Methods and compositions for inhibiting expression of LDHA

Abstract

To provide oligonucleotides for reducing LDHA expression.SOLUTION: An oligonucleotide comprises an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC(SEQ ID NO: 2).SELECTED DRAWING: Figure 3-1

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62 / 726,950, filed September 4, 2018, entitled "METHODS AND COMPOSITIONS FOR INHIBITING THE EXPRESSION OF LDHA," U.S. Provisional Application No. 62 / 572,403, filed October 13, 2017, entitled "METHODS AND COMPOSITIONS FOR INHIBITING THE EXPRESSION OF LDHA," and U.S. Provisional Application No. 62 / 572,398, filed October 13, 2017, entitled "METHODS AND COMPOSITIONS FOR INHIBITING THE EXPRESSION OF LDHA," the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to oligonucleotides, compositions, and methods for reducing gene expression and / or activity. [Background technology]

[0003] Primary hyperoxaluria (PH) is an autosomal recessive disorder caused by overproduction of oxalate, leading to calcium oxalate precipitation in the kidney and ultimately end-stage renal disease. There are three forms of PH, termed type 1 PH (PH1), type 2 PH (PH2), and type 3 PH (PH3), as well as idiopathic hyperoxaluria. Lactate dehydrogenase (LDH) is the key enzyme responsible for the conversion of glyoxalate to oxalate, the final step of oxalate metabolism in the liver, and has therefore been identified as a target for reducing hepatic oxalate production. RNAi oligonucleotides targeting genes encoding LDH subunits have been developed. Summary of the Invention

[0004] The present invention is based, at least in part, on the identification of potent oligonucleotides that create a permanent RNAi-based knockdown of LDH protein, thereby reducing LDH enzyme activity. In some embodiments, the RNAi oligonucleotides disclosed herein have, among other features, improved stability, improved bioavailability, improved liver targeting, and / or improved sustained effect on gene knockdown compared to previous oligonucleotides. In some embodiments, the RNAi oligonucleotides disclosed herein include a nicked tetraloop structure conjugated with an N-acetylgalactosamine (GalNAc) moiety to specifically deliver the oligonucleotide to hepatocytes, thereby avoiding or minimizing potential undesirable effects in other tissues, such as muscle, skin, or uterus. In some embodiments, the RNAi oligonucleotides disclosed herein are useful for reducing hepatic oxalate production in a subject, for example, a patient suffering from primary hyperoxaluria. In some embodiments, the RNAi oligonucleotides disclosed herein are useful for reducing urinary oxalate levels. In some embodiments, the RNAi oligonucleotides disclosed herein are useful for treating primary hyperoxaluria, including PH1, PH2 and / or PH3, as well as idiopathic hyperoxaluria.

[0005] Some embodiments of the present disclosure provide an oligonucleotide for reducing expression of LDHA, the oligonucleotide comprising an antisense strand having a sequence shown as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence shown as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2).

[0006] In some embodiments, the oligonucleotide comprises at least one modified nucleotide. In some embodiments, all nucleotides of the oligonucleotide are modified. In some embodiments, the modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is 2'-fluoro or 2'-O-methyl. In some embodiments, one or more of the following positions are modified with 2'-O-methyl: 1, 2, 4, 6, 7, 12, 14, 16, 18-26, or 31-36 of the sense strand and / or 1, 6, 8, 11-13, 15, 17, or 19-22 of the antisense strand. In some embodiments, positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are all modified with 2'-O-methyl. In some embodiments, one or more of the following positions: positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and / or positions 2-5, 7, 9, 10, 14, 16, or 18 of the antisense strand are modified with 2'-fluoro. In some embodiments, positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are all modified with 2'-fluoro.

[0007] In some embodiments, the oligonucleotide comprises at least one modified internucleotide bond. In some embodiments, the at least one modified internucleotide bond is a phosphorothioate bond. In some embodiments, the oligonucleotide has a phosphorothioate bond between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotide has a phosphorothioate bond between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.

[0008] In some embodiments, the uridine at the first position of the antisense strand contains a phosphate analog.

[0009] In some embodiments, the oligonucleotide comprises the following structure at position 1 of the antisense strand:

[0010] TIFF0007674420000001.tif4952

[0011] In some embodiments, one or more of the nucleotides of the -GAAA- sequence in the sense strand are conjugated to a monovalent GalNac moiety. In some embodiments, each of the nucleotides of the -GAAA- sequence in the sense strand is conjugated to a monovalent GalNac moiety. In some embodiments, the -GAAA- motif has the structure:

[0012] TIFF0007674420000002.tif15497

[0013] where L represents a bond, a click chemistry handle, or a linker of 1 to 20 contiguous covalently bonded atoms in length, inclusive, selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, and combinations thereof; and X is O, S, or N.

[0014] In some embodiments, L is an acetal linker. In some embodiments, X is O.

[0015] In some embodiments, the -GAAA- sequence comprises the following structure:

[0016] TIFF0007674420000003.tif223162

[0017] In some embodiments, the oligonucleotide for reducing expression of LDHA comprises an antisense strand having a sequence shown as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence shown as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2); positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are all modified with 2'-O-methyl, and positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are all modified with 2'-fluoro; the oligonucleotide has phosphorothioate bonds between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand; This oligonucleotide has the following structure at position 1 of the antisense strand:

[0018] TIFF0007674420000004.tif4952

[0019] Including, Each of the nucleotides of the -GAAA- sequence in the sense strand has the structure:

[0020] TIFF0007674420000005.tif13497

[0021] is conjugated to a monovalent GalNac moiety comprising

[0022] Another aspect of the present disclosure is a method for the preparation of a medicament comprising administering to a subject a compound comprising any of the oligonucleotides described herein and Na + and a counterion.

[0023] Compositions having chemical structures as shown in FIG. 3 are also provided.

[0024] Another aspect of the present disclosure provides a method of delivering oligonucleotide to a subject, the method comprising administering to the subject any of the compositions or oligonucleotides described herein. In some embodiments, the subject suffers from or is at risk of suffering from PH1, PH2, PH3, and / or idiopathic hyperoxaluria, and the method comprises administering to the subject the oligonucleotide described herein, thereby reducing the expression of LDHA protein in liver cells of the subject.

[0025] Another aspect of the present disclosure provides a use of an oligonucleotide or composition described herein for the treatment of a subject suffering from or at risk of suffering from primary hyperoxaluria, the treatment comprising administering the oligonucleotide or composition to the subject. In some embodiments, the oligonucleotide or composition is administered to the subject intravenously or subcutaneously.

[0026] The accompanying drawings, which are incorporated in and form a part of this specification, illustrate certain embodiments and, together with the written description, serve to demonstrate non-limiting examples of certain aspects of the compositions and methods disclosed herein. [Brief description of the drawings]

[0027] [Figure 1A] FIG. 1A is a schematic diagram showing a non-limiting example of an RNAi oligonucleotide having a guide (antisense) strand with a region of complementarity to LDHA mRNA. [Figure 1B] FIG. 1B is a non-limiting representation of the chemical structures of example loop sequences present at positions 27-30 of the passenger (sense) strand shown in FIG. 1A. [Figure 1C] FIG. 1C is a non-limiting representation of the chemical structure of the modified uridine shown at position 1 of the guide (antisense) strand shown in FIG. 1A. [Figure 2A] Figure 2A is a schematic diagram showing the timeline for in vivo evaluation of specific oligonucleotides shown in Figure 1A using the LDHA AAV mouse model. AAV injections were performed on week -1 and a single dose of oligonucleotide was injected subcutaneously at 0.5, 1, 3, or 6 mg / kg as indicated. 4 mm biopsy punches were taken at weeks 1, 2, 4, 6, 8, and 10 and flash frozen in RNAlater for block and mRNA knockdown analysis. [Figure 2B] Figure 2B is a graph showing a subset of the results of the study described in Example 1. The percentage of hLDHA mRNA remaining is shown weeks after administration of 1, 3, or 6 mg / kg doses. These results were normalized to time-matched PBS. Dose-dependent reduction of human LDHA mRNA was sustained for 4 weeks after administration. [Figure 3-1] FIG. 3 is a non-limiting chemical structure of an RNAi oligonucleotide having a guide (antisense) strand with a region complementary to LDHA mRNA and a passenger (sense) strand with a nicked tetraloop structure. [Figure 3-2]FIG. 3 is a non-limiting chemical structure of an RNAi oligonucleotide having a guide (antisense) strand with a region complementary to LDHA mRNA and a passenger (sense) strand with a nicked tetraloop structure. [Figure 3-3] FIG. 3 is a non-limiting chemical structure of an RNAi oligonucleotide having a guide (antisense) strand with a region complementary to LDHA mRNA and a passenger (sense) strand with a nicked tetraloop structure. [Figure 4] FIG. 4 is a graph showing reduction in LDHA mRNA (upper panel), LDH protein (middle panel), and LDH activity (% remaining, lower panel) after two doses of oligonucleotides as shown in FIG. 3 in cynomolgus monkeys (juvenile and young adult) on days 28 and 56 after the first dose. [Diagram 5] FIG. 5 is a graph showing the reduction in LDH protein levels (detected by Western blot) following two doses of oligonucleotides as shown in FIG. 3 in cynomolgus monkeys. [Figure 6] FIG. 6 is a graph showing the reduction in LDHA mRNA expression (% remaining) following 10 doses of oligonucleotides as shown in FIG. 3 in cynomolgus monkeys. [Figure 7] FIG. 7 is a graph showing the concentration of oligonucleotides incorporated into Ago2 / RISC after 10 doses of oligonucleotides as shown in FIG. 3 in cynomolgus monkeys. [Figure 8A] Figures 8A-8B are graphs showing the effect of various doses (1.5 mg / kg, 3 mg / kg, or 6 mg / kg) of oligonucleotides as shown in Figure 3 in PH patients in an open-label, multicenter study. Figure 8A shows the absolute change in urinary oxalate (UOX) content in these patients over the course of the study. In the 1.5 mg / kg dose group, n=2 after 57 days. In the 3 mg / kg dose group, n=2 after 57 days. In the 6 mg / kg dose group, n=2 and n=1 after 1 day. [Figure 8B]Figures 8A-8B are graphs showing the effect of various doses (1.5 mg / kg, 3 mg / kg, or 6 mg / kg) of oligonucleotides as shown in Figure 3 in patients with PH in an open-label, multicenter study. Figure 8B shows the 24-hour change in urinary oxalate (UOX)% from baseline for patients in the 1.5 mg / kg and 3 mg / kg dose groups over the course of the study. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Detailed Description of the Invention According to some aspects, the present disclosure provides RNAi oligonucleotides that target LDHA mRNA and are effective for reducing LDH enzyme activity.In some embodiments, these RNAi oligonucleotides are useful for, for example, reducing LDHA in liver cells (e.g., hepatocytes).In some embodiments, suppressing hepatic LDH activity using the RNAi oligonucleotides disclosed herein provides a therapeutic approach for treating primary hyperoxaluria, including PH1, PH2 and / or PH3, and idiopathic hyperoxaluria.

