Method for producing lodging-resistant plants

Abstract

To provide means and methods for achieving falling resistance in plant cultivation.SOLUTION: A method for making a falling-resistant plant includes increasing trehalose-6-phosphate in at least part of a plant.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a substance and a gene involved in lodging resistance of a plant, particularly rice, a method for producing a plant having lodging resistance, and a lodging-resistant plant. The present invention also relates to a method and a means for determining or selecting a lodging-resistant plant. [Background technology]

[0002] Lodging is the most important obstacle in plant cultivation, and it reduces productivity and quality, which directly leads to reduced income for growers. For example, it can reduce the yield, production quality, and mechanical harvesting efficiency of wheat (Triticum aestivum), barley (Hordeum vulgare), oats (Avena sativa), corn (Zea mays), sorghum (Sorghum bicolor), soybean (Glycine max), tomato (Lycopersicon esculentum), and tobacco (Nicotiana tabacum). There are three main countermeasures to reduce damage caused by lodging. The first is lodging reducers, and various reducers containing gibberellin inhibitors are commercially available. Lodging reducers inhibit gibberellin and suppress the elongation of the upper part of the plant body, so they can only be administered during the middle growth period, which means they are not fast-acting, and they increase labor hours and costs. The second type is a combine harvester that can handle lodging, which can harvest fallen plants (such as rice) while standing them up. Combine harvesters that can handle lodging have a high installation cost. Also, while they are effective for lodging just before harvest, they cannot handle lodging that occurs over a long period of time from when it occurs to when it is harvested.

[0003] The third is the creation of resistant lines, which is the least risky and also superior in terms of cost. Targets for increasing lodging resistance include shortening culms, strengthening culms, and strengthening the plant body's supporting capacity. In breeding resistant varieties, the semi-dwarf gene sd-1, which is related to shortening culms, is utilized, and many varieties in Japan and abroad have sd-1. While the semi-dwarf gene sd-1 made the "Green Revolution" possible, sd-1 has the drawback of reducing nitrogen absorption, and requires high input of nitrogen fertilizer during cultivation (Non-Patent Document 1). High input of fertilizer reduces soil fertility and causes a burden on the current environment due to residual nitrogen. In order to achieve the Sustainable Development Goals (SDGs) and comply with the "Green Food System Strategy," there is a need to develop lodging resistance improvement technology to replace sd-1.

[0004] In addition, in the creation of resistant lines targeting strengthening of culms, the introduction of the SCM2 gene increases the physical strength of the culm, thereby improving lodging resistance, but the number of stems is reduced due to its ambiguous action, so the lines that can be introduced are limited (Non-Patent Document 2). The creation of resistant lines targeting strengthening of bearing capacity has long been shown to be effective, but there is no information on markers that can be used for breeding, and there have been no reports of its use in breeding. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Special Publication No. 2001-523110 [Patent Document 2] Special Publication No. 2000-510691 [Non-patent literature]

[0006] [Non-Patent Document 1] Wang, F and Matsuoka, M, Nature 560:563-564, 2018 [Non-Patent Document 2] Ookawa, T. et al., Nat Commun 1:132, 2010 Summary of the Invention [Problem to be solved by the invention]

[0007] Therefore, there has been a demand for means and methods for achieving lodging resistance in plant cultivation.

[0008] On the other hand, there are descriptions of modifying the development and contents of cells and tissues by artificially varying the amount of trehalose-6-phosphate in cells (Patent Documents 1 and 2), and of expressing a trehalose-6-phosphate synthase gene under the control of a high expression promoter (35S CaMV promoter) in order to increase the amount of trehalose-6-phosphate. However, there is no description of improving the expression level of the trehalose-6-phosphate synthase gene by utilizing SNPs in the promoter region of the trehalose-6-phosphate synthase gene. In addition, it was not known that trehalose-6-phosphate synthase is involved in lodging resistance of plants. [Means for solving the problem]

[0009] The present inventors have conducted studies to solve the above problems and have found that the amount of trehalose-6-phosphate is related to lodging resistance in rice, and that lodging resistance can be imparted to plants by increasing this amount, for example, by increasing the expression of trehalose-6-phosphate synthase. The present inventors have also found that there is an SNP in the promoter sequence of trehalose-6-phosphate synthase that is related to increased expression of the gene. The present invention has been completed based on the above findings.

[0010] The present invention includes, for example, the following embodiments. [1] A method for producing a lodging-resistant plant, the method comprising increasing trehalose-6-phosphate in at least a part of the plant. [2] A method for removing weed plants in plant cultivation, comprising cultivating a plant having increased trehalose-6-phosphate in at least a portion of the plant. [3] A method for cultivating rice having a high ratio of top grains, the method comprising cultivating rice having increased trehalose-6-phosphate in at least a portion of the rice. [4] The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is achieved by increasing trehalose-6-phosphate synthase. [5] The method according to [4], wherein the trehalose-6-phosphate synthase is increased by expressing the trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2, or by introducing the trehalose-6-phosphate synthase gene. [6] The method according to [5], wherein the trehalose-6-phosphate synthase gene comprises at least one gene selected from the group consisting of OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4 and OsTPS5. [7] The method according to any of [1] to [3], wherein the increase in trehalose-6-phosphate is achieved by application of a signaling precursor of trehalose-6-phosphate. [8] The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is achieved by decreasing or inhibiting trehalose-6-phosphate phosphatase. [9] The method according to any one of [1], [2], and [4] to [8], wherein the plant comprises at least one species selected from the group consisting of grasses, legumes, Brassicaceae, and Solanaceae plants.

[10] The method according to any one of [1], [2], and [4] to [9], wherein the plant is rice.

[11] The method according to any of [1] to

[10] , wherein at least a part of the plant or rice includes at least one selected from the group consisting of a stem, a root, and a leaf.

[0011]

[12] A plant or a part of the plant, characterized in that the promoter sequence of a trehalose-6-phosphate synthase gene comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, or a promoter sequence having a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 is mutated to another base, or a sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted.

[13] The plant or plant part thereof described in

[12] , wherein the plant part is at least one selected from the group consisting of a plant seedling, a root, and a seed.

[14] The plant or plant part thereof according to

[12] or

[13] , wherein the plant comprises at least one species selected from the group consisting of grasses, legumes, crucifers, and solanaceae plants.

[15] The plant or plant part thereof according to any one of

[12] to

[14] , wherein the plant is rice.

[16] The plant or plant part thereof described in any of

[12] to

[15] , wherein the plant has lodging resistance, or the plant part has lodging resistance when formed into an individual plant.

[0012]

[17] A method for determining or selecting a lodging-resistant plant, the method comprising a step of detecting whether the promoter sequence of a trehalose-6-phosphate synthase gene in a target plant is a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, or whether it contains a mutation of the base G at position 883 of the promoter sequence shown in SEQ ID NO: 1 to another base, or a disruption of the base motif GCGG at positions 883 to 886 of the promoter sequence shown in SEQ ID NO: 1.

