Reactivation of mutant p53 for cancer therapy by targeting prolidase (PEPD)

Abstract

A method for preventing or treating cancer is provided. The method is directed to cancers characterized by the expression of mutant p53. The mutant p53 may be a loss-of-function p53 mutant, a dominant-negative p53 mutant, or a gain-of-function p53 mutant. The method comprises delivering to cancer cells an agent capable of inhibiting the expression of prolidase (PEPD) or interfering with the association of mutant p53 with PEPD.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The claims of this application claim priority to U.S. Provisional Patent Application No. 62 / 893,367, filed August 29, 2019, the entire disclosure of which is incorporated herein by reference.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant Nos. CA215093 and CA164574 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0003] p53 tumor suppressor plays an important role in suppressing the development and progression of cancer, but it is commonly mutated in all types of human cancer. There are many p53 mutants, most of which are single amino acid changes in the DNA binding domain. Mutant p53 loses its tumor suppressor activity or acquires oncogenic activity. There is a continuing unmet need for compositions and methods for treating cancers expressing such p53 mutants. The present disclosure relates to this need. Summary of the Invention

[0004] The present disclosure provides compositions and methods for preventing and / or treating cancer, which generally involve targeting peptidase D (PEPD), also known as prolidase, in cancer cells that express mutant forms of p53 that promote the proliferation of cancer cells.

[0005] According to the disclosure provided at present, since the p53 domain (PRD) involved in PEPD binding is intact in almost all cancer-associated p53 mutants, analysis has been performed on whether PEPD binds to and regulates p53 mutants. We recently found that PEPD binds to and inhibits wild-type (normal) p53, and disrupting the association by targeting PEPD frees p53 to activate and cause cell death. However, a major concern has been whether targeting PEPD could free p53 mutants and unleash their dominant-negative or oncogenic effects, i.e., promoting the growth and proliferation of cancer cells, when PEPD is bound to p53 mutants.

[0006] This disclosure includes the evaluation of common cancer-associated p53 mutants, including R175H, R248Q, R273H, R280K, and E285A. These mutants are widely known to lose tumor suppressor function and gain dominant-negative or oncogenic function. However, unexpectedly, rather than freeing p53 mutants to promote cell survival and proliferation, PEPD knockdown (KD) by siRNA causes death of cancer cells expressing p53 mutants and induces molecular changes indicative of WT-p53 activity. This phenomenon is not limited to a specific mutant, with certain exceptions described below. Cell death resulting from loss of PEPD is clearly caused by the p53 mutant, as knocking out this mutant renders the cells insensitive to PEPD inhibition. These findings challenge the current understanding of p53 mutant biology, reveal important regulatory mechanisms of p53 mutants, and thus provide novel strategies to reactivate p53 mutants that may be applicable to most, if not all, p53 mutants that may or may not have oncogenic effects. Thus, in embodiments, the present disclosure includes inhibiting expression of PEPD in cancer cells harboring p53 mutants. The present disclosure is exemplified in non-limiting embodiments using RNA inhibition and PEPD knockout. Results include demonstration of in vivo effects of PEPD knockdown on growth and expression of key proteins in syngeneic tumors (with or without expression of p53 mutants) in relevant animal models. Thus, in embodiments, the present disclosure includes introduction into cancer cells containing p53 mutants, which may be loss-of-function p53 mutants, dominant-negative p53 mutants, and gain-of-function p53 mutants. [Brief description of the drawings]