[0029] Further aspects of the disclosure, including explanations of defined terms, are set forth below.

[0030] I. Definition Approximately: As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest, refers to a value similar to a reference value indicated. In certain embodiments, the term "approximately" or "about" refers to a value that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the reference value indicated, unless otherwise stated or otherwise clear from the context (except where such value exceeds 100% of the possible values).

[0031] Administering: As used herein, the terms "administering" or "administration" mean providing a substance (e.g., an oligonucleotide) to a subject in a pharmacologically useful manner (e.g., to treat a condition in the subject).

[0032] Asialoglycoprotein receptor (ASGPR): As used herein, the term "asialoglycoprotein receptor" or "ASGPR" refers to a bipartite C-type lectin formed by a 48 kDa large subunit (ASGPR-1) and a 40 kDa small subunit (ASGPR-2). ASGPR is expressed primarily on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins that contain terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins).

[0033] Attenuate: As used herein, the term "attenuate" means to reduce or effectively stop. As a non-limiting example, one or more of the treatments provided herein may reduce or effectively stop oxalate accumulation in a subject. Such attenuation is exemplified, for example, by a reduction in one or more aspects of oxalate accumulation (e.g., symptoms, tissue characteristics, cells, etc.) or symptoms resulting from such accumulation, the absence of detectable progression (worsening) of one or more aspects of oxalate accumulation or symptoms resulting from such accumulation, or the absence of detectable oxalate accumulation or symptoms resulting from such accumulation in a subject that would otherwise be expected.

[0034] Complementary: As used herein, the term "complementary" refers to a structural relationship between two nucleotides (e.g., of two opposing nucleic acids or opposing regions of a single nucleic acid strand) that allows the two nucleotides to base pair with each other. For example, the purine nucleotides of one nucleic acid are complementary to the pyrimidine nucleotides of the opposing nucleic acid and can base pair together by forming hydrogen bonds with each other. In some embodiments, the complementary nucleotides can base pair in a Watson-Crick manner or in any other manner that allows the formation of a stable duplex. In some embodiments, the two nucleic acids can have a region of multiple nucleotides that are complementary to each other to form a region of complementarity as described herein.

[0035] Deoxyribonucleotide: As used herein, the term "deoxyribonucleotide" refers to a nucleotide that has a hydrogen instead of a hydroxyl at the 2' position of its pentose sugar compared to a ribonucleotide. Modified deoxyribonucleotides are deoxyribonucleotides that have one or more modifications or substitutions of an atom other than the 2' position, including modifications or substitutions in or of the sugar, phosphate group, or base.

[0036] Double-stranded oligonucleotide: As used herein, the term "double-stranded oligonucleotide" refers to an oligonucleotide in a substantially double-stranded form. In some embodiments, the complementary base pairing of the double-stranded region of the double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of covalently separated nucleic acid strands. In some embodiments, the complementary base pairing of the double-stranded region of the double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of covalently linked nucleic acid strands. In some embodiments, the complementary base pairing of the double-stranded region of the double-stranded oligonucleotide is formed from a single nucleic acid strand that is folded back (e.g., via a hairpin) to provide a complementary antiparallel sequence of nucleotides that are base-paired together. In some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are fully duplexed with each other. However, in some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are partially duplexed, e.g., with an overhang at one or both ends. In some embodiments, double-stranded oligonucleotides contain antiparallel sequences of partially complementary nucleotides and therefore may have one or more mismatches, which may include internal or terminal mismatches.

[0037] Duplex: As used herein, the term "duplex," with respect to nucleic acids (e.g., oligonucleotides), refers to the structure formed through complementary base pairing of two antiparallel sequences of nucleotides.

[0038] Excipient: As used herein, the term "excipient" refers to a non-therapeutic agent that may be included in a composition to, for example, provide or contribute a desired consistency or stabilizing effect.

[0039] Hepatocytes: As used herein, the term "hepatocytes" refers to cells of the liver parenchyma. These cells constitute approximately 70-85% of the liver mass and produce serum albumin, fibrinogen, and the prothrombin group of clotting factors (excluding factors 3 and 4). Markers of hepatocyte lineage cells may include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers of mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6 phosphate (G6p), albumin (Alb), and OC2-2F8. See, e.g., Huch et al. (2013), Nature, 494(7436):247-250, the contents of which regarding hepatocyte markers are incorporated by reference herein.

[0040] Lactate dehydrogenase (LDH): As used herein, the term "lactate dehydrogenase" or "LDH" refers to an enzyme that regulates the homeostasis of lactate / pyruvate, hydroxypyruvate / glycerate, and glyoxalate / oxalate metabolism. Functional LDH is composed of four monomeric polypeptide chains, forming a tetramer. The most abundant subunits, known as muscle (M)-type or cardiac (H)-type LDH, are encoded by the LDHA and LDHB genes, respectively. Based on the subunit composition, five different isozymes have been identified (4H, 3H1M, 2H2M, 1H3M, 4M), which show similar enzymatic activity but differ in kinetic behavior and tissue distribution. The major isozyme LDH5 in liver and skeletal muscle has the 4M subunit.

[0041] Lactate dehydrogenase A (LDHA): As used herein, the term "lactate dehydrogenase A" or "LDHA" refers to a monomer of the LDH enzyme encoded by the LDHA gene (Entrez Gene ID: 3939), which has at least five mRNA transcript variants encoding different isoforms (e.g., NCBI Reference Sequences: NM_005566.3, NM_001135239.1, NM_001165414.1, NM_001165415.1, and NM_001165416.1).

[0042] Lactate dehydrogenase B (LDHB): As used herein, the term "lactate dehydrogenase B" or "LDHB" refers to the monomer of the LDH enzyme encoded by the LDHB gene (Entrez Gene ID: 3945), of which there are at least two mRNA transcript variants (e.g., NCBI Reference Sequences: NM_001174097.2 and NM_001315537.1) that encode different isoforms.

[0043] Loop: As used herein, the term "loop" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) flanked by two antiparallel regions of nucleic acid that are sufficiently complementary to one another such that under appropriate hybridization conditions (e.g., in a phosphate buffer, inside a cell), these two antiparallel regions flanked by the unpaired regions hybridize to form a duplex (called a "stem").

[0044] Modified internucleotide linkage: As used herein, the term "modified internucleotide linkage" refers to an internucleotide linkage that has one or more chemical modifications compared to a reference internucleotide linkage that includes a phosphodiester bond. In some embodiments, the modified nucleotide is a non-naturally occurring linkage. In some embodiments, the modified internucleotide linkage confers one or more desirable properties to the nucleic acid in which the modified internucleotide linkage is present.

[0045] Modified nucleotide: As used herein, the term "modified nucleotide" refers to a nucleotide that has one or more chemical modifications compared to a corresponding reference nucleotide selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymidine deoxyribonucleotide. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, the modified nucleotide has one or more chemical modifications in its sugar, nucleobase, and / or phosphate group. In some embodiments, the modified nucleotide has one or more chemical moieties conjugated to the corresponding reference nucleotide. In some embodiments, the modified nucleotides provided herein may contribute to improved temperature stability, resistance to degradation, resistance to nucleases, solubility, bioavailability, biological activity, reduced immunogenicity, and the like.

[0046] Nicked tetraloop structure: A "nicked tetraloop structure" is a structure of an RNAi oligonucleotide characterized by the presence of separate sense (passenger) and antisense (guide) strands, where the sense strand has a region complementary to the antisense strand and where at least one of the strands, typically the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within at least one of the strands.