[18] The method according to

[17] , wherein the detection of the mutation is carried out using polymerase chain reaction (PCR), hybridization, or sequencing. Effect of the Invention

[0013] According to the present invention, it is possible to produce plants and plant parts thereof having lodging resistance. In particular, the prl5 locus containing a gene involved in lodging resistance is a highly practical locus for improving lodging resistance because it does not negatively affect other agricultural traits. Furthermore, according to the present invention, it is possible to determine whether or not a certain plant has lodging resistance and to select it. Therefore, the present invention is useful in fields such as agriculture, plant improvement, and food production. [Brief description of the drawings]

[0014] [Figure 1] This figure shows a comparison of the sequence of the region containing the promoter of the TPS6 gene of the Kasalath variety (sequence number 2) with the sequence of the region containing the promoter of the TPS6 gene of the Koshihikari or Nipponbare variety (sequence number 1). [Diagram 2] FIG. 1 shows the results of positional cloning using CSSLs between Koshihikari and Kasalath. [Diagram 3] 1 is a graph showing the relative expression level of OsTPS6 in the NILprl5 line. [Figure 4] Graphs showing (A) the expression level of OsTPS6, (B) the chlorophyll content in lower leaves (actual values ​​measured with Konica Minolta SPAD-502), and (C) the pushing resistance in each rice line. The rice lines are 1: Nipponbare, 2: null, and 3-5: recombinant (n=3). [Diagram 5] These photographs show an individual plant with increased OsTPS6 expression (NILprl5) and a control plant, Koshihikari, taken the day after Typhoon No. 9 hit directly on August 23, 2016 (maximum wind speed: 26.9 m / s). [Figure 6] This is a photograph showing the results of a cultivation test of an individual plant with increased OsTPS6 expression (NILprl5) and a control plant, Koshihikari. On the left is Koshihikari, and on the right is NILprl5. The arrows indicate the weedy rice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention will be described in detail below. The present invention is based on the discovery that trehalose-6-phosphate is involved in lodging resistance in plants. Trehalose-6-phosphate is produced from glucose-6-phosphate by trehalose-6-phosphate synthase (TPS), and trehalose is produced from trehalose-6-phosphate by trehalose-6-phosphate phosphatase (TPP). Glucose-6-phosphate → trehalose-6-phosphate → trehalose TPS TPP

[0016] Therefore, the present invention relates to a lodging-resistant plant focusing on trehalose-6-phosphate, a method for producing the same, and a method and means for identifying or selecting a lodging-resistant plant.

[0017] Here, "lodging resistance" or "lodging resistance trait" or "lodging resistance" refers to the property of a plant individual being less susceptible to lodging, and specifically means that lodging resistance is improved compared to when the present invention is not applied. Lodging resistance can be confirmed by a method known in the art, and for example, lodging resistance can be measured by pushing resistance (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004).

[0018] 1. How to create lodging-resistant plants In one aspect, the present invention relates to a method for producing a lodging resistant plant, comprising increasing trehalose-6-phosphate in at least a part of the plant, for example by increasing trehalose-6-phosphate synthase, which catalyzes the production of trehalose-6-phosphate from glucose-6-phosphate, and / or by applying a signaling precursor of trehalose-6-phosphate, and / or by reducing or inhibiting trehalose-6-phosphate phosphatase, which catalyzes the production of trehalose from trehalose-6-phosphate.

[0019] The increase in trehalose-6-phosphate may occur in at least a part of a plant, and is preferably increased in at least one part of a plant to which lodging resistance is desired, such as stems, roots, and leaves.

[0020] In this specification, a plant or a part thereof means a whole plant, a plant organ (e.g., leaves, petals, stems, roots, seeds, etc.), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, vascular bundles, palisade tissue, spongy tissue, etc.), or a cultured plant cell, or various forms of plant cells (e.g., suspension culture cells), protoplasts, leaf slices, callus, etc.

[0021] In one embodiment, the increase in trehalose-6-phosphate is achieved by increasing trehalose-6-phosphate synthase. Trehalose-6-phosphate synthase (TPS) is known in the art, and its genes and proteins have been isolated in various plants. Examples of trehalose-6-phosphate synthase genes include OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4, and OsTPS5, and at least one of the genes can be used. In this specification, the trehalose-6-phosphate synthase (TPS) gene is mainly described based on the TPS6 protein (GenBank accession number AK072066.1) or TPS6 gene (SEQ ID NO: 20, GenBank accession number BAF17964.1 (genome sequence)) derived from the Koshihikari variety, but it is known in the art that there are homologous TPS proteins and TPS genes derived from other rice varieties and other plants (e.g., cereals of the family Gramineae). For example, wheat, Arabidopsis, soybean, sorghum, etc. (e.g., Xie et al., Journal of Genetics, Vol.94, No.1, pp.55-65, Hu et al., Agronomy 10(7), 969, 2020) are known, and sequence information for all of them can be obtained from literature, GenBank, UniProt, and other databases. Such homologous proteins and homologous genes can also be used equally. Homologous proteins and homologous genes and their regulatory sequences (such as promoter sequences) have sequence homology with the reference protein and gene and its regulatory sequence, and the "corresponding position" described in this specification refers to the position of the homologous protein or gene or regulatory sequence (promoter sequence) corresponding to the position of the reference protein or gene or regulatory sequence (promoter sequence), and can be easily determined according to methods known in the art.

[0022] The increase in trehalose-6-phosphate synthase can be achieved by a method known in the art, and is not particularly limited. In one embodiment, the increase can be achieved by highly expressing a trehalose-6-phosphate synthase gene in a plant. High expression of the trehalose-6-phosphate synthase gene can be achieved, for example, by introducing a trehalose-6-phosphate synthase gene into a target plant, or by expressing the trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2.

[0023] A method for introducing a target gene or a specific promoter into a plant can be carried out by utilizing a gene recombination method known in the art. For example, a recombinant vector can be constructed and introduced into a plant to introduce a target gene or a specific promoter into the plant. Such a recombinant vector can be constructed by inserting a target gene or a specific promoter into an appropriate vector. As a vector for introducing a target gene or a specific promoter into a plant cell and expressing it, a pBI vector, a pUC vector, or a pTRA vector is preferably used. The pBI and pTRA vectors can introduce a target gene or a specific promoter into a plant via Agrobacterium. A pBI binary vector or intermediate vector is preferably used, such as pBI121, pBI101, pBI101.2, pBI101.3, etc. A pUC vector can directly introduce a gene or a promoter into a plant, such as pUC18, pUC19, pUC9, etc.