[0007] [Figure 1]PEPD knockdown reactivates p53 mutants. (A) Cells were treated with siRNA (10 nM) for 48 h, and total cell lysates were prepared and analyzed by Western blotting (WB). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a loading control. (B) Cells were treated with siRNA (10 nM) for 72 h and then analyzed by trypan blue viability assay (mean ± SD, n = 3). *p < (0.0001) [Diagram 2] PEPD KD by siRNA can induce the transcription-dependent tumor suppressor activity of p53E285A mutant. (A) WB analysis of p53 relocation in cells after 72 h of siRNA (10 nM) treatment. Lamin A, α-tubulin and voltage-dependent anion channel (VDAC) were measured to exclude cross-contamination of subcellular fractions or as loading controls. (B) WB analysis of p53 binding to cyclophilin D (CYPD) in mitochondria was performed after 72 h of cell treatment with siRNA (10 nM). (C) Flow cytometry analysis of mitochondrial membrane potential (MMP) after 72 h of cell treatment with siRNA (10 nM). Error bars are mean ± SD and calculated from triplicate experiments. [Diagram 3] PEPD KD induces phosphorylation and transcriptional activity of p53 mutants in BT-474 cells. (A) Reporter activity in cells after 24 h of plasmid transfection and subsequent treatment with siRNA (10 nM) for 48 h. PG13-luc is a p53WT reporter that contains multiple copies of the p53WT binding site, whereas MG15-luc contains multiple copies of the mutant p53 binding site and is unresponsive to p53WT. To control for transfection efficiency, cells were transfected with either PG13-luc or MG15-luc together with pRL-TK. (B and C) Phostag-WB and WB analysis of p53E285A phosphorylation in cells treated with siRNA (10 nM) for 72 h. (D) WB and phostag-WB analysis of nuclear fractions and cytosol of cells treated with siRNA (10 nM) for 72 h. Lamin A and GAPDH were measured as loading controls. [Figure 4] PEPD binding to p53 mutants in BT-474 cells and effect of PEPD KD. (A-D) Immunoprecipitation (IP)-WB analysis of cellular p53E285A bound to PEPD and the percentage of cellular PEPD bound to p53E285A. IB bands were quantified by ImageJ. Error bars are mean ± SD (n=3). (E) WB analysis of PEPD and p53E285A, and IP-WB analysis of PEPD-free p53E285A and phosphor-p53E285A in nuclear fractions of cells treated with siRNA for 72 h. Lamin A was measured as a loading control. [Diagram 5] PEPD KO by CRISPR-Cas9 kills human cancer cells in a p53-dependent manner. Cells were treated with control or PEPD-targeted CRISPR-Cas9 for 72 hours, and representative micrographs are shown (bar: 100 μm). MDA-MB-231(p53R280K) is a human breast cancer cell line. MDA-MB-231(p53- / -) was generated from MDA-MB-231(p53R280K) by CRISPR-Cas9 gene editing. [Figure 6] PEPD binding to p53WT and mutants. (A) Direct binding of PEPD to wild-type p53 (p53WT) and mutants measured by enzyme-linked immunosorbent assay (ELISA). (B) WB analysis of whole cell lysates of untreated cells. GAPDH is a loading control. (C-D) Total PEPD or p53 in the samples was pulled down by IP. Isotype-specific IgG was used as a control. The percentage of p53 and PEPD not bound to each other was calculated by measuring p53 and PEPD in the supernatant by ELISA. The precipitate and input were analyzed by WB (Figures 14A, 14B), and the percentage of p53 and PEPD bound to each other was calculated by comparing their band intensities with those of the input (measured with ImageJ). (E) PEPD and p53 levels in whole cell lysates measured by ELISA. Mean ± SD (n=3) in (A) and (C-E). See also Figures 13 and 14. [Figure 7]Effect of PEPD KD on cell viability and levels of key proteins, and the opposing effect of PEPDG278D. (A) Viability of cells treated with siRNA (10 nM) for 72 h as measured by trypan blue assay. (B) WB analysis of total cell lysates. GAPDH is a loading control. Cells were treated with siRNA (10 nM) for 48 h. (C) Total PEPD in total cell lysates was pulled down by IP and the supernatants were analyzed by WB. GAPDH is a loading control. p53 is shown in a double exposure for clear display of all bands. Cells were treated with siRNA (10 nM) for 48 h. Lysates of untreated MDA-MB-231 cells were used as a positive control in WB. (DE) Cell viability measured by trypan blue assay and WB analysis of total cell lysates. GAPDH is a loading control. Cells were transfected with equal amounts of plasmids and 24 hours later treated with vehicle or PEPD siRNA (10 nM) for 72 hours. Mean ± SD (n=3) in (A) and (D). ***P<0.001; ****P<0.0001; ns=not significant. See also Figure 15. [Figure 8] Effect of PEPD KD on p53 mutants in isogenic cells. (A) WB analysis of total cell lysates. GAPDH is a loading control. MDA-MB-231(p53KO) cells were transfected with equal amounts of plasmid (empty vector or p53 mutants) for 48 h. (B-C) Cell viability measured by trypan blue assay and WB analysis of total cell lysates. GAPDH is a loading control. MDA-MB-231(p53KO) cells were transfected with p53 mutants (equal amounts of plasmid for each mutant) and 24 h later treated with siRNA (10 nM) for 96 h. Mean ± SD (n=3) in (B). ****p<0.0001 [Figure 9]Effect of PEPD KD on transcription-independent tumor suppressor activity of p53 mutants. (A) WB analysis of subcellular fractions (using voltage-dependent anion channel (VDAC), GAPDH and lamin B as loading controls). Cells were treated with iRNA (10 nM) for 48 h. (B) Mitochondrial membrane potential loss measured by JC-1 fluorescence. Cells were treated with siRNA (10 nM) for 48 h. (C) Cells were treated with siRNA (10 nM) for 48 h, from which mitochondria were isolated and subjected to IP. The immunoprecipitates were analyzed by WB. (D) Apoptosis measured by TUNEL assay. Cells were treated with siRNA (10 nM) for 72 h (see FIG. 15D). Mean ± SD (n=3) in (B) and (D). See also FIG. 15 and FIG. 16. [Figure 10] Effect of PEPD KD on phosphorylation and transcriptional activity of p53 mutants. (A) WB analysis of whole cell lysates. Cells were treated with siRNA (10 nM) for 24 h. (B) Phostag WB analysis of subcellular fractions. Cells were treated with siRNA (10 nM) for 48 h. (C) Luciferase activity measured in whole cell lysates. Cells were transfected with equal amounts of PG13-Luc or MG15-Luc together with pRL-TK and 24 h later treated with siRNA (10 nM) for 48 h. (D) Binding of p53 mutants to p53WT binding sites in the promoters of CDKN1A (encoding p21) and BBC3 (encoding PUMA) as measured by ChIP-qPCR assay. Cells were treated with siRNA (10 nM) for 48 h. Mean ± SD (n=3) in (C) and (D). See also Figure 17. [Figure 11]Effect of PEPD KD on refolding of p53 mutants and the role of K373 acetylation. (A) WB analysis of whole cell lysates. GAPDH is a loading control. Cells were treated with siRNA (10 nM) for 48 h. (B) WB analysis of subcellular fractions. SKBR3 cells were treated with siRNA (10 nM) for 48 h. (CD) Cell viability measured by trypan blue assay and WB analysis of whole cell lysates. GAPDH is a loading control. Cells were treated with siRNA (10 nM) with or without C646 (8 μM) for 72 h. C646 is an inhibitor of p300 / CBP, which acetylates p53. (EF) Cell viability measured by trypan blue assay and WB analysis of whole cell lysates. GAPDH is a loading control. p53R175H / K373R was transfected into MDA-MB-231 (p53KO) cells, and 24 hours later, cells were treated with siRNA (10 nM) for 96 hours. (GK) Total cell lysates were subjected to IP of p53 using Pab1620, Pab240, or isotype-matched IgG, and WB analysis of immunoprecipitates was performed. Pab1620 and Pab240 detect the "wild-type" and "denatured" conformations of p53, respectively. (I) Relative p53R175H levels were measured with ImageJ. Cells were left untreated (G,H) or treated with siRNA (10 nM) for 48 hours with or without 8 μM C656 (I,J). p53R175H / L373R was transfected into MDA-MD-231 (p53KO) cells, and 24 hours later, cells were treated with siRNA (10 nM) for 48 hours (K). WB analysis of subcellular fractions. p53R175H / K373R was transfected into MDA-MB-231 (p53KO) cells, and 24 hours later, cells were treated with siRNA (10 nM) for 48 hours. Lamin B, α-tubulin, and VDAC were used as loading controls to exclude cross-contamination (B, L). CAL-51 whole cell lysates were used as p53WT input for WB. Mean ± SD (n=3) in (B, E). *p<(0.05), ****p<0.0001. See also Figure 18. [Figure 12]Effect of PEPD KD on proliferation and expression of key proteins in syngeneic tumors with or without expression of p53 mutants. (AF) Mice bearing orthotopic mammary tumors generated from MDA-MB-231-p53R280K, MDA-MB-231-p53KO, or MDA-MB-231-p53R175H cells were treated by intratumoral injection of siRNA (10 pmol) every 3 days. Arrows indicate start of treatment. Experiments were terminated 24 or 48 h after the last dose. Mean ± SEM (n=13-16). ****p<0.0001. (G) WB analysis of tumor tissue homogenates. GAPDH is a loading control. Two tumors were analyzed per group. (H) Illustrative illustration of reactivation of p53 mutants by PEPD KD. A, acetylation; p, phosphorylation; U, mono-ubiquitination; p53m, p53 mutant. See also Figure 19. [Figure 13] Characterization of PEPD, p53WT, p53 mutants, and cell lines (related to Figure 6). (A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining of affinity purified recombinant PEPD, p53WT, and p53 mutants. (B) Sanger sequencing of p53 in cell lines focusing on changes at amino acids #175, #248, #273, and #280. (C) Measurement of PEPD mRNA levels in cells by RT-PCR (GAPDH mRNA was used as a control). [Figure 14]Binding of PEPD to p53WT and its mutants in cells in relation to Figure 6. (A) Total PEPD in samples (whole cell lysates, cytosolic or nuclear extracts) was pulled down by IP using PEPD antibody in excess. Precipitates and inputs were analyzed by WB. Inputs for p53WB were 10%, 15% or 20% of each sample used in PEPD IP: 10% input for SKBR3 and MDA-MB-231 whole cell lysates, 15% input for SKBR3 and MDA-MB-231 cytosolic and nuclear extracts, and 20% input for CAL-51 (whole cell lysates, cytosolic and nuclear extracts). WB analysis of selected supernatants was also performed to confirm that all PEPD was pulled down. Triplicate experiments were performed to calculate the percent binding shown in Figure 6C. (B) Total p53 in samples was pulled down by IP using p53 antibody in excess. Precipitates and inputs were analyzed by WB. WB analysis of selected supernatants was also performed to confirm that all p53 was pulled down. The input for PEPD WB was 15% of each sample used in the p53IP. WB analysis of selected supernatants was also performed to confirm that all p53 was pulled down. Triplicate experiments were performed to calculate the percent binding shown in Figure 6D. (C) WB analysis of nuclear extracts and cytosol for lamin B and α-tubulin to exclude cross contamination. [Figure 15]Effect of PEPD KD on levels of p53 and other proteins, cell cycle progression and apoptosis (related to Figures 7 and 9). (A) WB analysis of whole cell lysates for PEPD and other proteins, using GAPDH as a loading control. Cells were treated with siRNA (10 nM) for 48 h. (B) Measurement of cell cycle progression by flow cytometry. Cells were treated with siRNA (10 nM) for 48 h. Mean ± SD (n = 3). **p < (0.01); ****P < 0.0001. (C) WB analysis of whole cell lysates for cleaved caspase 3, using GAPDH as a loading control. Cells were treated with siRNA (10 nM) for 48 h. (D) TUNEL fluorescent staining with Fluor-594 and nuclear fluorescent staining with 4',6-diamidino-2-phenylindole (DAPI). Cells were treated with siRNA (10 nM) for 72 h before staining. Scale bar: 100 μm. [Figure 16] Role of MDM2 in mitochondrial enrichment of p53R175H in SKBR3 cells (related to Figure 9). (A) WB analysis of total cell lysates, cell lysates minus mitochondria, and mitochondria. GAPDH, VDAC, and α-tubulin were used as loading controls to exclude cross contamination. Cells were treated with scrambled siRNA or MDM2 siRNA (10 nM) for 24 h and then with scrambled siRNA or PEPD siRNA (10 nM) for 48 h. (B) WB analysis of (cell lysates-mitochondria). GAPDH is a loading control. The same samples were also subjected to p53R175HIP and immunoprecipitates were analyzed by WB. Cells were treated with siRNA (10 nM) for 48 h. (C) Mitochondria samples and nuclear extracts were subjected to IP with ubiquitin (Ub) antibody and immunoprecipitates were analyzed by WB. Cells were treated with siRNA (10 nM) for 48 h, ubiquitin aldehyde (100 μM) was added (last 4 h), and mitochondria were isolated. [Figure 17]Effect of PEPD KD on phosphorylation of p53WT and p53 mutants (related to Figure 10). (A) WB analysis of total cell lysates. Cells were treated with siRNA (10 nM) for 48 h. (B) Cells were treated with siRNA (10 nM) for 48 h and nuclear extracts were prepared. Extracts were subjected to PEPD IP. Both immunoprecipitates and supernatants were analyzed by WB and phostag WB. The amount of p53 in samples from cells treated with scrambled siRNA and PEPD siRNA was equalized for phostag WB. [Figure 18]Effect of PEPD KD on p53 mutant refolding and role of K373 acetylation in p53 mutant refolding and reactivation (related to FIG. 11). (A) WB analysis of subcellular fractions (nuclear extracts, cytosol and mitochondria). MDA-MB-231 cells were treated with siRNA (10 nM) for 48 h. (B) Nuclear extracts of SKBR3 and MDA-MB231 cells were subjected to IP with excess PEPD antibody to pull down total PEPD followed by WB analysis of both precipitates and supernatants. Cells were treated with siRNA (10 nM) for 48 h. (CF) Cell viability measured by trypan blue assay and WB analysis of total cell lysates. GAPDH is a loading control. MDA-MB-231, MDA-MB-468 and HCC70 cells were treated with siRNA (10 nM) for 72 h with or without C646 (8 μM) (C, D). MDA-MB-231 (p53KO) cells were transfected with p53 mutants including p53R248Q / K373R, p53R273H / K373R and p53R280K / K373R and treated with siRNA (10 nM) for 96 h after 24 h (E, F). (G) Recombinant p53WT and p53R175H were subjected to IP with Pab1620 or Pab240, followed by WB analysis of the precipitates for p53WT and p53R175H. (HK) Whole cell lysates were subjected to IP with Pab1620 or Pab240, followed by WB analysis of the precipitates (HK) and supernatants (H). MDA-MB-231, MDA-MB-468, and HCC70 cells were either untreated (H) or treated with siRNA (10 nM) for 48 h with or without 8 mM C646 (I, J). MDA-MB-231 (p53KO) cells were transfected with p53 mutants including p53R248Q / K373R, p53R273H / K373R, and p53R280K / K373R, and 24 h later treated with siRNA (10 nM) for 48 h (K). Untreated whole cell lysates were used as a control for WB in (H). (L) WB analysis of subcellular fractions.p53R280K / K373R was transfected into MDA-MB-231 (p53KO) cells, and 24 hours later, cells were treated with siRNA (10 nM) for 48 hours. Lamin B, α-tubulin and VDAC were used as loading controls to exclude cross-contamination (A, L). Mean ± SD (n=3) in (B, E). *p<0.05, ****p<0.0001. [Figure 19] Characterization of MDA-MB-231 cells stably expressing p53R175H (related to Figure 12). (A) WB analysis of total cell lysates. MDA-MB-231 (p53KO) cells were transfected with p53R175H and stable clones expressing this mutant were selected by puromycin. SKBR3 cells were used for comparison in WB. GAPDH is a loading control. (B) Cell viability measured by trypan blue assay. Cells were treated with siRNA (10 nM) for 72 h. Mean ± SD (n = 3), P < 0.0001. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] Unless otherwise defined herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0009] Every numerical range given herein includes its upper and lower limits, and every narrower numerical range subsumed within that range, as if such narrower numerical ranges were all expressly written herein.