[0047] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a short nucleic acid, for example, less than 100 nucleotides in length. An oligonucleotide can be single-stranded or double-stranded. An oligonucleotide may or may not have a double-stranded region. As a set of non-limiting examples, an oligonucleotide can be, but is not limited to, a small interfering RNA (siRNA), a microRNA (miRNA), a short hairpin RNA (shRNA), a dicer substrate interfering RNA (dsiRNA), an antisense oligonucleotide, a short siRNA, or a single-stranded siRNA. In some embodiments, the double-stranded oligonucleotide is an RNAi oligonucleotide.

[0048] Overhang: As used herein, the term "overhang" refers to terminal non-base-paired nucleotides that result in a strand or region that extends beyond the end of the complementary strand with which it forms a duplex. In some embodiments, an overhang comprises one or more unpaired nucleotides that extend from the duplex region at the 5'-end or 3'-end of a double-stranded oligonucleotide. In certain embodiments, an overhang is a 3' or 5' overhang on the antisense or sense strand of a double-stranded oligonucleotide.

[0049] Phosphate analog: As used herein, the term "phosphate analog" refers to a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, an oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar of the 5'-terminal nucleotide (referred to as a "4'-phosphate analog"). An example of a 4'-phosphate analog is an oxymethylphosphonate or an analog thereof in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., at its 4'-carbon).

[0050] Reduced expression: As used herein, the term "reduced expression" of a gene refers to a reduction in the amount of RNA transcript or protein encoded by that gene in a cell or subject, and / or a reduction in the amount of activity of that gene, when compared to a suitable reference cell or subject. For example, the act of treating a cell with a double-stranded oligonucleotide (e.g., one having an antisense strand complementary to the LDHA mRNA sequence) can result in a reduction in the amount of mRNA transcript, protein and / or enzyme activity (e.g., encoded by the LDHA gene) compared to a cell that is not treated with the double-stranded oligonucleotide. Similarly, "reducing expression" as used herein refers to an act that results in a reduction in the expression of a gene (e.g., LDHA).

[0051] Region of Complementarity: As used herein, the term "region of complementarity" refers to a nucleotide sequence of a nucleic acid (e.g., a double-stranded oligonucleotide) that is sufficiently complementary to an antiparallel nucleotide sequence to allow hybridization between the two nucleotide sequences under appropriate hybridization conditions, such as in a phosphate buffer, inside a cell, etc.

[0052] Ribonucleotide: As used herein, the term "ribonucleotide" refers to a nucleotide having as its pentose sugar a ribose containing a hydroxyl group at the 2' position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of an atom other than the 2' position, including modifications or substitutions of the ribose, the phosphate group, or the base.

[0053] RNAi Oligonucleotide: As used herein, the term "RNAi oligonucleotide" refers to either (a) a double-stranded oligonucleotide having a sense strand (passenger) and an antisense strand (guide), where the antisense strand, or a portion of the antisense strand, is used by Argonaute 2 (Ago2) endonuclease in cleaving a target mRNA, or (b) a single-stranded oligonucleotide having a single antisense strand, where the antisense strand (or a portion of the antisense strand) is used by Ago2 endonuclease in cleaving a target mRNA.

[0054] Strand: As used herein, the term "strand" refers to a single continuous sequence of nucleotides linked together via internucleotide bonds (e.g., phosphodiester bonds, phosphorothioate bonds). In some embodiments, a strand has two free ends, e.g., a 5' end and a 3' end.

[0055] Subject: As used herein, the term "subject" refers to any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or a non-human primate. The terms "individual" or "patient" may be used interchangeably with "subject."

[0056] Synthetic: As used herein, the term "synthetic" refers to a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid phase nucleic acid synthesizer)) or is not otherwise derived from a natural source (e.g., a cell or organism) that normally produces that molecule.

[0057] Targeting Ligand: As used herein, the term "targeting ligand" refers to a molecule (e.g., a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid) that selectively binds to a cognate molecule (e.g., a receptor) of a tissue or cell of interest and can be conjugated to another substance for the purpose of targeting the other substance to the tissue or cell of interest. In some embodiments, the targeting ligand comprises a GalNac moiety.

[0058] Tetraloop: As used herein, the term "tetraloop" refers to a loop that increases the stability of adjacent duplexes formed by hybridization of flanking sequences of nucleotides. The increased stability is due to the fact that the melting temperature (T m ) is the average expected T of adjacent stem duplexes from a set of loops of equal length made of randomly selected nucleotide sequences. mFor example, a tetraloop may confer a melting temperature of at least 50° C., at least 55° C., at least 56° C., at least 58° C., at least 60° C., at least 65° C., or at least 75° C. in 10 mM NaHPO4 to a hairpin comprising a duplex at least 2 bases in length. In some embodiments, the tetraloop may stabilize base pairs of adjacent stem duplexes through stacking interactions. In addition, interactions between nucleotides within the tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al., Nature 1990 Aug. 16; 346(6285):680-2; Heus and Pardi, Science 1991 Jul. 12; 253(5016):191-4). In some embodiments, the tetraloop comprises or consists of 3-6 nucleotides, typically 4-5 nucleotides. In certain embodiments, the tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., conjugated to a targeting moiety). In one embodiment, the tetraloop consists of 4 nucleotides. Standard IUPAC-IUB symbols may be used to refer to the tetraloop nucleotides as described in Cornish-Bowden (1985) Nucl. Acids Res. 13: 3021-3030. For example, the letter "N" may be used to mean that either base may be at that position, the letter "R" may be used to indicate that A (adenine) or G (guanine) may be at that position, and "B" may be used to indicate that C (cytosine), G (guanine), or T (thymine) may be at that position.Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al., Proc Natl Acad Sci USA. 1990 November; 87(21):8467-71; Antao et al., Nucleic Acids Res. 1991 Nov. 11; 19(21):5901-5). Examples of DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA)), the d(GNRA) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)). See, for example, Nakano et al., Biochemistry, 41 (48), 14281-14292, 2002. SHINJI et al., Nippon Kagakkai Koen Yokoshu, VOL. 78th; NO. 2; PAGE. 731 (2000), which are incorporated herein by reference for relevant disclosures. In some embodiments, the tetraloop is comprised within a nicked tetraloop structure.

[0059] Treatment: As used herein, the term "treatment" refers to the act of providing medical care to a subject in need thereof for the purpose of improving the health and / or well-being of the subject with respect to an existing condition (e.g., disease, disorder) or to prevent or reduce the likelihood of the occurrence of a condition, for example, via administration of a therapeutic agent (e.g., an oligonucleotide) to the subject. In some embodiments, treatment includes reducing the frequency or severity of at least one sign, symptom, or contributing factor of a condition (e.g., disease, disorder) from which the subject suffers.

[0060] II. Oligonucleotide-Based Inhibitors of LDHA Expression i. Oligonucleotide sequence In some embodiments, the oligonucleotides described herein have a guide (antisense) strand with the sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1). In some embodiments, a sense strand is provided that forms a duplex with the antisense strand. In some embodiments, the sense strand comprises a stem-loop at its 3' end. In certain embodiments, the sense strand comprises (e.g., at its 3' end) a stem-loop set depicted as S1-L-S2, where S1 is complementary to S2, and L forms a loop between S1 and S2 ranging from 2 to 6 nucleotides in length. In some embodiments, S 1と The duplex formed between S2 is 4, 5, 6, 7, or 8 base pairs in length. In some embodiments, the loop (L) of the stem-loop is a tetraloop (e.g., in a nicked tetraloop structure). The tetraloop may contain ribonucleotides, modified nucleotides, and / or combinations thereof. Generally, the tetraloop has 4-5 nucleotides. However, in some embodiments, the tetraloop comprises or consists of 3-6 nucleotides, generally consisting of 4 nucleotides. In certain embodiments, the tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides.

[0061] In some embodiments, the oligonucleotides described herein have a sense strand of the sequence AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2). In one embodiment, the oligonucleotide comprises an antisense strand of the sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand of the sequence AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2).

[0062] ii. Oligonucleotide Modification In some embodiments, the oligonucleotides of the present disclosure may include one or more suitable modifications. In some embodiments, modified nucleotides have modifications at their base (or nucleobase), sugar (e.g., ribose, deoxyribose), or phosphate groups. In certain embodiments of the oligonucleotides provided herein, all or substantially all of the nucleotides of the oligonucleotide are modified. In certain embodiments, more than half of the nucleotides are modified. In certain embodiments, less than half of the nucleotides are modified.

[0063] a. Sugar modification In some embodiments, modified sugars (also referred to herein as sugar analogs) include modified deoxyribose or ribose moieties. In some embodiments, the sugar nucleotide modification includes a 2' modification. The 2' modification can be 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, or 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. Typically, the modification is 2'-fluoro or 2'-O-methyl. In some embodiments, the sugar modification includes a modification of the sugar ring, which can include a modification of one or more carbons of the sugar ring.