[0024] To insert a gene of interest or a specific promoter into a vector, a method is adopted in which purified DNA is first cleaved with an appropriate restriction enzyme, and then inserted into a restriction enzyme site or a multicloning site of an appropriate vector DNA and ligated to the vector. The gene of interest or a specific promoter must be incorporated into the vector so that the gene's function can be exerted. Therefore, in addition to the promoter, an enhancer, a splicing signal, a polyA addition signal, a 5'-UTR sequence, a selection marker gene, etc. can be ligated to the vector as desired.

[0025] A "promoter" may be of plant or non-plant origin, so long as it is DNA that functions in plant cells and can induce expression in a specific tissue of the plant (particularly a tissue to which lodging resistance is desired, such as a stem) or at a specific developmental stage.

[0026] In the present invention, a promoter capable of enhancing the expression of the trehalose-6-phosphate synthase gene is used. In one embodiment, a strong promoter sequence, for example, a cauliflower mosaic virus 35S promoter, a promoter derived from the Agrobacterium T-DNA opine synthase gene, a nopaline synthase (nos) promoter, an octopine synthase (ocs) promoter, a mannopine synthase (mas) promoter, a tomato ubiquitin promoter, or the like, may be used to enhance the expression of the gene. In another embodiment, a promoter sequence having a mutation that enhances the expression of the trehalose-6-phosphate synthase gene may be used. For example, a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity may be used. Here, the identity of the nucleotide sequence can be easily determined by a method known in the art, for example, using a known sequence program (such as BLAST provided by NIBI).Alternatively, a mutation of the base T corresponding to position 48 of SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare variety) to another base (e.g., A, C or G, preferably C), a deletion of the bases T (e.g., 1, 2 or 3, preferably 2 TTs) corresponding to positions 68 and 69, a mutation of the base G corresponding to position 86 to another base (e.g., A, T or C, preferably A), a mutation of the base C corresponding to position 210 to another base (e.g., G, T or A, preferably A), a mutation of the base T corresponding to position 305 to another base (e.g., G, A or C, preferably A). A promoter sequence having at least one selected from the group consisting of a mutation of base A corresponding to position 517 to another base (e.g., G, T or C, preferably G), a mutation of base C corresponding to position 696 to another base (e.g., G, T or A, preferably A), a mutation of base G corresponding to position 825 to another base (e.g., A, T or C, preferably A), a mutation of base G corresponding to position 883 to another base (e.g., A, T or C, preferably A), and a deletion of bases corresponding to positions 1113 and 1115 (e.g., base GAG). The results of sequence comparison between SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare variety) and SEQ ID NO: 2 (promoter sequence of Kasalath variety) are shown in FIG. 1. In a preferred embodiment, it is preferable to use a promoter sequence having at least a mutation of base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T or C, preferably A), or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is destroyed. As long as the promoter sequence has promoter activity, it may contain a sequence in which 1 to 30, preferably 1 to 20, more preferably 1 to 10, for example 1 to 3 bases are deleted, substituted or added in the base sequence of SEQ ID NO: 1 or 2. The promoter activity means that when a gene of interest is linked downstream of the promoter in an expressible state and introduced into a host, the promoter has the ability and function to produce a gene product of the gene of interest inside or outside the host.Such DNA maintains promoter activity to such an extent that it can be used in a similar manner under the same conditions as those under which a promoter consisting of a full-length nucleotide sequence without any mutation (deletion, substitution or addition) functions. For example, the DNA maintains about 0.01 to 100 times, preferably about 0.5 to 20 times, and more preferably about 0.5 to 2 times the promoter activity of the full-length sequence.

[0027] The terminator may be any sequence capable of terminating the transcription of the gene transcribed by the promoter. The enhancer is used to increase the expression efficiency of the target gene. The selection marker is used to facilitate the selection of transformants, and examples of such a hygromycin resistance gene and neomycin resistance gene are included.

[0028] The constructed recombinant vector is introduced into a plant so that the target gene can be expressed or the gene can be expressed under a specific promoter. The target plants in the present invention can be applied to all plants such as various monocotyledonous plants, dicotyledonous plants, cereal plants, trees, etc. For example, examples of monocotyledonous plants include Gramineae plants (rice, wheat, barley, oats, corn, sorghum, rye, pearl barley, sugarcane, etc.), Orchidaceae plants including Cattleya plants, Juncaceae plants, etc. Note that cereal plants mainly refer to plants having starchy seeds (especially edible seeds), and include Gramineae, Fabaceae, etc.

[0029] Examples of dicotyledonous plants include plants of the Convolvulaceae family, which includes plants of the Ipomoea genus (such as morning glory and sweet potato); plants of the Caryophyllaceae family, which includes plants of the Dianthus genus (such as carnation); plants of the Piperaceae family, plants of the Myricaceae family, plants of the Brassicaceae family (such as Arabidopsis thaliana, cabbage, radish, wasabi, varied mustard, and broccoli), plants of the Leguminosae family (such as soybean), plants of the Linaceae family, plants of the Tribulus family, plants of the Umbelliferae family, plants of the Solanaceae family (such as tomato and tobacco), and plants of the Asteraceae family (such as chrysanthemum, lettuce, burdock, and butterbur).

[0030] In a preferred embodiment, the plant is a grass plant, in particular rice. The variety of rice (e.g., non-glutinous rice variety) is not limited, and examples thereof include Koshihikari, Hitomebore, Hinohikari, Akitakomachi, Nanatsuboshi, Haenuki, Masshigura, Kinuhikari, Asahi no Yume, Yumepirika, Kinumusume, Koshibuki, Tsuyahime, Yumetsukushi, Fusakogane, Tsugaru Roman, Aichi no Kaori, Iro no Kagayaki, Ten no Tsubu, Kirara 397, etc.

[0031] The target plant means any of the whole plant, plant organs (e.g., leaves, roots, seeds, etc.), plant tissues (e.g., epidermis, phloem, parenchyma, xylem, vascular bundles, etc.), or cultured plant cells. When cultured plant cells are the target, in order to regenerate a transformant from the obtained transformed cells, the organ or individual may be regenerated by a known tissue culture method.

[0032] Methods for introducing a target gene, a specific promoter, or a recombinant vector into a plant include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, the liposome method, the particle gun method, the microinjection method, and the like. For example, when using the Agrobacterium method, protoplasts and tissue fragments can be used. When using protoplasts, they can be co-cultured with Agrobacterium having a Ti plasmid, or fused with spheroplasted Agrobacterium (spheroplast method), and when using tissue fragments, they can be infected with a sterile cultured leaf fragment of the target plant using a leaf disk (leaf disk method) or infected with callus (undifferentiated cultured cells), etc.