[0010] The present disclosure includes all polynucleotides disclosed herein, their complementary sequences, and reverse complementary sequences. To reference a polynucleotide or amino acid sequence via a database entry, the polynucleotide and amino acid sequence presented in the database entry is incorporated herein as it exists on the effective filing date of this application or patent.

[0011] In embodiments, the disclosure includes inhibiting expression of PEPD in cancer cells that express mutant forms of p53 that have lost tumor suppressor function and / or gained dominant negative function and / or gained oncogenic function.

[0012] Inhibition of PEPD expression in cancer cells has been described in Yang et al. Nature Communications, Volume 8, Article number: 2052 (2017). Briefly, Yang et al. described that PEPD binds to and inhibits more than half of nuclear and cytoplasmic p53, independent of its enzymatic activity. The paper also showed that PEPD binds to the proline-rich domain (PRD) in p53 and inhibits nuclear p53 phosphorylation and MDM2-mediated mitochondrial translocation of nuclear and cytoplasmic p53. The paper also showed that removing PEPD caused cell death and tumor regression due to p53 activation. Yang et al. used cells expressing wild-type p53, with the exception of one mutant. However, Yang et al. concluded in their paper that the p53 mutant (p53 with the F113C change found in UM-UC-3 cells) remained functional and therefore it is believed that its wild-type function is retained despite this mutation. Thus, the Yang et al. article did not describe or suggest the consequences of uncoupling PEPD from p53 mutants known to have oncogenic effects.

[0013] In contrast, the present disclosure relates to inhibiting the interaction between PEPD and mutant forms of p53, which surprisingly results in cancer cell death. The method of the present disclosure has a counterintuitive result, which is that the prediction is that freeing mutant p53, which has lost its tumor suppressor function and acquired oncogenic function, from the complex with PEPD should release its oncogenic function and promote tumor growth. However, the data presented in the present disclosure unexpectedly demonstrates the opposite effect, i.e., disrupting the interaction between PEPD and mutant p53 is predicted to induce cancer cell death.

[0014] Thus, in embodiments, the present disclosure includes inhibiting the interaction of PEPD with p53 in cancer cells that contain oncogenic mutant p53 proteins other than those that preserve wild-type tumor suppressor function. Thus, the present disclosure provides, in certain non-limiting embodiments, that the cancer cells do not contain mutant p53 in which the only mutation is F113C.