[0064] In some embodiments, one or more of the following positions are modified with 2'-O-methyl: positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, or 31-36 of the sense strand and / or positions 1, 6, 8, 11-13, 15, 17, or 19-22 of the antisense strand. In certain embodiments, all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and / or all of positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with 2'-O-methyl. In some embodiments, one or more of the following positions are modified with 2'-fluoro: positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and / or positions 2-5, 7, 9, 10, 14, 16, or 18 of the antisense strand. In certain embodiments, all of positions 3, 5, 8-11, 13, 15, and 17 of the sense strand and / or all of positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with 2'-fluoro.

[0065] In some embodiments, the terminal 3' end group (eg, 3'-hydroxyl) is a phosphate group or other group, which can be used, for example, to add a linker, adaptor, or label.

[0066] b. 5' terminal phosphate group In some embodiments, the 5' terminal phosphate group of an oligonucleotide enhances the interaction with Argonaute 2. However, oligonucleotides containing a 5' phosphate group may be susceptible to degradation by phosphatases or other enzymes, which can limit their in vivo bioavailability. In some embodiments, the oligonucleotide contains an analog of the 5' phosphate group that is resistant to such degradation.

[0067] In some embodiments, oligonucleotides have a phosphate analog at the 4'-carbon position of the sugar (referred to as a "4'-phosphate analog"). See, e.g., International Application No. PCT / US2017 / 049909, filed Sep. 1, 2017, entitled "4'-Phosphate Analogs and Oligonucleotides Comprising Same," the disclosure of which is incorporated herein by reference with respect to phosphate analogs.

[0068] In some embodiments, the oligonucleotides provided herein comprise a 4'-phosphate analog at the 5'-terminal nucleotide. In some embodiments, the phosphate analog is an oxymethylphosphonate or an analog thereof in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., at its 4'-carbon). In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or an aminomethylphosphonate or an analog thereof in which the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is attached to the 4'-carbon of the sugar moiety. In certain embodiments, the 4'-phosphate analog is an oxymethylphosphonate.

[0069] In certain embodiments, the phosphate analog attached to the oligonucleotide is a methoxyphosphonate (MOP). In certain embodiments, the phosphate analog attached to the oligonucleotide is a 5' monomethyl protected MOP. In some embodiments, uridine nucleotides containing the following phosphate analogs can be used, for example, at the first position of the guide (antisense) strand.

[0070] TIFF0007674420000006.tif4747

[0071] wherein the modified nucleotide is referred to as [Mephosphonate-4O-mU] or 5'-methoxy, phosphonate-4'oxy-2'-O-methyluridine.

[0072] C modified internucleotide linkage In some embodiments, the phosphate modification or substitution may result in an oligonucleotide that includes at least one (e.g., at least one, at least two, at least three, or at least five) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages. In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides as disclosed herein is a phosphorothioate linkage.

[0073] In some embodiments, the oligonucleotide has a phosphorothioate bond between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In certain embodiments, the oligonucleotide has a phosphorothioate bond between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.

[0074] iii. Targeting Ligands In some embodiments, the oligonucleotides disclosed herein are modified to facilitate targeting of a particular tissue, cell or organ, for example, to facilitate delivery of the oligonucleotide to the liver. In certain embodiments, the oligonucleotides disclosed herein can be modified to facilitate delivery of the oligonucleotide to hepatocytes in the liver.

[0075] In some embodiments, the oligonucleotide comprises a nucleotide conjugated to one or more targeting ligands. In certain embodiments, the targeting ligand is one or more GalNAc moieties. GalNAc is a high affinity ligand for the asialoglycoprotein receptor (ASGPR), which is primarily expressed on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins (asialoglycoproteins) that contain terminal galactose or N-acetylgalactosamine residues. In some embodiments, conjugation of GalNAc moieties to oligonucleotides of the present disclosure is used to target these oligonucleotides to ASGPRs expressed on these hepatocytes. In some embodiments, the oligonucleotides of the present disclosure are conjugated directly or indirectly to a monovalent GalNAc moiety. In some embodiments, the oligonucleotides of the present disclosure are conjugated to one or more divalent, trivalent, or tetravalent GalNAc moieties.

[0076] In some embodiments, the oligonucleotides herein comprise a monovalent GalNac linked to a guanidine nucleotide, referred to as [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanidine-GalNAc, as shown below.

[0077] TIFF0007674420000007.tif59108

[0078] In some embodiments, the oligonucleotides herein comprise a monovalent GalNAc attached to an adenine nucleotide, referred to as [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc, as shown below.

[0079] TIFF0007674420000008.tif54100

[0080] In some embodiments, 2-4 nucleotides of the oligonucleotide are conjugated to a GalNAc moiety. In some embodiments, 2-4 nucleotides of the loop (L) of the stem-loop are each conjugated to a separate GalNAc. For example, the oligonucleotide may contain a stem-loop at the 3' end of the sense strand, and all four nucleotides of this loop may be individually conjugated to a monovalent GalNAc moiety. An example of such a conjugation is shown in the 5' to 3' direction in the nucleotide sequence GAAA (L=linker, X=heteroatom), with the loop containing the stem attachment point shown below. Such a loop may be present, for example, at positions 27-30 of the molecule shown in FIG. 1A. In the formula: TIFF0007674420000009.tif76 is the attachment point to the oligonucleotide chain.

[0081] TIFF0007674420000010.tif15497

[0082] The targeting ligand can be linked to the nucleotide using a suitable method or chemistry (e.g., click chemistry). In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is more stable. In some embodiments, the targeting ligand is conjugated to the nucleotide using a click linker. In some embodiments, an acetal-based linker is used to conjugate the targeting ligand to the nucleotide of the oligonucleotide described herein. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016100401 A1, published on June 23, 2016, the contents of which regarding such linkers are incorporated herein by reference.

[0083] An example is shown below for a loop containing the nucleotides GAAA in the 5' to 3' direction, where the GalNac moiety is attached to the nucleotides of the loop using an acetal linker. Such a loop may be present, for example, at positions 27-30 of the molecule shown in FIG. 1A. The chemical formula is: TIFF0007674420000011.tif88 is the attachment point to the oligonucleotide chain.

[0084] TIFF0007674420000012.tif223162

[0085] III. Preparations Formulations are provided herein to facilitate the use of oligonucleotides.For example, compositions comprising oligonucleotides for use in reducing the expression of LDHA are provided herein.Such compositions can be appropriately formulated so that sufficient amount of oligonucleotide enters cells to reduce LDHA expression when administered to the environment surrounding target cells of a subject or systemically.In some embodiments, oligonucleotide formulations can be used to deliver oligonucleotides for reducing LDHA as disclosed herein.In some embodiments, formulations as disclosed herein include excipients.

[0086] In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration, including but not limited to subcutaneous, intradermal, transmucosal, intravenous, and rectal administration.

[0087] IV.How to use i. Reducing LDHA expression in cells In some embodiments, a method is provided for delivering to a cell an effective amount of any one of the oligonucleotides disclosed herein to reduce the expression of LDHA in the cell. The methods provided herein are useful for any suitable cell type. In some embodiments, the cell is any cell that expresses LDHA. In some embodiments, the cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., it can be delivered to a cultured cell or to an organism in which the cell resides). In certain embodiments, a method is provided for delivering to a cell an effective amount of any one of the oligonucleotides disclosed herein to reduce the expression of LDHA in liver cells.

[0088] The result of inhibition can be confirmed by a suitable assay to evaluate one or more characteristics of the cell or subject, or by a biochemical technique to evaluate a molecule indicative of LDHA expression (e.g., RNA, protein, enzyme activity, metabolite level, oxalate level, etc.). In some embodiments, the extent to which the oligonucleotides provided herein reduce the expression level of LDHA is evaluated by comparing the expression level (e.g., LDHA mRNA or protein level) with a suitable control (e.g., the level of LDHA expression in a cell or cell population to which no oligonucleotide or a negative control has been delivered). In some embodiments, a suitable control level of LDHA expression can be a predetermined level or value, and thus the control level does not need to be measured every time. The predetermined level or value can take a variety of forms. In some embodiments, the predetermined level or value can be a single cutoff value, such as a median or mean value.

[0089] In some embodiments, administration of an oligonucleotide as described herein results in a reduction in the level of LDHA expression in cells. In some embodiments, the reduction in the level of LDHA expression can be 1% or less, 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 70% or less, 80% or less, or 90% or less compared to a suitable control level of LDHA. A suitable control level can be the level of LDHA expression in a cell or cell population contacted with an oligonucleotide as described herein. In some embodiments, the effect of delivery of an oligonucleotide to a cell according to the method disclosed herein is evaluated after a finite period of time. For example, levels of LDHA can be analyzed in cells at least 8 hours, 12 hours, 18 hours, 24 hours; or at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 21 days, 28 days, 35 days or more after introduction of the oligonucleotide into the cells.

[0090] ii. Treatment method In some embodiments, the RNAi oligonucleotides disclosed herein are useful for reducing hepatic oxalate production in a subject, for example, a patient suffering from primary hyperoxaluria. In some embodiments, the RNAi oligonucleotides disclosed herein are useful for reducing urinary oxalate levels. In some embodiments, the RNAi oligonucleotides disclosed herein are useful for treating primary hyperoxaluria, including PH1, PH2 and / or PH3, as well as idiopathic hyperoxaluria. Thus, aspects of the present disclosure relate to methods for reducing LDHA expression for the treatment of oxalate accumulation. In some aspects, methods are provided for treating primary hyperoxaluria, including PH1, PH2 and / or PH3, as well as idiopathic hyperoxaluria. In some embodiments, these methods may include administering an effective amount of any one of the oligonucleotides disclosed herein to a subject in need thereof. Such treatment can be used, for example, to attenuate or stop oxalate accumulation. The present disclosure provides both prophylactic and therapeutic methods of treating a subject at risk for (or susceptible to) a disease or disorder associated with oxalate accumulation.