[0033] Alternatively, random mutagenesis may be performed on a plant to introduce a mutation into the promoter sequence of the trehalose-6-phosphate synthase gene. Examples of such random mutagenesis include treatment with known mutagens (e.g., ultraviolet light, radiation, heavy ion beams, chemical mutagens, etc.). Alternatively, genome editing may be performed on a plant to introduce a mutation into the promoter sequence of the trehalose-6-phosphate synthase gene. Preferably, the expression of the trehalose-6-phosphate synthase gene can be enhanced by introducing a mutation from the base G corresponding to position 883 of SEQ ID NO: 1 to at least one other base (e.g., A, T, or C, preferably A) into the promoter sequence, or by disrupting the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1.

[0034] Confirmation of whether or not a gene of interest or a specific promoter has been incorporated into a plant, or whether or not a mutation has been introduced into a specific position of a promoter, or whether or not a GCGG motif has been destroyed can be performed by PCR, Southern hybridization, Northern hybridization, or the like. For example, DNA is prepared from a transformed plant, and DNA-specific primers are designed to perform PCR. After PCR, the amplified product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, or the like, and stained with ethidium bromide, SYBR Green solution, or the like, and the amplified product is detected as a single band, thereby confirming that the plant has been transformed. PCR can also be performed using primers previously labeled with a fluorescent dye, or the like to detect the amplified product. Furthermore, a method in which the amplified product is bound to a solid phase such as a microplate, and the amplified product is confirmed by a fluorescent or enzymatic reaction, or the like, may also be used.

[0035] Next, it is confirmed whether the obtained plant has a lodging resistance trait. That is, the lodging resistance of the obtained plant is measured. The measurement of lodging resistance can be carried out by a method conventional in the art, and as such a method, lodging resistance can be measured by pushing resistance value (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004) or the like.

[0036] In another embodiment, the increase in trehalose-6-phosphate is carried out by applying a signaling precursor of trehalose-6-phosphate. As a signaling precursor of trehalose-6-phosphate, it has been reported that synthetic small molecules that are permeable through plants can be easily taken up by plants to induce the light-activated release of T6P (Griffiths et al., Nature 540: 574-578, 2016). For example, 6-O-bis-(2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O-bis-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O-bis-[1-(2-nitrophenyl)-ethoxyphosphoryl]-D-trehalose, 6-O-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, etc. can be used to increase trehalose-6-phosphate in plants.

[0037] In another embodiment, the increase in trehalose-6-phosphate is achieved by reducing or inhibiting trehalose-6-phosphate phosphatase. Trehalose-6-phosphate phosphatase (TPP) is also known in the art, and its genes and proteins have been isolated in various plants, such as rice (Accession No. GenBank AP008208). The reduction or inhibition of trehalose-6-phosphate phosphatase can be achieved using methods known in the art, such as antisense methods, RNAi techniques, antibodies, etc.

[0038] The plant obtained as described above acquires a lodging resistance trait. That is, by increasing trehalose-6-phosphate in a plant, the lodging resistance trait can be imparted to the plant. Therefore, according to the present invention, it is possible to impart the lodging resistance trait to a plant that was previously prone to lodging, such as the rice variety Koshihikari.

[0039] 2. How to remove weed plants As described above, plants with increased trehalose-6-phosphate have lodging resistance traits, and therefore weedy plants can be visually distinguished from non-lodged plants (target plants), allowing the weedy plants to be easily and quickly removed (e.g., Example 4). If a plant locates during cultivation, it becomes difficult to distinguish it from other varieties or weedy plants that have become mixed in (Figure 5), so the present invention is also useful for removing weedy plants.

[0040] Thus, in one aspect, the present invention relates to a method for removing weed plants in plant cultivation comprising cultivating a plant having increased trehalose-6-phosphate in at least one part of the plant. A plant having increased trehalose-6-phosphate in at least one part of the plant can be produced as described elsewhere herein.

[0041] A weed plant refers to a plant other than the plant to be cultivated (i.e., the plant in which trehalose-6-phosphate has been increased according to the present invention). In the present invention, since the cultivated plants are unlikely to fall over, weed plants are visually distinguished and removed. Those skilled in the art can adopt an appropriate removal method depending on the type of the target plant and the type of plant to be removed.

[0042] 3. How to grow rice with a high ratio of top-quality rice Rice with increased trehalose-6-phosphate produces seeds with a high ratio of top-grade rice (e.g., Example 4). Top-grade rice refers to rice that is selected through a sieve with 2.00 mm mesh among sieves (generally 1.7 mm to 2.00 mm mesh) used to select brown rice. The top-grade rice ratio refers to the proportion (weight %) of rice that is selected out of rice that is subjected to a sieve with 2.00 mm mesh, and a high top-grade rice ratio means that the top-grade rice ratio is at least 25%, for example at least 28%, preferably at least 30%, and more preferably at least 40% or more.

[0043] Thus, in another aspect, the present invention relates to a method for cultivating rice having a high proportion of top grains, comprising cultivating rice having increased trehalose-6-phosphate in at least a portion of the rice plant. The rice having increased trehalose-6-phosphate in at least a portion of the rice plant can be produced as described elsewhere herein.

[0044] 4. Plants with a mutation in the promoter of the trehalose-6-phosphate synthase gene In one aspect, the present invention relates to a plant or a plant part thereof, characterized in that the promoter sequence of a trehalose-6-phosphate synthase gene comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a plant or a plant part thereof, characterized in that the promoter sequence of a trehalose-6-phosphate synthase gene comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a plant or a plant part thereof, characterized in that the promoter sequence of a trehalose-6-phosphate synthase gene comprises a promoter sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2. The present invention relates to a plant or a plant part thereof comprising a promoter sequence having at least one selected from the group consisting of a mutation of base A corresponding to position 17 to another base (e.g., G, T or C, preferably G), a mutation of base C corresponding to position 696 to another base (e.g., G, T or A, preferably A), a mutation of base G corresponding to position 825 to another base (e.g., A, T or C, preferably A), a mutation of base G corresponding to position 883 to another base (e.g., A, T or C, preferably A), and a deletion of bases corresponding to positions 1113 and 1115 (e.g., base GAG). In a preferred embodiment, the plant or plant part thereof comprises a promoter sequence having at least a mutation of base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T or C, preferably A), or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 has been disrupted.

[0045] As described above, a plant or a plant part thereof having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene has an increased amount of trehalose-6-phosphate and therefore has lodging resistance when it becomes an individual plant. Here, the plant is not particularly limited as long as it is a plant for which it is desired to acquire a lodging resistance trait, and examples of the plant include the plants described above. Furthermore, the plant part is not particularly limited as long as it is a part of a plant, and examples of the plant part include seedlings, plant organs (e.g., leaves, roots, seeds, etc.), and cultured plant cells.

[0046] A plant or a plant part thereof having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene can be produced as described above.

