between nicks by suppressing the functions of FANCS and FANCD1. [Industrial Applicability]

[0097] As described above, according to the present invention, DNA containing a specific site (a base that differs between homologous chromosomes) can be deleted in one of the homologous chromosomes by utilizing single-strand breaks caused by site-specific nickases. The present invention, which does not use double-strand breaks or foreign donor DNA, can greatly contribute to gene therapy, particularly for diseases caused by heterozygous mutations, due to its high safety. Furthermore, according to the present invention, the homologous recombination function of cells can be evaluated using DNA deletion specific to one of the homologous chromosomes as an index, which can greatly contribute to the diagnosis of diseases such as cancer.

Claims

1. A method for producing a cell having a DNA deletion specific to chromosome A in a homologous chromosome consisting of chromosome A and chromosome B, comprising the steps of: The method includes introducing into a cell (excluding cells in a human body and human germ cells) a combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to a specific site in a homologous chromosome, the cell having a different base between the homologous chromosomes at the specific site, a method in which the combination of site-specific nickases causes single-strand breaks in multiple locations in the DNA region adjacent to the specific site in chromosome A, and the single-strand breaks are on both DNA strands or on the same DNA strand in the adjacent DNA region, and causes single-strand breaks in chromosome B at one location corresponding to the location where the single-strand break occurs in chromosome A, or does not cause single-strand breaks at the corresponding location; However, when the combination of site-specific nickases causes single-strand breaks at multiple sites in the DNA region near the specific site in chromosome A, and the single-strand breaks are on the same DNA strand in the nearby DNA region, and causes single-strand breaks in chromosome B at one site corresponding to the site of the single-strand break in chromosome A, a cell having a base that differs between homologous chromosomes at a specific site in the homologous chromosome is a cell in which the function of the FANC gene is suppressed, The method, wherein the site-specific nickase is a CRISPR-Cas system comprising Cas9D10A.

2. The method of claim 1 , wherein the base that differs between homologous chromosomes is the base at the mutation site.

3. A kit for use in the method of claim 1, comprising: The method includes the steps of: (a) determining whether a specific site of a homologous chromosome is different from that of a homologous chromosome in a cell (excluding human germ cells); and (b) determining whether a specific site of a homologous chromosome is different from that of a homologous chromosome in a cell (excluding human germ cells). a kit in which the combination of site-specific nickases causes single-strand breaks in multiple locations in the DNA region adjacent to the specific site in chromosome A, and the single-strand breaks are on both DNA strands or on the same DNA strand in the adjacent DNA region, and causes single-strand breaks in chromosome B at one location corresponding to the location of the single-strand break in chromosome A, or does not cause single-strand breaks at the corresponding location; However, when the combination of site-specific nickases causes single-strand breaks at multiple sites in the DNA region near the specific site in chromosome A, and the single-strand breaks are on the same DNA strand in the nearby DNA region, and causes single-strand breaks in chromosome B at one site corresponding to the site of the single-strand break in chromosome A, a cell having a base that differs between homologous chromosomes at a specific site in the homologous chromosome is a cell in which the function of the FANC gene is suppressed, The kit, wherein the site-specific nickase is a CRISPR-Cas system comprising Cas9D10A.

4. A method for evaluating a homologous recombination function of a cancer cell derived from a cancer patient, comprising: The method includes introducing a combination of site-specific nickases that cause single-strand breaks in a DNA region adjacent to a specific site of a homologous chromosome consisting of chromosome A and chromosome B into a cancer cell derived from a cancer patient, the cancer cell having a different base between the homologous chromosomes at the specific site, and detecting a DNA deletion specific to chromosome A that is generated thereby, the combination of site-specific nickases in chromosome A causes single-strand breaks at multiple sites in the DNA region adjacent to the specific site, and the single-strand breaks are on both DNA strands or on the same DNA strand in the DNA region adjacent to the specific site, and in chromosome B causes single-strand breaks at one site corresponding to the site where the single-strand break occurs in chromosome A, or does not cause single-strand breaks at the corresponding site; The site-specific nickase is a CRISPR-Cas system comprising Cas9D10A, A method for evaluating that the homologous recombination function of a cancer cell derived from a cancer patient is suppressed if the frequency of DNA deletion specific to chromosome A is higher than the frequency in cells derived from the cancer patient in which the homologous recombination function is not suppressed.

5. A kit for use in the method of claim 4, comprising: A combination of site-specific nickases that cause single-strand breaks in a DNA region near a specific site in a cancer cell derived from a cancer patient, the cancer cell having a different base between the homologous chromosomes, the specific site being composed of chromosome A and chromosome B, a kit in which the combination of site-specific nickases causes single-strand breaks in multiple locations in the DNA region adjacent to the specific site in chromosome A, and the single-strand breaks are on both DNA strands or on the same DNA strand in the adjacent DNA region, and causes single-strand breaks in chromosome B at one location corresponding to the location of the single-strand break in chromosome A, or does not cause single-strand breaks at the corresponding location; The kit, wherein the site-specific nickase is a CRISPR-Cas system comprising Cas9D10A.

Images