[0015] In some embodiments, the formation of a complex (eg, a heterodimer) comprising mutant p53 and wild-type p53 inhibits the function of wild-type p53 in the absence of a PEPD targeting agent described herein.

[0016] In embodiments, the cancer cells contain mutant p53 that forms a complex with PEPD in the absence of a PEPD targeting agent described herein.

[0017] In some embodiments, inhibiting the formation of a complex between PEPD and mutant p53 converts mutant p53 to a p53 that mimics the function of wild-type p53, thereby killing cancer cells (rather than the other expected outcome of promoting tumor growth). Thus, the present disclosure includes reactivating mutant p53 for cancer treatment by targeting PEPD. In some embodiments, after administration of an RNAi agent described herein, PEPD that was originally present in a complex with mutant p53 is naturally degraded by normal cellular proteolytic methods, and the presence of the RNAi agent does not create a replacement PEPD, thus allowing mutant p53 to be freed from PEPD and acquire a wild-type conformation induced by certain post-translational modifications (acetylation, mono-ubiquitination, and phosphorylation of lysine 373 in the transactivation domain), thereby participating in the death of cancer cells. In some embodiments, the present disclosure provides for the use of agents (such as small molecules or other compounds that have this function) that disrupt the association of mutant p53 with PEPD.

[0018] In embodiments, the mutated p53 in cancer cells targeted by the agents of the present disclosure is one that has lost its normal function as a regulator of transcription or has lost its normal transcription-independent function, and this aberrant function and the associated mutations are well known in the art.

[0019] In embodiments, cancer cells targeted with the agents of the present disclosure include loss-of-function p53 mutants, dominant-negative p53 mutants, and / or gain-of-function p53 mutants, each of which are known in the art.

[0020] In some embodiments, the cancer cells express mutant and wild-type p53, and thus the individual being treated may have a tumor that is heterozygous for the p53 allele. In some embodiments, the cancer cells may express only mutant p53, and thus the individual being treated may be homozygous for the p53 allele.

[0021] p53 mutations that promote cancer growth and characterize cancer cells that may be targeted in accordance with the present disclosure are described in detail, for example, in Freed-Pastor and Prives, Genes & Dev (2012) 26: 1268-1286, the disclosure of which is incorporated herein by reference.

[0022] The amino acid sequence of p53, and the associated amino acid positions, are well known in the art and are referred to by amino acid position. In a non-limiting example, the cancer cell expresses p53 with a mutation at p53 amino acid position R175, R248, R273, R280, or E285. Specific, non-limiting examples of mutations at these positions include R175H, R248Q, R273H, R280K, and E285A, with further examples described below. In some embodiments, the p53 mutations are K132Q, A138P, L145R, V147D, P151S, P152L, G154V, T155P, T155N, R156P, V157F, R158L, R158H, A159D, A161T, Y163C, K164N, R175L, C176F, C 176Y, C176W, H179Q, R181C, H193L, H193R, H193Y, L194F, R213Q, Y205F, S215I, V2 16M, Y220C, Y220D, P223L, E224D, I232N, Y234H, Y236C, M237I, N239D, S241F, C242 F, C242R, C242S, C242W, R244D, G245R, G245S, R248W, R248L, G245S, G245C, G245D , G245V, M246I, R249S, P250L, I251N, I254D, I255N, G262V, G262D, G266E, G266V, R 267L, R267W, V272M, R273C, R273L, V274F, C275G, C275F, C277F, P278A, R280T, R282W, R282G, R283C, R283P, P309S, K320N, Q331R, G334V, G389W or any combination thereof.

[0023] In embodiments, the p53 mutations in cancer cells targeted by the methods of the present disclosure alter p53 interaction with one or more other proteins, including, but not limited to, NF-y, Sp1, Ets-1, VDR, SREBP-2, TopBPi, Pin1, MRE11, PML, p63, or p73. In embodiments, such p53 mutations include those described above and may further include mutations at p53 positions V143, D281, R249, and Y220.

[0024] In embodiments, p53 mutations induce the expression of oncogenes, non-limiting examples of which include proliferating cell nuclear antigen (PCNA), EGFR, c-Myc, and mixed lineage leukemia 1 (MLL1).

[0025] In embodiments, p53 mutations in cancer cells, when not targeted by the PEPD KD described herein, can transactivate other proteins (including, but not limited to, MYC, CXCL1, PCN, MAP2K3, CCNA, CCNB, CDK1, CDC25C, ASNS, E2F5, MCM6, IGF1R, STMN1, and EGFR), thereby promoting cancer cell proliferation.

[0026] In some embodiments, p53 mutations in cancer cells when not targeted by the PEPD KD described herein may upregulate genes that encode proteins that inhibit apoptosis or enhance resistance to chemotherapeutic agents, including, but not limited to, EGR1, ABCB1, IGF2, DUT, BCL2L1, TIMM50, LGALS3, and NFKB2.

[0027] In some embodiments, the agent used to suppress the formation of the complex comprising PEPD and mutant p53 is an RNAi agent. In some embodiments, the RNAi agent has complementarity to the mRNA encoding PEPD. The sequence of human PEPD and its encoding mRNA is known in the art, and the present disclosure includes targeting such mRNA sequence. See, for example, U.S. Patent No. 10,155,028 (the description of PEPD therein is incorporated by reference).

[0028] Thus, in embodiments, expression of PEPD can be suppressed in cancer cells containing the mutated p53 described herein by inhibiting translation of the mRNA encoding PEPD. In embodiments, the mRNA encoding the protein is degraded. In this regard, in non-limiting embodiments, RNA interference (RNAi) mediated silencing and / or reduction of the mRNA encoding PEPD is performed. In embodiments, this is accomplished by delivery of any suitable RNAi agent. In embodiments, an siRNA-based approach is used. This can be done by introducing and / or expressing one or more suitable short hairpin RNAs (shRNAs) in the cell. shRNAs are RNA molecules that contain a sense strand, an antisense strand, and a short loop sequence between the sense and antisense fragments. The shRNAs are transported to the cytoplasm where they are processed by Dicer into small interfering RNAs (siRNAs). siRNAs are 21-23 nucleotide double-stranded RNA molecules that are recognized by the RNA-induced silencing complex (RISC). Once incorporated into the RISC, the siRNAs promote cleavage and degradation of the target mRNA. Thus, siRNA, shRNA, or miRNA can be used for use in the RNAi-mediated silencing or downregulation of PEPD expression as described herein. In other embodiments, functional RNAs such as ribozymes are used. In embodiments, the ribozymes include hammerhead ribozymes, hairpin ribozymes, or hepatitis delta virus ribozymes. In related embodiments, microRNAs (miRNAs) adapted to target relevant mRNAs can be used. The term "microRNA" can be used interchangeably with "miR" or "miRNA" and refers to unprocessed or processed RNA transcripts, for example, from engineered miRNA genes. Unprocessed miRNA gene transcripts, also referred to as "miRNA precursors," typically comprise RNA transcripts of about 70-100 nucleotides in length.The miRNA precursor may be processed into an active 19-25 nucleotide RNA molecule by digestion with an RNAse (e.g., Dicer, Argonaute, or ribonuclease III). This active 19-25 nucleotide RNA molecule is also referred to as the "processed" miRNA gene transcript or "mature" miRNA. Any of these forms of microRNA may be adapted for use in the embodiments of the present disclosure. Also, in certain embodiments, the RNAi agent may be provided as a synthetic agent, such as a microRNA mimic, small interfering RNA (siRNA), RNA interference (RNAi) molecule, double-stranded RNA (dsRNA), short hairpin RNA (shRNA) (as described above), primary miRNA (pri-miRNA), or small nucleolar RNA (snoRNA). Thus, inhibition of expression of PEPD may be achieved by inhibiting translation, transcription, and / or by degradation of the mRNA.