[0047] 5. Identification or selection of lodging-resistant plants Since it is believed that plants having a mutation in the promoter sequence of the above-mentioned trehalose-6-phosphate synthase gene have an increased amount of trehalose-6-phosphate, lodging-resistant plants can be identified or selected by detecting this mutation.

[0048] The plants to be judged or selected in the present invention are not particularly limited, and can be applied to all plants such as various monocotyledonous plants, dicotyledonous plants, trees, etc. For example, examples of monocotyledonous plants include plants of the Poaceae family (rice, wheat, barley, oats, corn, sorghum, rye, pearl barley, sugarcane, etc.), plants of the Orchidaceae family including plants of the genus Cattleya, plants of the Juncaceae family, etc.

[0049] Examples of dicotyledonous plants include Convolvulaceae plants including Ipomoea plants (Ipomoea batatas, sweet potato); Caryophyllaceae plants including Dianthus plants (carnation, etc.); Piperaceae plants, Myricaceae plants, Brassicaceae plants (Arabidopsis thaliana, cabbage, radish, wasabi, wild mustard, broccoli, etc.), Leguminosae plants (soybean, etc.), Linaceae plants, Tribulus terrestris plants, Umbelliferae plants, Solanaceae plants (tomato, tobacco, etc.), Asteraceae plants (garland chrysanthemum, lettuce, burdock, butterbur, etc.), etc. The plants that are the subject of the present invention may be not only wild-type plants exemplified above, but also mutants, transformants, genetically modified plants, and genome-edited plants.

[0050] In one aspect, the present invention relates to a method for identifying or selecting a lodging-resistant plant, the method comprising a step of detecting whether or not a promoter sequence of a trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a method for identifying or selecting a lodging-resistant plant, the method comprising a step of detecting whether or not a promoter sequence of a trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a method for identifying or selecting a lodging-resistant plant, the method comprising a step of detecting whether or not a promoter sequence of a trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention relates to a method for detecting whether a promoter sequence of a target plant contains at least one selected from the group consisting of a mutation of base A corresponding to position 517 to another base (e.g., G, A or C, preferably A), a mutation of base C corresponding to position 696 to another base (e.g., G, T or A, preferably A), a mutation of base G corresponding to position 825 to another base (e.g., A, T or C, preferably A), a mutation of base G corresponding to position 883 to another base (e.g., A, T or C, preferably A), and a deletion of bases corresponding to positions 1113 and 1115 (e.g., base GAG). In a preferred embodiment, the method detects whether a promoter sequence of a trehalose-6-phosphate synthase gene in a target plant contains at least a mutation of base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T or C, preferably A) or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted.

[0051] In one embodiment, genomic DNA is prepared from a plant to be judged or selected. The genomic DNA can be prepared by a known method, such as the phenol / chloroform method. If necessary, genomic DNA may be prepared from a positive control and / or a negative control plant. The source from which DNA is prepared is also not particularly limited, and DNA can be extracted from any tissue of the plant body, for example, from ears, leaves, roots, seeds, and in the case of rice, from polished rice, brown rice, etc.

[0052] Detection of mutations in genomic DNA can be performed by any method known in the art, including, but not limited to, amplification reactions such as polymerase chain reaction (PCR), hybridization, direct sequencing, and restriction fragment length polymorphism (RFLP). All of these methods are well known to those skilled in the art. Representative methods are outlined below.

[0053] (1) Method using amplification reaction (PCR method) In the present invention, for example, the polymerase chain reaction (PCR) can be used to detect a target mutation simply and with high accuracy.

[0054] First, a primer capable of amplifying the nucleotide sequence of the promoter of trehalose-6-phosphate synthase without mutation (e.g., SEQ ID NO: 1) and the nucleotide sequence of the mutant promoter (e.g., SEQ ID NO: 2) based on Koshihikari or Nipponbare varieties is designed to distinguish between the two, or to amplify the promoter so as to include the mutant portion. Specifically, a primer set is designed to amplify a region including a mutation in the promoter sequence (particularly, a mutation from the base G corresponding to the 883rd base of SEQ ID NO: 1 to another base, or a destruction of the base motif GCGG at the 883rd to 886th bases of the sequence shown in SEQ ID NO: 1). The primer set can be designed based on the genomic sequence of trehalose-6-phosphate synthase and the mutant promoter (SEQ ID NO: 2), or based on the genomic sequence of trehalose-6-phosphate synthase and the promoter without mutation based on Koshihikari or Nipponbare varieties (SEQ ID NO: 1). SEQ ID NOs: 1 and 2 show the genomic sequence of the surrounding region including the promoter of the trehalose-6-phosphate synthase gene.

[0055] Primer design techniques are well known in the art, and primers that can be used in the present invention are designed to satisfy conditions that allow specific annealing, for example, to have a length and base composition (melting temperature) that allow specific annealing. For example, the length that functions as a primer is preferably 10 bases or more, more preferably 15 to 50 bases, and even more preferably 15 to 30 bases. In addition, when designing, it is preferable to confirm the GC content of the primer and the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand, and in order for the template DNA and the primer to form a double strand and anneal, it is necessary to optimize the annealing temperature. On the other hand, if this temperature is lowered too much, a non-specific reaction will occur, so it is desirable that the temperature be as high as possible. Known software for primer design can be used to confirm Tm. The designed primer can be chemically synthesized by a known oligonucleotide synthesis technique, but is usually synthesized using a commercially available chemical synthesis device.

[0056] In a specific embodiment, a primer set that can be used in the present invention includes, but is not limited to, a primer set including a primer having the nucleotide sequence of CTGGGCAGAAGCTACTTTACTC (SEQ ID NO: 3) and a primer having the nucleotide sequence of CAGCGCCTCGAAGTTCCC (SEQ ID NO: 4). These primer sets are capable of amplifying a region containing a mutation of interest.

[0057] When a primer set designed in this way is used, the amplification product obtained using the DNA containing the mutation as a template has a different base sequence from the amplification product obtained using other DNA as a template. Therefore, from the difference in the sequences of the amplification products obtained by the amplification reaction using the primer set, it is possible to determine whether or not the target plant has a mutation involved in lodging resistance in the promoter sequence of the trehalose-6-phosphate synthase gene.

[0058] The amplification reaction is not particularly limited, but may be a known method utilizing the principle of the polymerase chain reaction (PCR). Amplification is carried out until the amplified product reaches a detectable level. The optimal conditions for PCR can be easily determined by those skilled in the art.

[0059] As described above, a nucleic acid fragment containing a target mutation can be specifically amplified using genomic DNA derived from a target plant as a template.