[0091] In some embodiments, the subject being treated is one who would benefit therapeutically from a reduction in oxalate accumulation, for example in the liver. In some embodiments, the subject being treated is one who has or is suspected of having oxalate accumulation, renal disease, or a condition that leads to primary hyperoxaluria, including PH1, PH2, and / or PH3, and idiopathic hyperoxaluria.

[0092] The methods described herein generally include administering to a subject an effective amount of oligonucleotide, i.e., an amount that can produce a desired therapeutic result. A therapeutically acceptable amount can be an amount that can treat a disease or disorder. The appropriate dose for any subject will vary depending on certain factors, including the subject's size, body surface area, age, the specific composition administered, the active ingredient in the composition, the time and route of administration, health condition, and other drugs administered at the same time. Generally, the oligonucleotides disclosed herein are administered intravenously or subcutaneously.

[0093] As a non-limiting example of a series, the oligonucleotide of the present disclosure is generally administered four times a year (once every three months), every other month (once every two months), monthly, or weekly. For example, the oligonucleotide can be administered every week, every two weeks, or every three weeks. The oligonucleotide can be administered monthly in some embodiments.

[0094] In some embodiments, the subject to be treated is a human. In some embodiments, the subject to be treated is a non-human primate or other mammalian subject (e.g., mouse or rat). In some embodiments, the subject to be treated is a non-human primate or other mammalian subject engineered to express human LDHA transcripts (e.g., from an AAV-delivered expression vector). EXAMPLES

[0095] Example 1: Specific RNAi oligonucleotides useful for specific knockdown of LDHA RNAi oligonucleotides with an antisense strand of the sequence UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand of the sequence AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2) were evaluated for their ability to knock down LDHA mRNA expression. In the RNAi oligonucleotides, the following positions were modified with 2'-O-methyl (designated as 2'-OMe): positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 in the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 in the antisense strand. The following positions were modified with 2'-fluoro (designated as 2'-F): positions 3, 5, 8-11, 13, 15, or 17 in the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 in the antisense strand. The RNAi oligonucleotide has phosphorothioate bonds between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. FIG. 1B is a representation of the chemical structure of positions 27-30 of the passenger (sense) strand shown in FIG. 1A, and FIG. 1C is a representation of the chemical structure of a modified uridine shown at position 1 of the guide (antisense) strand in the same molecule. FIG. 1C is a non-limiting representation of the chemical structure of a modified uridine shown at position 1 of the guide (antisense) strand shown in FIG. 1A. Chemical formula TIFF0007674420000013.tif6170 is a single bond with no specified stereochemistry to the moiety directly attached to it. Figure 3 is the chemical structure of an RNAi oligonucleotide. This RNAi oligonucleotide has also been referred to as LDHA-1. GalNAc sugars are conjugated to nucleotides including positions 27-30 on the sense strand. The dose-response and duration of LDHA mRNA knockdown by LDHA-1 in the liver of healthy female mice was evaluated in vivo using a human LDHA AAV mouse model. Human LDHA mRNA was expressed under the control of the thyroid hormone-binding globulin promoter via AAV9 viral transduction. To establish the mouse model, 4-6 week old female CD-1 mice were administered a controlled titer of AAV9 virus intravenously (IV) to generate stable human LDHA mRNA expression. Figure 2A is a schematic showing the timeline of this evaluation. This AAV injection (7.5 × 10 in 100 μL) was performed in 100 mice. 11 Genome copy doses) were administered 1 week prior and a single dose of LDHA-1 was injected subcutaneously 1 week later at 0.5 mg / kg (n=20 mice), 1 mg / kg (n=30 mice), 3 mg / kg (n=30 mice), or 6 mg / kg (n=30 mice), as indicated. At 1, 2, 4, 6, 8, and 10 weeks, 4 mm liver biopsy punches were taken and snap frozen in blocks and in RNAlater (ThermoFisher Scientific) for mRNA knockdown analysis.

[0096] Figure 2B is a graph showing a subset of the results of the study described in Figure 2A. The percentage of remaining hLDHA mRNA is shown weeks after administration of 1, 3, or 6 mg / kg doses. The results were normalized to time-matched PBS (n=40 mice). These results show that rapid and sustained knockdown of ectopically expressed LDHA mRNA was achieved after a single SC administration of 1, 3, or 6 mg / kg doses of LDHA-1 in healthy mice expressing human LDHA.

[0097] A single SC dose of 6 mg / kg LDHA-1 reduced human LDHA mRNA expression in the liver by 90% compared to PBS controls at 1 week post-dose (p≦0.05). The dose-dependent reduction in human LDHA mRNA persisted for 4 weeks after a single dose. LDHA expression recovered at 6 weeks after a single dose.

[0098] A single SC dose of 3 mg / kg LDHA-1 reduced human LDHA mRNA expression in the liver by 63% compared to PBS controls at week 1. This degree of human LDHA mRNA knockdown remained constant for 4 weeks after a single dose, with baseline LDHA expression restored at week 6 after a single dose.

[0099] A single SC dose of 1 mg / kg LDHA-1 reduced human LDHA mRNA expression in the liver by 50% compared to PBS controls at 1 week post-dose. This degree of human LDHA mRNA knockdown was sustained at 45% knockdown 4 weeks post-dose. LDHA mRNA expression returned to baseline by 6 weeks post-single dose.

[0100] Materials and Methods for Example 1 Animals: Female CD-1 mice (birth date: August 9, 2016; received date: September 13, 2016) were purchased from Charles River Laboratories (Kingston, NY; strain code 022). Mice were acclimated for at least 3 days before treatment initiation. Mice were maintained under specific pathogen-free housing conditions and provided with laboratory chow and water ad libitum.

[0101] RNAi oligonucleotide LDHA-1: Double-stranded, duplexed RNA oligonucleotides bearing GalNAc functional groups were chemically synthesized in sterile phosphate buffered saline (PBS). These oligonucleotides were stored at -20°C. Before use, these oligonucleotides were thawed, mixed thoroughly (gently vortexed), and then equilibrated to room temperature for at least 30 minutes.

[0102] Measurement of LDHA mRNA by RT-qPCR: Approximately 50 mg of sample was homogenized in 0.75 mL of phenol / guanidine-based QIAzol Lysis Reagent (Qiagen, Valencia, CA) using a Tiussuelyser II (Qiagen, Valencia, CA). The homogenate was extracted with 1-bromo-3-chloropropane (Sigma-Aldrich, St. Louis, MO). RNA was extracted from 0.2 ml of the aqueous phase using MagMax Technology (ThermoFisher Scientific, Waltham, MA) according to the manufacturer's instructions. RNA was quantified using spectrophotometric measurements at 260 nm and 280 nm. LDHA mRNA levels were measured using RT-qPCR assays from Integrated DNA Technologies (Coralville, IA) and reagents from ThermoFisher Scientific (Waltham, MA) and BioRad Laboratories (Hercules, CA) and normalized to AA V9 plasmid levels. The degree of LDHA mRNA reduction in the LDHA-1-treated group was calculated as the percentage of expression (normalized to AAV9 plasmid copy number determined by DNA qPCR) relative to the mean expression level of the PBS control group on the same day, where LDHA mRNA expression in the PBS control group was set to 100%. Graphs were generated in GraphPad Prism and data were analyzed using GraphPad Prism. A one-way analysis of variance (ANOVA) with Dunnett's multiple comparison test was performed to compare the LDHA mRNA levels (normalized to AAV9 copy number) of the LDHA-1-treated group with the PBS control group at the same time point.

[0103] Example 2: Toxicity and toxicokinetics of LDHA-1 targeted LDHA in juvenile and young adult cynomolgus monkeys A 5-week repeated subcutaneous dose toxicity and toxicokinetics study was designed to demonstrate the effects of LDHA-targeted oligonucleotides in juvenile and young adult cynomolgus monkeys receiving two subcutaneous doses of 30, 100, or 300 mg / kg LDHA-1 as described in Example 1 (see also FIG. 3). Male and female juvenile and young adult cynomolgus monkeys received subcutaneous (SC) injections of 0 (sterile water for injection, SWFI on day 1, sterile saline on day 29), 30, 100, or 300 mg / kg LDHA-1 on days 1 and 29. At terminal sacrifice (day 31) and recovery sacrifice (day 57), liver tissue was harvested for analysis of LDHA mRNA levels by RT-qPCR, LDH protein levels by Western analysis, and LDH activity by enzyme assay.

[0104] The study design is shown in Table 1. Liver tissues were collected from cynomolgus monkeys at scheduled sacrifice (day 31) and post-recovery sacrifice (day 57) and either flash frozen in liquid nitrogen for Western blot and LDH activity assays or incubated in RNAlater and frozen for RT-qPCR analysis.