[0029] In embodiments, the RNAi agent may be modified to improve its potency (e.g., by making it resistant to nuclease digestion). In embodiments, the RNAi agent polynucleotide comprising modified ribonucleotides or deoxyribonucleotides comprises an RNA / DNA hybrid. In a non-limiting example, the modified ribonucleotide may be methylated and / or substituted at the 2' position of the ribose moiety with an --O--alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an --O-aryl group containing 3-6 carbon atoms, where such alkyl or aryl groups may be unsubstituted or substituted (e.g., with a halo group, a hydroxy group, a trifluoromethyl group, a cyano group, a nitro group, an acyl group, an acyloxy group, an alkoxy group, a carboxyl group, a carboalkoxyl group, an amino group; or with a hydroxy group, an amino group, or a halo group). In embodiments, the modified nucleotide comprises a methyl-cytidine and / or a pseudo-uridine. Nucleotides may be linked by phosphodiester bonds or by synthetic bonds, i.e. bonds other than phosphodiester bonds.Examples of internucleoside bonds in polynucleotide agents that can be used in the present disclosure include, but are not limited to, phosphodiester, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, morpholino, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof.In the examples of the present disclosure, the following RNAi agents are used: Non-specific scrambled control siRNA: rCrGrUrUrArArUrCrGrCrGrUrArUrArArUrArCrGrCrGrUAT (SEQ ID NO: 1) PEPD siRNA #1: rGrCrArUrUrGrArUrCrArGrArCrArArArCrArGrUrGCT (SEQ ID NO: 2) PEPD siRNA #2: rGrGrCrCrGrUrCrUrArUrGrArGrGrCrArGrUrGrCrUrGrCGG (SEQ ID NO: 3) PEPD siRNA #3: rCrGrArArGrUrCrArArCrArArUrArCrCrArUrUrCrUrUrCAC (SEQ ID NO: 4)

[0030] In some embodiments, the RNAi agent comprises rGmCrA mUmUmU rGrAmUmCrArG rAmCmCrArArAmCrArG mUrGC T / 36-FAM (SEQ ID NO:5), which is 2'-O-methylated at all of the C and U residues in the sense strand. This, or any other RNAi agent, may be provided with further modifications, for example, to improve delivery. For example, the RNAi agent may be complexed with one or more proteins. In some embodiments, the RNAi agent binds irreversibly or reversibly to a protein. In some embodiments, the protein comprises a cancer cell specific binding partner (including, but not necessarily limited to, a cancer cell receptor ligand, such as a protein or peptide), such that the RNAi agent can be specifically delivered to cancer cells that contain mutant PEPD. In some embodiments, the RNAi agent is selected from the group consisting of Her2 / neu (human epidermal growth factor receptor 2), fibroblast growth factor receptor (FGFR), E-cadherin, EMA (epithelial membrane antigen), αvβ6 integrin, EpCAM (epithelial cell adhesion molecule), CEA (carcinoembryonic antigen), FR-α (folate receptor-α), or uPAR (urokinase-type plasminogen activator receptor), αvβ3 integrin, bombesin R, carcinoembryonic antigen (CEA), CD13, CD44, CXC chemokine receptor-4 (CXCR), carbonate The agent is used in a complex with a ligand that specifically binds to anhydrase-9 (CAIX), emmprin (CD147), endoglin (CD105), epithelial cell adhesion molecule (EpCAM), MET, IFG1R, EphA2, fibroblast activation protein-alpha (FAP-alpha), matriptase, mesothelin, MT1-MMP, Muc-1, prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), Tn antigen, urokinase-type plasminogen activator receptor (uPAR), or VEGFR. In some embodiments, the RNAi agent is provided in a complex with ERBB1, or ERBB2, or a segment thereof. In some embodiments, the protein or peptide ligand is present in a fusion protein.In some embodiments, the protein or peptide cancer cell-specific ligand is provided in the form of an immunoglobulin (such as an antibody) or a fusion protein comprising a segment of an immunoglobulin. Non-limiting examples of such proteins include single chain variable fragments (scFv), V. H Single chain antibodies, Fab, single domain antibodies (sdAb, V HH), affibodies or DARPins. In some embodiments, the ligand and immunoglobulin segments are separated by a linker (such as a flexible GS linker), many suitable examples of which are known in the art. In some embodiments, the RNAi agent is used with a fusion protein of ERBB2 and a scFV-protamine fragment (e.g., amino acids 8-29). In some embodiments, the protamine fragment comprises or consists of the amino acid sequence RSQSRSRYYRQRQRSRRRRRRS (SEQ ID NO:6). In some embodiments, the present disclosure includes a fusion comprising an scRv and an arginine polymer (e.g., an arginine peptide consisting of nine monomers) (e.g., as described in Lu et al., Biomaterials 2016, 76, 196-207; the disclosure of which is incorporated herein by reference). Such approaches and compositions are known in the art and can be adapted for use with the presently provided RNAi agents in light of the present disclosure. (See, e.g., Song et al., Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors. Nature Biotechnology 2005, 23, 709-717; Yao et al., Targeted delivery of PLK1-siRNA by ScFV suppresses HER2+ breast cancer growth and metastasis. Science Translational Medicine 2012, 4, 130ra48; Lu et al., siRNA delivered by EGFR-specific scFV sensitizes EGFR-TKI-resistant human long cancer cells. Biomaterials 2016, 76, 196-207; the disclosures of which are incorporated herein by reference).

[0031] In embodiments, the disclosure includes selecting a cancer patient based on having a cancer that expresses a mutant p53 as described herein, and administering to the individual an RNAi agent that targets PEPD, thereby disrupting the interaction between PEPD and the mutant p53 protein and providing the individual with a prophylactic or therapeutic effect against the cancer.

[0032] In some embodiments, the cancer patient has any type of cancer that expresses the mutant p53 protein described herein. Thus, the type of cancer is not particularly limited, and includes, but is not necessarily limited to, breast cancer, prostate cancer, pancreatic cancer, lung cancer, liver cancer, ovarian cancer, cervical cancer, colon cancer, esophageal cancer, gastric cancer, bladder cancer, brain cancer, testicular cancer, head and neck cancer, melanoma, skin cancer, any sarcoma (including but not limited to fibrosarcoma, hemangiosarcoma, adenocarcinoma, rhabdomyosarcoma), any blood cancer (including all types of leukemia, lymphoma, myeloma). In some embodiments, the cancer includes triple negative breast cancer (TNBC). TNBC represents a subset of breast cancer that lacks estrogen receptor (ER), progesterone receptor, and HER2 receptor tyrosine kinase. Currently, there is no targeted treatment, and the prognosis of the patient is poor.

[0033] In embodiments, the RNAi agent can be administered to an individual as a naked polynucleotide, in combination with a delivery reagent, or as a recombinant plasmid or viral vector that contains and / or expresses the RNAi agent. In some embodiments, the protein is encoded by a recombinant oncolytic virus that can specifically target cancer cells and may be non-infectious to and / or cleared from non-cancerous cells when the oncolytic virus enters the non-cancerous cells.