[0060] To detect whether a specific amplification reaction has occurred after the above-mentioned amplification reaction, a known means capable of specifically recognizing the amplification product obtained by the amplification reaction can be used. For example, a specific amplification reaction can be detected by confirming whether an amplified fragment of a specific size has been amplified using agarose gel electrophoresis or the like. The size of the amplified product can be estimated based on the base sequence between the designed primers. Alternatively, by determining the base sequence of the obtained amplified fragment, it can be determined whether a sequence containing the target mutation has been amplified.

[0061] Alternatively, the presence or absence of amplification of a nucleic acid fragment is detected based on the label attached to the primer or substrate. For example, a label such as a radioisotope, a fluorescent substance, or a luminescent substance can be reacted with the dNTP incorporated during the amplification reaction, and the label can be detected. Examples of radioisotopes include: 32 P, 125 I, 35 S, etc. can be used. As the fluorescent substance, for example, fluorescein (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), etc. can be used. As the luminescent substance, luciferin, etc. can be used. There are no particular limitations on the type of these labels and the method of introducing the labels, and various conventionally known means can be used. For example, the method of introducing the labels includes the random prime method using a radioisotope.

[0062] The method for observing the amplification product incorporating the labeled dNTP may be any method known in the art for detecting the above-mentioned label. For example, when a radioisotope is used as the label, the radioactivity can be measured, for example, by a liquid scintillation counter, a γ-counter, etc. When a fluorescent substance is used as the label, the fluorescence can be detected using a fluorescent microscope, a fluorescent plate reader, etc.

[0063] This makes it possible to determine and select whether or not the target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene (particularly, a mutation from base G corresponding to position 883 of SEQ ID NO: 1 to another base, or a disruption of the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1), i.e., whether or not the plant is lodging-resistant.

[0064] (2) Hybridization method The target mutation can also be detected using a hybridization method. The hybridization method is a method for determining whether or not the genomic DNA from the target plant has a mutation based on its ability to hybridize with a complementary DNA molecule (e.g., an oligonucleotide probe). This hybridization method can be performed using various techniques for hybridization and detection.

[0065] First, a probe capable of hybridizing to the mutant promoter of trehalose-6-phosphate synthase without mutation is designed by comparing the base sequence of the mutant promoter with that of the Koshihikari or Nipponbare cultivar. For example, a probe can be designed to span the target mutation. For example, a probe is designed to hybridize to the promoter sequence without mutation but not to the promoter sequence containing a mutation. Whether or not the genomic DNA of a target plant contains a target mutation can be detected by the presence or absence of hybridization using such a probe.

[0066] Probe design techniques are well known in the art, and probes that can be used in the present invention are designed to satisfy conditions that allow specific hybridization, for example, to have a length and base composition (melting temperature) that allow specific hybridization. The length of the probe is preferably 10 bases or more, more preferably 20 to 50 bases, and even more preferably 20 to 30 bases.

[0067] In this method, a probe is used to carry out a hybridization reaction with genomic DNA derived from a target plant, and the presence of a target mutation is detected by detecting the specific binding (hybrid). The hybridization reaction must be carried out under stringent conditions. Such stringent conditions are well known in the art and are not particularly limited.

[0068] When hybridization is performed in this method, the probe may be labeled with a fluorescent label (fluorescein, rhodamine, etc.), a radioactive label ( 32 Appropriate labels such as phospholipids (e.g., phospholipids), enzyme labels (e.g., alkaline phosphatase, horseradish peroxidase), and biotin labels can be added.

[0069] Detection using a labeled probe involves contacting the genomic DNA derived from the target plant with the probe so that they can hybridize. Specifically, for example, the genomic DNA derived from the target plant is digested with an appropriate restriction enzyme if necessary, immobilized on a suitable carrier such as a slide glass, a membrane, or a microtiter plate, and a labeled probe is added to bring the probe into contact with the genomic DNA to perform a hybridization reaction, and after removing the unhybridized probe, the label of the probe hybridized with the genomic DNA is detected. If the label is detected, it means that the target plant has the target mutation.

[0070] Alternatively, hybridization can be detected using a DNA chip. In this method, the probe is attached to a solid support. Genomic DNA from the target plant is contacted with the DNA chip and hybridization is detected.

[0071] (3) Direct sequencing Mutations in the promoter sequence of the trehalose-6-phosphate synthase gene can be detected by direct sequencing using genomic DNA. In the direct sequencing method, first, genomic DNA is prepared from the target plant, and a region containing the mutation to be detected is cloned into a vector and amplified in a host cell (e.g., bacteria). Alternatively, DNA in the region containing the mutation to be detected can be amplified by PCR. After amplification, DNA in the region to be detected is sequenced. Sequencing methods include, but are not limited to, manual sequencing methods or automatic sequencing methods. Automatic sequencing methods include methods using dye terminators, next-generation sequencing (NGS), and the like. Based on the results of sequencing, it is determined whether the target plant has the mutation of interest.

[0072] According to the above-mentioned method, it is possible to detect whether or not a target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene, and from the result, it is possible to determine whether or not the target plant has a lodging resistance trait and select the plant. Since the method of the present invention utilizes a genetic technique, it is possible to determine and select lodging-resistant plants simply and with high accuracy.

[0073] 6. Kit The above-mentioned method for determining or selecting a lodging-resistant plant can be carried out more simply by using a kit, which contains at least a means for detecting a mutation in the promoter region of the trehalose-6-phosphate synthase gene as described above, specifically a primer or a probe.

[0074] In one embodiment, the present invention relates to a kit for identifying or selecting lodging-resistant plants, characterized by comprising a primer set including a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4.

[0075] In addition, when the kit contains a primer, it may further contain a buffer constituting a reaction solution, a dNTP mixture, enzymes (reverse transcriptase, RNase H, etc.), a standard sample for calibration, etc. In addition, when the kit contains a probe, it may further contain a hybridization buffer, a washing buffer, a microplate, a nylon membrane, etc. EXAMPLES

[0076] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0077] [Example 1] Isolation of OsTPS6, a gene responsible for increasing plant support capacity In a previous report (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), a QTL (prl5) that increases the plant's bearing capacity was identified. In addition, a method for evaluating the phenotype (bearing capacity of the lower part of the plant) based on the resistance of the lower part to being pushed down by removing the plant body more than 40 cm above the earth's pole has been reported. In this example, we attempted to isolate the causative gene involved in the plant's bearing capacity based on the genotype and phenotype.

[0078] The identified QTL region (pr15) was further analyzed using chromosome segment substitution lines (CSSLs) in which a chromosome segment of the Japonica rice cultivar Koshihikari was replaced with an Indica rice cultivar Kasalath. Specifically, the CSSLs were crossed with Koshihikari to produce BC1F1.