[0105] After two doses of 30, 100, or 300 mg / kg LDHA-1, monkey LDHA mRNA expression, LDH protein concentration, and LDH activity were all significantly reduced at all dose levels at scheduled sacrifice on day 31 with no clear dose response (p≦0.0001). Similar findings were seen at recovery sacrifice on day 57 (p<0.0001, p≦0.001, p≦0.01 as indicated, statistical significance calculated using unpaired t-test); no reversal of knockdown of LDHA mRNA, LDH protein, and LDH activity was seen (FIG. 4). The effect of dose on hepatic LDH protein levels as measured by Western blot is shown in FIG. 5. LDH protein levels were significantly reduced at all dose levels at both scheduled sacrifice (day 31) and recovery sacrifice (day 57).

[0106] The results showed that LDHA-1 exhibited potent activity at all dose levels in reducing monkey LDHA mRNA expression, LDH protein concentration, and LDH activity compared to controls without any apparent dose-response at day 31. This reduction was sustained through day 57 without any signs of recovery of target knockdown.

[0107] [Table 1]

[0108] In addition, to assess reduction in LDHA mRNA levels and to quantify the concentration of LDHA-1 incorporated into the RNA-induced silencing complex (RISC), a 39-week repeated subcutaneous dose toxicity and toxicokinetic study of LDHA-targeting oligonucleotides was conducted in juvenile and young adult cynomolgus monkeys receiving ten SC doses of 30, 100, or 300 mg / kg of LDHA-1 as described in Example 1. Juvenile monkeys received subcutaneous (SC) injections of 0 (saline), 30, 100, or 300 mg / kg LDHA-1 and young adult monkeys received SC injections of 0 (saline) or 300 mg / kg LDHA-1 on study days 1, 29, 57, 85, 113, 141, 169, 197, 225, and 253. Liver tissue was collected at scheduled sacrifice (day 255, 2 days after the last dose) and at post-recovery sacrifice (day 309, 8 weeks after the last dose) for analysis of LDHA mRNA levels by RT-qPCR. Liver samples collected on day 255 were also used to quantify the concentration of LDHA-1, which is incorporated into the RNA-induced silencing complex (RISC) and measured by Argonaute protein 2 (Ago2) immunoprecipitation followed by stem-loop (SL)-RT-qPCR.

[0109] At the end of the treatment period (day 255), a strong pharmacodynamic activity of LDHA-1 was evident. Monkey LDHA mRNA expression was reduced at all dose levels (91.4% to 86.1%, P ≤ 0.0001). The concentration of LDHA-1 loaded into the RISC complex was dose-dependent, with a significantly higher concentration at the dose level of 300 mg / kg (5.6 ng / g) compared with 30 mg / kg (2.1 ng / g) (P ≤ 0.05). The pharmacodynamic effect of LDHA-1, as indicated by a significant reduction in LDHA mRNA expression (92.0% to 86.2%), persisted for at least 8 weeks after treatment without recovery (Figure 6). The assessment of LDHA mRNA reduction on day 309 was deemed sufficient to assess pharmacodynamic recovery, and therefore the concentration of LDHA-1 loaded into the RISC complex on day 309 was not evaluated.

[0110] Quantification of LDHA-1 incorporated into RISC on study day 255 is reported in Figure 7. Graph of mean ± SD for each dose group. On day 255, the concentration of LDHA-1 incorporated into RISC in liver increased with increasing dose. LDHA-1 concentration was significantly increased at the 300 mg / kg dose compared to the 30 mg / kg dose (P < 0.05). The concentration of LDHA-1 incorporated into RISC complexes was similar between juvenile and young adult monkeys treated with 300 mg / kg.

[0111] At the end of the treatment period (day 255), potent pharmacodynamic activity of LDHA-1 was evident. LDHA mRNA expression in monkeys was reduced compared to controls at all dose levels. In contrast, the concentration of LDHA-1 incorporated into the RISC complex was dose-dependent, with significantly higher concentrations at the 300 mg / kg dose level compared to 30 mg / kg. The pharmacodynamic effect of LDHA-1, as measured by reduction in LDHA mRNA, persisted through day 309 (8 weeks post-treatment) without signs of recovery.

[0112] Materials and Methods for Example 2 Measurement of LDHA mRNA by RT-qPCR: Approximately 50 mg of each sample was homogenized in 0.75 mL of phenol / guanidine-based QIAzol Lysis Reagent (Qiagen, Valencia, CA) using a Tiussuelyser II (Qiagen, Valencia, CA). The homogenate was extracted with 1-bromo-3-chloropropane (Sigma-Aldrich, St. Louis, MO). RNA was extracted from 0.2 ml of the aqueous phase using MagMax Technology (ThermoFisher Scientific, Waltham, MA) according to the manufacturer's instructions. RNA was quantified using spectrophotometric measurements at 260 nm and 280 nm. LDHA mRNA levels were measured using RT-qPCR assays and reagents from ThermoFisher Scientific (Waltham, MA) and normalized to peptidyl-prolyl cis-trans isomerase B (PPIB) mRNA levels. The degree of LDHA mRNA reduction in the LDHA-1 treated group was calculated as the percentage of expression relative to the average expression level of the control group on the same day (normalized to PPIB mRNA levels), where LDHA mRNA expression in the control group was set to 100%.

[0113] Western blot for LDH: Tissue lysates were prepared using a TissueLyserII (Qiagen, Valencia, CA) with T-PER Tissue Protein Extraction Reagent and protease inhibitor cocktail (ThermoFisher Scientific, Waltham, MA). Total protein concentrations were measured by BCA Protein Assay (ThermoFisher Scientific, Waltham, MA) and equal protein concentrations were resolved by NuPAGE 4-12% Bis-Tris SDS-PAGE (ThermoFisher Scientific, Waltham, MA). Electrophoresed proteins were transferred to nitrocellulose membranes using the iBlot Dry Blotting System (ThermoFisher Scientific, Waltham, MA) and blocked with Odyssey Blocking Buffer (PBS) (Li-Cor Biosciences, Lincoln, NE). The membrane was then incubated with rabbit anti-LDHA antibody (Cell Signaling Technology, Danvers, MA) and mouse anti-glyceraldehyde 3-phosphate dehydrogenase antibody (Abeam, Cambridge, MA). Anti-rabbit IRDye 680 and anti-mouse IRDye 800 secondary antibodies (Li-Cor Biosciences, Lincoln, NE) were used for detection, and signal intensity was measured using an Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE). Integrated intensity (a measure of the magnitude of the signal and the area in which it is distributed) was measured for each band. Noise signals were corrected using the "mean or median background" method. The degree of reduction of LDH protein in the LDHA-1-treated group was calculated as the percentage of expression relative to the mean expression level of the control group on the same day (normalized to GAPDH protein level), where the LDHA protein expression of the control group was set to 100%.

[0114] LDH Activity Assay: Normalized protein concentrations of tissue extracts prepared for the LDH Western Blot in Section 6.2.2 were assessed for LDH activity using the Lactate Dehydrogenase Assay Kit (Abeam, Inc., Cambridge, MA) according to the manufacturer's instructions. Briefly, tissue extracts were diluted to a concentration of 50 μg / mL in T-PER Tissue Protein Extraction Reagent, and then duplicate 5-fold dilutions were made in 96-well plates by adding 10 μL of sample into 40 μL of LDH Assay Buffer. A series of standard solutions of nicotinamide adenine dinucleotide (NADH) and LDH positive controls were prepared according to the manufacturer's instructions. The plate was mixed, protected from light, and incubated at room temperature for 30 minutes. Absorbance was measured at 450 nanometers using a SpectraMax MS plate reader (Molecular Devices, Sunnyvale, CA) at the time of addition of the reaction mixture and 30 minutes later. The degree of reduction in LDH activity in the LDHA-1-treated group was calculated as the percentage of activity relative to the mean activity level of the control group on the same day, where the LDH activity of the control group was set at 100%.

[0115] Measurement of Ago2-associated oligonucleotides using SL-RT-qPCR: Immunoprecipitation of Ago2 protein from snap-frozen monkey liver samples was performed using Dynabeads Protein G. After isolation of Ago2 protein in the samples, the concentration of LDHA-1 associated with the Ago2 complex was quantified using a laboratory-based SL-RT-qPCR method. To control for sample-to-sample variation in immunoprecipitation, miR-16, an endogenous microRNA loaded into the Ago2 complex, was used as a normalization factor. The details of the procedure are shown in Appendix 10.2. To obtain information on the dose proportionality of RISC-loaded LDHA-1 at high doses where the reduction of LDHA mRNA was saturated, only samples from day 255 were analyzed. For the evaluation of pharmacodynamic recovery, the determination of the reduction of LDHA mRNA at day 309 seemed sufficient.

[0116] Data Analysis: Graphs were generated in GraphPad Prism and data were analyzed using GraphPad Prism. One-way analysis of variance (ANOVA) with Dunnett's multiple comparison test was performed to compare LDHA mRNA levels (normalized to PPIB mRNA levels), LDH protein levels (normalized to GAPDH protein levels), and LDH activity levels of LDHA-1 treated groups with PBS control groups at the same time points. One-way ANOVA with multiple comparisons was used to compare the concentration of LDHA-1 incorporated into RISC at α=0.05. ROUT outlier analysis was performed on individual animal data for miR-16 normalized LDHA- and one outlier was identified and removed from all analyses.