[0034] In some embodiments, a therapeutically acceptable amount of an RNAi agent is used. A therapeutically effective amount is an amount capable of achieving a desired effect, such as reducing the rate of tumor growth, inhibiting tumor formation, inhibiting metastasis, or preventing the development of cancer and / or tumors.

[0035] In some embodiments, the RNAi agent of the present disclosure may be combined with a delivery agent, if desired. Suitable delivery reagents for administration include, but are not limited to, Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), liposomes, nanoparticles, or combinations thereof, in addition to the fusion proteins described above. In some embodiments, the RNAi agent may be administered by intratumoral injection. In some embodiments, nanoparticles or other suitable drug delivery reagents may be used such that the RNAi agent is included in the nanoparticles. In some embodiments, the nanoparticles or other drug delivery reagents may be provided in association with a binding partner that specifically binds to a cancer cell marker. As described above, in some embodiments, the binding partner comprises a cancer cell surface receptor ligand. In some embodiments, the binding partner comprises an antibody or an antigen-binding fragment thereof, which may be provided as a fusion protein with a cancer cell surface receptor ligand. In some embodiments, when RNAi and drug delivery reagents are delivered to specifically target cancer cells, administration can include any suitable route, including oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intranasal, and intracranial. Parenteral injection includes intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. Direct injection into tumor is also included.

[0036] The treatment or inhibition of cancer described herein can be combined with any other anti-cancer approach, such as surgical intervention and conventional chemotherapy. In some embodiments, the cancer treatment according to the present disclosure can be combined with the administration of one or more immune checkpoint inhibitors. In some embodiments, the checkpoint inhibitor comprises an anti-programmed cell death protein 1 (anti-PD-1) checkpoint inhibitor, or an anti-cytotoxic T-lymphocyte associated protein 4 (anti-CTLA-4) checkpoint inhibitor. There are many such checkpoint inhibitors known in the art. For example, anti-PD-1 agents include pembrolizumab and nivolumab. An example of anti-PD-L1 is avelumab. An example of anti-CTLA-4 is ipilimumab. In some embodiments, the combination of an RNAi agent with a chemotherapy agent or an RNAi agent with an immune checkpoint inhibitor can exert a synergistic anti-cancer effect.

[0037] The following examples illustrate certain embodiments of the present disclosure, but are not intended to be limiting.

[0038] The following experiments were performed using multiple human breast cancer cell lines, including: 1) MCF-7 (WT-53);2) CAL-51 (WT-p53);3) BT-474 (p53 E285A ); 4) MDA-MB-231 (p53 R280K ); 5) MDA-MB-231 with p53 knockout (p53 - / - ), which was generated by CRISPR-Cas9 to transform MDA-MB-231 (p53 R280K );6) MDA-MB-468 (p53 R273H );7) HCC70 (p53 R248Q ); 8) SKBR3 (p53 R175H ) MCF-7 is an estrogen receptor-positive breast cancer cell line. BT-474 and SKBR3 are HER2-positive breast cancer cell lines. The other cell lines are triple-negative breast cancer cell lines. The p53 mutant in BT-474 cells is temperature sensitive, exhibiting mutant activity at 37°C, but reverting to wild-type activity at 32°C. All experiments were performed at 37°C.

[0039] [Example 1] This example shows the expression of one hotspot p53 mutant, i.e., p53 in BT-474 cells, as shown in FIG. E285A Results are presented for the present study. PEPD KD by siRNA was associated with downregulation of Bcl-xl and Bcl-2, and induction of Bax and Bak, but not alteration of p53 levels (A). The changes in Bcl-2 family proteins are consistent with a marked inhibition of cell proliferation (B). These results suggest that PEPD KD reduces p53 levels and is associated with downregulation of Bcl-xl and Bcl-2, and induction of Bax and Bak, but not alteration of p53 levels (C). E285A These results suggest that it may be possible to reactivate

[0040] [Example 2] This example demonstrates that PEPD KD by siRNA inhibits p53 E285A This demonstrates that PEPD KD can induce transcription-independent tumor suppressor activity of mutants. In particular, the data shown in Figure 2 show that PEPD KD by siRNA induces mitochondrial translocation of mutant p53 from both the cytosol and nucleus (A), binds mutant mitochondrial p53 to Cyclophilin D (CypD; a key regulator of the mitochondrial permeability transition pore) (B), and induces mitochondrial damage (reduction in mitochondrial membrane potential) (C).

[0041] [Example 3] This example shows the expression of p53 in BT-474 cells. E285A This suggests the reactivation of p53. E285ATo determine the effect of PEPD KD on the transcriptional function of p53, BT-474 cells were transfected with equal amounts of p53 reporter PG13-luc, which contains multiple copies of the p53-binding sequence, or MG15-luc, which contains multiple copies of the mutant p53-binding sequence, along with pRL-TK (Renilla luc) for transfection efficiency control. After 24 h, cells were treated with control siRNA or PEPD siRNA (10 nM) for 48 h. PG13-luc increased luciferase (luc) expression 5.9-fold in response to PEPD KO, whereas luc expression by MG15-luc was almost unchanged after PEPD KD (Figure 3A). This suggests that PEPD KD reduces the expression of p53 E285A These results suggest that PEPD KD may significantly increase the transactivation activity of p53, which is consistent with the previously described regulation of various p53 target proteins by PEPD KD. Furthermore, PEPD KD stimulated p53 phosphorylation as detected by phostag WB analysis (Fig. 3B). Two specific phosphorylation sites (serine 6 and serine 15) in the p53 transactivation domain were measured, and PEPD knockdown resulted in phosphorylation at both sites (Fig. 3C). By analyzing nuclear and cytosolic fractions separately, we found that PEPD KD-induced p53 phosphorylation occurred in nuclear p53, but not in cytosolic p53 (Fig. 3D).

[0042] [Example 4] This example demonstrates PEPD binding to p53 mutants in BT-474 cells. E285A The binding of p53 to PEPD was analyzed in BT-474 cells. E285A To estimate the proportion of cellular PEPD that binds to p53, we used total p53 in whole cell lysates. E285A Molecules were pulled down with excess p53 antibody and the p53 band intensity was compared to that of the input control. E285A We then determined the percentage of PEPD molecules bound to p53 (Figure 4A). In these cells, approximately 6% of cellular PEPD molecules bound to p53. E285A We found that cellular p53 bound to PEPD (Fig. 4B).E285A To estimate the proportion of molecules, all PEPD molecules in the cell lysate were pulled down with an excess of PEPD antibody and expressed as p53 E285A The intensity of the band was compared with that of the input control to determine the amount of p53 remaining in the supernatant. E285A The proportion of p53 in the cell lines was determined (Figure 4C). E285A Approximately 55% of the molecules were found to be bound to PEPD (Figure 4D). E285A We also measured the amount of mutant molecules in this fraction and found that approximately 45% of the mutant molecules were in this fraction (Fig. 4C).

[0043] PEPD nuclear p53 E285A To better understand how to inhibit p53 expression in BT-474 cells, we treated the cells with control or PEPD siRNA and then analyzed the nuclear p53 expression in the cells. E285A PEPD knockdown resulted in a significant decrease in nuclear p53 levels (Figure 4E). Next, PEPD-bound p53 in nuclear extracts was analyzed. E285A The PEPD KD was performed to remove p53 that remained bound to PEPD. E285A PEPD KD did not result in phosphorylation of p53 (pull-down fraction) (Fig. 4E). E285A In such cells, PEPD-free nuclear p53 E285A The level of p53 in the supernatant fraction was significantly increased (Fig. 4E). E285A (Figure 4E). Thus, upon release from PEPD, p53 E285A is phosphorylated.