[0079] Next, DNA markers were set at both ends of the region where the causative gene was thought to exist, and individuals in which recombination had occurred within the region were selected from 2,000 individuals of BC1F2, the self-fertilized progeny of BC1F1. Specifically, the first leaf below the flag leaf of cultivated rice was sampled at 10:30 a.m., cooled with liquid nitrogen, and stored in a -80°C freezer, after which 100 mg of the leaf was crushed in a mortar with liquid nitrogen, and DNA was extracted using Qiagen's DNeasy Plant Mini Kit. Next, positional cloning was performed using the primers shown in Table 1. For SSR1896, PCR conditions were as follows: 30 cycles of 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute were performed using TAKARA EX TAQ (Takara Bio Inc.), and for PRL1441, 30 cycles of 95°C for 1 minute, 68°C for 1 minute, and 72°C for 1 minute were performed using TAKARA EX TAQ (Takara Bio Inc.).

[0080] [Table 1]

[0081] Next, the six BC1F2 lines that had recombination within the region were selfed to produce their progeny BC1F3. From these BC1F3 lines, individuals in which the region derived from Kasalath was homozygous for Kasalath were selected and selfed to obtain the progeny seeds.

[0082] BC1F4 (20 individuals from each line) were cultivated in a field at the National Institute for Agro-Environmental Sciences (currently the Agro-Environmental Research Division of the National Agriculture and Food Research Organization, Kannondai, Tsukuba City, hereafter referred to as "NIA"). The region where the causative gene exists was narrowed down to 137 kb based on the genotyping and phenotype (upper part of Fig. 2). The phenotype was measured according to a previously reported evaluation method (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), and the region where the prl5 causative gene exists was narrowed down based on the measured values ​​and the results of genotyping using DNA markers.

[0083] Using the same method, we repeated the analysis and narrowed down the region to 12.1 kb. We narrowed down the candidate gene to Os05g0517200 (OsTPS6) based on the rice genome annotation data.

[0084] Next, genomic DNA was extracted from the leaf tissue of BC1F4 two weeks after transplantation in the same manner as above, and OsTPS6 was sequenced to compare the ORF sequences of Koshihikari and Kasalath. The primers used for sequencing were forward primer Os05g0517200_Fw (CTGGGCAGAAGCTACTTTACTC: SEQ ID NO: 3) and reverse primer Os05g0517200_Rv (CAGCGCCTCGAAGTTCCC: SEQ ID NO: 4), which generated an amplification product of 1160 bp.

[0085] As a result, as shown in Table 2, five SNPs were present in Kasalath, but no amino acid substitutions were found.

[0086] [Table 2]

[0087] Near-isogenic NILs with the genetic background of Koshihikari, into which the TPS6 locus from Kasalath was introduced, were selected by the above method. The second leaf from the flag leaf of Koshihikari and NILs grown in the paddy field of the National Institute of Agro-Environmental Sciences was sampled using liquid nitrogen after heading and stored in a freezer set at -80°C. RNA extraction and real-time PCR were performed according to a previous report (Ishimaru et al., Nature Genet vol.45, pp.707-713, 2013). Specifically, leaves (100 mg) were taken from Koshihikari and NILprl5, and total RNA was extracted using Qiagen's Plant RNeasy kit according to the protocol. Next, cDNA was obtained by using the total RNA as a template and AMV reverse transcriptase from WAKO as a reaction. The expression levels of genes such as OsTPS6 were compared by real-time PCR using the obtained cDNA as a template and the primers shown in the table below. Plants used were 60 days after transplantation.

[0088] [Table 3]

[0089] The results are shown in Figure 3. From the results in Figure 3, it was found that among the RNAs in the TPS6 locus, OsTPS6 was significantly highly expressed in the NILs, and the expression level was about 3.8-fold higher in NILprl5 than in Koshihikari.

[0090] [Example 2] Demonstration experiment using OsTPS6 recombinant plants In this example, a recombinant plant was produced in which OsTPS6, which was considered to be the causative gene in Example 1, was highly expressed under the control of a strong 35S promoter.

[0091] Specifically, the cDNA of Nipponbare OsTPS6 (accession number AK072066) was inserted between the cauliflower 35S protein promoter and the nos terminator into pSTAH301G (containing a hygromycin resistance gene) using XgaI and SacI to construct a vector.

[0092] The constructed vector was introduced into Nipponbare by the Agrobacterium method, and recombinant plants (T0) were selected with hygromycin. The introduction of OsTPS6 into the recombinant plants (T0) was confirmed using OsTPS6 cDNA-specific primers (SEQ ID NOs: 3 and 4).

[0093] Next, the self-fertilized progeny (T1) were selected, and 10 individuals from each line of the recombinant plants (T3) were confirmed by PCR. Three lines that were determined to be homozygous for the OsTPS6 gene and a line in which the introduced gene could not be detected (null; control) were selected.

[0094] Six individuals from each of the three lines, Nipponbare, null, and recombinant, were grown in an isolated greenhouse and used for analysis. Samples (-2 leaves) taken two weeks after heading were measured using a green meter (SPAD: KONIKA-MINOLTA 501), and then sampled to measure the expression level of OsTPS6 by the method described in Example 1. In addition, four weeks after heading, pushing resistance was measured as previously reported (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004).

[0095] The results are shown in Figure 4. In Figure 4, A shows the OsTPS6 expression level in each individual, B shows the SPAD (chlorophyll in lower leaves) of the -2 leaf, and C shows the pushing resistance. 1 is Nipponbare, 2 is null, and 3 to 5 are recombinant plants, and all are averages of triplicates (n = 3). As a result of overexpressing OsTPS6 cDNA under the 35S promoter, the OsTPS6 expression level, SPAD of the -2 leaf, and pushing resistance of the recombinant plants were significantly higher than those of Koshihikari, except for the pushing resistance of individual 4 (p < 0.01). This suggests that increased expression of OsTPS6 suppressed the senescence of lower leaves and increased the supporting capacity of the plant.

[0096] [Example 3] Examination of the promoter sequence of OsTPS6 In this example, we identified the promoter region of the OsTPS6 gene. Specifically, we sequenced 1 kb upstream of the initiation codon and compared the sequences between Kasalath and Koshihikari. We found nine SNPs between Kasalath and Koshihikari.

[0097] Among them, the GCGG motif was destroyed in the Kasalath type by the SNP at -188 (G / A). Previously, it was reported (Non-Patent Document 1) that under sd1, excessive DELLa protein (gibberellin signal enhancer) binds to the GCGG motif (-148bp) and reduces the expression level of OsTPS6.

[0098] To investigate the relationship between the GCGG motif and the expression level of the OsTPS6 gene, the expression level of OsTPS6 in multiple NIL individuals was examined. First, NILprl5 (GCGG motif destruction) was crossed with NILsd1 (excessive accumulation of DELLa protein), and the self-fertilized progeny F2 of the obtained F1 was produced. From the results of genotyping of these 200 F2 individuals, lines with prl5 and sd1 loci of Kasalath type or Short Leg Oolong type were selected, and progeny seeds were obtained. Seedlings obtained by sowing the progeny seeds were sampled one month after transplantation, and the OsTPS6 expression level was measured in the same manner as in Example 1. The results are shown in Table 4.