[0117] Example 3: Proof of concept for RNAi oligonucleotides targeting LDHA in the treatment of primary hyperoxaluria in human trials The objective of this study was to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics in humans of a single ascending dose study of the RNAi oligonucleotide LDHA-1 of Example 1. Secondary endpoints included evaluating the change from baseline in 24-hour urinary oxalate excretion, defined as the mean of two 24-hour collections during screening. The study was divided into two arms.

[0118] Group A was designed as a placebo-controlled, single-blind, phase 1 study in 25 healthy volunteers (NHVs) enrolled at a single center in the UK. Group B was designed as an open-label, multicenter study of the LDHA-1 oligonucleotide described in Example 1 in flexible dosing in 16 PH patients, including three cohorts of PH1 patients receiving 1.5, 3, and 6 mg / kg, and a fourth PH2-only cohort receiving flexible dosing. Patients in Group B were enrolled at five centers in the European Union (EU) and one center in the United States.

[0119] In the first B cohort (1.5 mg / kg), early results after a single dose of RNAi oligonucleotide showed that three of four adult patients had already reached near-normal urinary oxalate concentrations (≦60 mmol / 24 hr) between days 43 and 57. The fourth adult with a baseline urinary oxalate level of 2.28 mmol / 24 hr showed a substantial reduction, which was significant for that patient from day 71 onwards (urinary oxalate (UOX) <1.0 mmol / 24 hr). These results are summarized in Figures 8A and 8B.

[0120] In the second B cohort (3 mg / kg), two of four adult patients reached normal urinary oxalate concentrations (≦0.46 mmol / 24 hr) already on days 29-43. Both other patients showed substantial oxalate reductions. One patient in this group showed elevated plasma oxalate levels. Nevertheless, plasma oxalate was reduced to normal levels during treatment with LDHA-1. These results are summarized in Figures 8A and 8B.

[0121] One adult PH2 patient in the fourth Group B cohort also had a substantial (>35%) reduction in 24-hour urinary oxalate excretion on at least one sample collection day (day 57).

[0122] Additionally, only three mild to moderate injection site reactions were observed, all of which were transient (<72 hours) and resolved without intervention.

[0123] In summary, administration of LDHA-1 resulted in urinary oxalate levels in the normal range (defined as 24-hour excretion ≦0.46 mmol) or near-normal range (defined as 24-hour excretion ≦0.6 mmol) in the majority of the eight patients with primary hyperoxaluria type 1 and type 2 (PH1 and PH2) evaluated. All patients evaluated had substantial and clinically meaningful reductions in urinary oxalate (defined as a >30% reduction compared to baseline). Patients evaluated were those with data available through week 6 or day 43. All patients evaluated were adults and included seven PH1 patients and one PH2 patient.

[0124] These above data provide clinical proof of concept for the RNAi oligonucleotide LDHA-1 of Example 1 in humans and also show that LDHA-1 is safe and well tolerated. These results demonstrate efficacy and duration of action following administration of a single dose, consistent with and supporting dosing of subjects every three months.

[0125] The magnitude of this reduction in urinary oxalate, together with the duration of action, confirms the effectiveness of therapeutic targeting of lactate dehydrogenase, which is involved in the final stage of liver oxalate production.Based on this mechanism of action, LDHA-1 can be used to treat all types of primary hyperoxaluria.The substantial reduction in urinary oxalate establishes that this platform can effectively reduce target gene expression in humans, and the use of such RNAi therapeutics to treat multiple forms of primary hyperoxaluria.

[0126] Materials and Methods for Example 3 Molecular structure of LDHA-1 (see also Example 1, FIG. 1A and FIG. 3)

[0127] TIFF0007674420000015.tif116162

[0128] Drug Development The drug product was a sterile liquid drug product consisting of LDHA-1 as a solution in WFI (water for injection) for SC administration. The formulation used (LDHA-1 at a concentration of 170 mg / ml in WFI at pH 6.2-8.2) was selected based on pH, osmolality (200-300 mOsm / kg), viscosity, and compatibility with the route of administration.

[0129] Diagnosis and inclusion / exclusion criteria Selection criteria for Group A: 1. Subjects must understand all the nature and purposes of the study, including potential risks and side effects, and are willing and able to comply with all study procedures and limitations. 2. Male or female subjects aged 18-55 years (inclusive). 3. Subjects had to have a body mass index (BMI) between 19.0 and 32 kg / m2 (inclusive). 4. Non-smoker, abstained from smoking for at least 1 month, and willing to continue abstaining from smoking during the EOS. Subjects must also be abstaining from nicotine-containing products (e.g., nicotine patches). 5. Subjects had to be otherwise healthy. Healthy status was defined by the absence of evidence of clinically significant, active, or chronic disease in the opinion of the PI after a complete physical examination including detailed medical and surgical history, vital signs, 12-lead ECG, hematology, blood tests, serology, and urinalysis. 6. Subjects had to have hematology and clinical chemistry and urinalysis within normal ranges unless abnormalities were classified as Not Clinically Significant (NCS) by the Investigator or qualified designee. Liver panel (ALT and AST) had to be normal. Liver panel results could be retested once. 7. Women and men of childbearing potential and the female partners of male subjects had to be willing to use a highly effective and approved method of contraception from the date of informed consent through 12 weeks after the last dose of IMP. A highly effective method of contraception was defined as meeting at least one of the following: Strict abstinence, if this was consistent with the patient's preferred and usual lifestyle. [Periodic abstinence (e.g., calendar, ovulation, symptom-temperature, post-embryo) and withdrawal were not acceptable methods of contraception]. b. Surgical contraception (having undergone one of the following surgical procedures: hysterectomy, bilateral tubal ligation, bilateral oophorectomy, or bilateral salpingectomy) and for at least 6 weeks after contraception. c. Combined hormonal oral contraceptives (estrogen and progesterone), implants, or injectable contraceptives and barrier methods in stable doses for at least 1 month prior to the screening visit. Combined hormonal contraception was considered a highly effective method only if it was associated with ovulation suppression. Progesterone-only hormonal contraceptives were also considered to be a highly effective method if it was associated with ovulation suppression. d. Intrauterine devices and condoms. Hormonal intrauterine devices (IUDs) inserted at least 1 month prior to the screening visit. e. Dual barrier methods [e.g., condom and occlusive cap (diaphragm or cervical cap / vaginal vault cap) with spermicidal foam / gel / film / cream / suppository]. Note, female and male condoms, or two male condoms should not be used together as friction between the two may cause failure of either product. f. Partner had a vasectomy (at least 6 months post-surgery) prior to the screening visit. 8. Postmenopausal women: defined as amenorrhea in the 12 months prior to screening and serum FSH > 26 IU / L at the screening visit. 9. Females: Negative pregnancy test at Screening and Day 0 visit.

[0130] Group B - PH patient selection criteria Patients with PH had to meet all of the following criteria to be eligible to participate in the study: 1. The patient and / or, if the patient is a minor (defined as a patient < 18 years of age or under the age of majority according to local regulations), the patient's parent or guardian: a. They understood all the nature and objectives of the study, including its potential risks and side effects. b. You must be willing and able to comply with all study procedures, including the collection of a 24-hour urine sample. c) Had to provide informed consent. Adolescents (aged 12-18 years or older than 12 years but under the age of majority according to local regulations) had to be able to provide written assent to participate. For children under 12 years of age, assent was based on local regulations. 2. Male or female, at least 6 years of age at the time of obtaining informed consent. 3. Patients had to weigh a minimum of 25 kg. 4. A confirmed diagnosis of PH1 or PH2 confirmed by genotyping (historically available genotype information is acceptable for study eligibility). 5. 24-hour oxalate excretion of ≥ 0.7 mmol / 1.73 m2 body surface area (BSA) in patients aged 18 years or older or ≥ 0.7 mmol / 1.73 m2 BSA in patients younger than 18 years during at least one of two assessments performed during the screening period, with less than 30% variability between both oxalate measurements. 6. eGFR ≥ 30 mL / min when calculated using the Modification of Diet in Renal Disease (MDRD) formula for adults (age ≥ 18 years) or the Schwartz formula for patients 6 to < 18 years of age and normalized to 1.73 m2 BSA. 7. Male and female patients of childbearing potential, and the female partners of male patients of childbearing potential, were willing to use a highly effective and approved method of contraception from the date of informed consent until 12 weeks after the last dose of IMP. A highly effective method of contraception was defined as meeting at least one of the following: Strict abstinence, if this was consistent with the patient's preferred and usual lifestyle. [Periodic abstinence (e.g., calendar, ovulation, symptom-temperature, post-embryo) and withdrawal were not acceptable methods of contraception]. b. Surgical contraception (having undergone one of the following surgical procedures: hysterectomy, bilateral tubal ligation, bilateral oophorectomy, or bilateral salpingectomy) and for at least 6 weeks after contraception. c. Combined hormonal oral contraceptives (estrogen and progesterone), implants, or injectable contraceptives and barrier methods in stable doses for at least 1 month prior to the screening visit. Combined hormonal contraception was considered a highly effective method only if it was associated with ovulation suppression. Progesterone-only hormonal contraception was also considered a highly effective method if it was associated with ovulation suppression. d. Intrauterine devices and condoms. Hormonal intrauterine devices (IUDs) were inserted at least 1 month prior to the screening visit. e. Dual barrier methods [e.g., condom and occlusive cap (diaphragm or cervical cap / vaginal vault cap) with spermicidal foam / gel / film / cream / suppository]. Note, female and male condoms, or two male condoms should not be used together as friction between the two may cause failure of either product. f. Partner had a vasectomy (at least 6 months post-surgery) prior to the screening visit. 8. Postmenopausal women: defined as amenorrhea for 12 months prior to screening and serum FSH > 26 IU / L at screening. 9. For WOCP, negative pregnancy test at screening and day 0. 10. PH1 patients receiving a stable dose of pyridoxine for at least 4 weeks prior to study entry had to be willing to maintain the same stable dose throughout the study. If a PH2 patient was receiving pyridoxine, they had to discontinue this at least 4 weeks prior to study entry.