[0044] [Example 5] This example demonstrates that PEPD KO by CRISPR-Cas9 kills human cancer cells in a p53-dependent manner. The results are shown in Figure 5 and demonstrate that cancer cell killing by PEPD KO requires p53 mutants. A set of CRISPR-Cas9 nuclease and gRNA target gene knockout was purchased from Celltechgen (CTG-CS9O-19761), which included CRISPR Cas9 nuclease expression vector (pST1374-N-NLS-Flag-Cas9-EGFP), PEPD gRNA vector 1 (pGL3-PEPD-sgRNA1), PEPD gRNA vector 2 (pGL3-PEPD-sgRNA2), and scrambled RNA vector. The human PEPD-specific gRNA sequences used for PEPD knockout by CRISPR-Cas9 are as follows; DNA equivalents: gccgctcacacaggcgctgc (gRNA1; SEQ ID NO: 7), and gcggaagaaccctgctgtgc (gRNA2; SEQ ID NO: 8). MDA-MB-231 (homozygous p53 R280K ) was compared with its p53-deficient isogenic counterpart (MDA-MB-231 p53 - / - ) were used in combination with triple-negative breast (TNBC) cells. MDA-MB-231-p53 - / - was generated from MDA-MB-231-p53R280K using CRISPR-Cas9 (Mukhopadhyay et al., J Natl Cancer Inst 2019, 111, djz051). Cells were transfected with various plasmids (same amount of plasmid for each cell line) and checked after 72 hours.

[0045] [Example 6] This example shows the p53 WT This example demonstrates binding of PEPD to p53 mutants and to various p53 mutants. In particular, this example demonstrates that PEPD binds directly and with similar affinity to p53 mutants, and that PEPD binds to approximately half the amount of each p53 mutant in the cytosol and nucleus.

[0046] To obtain these results, we produced His-tagged recombinant human proteins (including PEPD, p53 and their mutants) in bacteria, purified them by affinity chromatography, and confirmed their purity by gel electrophoresis and silver staining (see FIG. 13A). PEPD binding to p53 and its mutants was measured by ELISA. PEPD binds p53 with nearly identical affinity. WT , p53 R175H , p53 R248Q , p53 R273H , and p53 R280K The p53 protein binds to p53A and has a Kd of 145–185 nM (see Figure 6A). mPRD We showed that PEPD does not bind to p53 (Yang et al., Nature Communications 2017, 8, 2052). mPRD was used as a negative control to confirm that the ELISA specifically detects PEPD binding to the PRD in p53.

[0047] We next measured the binding of PEPD to p53 mutants in cells. R175H ), HCC70 (homozygous p53 R248Q ), MDA-MB-468 (homozygous p53 R273H ), MDA-MB-231 (homozygous p53 R280K ), MDA-MB-231(p53 KO ), MCF-7(p53 WT ), and CAL-51(p53 WT We screened seven cell lines, including human breast cancer cells that were HER2-positive (SKBR3), estrogen receptor-positive (MCF-7), or triple-negative (all remaining cell lines), including MDA-MB-231 (p53 KO ) was generated from MDA-MB-231 by CRISPR-Cas9 knockout of TP53. R280K ) and MDA-MB-231(p53 KO) constitute an isogenic pair of cells. The p53 genotype was confirmed in each cell line by Sanger sequencing (Figure 13B). The expression of both p53 and PEPD in each cell line was measured by Western blotting (WB). As expected, p53 WT Compared with MDA-MB-231-p53, all p53 mutants were overexpressed and p53 was KO Interestingly, PEPD was not found in cells harboring p53 mutants, but was found to be absent in MDA-MB-231-p53 KO p53 is even overexpressed in the WT p53 was detected by WB using DO-1, an antibody that recognizes both p53 and its mutants.

[0048] Based on these results, we measured PEPD binding to p53 mutants in whole cell lysates of SKBR3, MDA-MB-231, MDA-MB-468, and HCC70, and determined p53 WTCAL-51 was included for comparison with p53. We also measured PEPD binding to p53 in the cytosolic and nuclear fractions of MDA-MB-231, SKBR3, and CAL-51 because PEPD is present in both the cytosol and the nucleus. PEPD or p53 in each sample was subjected to immunoprecipitation (IP) using an excess of antibody. Analysis of the supernatant by WB confirmed complete pull-down of PEPD or p53 (Figures 14A, 14B). The precipitates, along with the input, were analyzed by WB for p53 or PEPD (Figures 14A, 14B), and the percentage of PEPD or p53 that coprecipitated with each other was calculated by comparing their band intensities with those of the input. Cross-contamination between the cytosolic and nuclear extracts was excluded by WB analysis of lamin B (nuclear protein) and α-tubulin (cytosolic protein) (Figure 14C). For whole cell lysates, following IP, we also measured PEPD or p53 in the supernatants by ELISA to determine the percentage of PEPD or p53 molecules that were not bound to each other. The total amount of PEPD or p53 detected in the precipitates and corresponding supernatants accounted for 95-97% of PEPD and 93-96% of p53 in the cells (Figures 6C, 6D), validating the validity of our experimental approach. Approximately 23% of p53 WT and 40-47% of the mutants bound PEPD in whole cell lysates, with results similar in cytosolic and nuclear extracts (Figure 6C). In contrast, only 6-9% of PEPD bound to p53, even though cellular levels of PEPD were 3.1-8.7-fold higher than those of p53, as measured by ELISA (Figure 6E). WT and mutants ( Fig. 6D ).

[0049] [Example 7] This example describes the effects of PEPD KD on cell viability and levels of key proteins, and G278D The results are shown in Figure 7. R175H, R248Q, R273H, and R280K are the most common cancer-associated p53 mutations and are well-known gain-of-function (GOF) mutations. Seven cell lines were used, including HCC70 (homozygous p53 R248Q), MDA-MB-468 (homozygous p53 R273H ), SKBR3 (homozygous p53 R175H ), MDA-MB-231 (homozygous p53 R280K ), and its p53-deficient isogenic counterpart (MDA-MB-231-p53 - / - ), CAL-51(p53 WT ), and MCF-7(p53 WT ) was generated from MDA-MB-231-p53R280K using CRISPR-Cas9. - / - All cell lines were obtained from ATCC, except for (Mukhopadhyay et al., J Natl Cancer Inst 2019, 111, djz051). Cells were treated with control or PEPD siRNA (Origene) for 48-72 h. Two types of PEPD siRNA, one targeting exon 12 (siRNA2) and one targeting exon 15 (siRNA1), were used, respectively, to exclude non-specific effects. After 72 h, each PEPD siRNA induced cell death and downregulated p53 WT or mutant, killing 64–89% of cells carrying the p53 or p53 mutant (Figure 7A). - / - Neither siRNA was cytotoxic in p53 cells (Figure 7A). WT In all cell lines bearing p53, PEPD KD detected strong modulation of p53 target genes (including induction of p21, CD95, PUMA, Bax, and Bak, and downregulation of Bcl-2 and Bcl-xL), and although the modulation of some Bcl-2 family proteins was not uniform among the cell lines, none of these changes occurred in p53-deficient cells (Figure 7B). There was no difference in the effect of the two PEPD siRNAs (Figures 7A, 7B, 15A). Therefore, in subsequent experiments, we focused on PEPD siRNA1. Since p21 inhibits the G1 / S phase of the cell cycle, it is important to consider the effect of PEPD siRNA1 in MDA-MB-231, MDA-MB-231 (p53 KO), SKRB3, and CAL-51 were also analyzed for cell cycle progression by flow cytometry. KO ), but caused S-phase arrest in other cell lines (Fig. 15B). KO In all cell lines except for PEPD siRNA, PEPD siRNA also resulted in activation of multiple caspases (caspase-9, -8, and -7) (Figures 7B, 15A). These results suggest that PEPD KD reduces the expression of p53 WT We have shown that it not only activates p53 but also reactivates oncogenic p53 mutants.