[0099] [Table 4]

[0100] The expression level of OsTPS6 was increased in NILprl5 (disruption of GCGG motif) and NILprl5sd1 (disruption of GCGG motif and overexpression of DELLa protein) compared with NILsd1 (excessive accumulation of DELLa protein). From this result, −188 (G / A) of the promoter sequence of OsTPS6 was identified as FNP. That is, under sd1, excess DELLa protein binds to the GCGG motif to reduce the expression level of OsTPS6 (Non-Patent Document 1), whereas under the promoter sequence having FNP, DELLa protein cannot bind to the GCGG motif, and the expression level of OsTPS6 does not decrease, suggesting that the expression level of OsTPS6 increases. Therefore, when the promoter sequence without mutation (SEQ ID NO: 1) is used as a standard, the mutation of the base G at position 883 (the base corresponding to position 883) to another base (e.g., base A) and the disruption of the motif GCGG at positions 883 to 886 may contribute to the increase in the expression level of OsTPS6.

[0101] [Example 4] Characterization of plants with increased OsTPS6 expression (NILprl5) In this example, the characteristics of an individual (NILprl5) with increased OsTPS6 expression were examined.

[0102] (1) Lodging resistance Figure 5 shows photographs of an individual plant with increased OsTPS6 expression (NILprl5) and a control plant, Koshihikari, taken the day after Typhoon No. 9 hit directly on August 23, 2016 (maximum wind speed 26.9 m / s). Unlike Koshihikari (front), NILprl5 (back of the photograph in Figure 5) did not fall over even when hit directly by the typhoon, demonstrating its lodging resistance.

[0103] (2) Yield characteristics and the ratio of top-quality rice The control Koshihikari and NIL were cultivated under the same method and schedule as neighboring farmers (row spacing 30 cm, plant spacing 18 cm, mechanical planting). After harvesting, the top rice ratio was calculated using a sieve for brown rice. The results are shown in Table 5.

[0104] [Table 5]

[0105] From Table 5, we can see that the yield characteristics of NIL are equivalent to those of Koshihikari. We can also see that the ratio of top-grade rice in brown rice with a mesh size of 2.0 or more is higher than that of Koshihikari. In recent years, there has been a trend toward selecting rice with uniform grain size (large grains). Therefore, NIL has the advantage of having excellent characteristics such as a high ratio of top-grade rice.

[0106] (3) Ability to identify and remove weedy rice In recent years, damage caused by wild rice growing in fields mixed with cultivated varieties and its colored seeds (red rice) contaminating harvested brown rice has become a major problem. This wild rice that is mixed in is called "weedy rice" and is proliferating in various parts of the world, causing great damage to rice cultivation. In normal rice cultivation, weeds are controlled using herbicides, but because herbicides are extremely safe for rice, it is extremely difficult to control weedy rice, which is the same plant species as rice, with herbicides for rice.

[0107] Figure 6 shows the results of a cultivation test conducted on an individual with increased OsTPS6 expression (NILprl5) and a control Koshihikari at the University of Miyazaki farm in Miyazaki Prefecture. Koshihikari is on the left side of the photograph in Figure 6, and NILprl5 is on the right. Koshihikari on the left side of Figure 6 has fallen over, making it impossible to tell whether it has been contaminated by weedy rice, but NILprl5 on the right side does not fall over, demonstrating that it is possible to identify and remove weedy rice, as indicated by the arrow. [Sequence List Free Text]

[0108] SEQ ID NOs: 3 to 19: Artificial, synthetic primers

Claims

1. 1. A method for producing a lodging-resistant grass plant, comprising increasing trehalose-6-phosphate in at least the stems of the grass plant, wherein the increase in trehalose-6-phosphate is achieved by increasing trehalose-6-phosphate synthase by increasing expression or introducing a trehalose-6-phosphate synthase gene OsTPS6.

2. 1. A method for removing weed plants in the cultivation of a grass family plant, the method comprising cultivating a lodging-resistant grass family plant having increased trehalose-6-phosphate at least in the stems of the grass family plant, and distinguishing the weed plants from the grass family plant and removing the weed plants, wherein the increase in trehalose-6-phosphate is achieved by increasing the expression of a trehalose-6-phosphate synthase gene OsTPS6 or by introducing trehalose-6-phosphate synthase.

3. A method for cultivating rice with a high ratio of top grains, comprising cultivating lodging-resistant rice having increased trehalose-6-phosphate at least in the stems, wherein the increase in trehalose-6-phosphate is achieved by increasing the expression of trehalose-6-phosphate synthase gene OsTPS6 or by introducing trehalose-6-phosphate synthase.

4. 4. The method according to claim 1, wherein the trehalose-6-phosphate synthase is increased by expressing the trehalose-6-phosphate synthase gene OsTPS6 using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2, or by introducing the trehalose-6-phosphate synthase gene OsTPS6.

5. The increase in trehalose-6-phosphate synthase is (i) a promoter sequence having the sequence shown in SEQ ID NO: 2, or (ii) A promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, in which the base G at the position corresponding to the 883rd position of the sequence shown in SEQ ID NO: 1 is mutated to another base, or the base motif GCGG at the positions corresponding to the 883rd to 886th positions of the sequence shown in SEQ ID NO: 1 is disrupted; or (iii) a promoter sequence having a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 is mutated to another base, or a sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted The method according to claim 4, wherein the method is carried out by expression of the trehalose-6-phosphate synthase gene OsTPS6 under the control of

6. The method according to claim 1 , 2 , and 4 or 5 , wherein the grass plant is rice.

7. A method for determining or selecting a lodging-resistant grass plant, the method comprising the step of detecting whether or not a promoter sequence of a trehalose-6-phosphate synthase gene in a target grass plant is (i) a promoter sequence having the sequence shown in SEQ ID NO: 2, or (ii) a promoter sequence which has at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and has promoter activity, and which has a sequence in which the base G at position corresponding to position 883 of the sequence shown in SEQ ID NO: 1 has been mutated to another base or a sequence in which the base motif GCGG at positions corresponding to positions 883 to 886 of the sequence shown in SEQ ID NO: 1 has been disrupted, or (iii) a mutation of the base G at position 883 of the promoter sequence shown in SEQ ID NO: 1 to another base or a disruption of the base motif GCGG at positions 883 to 886 of the promoter sequence shown in SEQ ID NO:

1.

8. 8. The method of claim 7, wherein the detection of the mutation is performed using polymerase chain reaction (PCR), hybridization, or sequencing.

Images