[0131] Group A-NHV exclusion criteria Healthy volunteers who met any of the following criteria were excluded from the study: 1. The presence of any medical condition or comorbidity that may interfere with study compliance or interpretation of data or affect subject safety, including but not limited to: A severe intercurrent illness b. Routine vaccinations within 30 days prior to administration and up until the EOS visit c. Active liver disease / injury or elevated transaminases of known cause (e.g., alcoholic liver disease, nonalcoholic fatty liver disease / steatohepatitis (NAFLD / NASH)) d. Physician concerns about excessive alcohol consumption e. Regular or chronic use of paracetamol in excess of 3 grams per day. 2. History of kidney stones 3. Females who were pregnant, breastfeeding, or attempting to become pregnant during the study or within 90 days after the last dose of IMP. 4.Males with a female partner who was attempting to conceive during the study or within 90 days after the last dose of IMP. 5. Use of any investigational drug within 90 days prior to first dose of study medication. If the subject had previously participated in an siRNA or antibody study, a washout period of at least 6 months was required before the first dose was administered in this study. 6. Strenuous activity, sun exposure, and contact sports within 48 hours (2 days) prior to dose administration until the EOS visit or Day 29. 7. History of donating blood exceeding 450mL at the Clinical Research Center within 90 days prior to administration or scheduled to donate blood within 30 days after receiving IMP. 8. Donate plasma or platelets within 7 days of dosing and throughout the entire study. 9. History of alcohol consumption >21 units per week for men and >14 units per week for women, as determined by the investigator. Alcohol consumption was prohibited from 48 hours prior to admission to the clinical site until the end of the study. 10. Positive screening test for hepatitis B surface antigen (HBsAg), anti-hepatitis C virus (HCV) antibodies, or anti-human immunodeficiency virus (HIV) 1 and 2 antibodies. Historical data were available if subjects had been tested within the past 3 months. 11. History of one or more of the following responses to oligonucleotide-based therapy: A. Severe thrombocytopenia b. Hepatotoxicity c. Severe cold-like symptoms leading to discontinuation of therapy d. Localized skin reactions from injection (grade 3 or greater) leading to discontinuation of therapy e. Blood coagulation disorder / clinically significant prolongation of clotting time

[0132] Other restrictions: All routine nontopical and nonroutine medications (over-the-counter medications, dietary supplements, and chronic administration of botanical medicines such as St. John's wort extracts) had to be stopped from at least 14 days prior to admission to the Clinical Research Center until (and including) the EOS visit. An exception was made for paracetamol (acetaminophen), which was permitted until admission to the Clinical Research Center. However, NSAIDs such as ibuprofen, aspirin, and naproxen had to be stopped at least 14 days prior to admission to the Clinical Research Center. Subjects were not to engage in strenuous exercise during their participation in the study (i.e., from screening to the EOS visit). During the study, subjects were required to avoid foods high in oxalates and consume adequate amounts of protein and calcium not exceeding the national dietary guidelines. Protein shakes had to be avoided.

[0133] Group B-PH patient exclusion criteria Patients with PH who met any of the following criteria were excluded from the study: 1. Previous kidney and / or liver transplant. 2. You are undergoing dialysis at the time. 3. Confirmed evidence of the clinical picture of systemic oxalosis. 4. Participated in any clinical trial within 4 months prior to enrollment where they received an investigational medicinal product. IMPs with the potential to reduce Uox and / or plasma oxalate had to return these concentrations to historical baseline levels. If patients had participated in a previous cohort of this study, a minimum of 8 weeks had to pass before re-enrollment and urinary oxalate excretion had to return to ≥80% of baseline. 5. Presence of any medical condition or comorbidity that may interfere with study compliance or interpretation of data or affect patient safety, including but not limited to: A severe intercurrent illness b. Routine vaccinations within 30 days prior to administration and up until the EOS visit c. Active liver disease / injury or elevated transaminases of known cause (e.g., alcoholic liver disease, nonalcoholic fatty liver disease / steatohepatitis (NAFLD / NASH)) d. Physician concerns about excessive alcohol consumption e. Regular or chronic use of acetaminophen in excess of 3 grams per day. 6. History of alcohol consumption >21 units per week for men and >14 units per week for women, as determined by the investigator. 7.Females who are pregnant, nursing, or attempting to become pregnant during the study or within 90 days after the last dose of IMP. 8. Liver function test (LFT) abnormalities: ALT and / or AST >1.5x the ULN for age and sex. 9. History of one or more of the following responses to oligonucleotide-based therapy: A. Severe thrombocytopenia b. Hepatotoxicity c. Severe cold-like symptoms leading to discontinuation of therapy d. Localized skin reactions from injection (grade 3 or greater) leading to discontinuation of therapy e. Blood coagulation disorder / clinically significant prolongation of clotting time

[0134] Other restrictions: Patients also had to avoid vitamin C for 24 hours before and during the 24-hour urine specimen collection and for 24 hours before the PD blood draw. Patients were not to engage in strenuous exercise during their study participation (i.e., from screening to the EOS visit). During the study, patients were required to avoid foods high in oxalate and consume adequate amounts of protein and calcium not exceeding national dietary guidelines. Protein shakes were to be avoided.

[0135] Measurement of urinary oxalate (UOX) levels A 24-hour urine sample was obtained from the patient and an aliquot was acidified to increase the solubility of oxalate. Generally, oxalate is insoluble and forms crystals that can be solubilized under acidic conditions. HPLC analysis was then performed on the solubilized UOX to determine its levels.

[0136] The disclosure illustratively described herein may be suitably implemented in the absence of one or more elements, one or more limitations not specifically disclosed herein. Thus, for example, in each instance herein, the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms. The terms and expressions used are used as terms of description, not of limitation, and are not intended to exclude any equivalents of the features shown and described or portions thereof, recognizing that various modifications are possible within the scope of the invention claimed herein. Thus, although the invention has been specifically disclosed by preferred embodiments, optional features, it should be understood that modifications and variations of the concepts disclosed herein may be reclassified by those skilled in the art, and such modifications and variations are considered to be within the scope of the invention as defined by this specification and the appended claims.

[0137] In addition, where features or aspects of the invention are described in terms of a Markush group or other grouping of alternatives, those skilled in the art will recognize that the invention is thereby also described in terms of individual elements or subgroups of elements of the Markush group or other group.

[0138] In the context of describing the present invention (particularly with respect to the claims below), use of the terms "a" and "an" and "the" and similar referents should be construed to encompass both the singular and the plural, unless otherwise noted herein or the context clearly dictates otherwise. The terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (i.e., meaning "including, but not limited to"), unless otherwise stated. Recitation of ranges of values ​​herein is merely intended to be used as a shorthand method of individually indicating each separate value falling within the range, unless otherwise noted herein, and each separate value is incorporated herein as if it were individually recited herein. All methods described herein can be performed in any suitable order, unless otherwise noted herein or the context clearly dictates otherwise. Any or all examples or exemplary language (e.g., "etc.") presented herein are intended merely to better clarify the invention and do not pose a limitation on the scope of the invention unless otherwise stated. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0139] Embodiments of the invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those skilled in the art upon reading the foregoing description.

[0140] The inventors anticipate that those skilled in the art will employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, the present invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the present invention unless otherwise indicated herein or the context clearly indicates otherwise. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. The structure: An oligonucleotide for reducing expression of lactate dehydrogenase A (LDHA), comprising: each nucleotide of the -GAAA- sequence of the sense strand is conjugated to a monovalent GalNac moiety via an acetal linker; positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand, and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are all modified with 2'-O-methyl; positions 3, 5, 8-11, 13, 15, and 17 of the sense strand, and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are all modified with 2'-fluoro; the oligonucleotide has phosphorothioate bonds between positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand, respectively; and The antisense strand contains a 4'-oxymethylphosphonate at the 5'-terminal nucleotide. An oligonucleotide comprising:

2. A composition comprising the oligonucleotide of claim 1 and an excipient.

3. Na + The composition of claim 2 further comprising a counterion.

4. 3. The composition of claim 2 for the treatment of a subject suffering from or at risk of suffering from primary hyperoxaluria.

5. The composition of claim 4 which is administered subcutaneously.

6. 5. The composition of claim 4, wherein the primary hyperoxaluria is selected from PH1, PH2, PH3, and idiopathic hyperoxaluria.

7. The composition of claim 2 for reducing hepatic oxalate production in a subject.

Images