[0050] Interestingly, PEPD KD results in a loss of p53 WT PEPD KD activated caspase 3 only in IL-1 cells and not in any of the cell lines harboring p53 mutants (Fig. 15C). WT PEPD KD did not alter the total cellular levels of p53 and the mutants (Fig. 7B, 15A). However, by removing all PEPD (including PEPD bound to p53) from whole cell lysates using IP and measuring p53 in the supernatants by WB, we demonstrated that PEPD KD did not alter the total cellular levels of p53 WT and mutants were shown to be free from PEPD (Figure 7C).

[0051] Next, PEPD G278D We investigated whether PEPD siRNA, an enzymatically inactive PEPD mutant that binds to the PRD in p53 (Yang et al., Nature Communications 2017, 8, 2052), could neutralize the effect of PEPD siRNA on p53 mutants. G278D The cells were transfected with a plasmid expressing PEPD and then treated with siRNA for 72 hours. G278D PEPD killed 65-79% of the cells that did not contain G278D Only 16-25% of cells carrying PEPD were killed (Figure 7D). G278DRescue is highly effective. G278D In cells expressing PEPD, PEPD and PEPD G278D The total amount of p53 was not decreased. WT Induction of target proteins (p21 and PUMA) was largely abolished (Figure 7E). These results provide further evidence that reactivation of mutant p53 by PEPD siRNA results from its dissociation from PEPD and indicate that the enzymatic activity of PEPD is not involved in the regulation of mutant p53.

[0052] [Example 8] This example demonstrates the effect of PEPD KD on p53 mutants in isogenic cells. It is important to note that more than 50% of the p53 mutant molecules are not bound to PEPD in cells (Figure 6C). c-MYC (MYC), epidermal growth factor receptor (EGFR), and mitogen-activated protein kinase 3 (MKK3) are oncogenes upregulated by various p53 mutants. WB analysis showed that PEPD KD was significantly increased in MDA-MB-231 (p53 KO We showed that transfection of each of the four p53 mutants into MDA-MB-231 (p53 ) cells induced MYC, and three of them also induced EGFR and MKK3, but none of the mutants induced CD95 or PUMA, which are regulated by p53 WT (Figure 8A). KOWhen p53 mutants were transfected into 100-well platelets (100-well platelets) cells and treated with PEPD siRNA 24 hours later, trypan blue assays demonstrated that survival of cells expressing each mutant was significantly inhibited (Figure 8B). WB analysis showed that PEPD siRNA did not change p53 levels, significantly knocked down PEPD, induced p21, CD95, and PUMA, and activated caspase 7, but did not induce or even downregulated MKK3, EGFR, and MYC in some cases (Figure 8C). These results together with Figure 7 indicate that reactivation of p53 mutants by PEPD KD is independent of the cellular context, and that reactivated mutant molecules affect cell fate (although non-reactivated mutant molecules may still exert tumor-promoting activity).

[0053] [Example 9] This example demonstrates the effect of PEPD KD on the transcription-independent tumor suppressor activity of p53 mutants. The results are shown in Figure 9 and related to Figures 15 and 16. The results show that mitochondrial enrichment of p53 (WT or mutant) is accompanied by mitochondrial enrichment of truncated BH3-coupled domain death agonist (tBID), mitochondrial reduction of cytochrome c, apoptosis-inducing factor (AIF), and endonuclease G (EndoG), an increase in cytochrome c and tBID in the cytosol, a decrease in BID in the cytosol, and an increase in AIF and EndoG in the nucleus (Figure 9A). BID is known to be converted by caspase 8 to pro-apoptotic tBID (which translocates to mitochondria). Translocation of AIF and EndoG to the nucleus, and translocation of cytochrome c from mitochondria to the cytosol are well-established mechanisms of mitochondrial-mediated apoptosis. However, PEPD KD did not significantly alter the mitochondrial apoptosis of MDA-MB-231 (p53 KO ) was prominent in both the cytosol and nucleus of cells, whereas subcellular redistribution of AIF, EndoG, cytoC, BID, and tBID was not observed (Figure 9A).

[0054] Consistent with the above molecular changes, JC-1 fluorescent staining demonstrated that siRNA-induced PEPD KD inhibited p53 WT PEPD KD caused a marked loss of mitochondrial membrane potential (MMP) in cells carrying p53 or p53 mutants, and the extent of MMP loss was similar among cells with different p53 genotypes, whereas PEPD KD caused a marked loss of mitochondrial membrane potential (MMP) in cells carrying p53 or p53 mutants. KO ) did not significantly affect the MMP of mitochondrial p53 (Figure 9B). WT It is well known that PEPD binds to cyclophilin D (CYPD) to open the mitochondrial permeability transition pore, thereby causing MMP loss and cell death, and neutralizes their inhibitory effects on BAK and BAX by binding to BCL-2 and BCL-XL. By co-IP and WB, we showed that PEPD siRNA significantly increased the binding of all p53 mutants to CYPD in mitochondria (Figure 9C). However, since PEPD KD caused significant changes in the expression of BCL-2, BCL-XL, BAK, and BAX (Figure 7B), it was not feasible to evaluate the interaction of BCL-2 family proteins with p53 mutants in mitochondria. We also performed TUNEL assays in selected cell lines to detect the upregulation of p53 WT In cells carrying the p53 or p53 mutant, PEPD siRNA strongly induced apoptosis, but KO It was shown to be inactive in cells (Fig. 9D, 15D).

[0055] p53 in mitochondria WT It is known that the translocation of p53 is driven by MDM2-mediated monoubiquitination. Furthermore, low levels of MDM2 activity inhibit p53 WT Although high levels of MDM2 activity induce mono-ubiquitination of p53, WT It is known that p53 induces polyubiquitination and degradation in SKBR3 cells. R175H Focusing on these findings, we demonstrated that siRNA-induced MDM2 KD inhibits p53 R175H Blocked PEPD KD-induced mitochondrial enrichment of p53 (Figure 16A). R175H16B), and increased MDM2 binding to monoubiquitinated p53 in mitochondria. R175H PEPD KD, however, did not result in the enrichment of nuclear p53 R175H However, it did not induce monoubiquitination of β-actin (Figure 16C).

[0056] [Example 10] This example demonstrates the effect of PEPD KD on the phosphorylation and transcriptional activity of p53 mutants. The results are shown in Figures 10 and 17. PEPD KD also clearly reactivates the transcriptional function of p53 mutants (Figure 7B). p53 WT Because phosphorylation is a well-known important step in transcriptional activation, we investigated the mechanism of p53 phosphorylation. WT The phosphorylation of p53 was measured by WB at four phosphorylation sites (S6, S15, S20, and S46) in the transactivation domain of the mutant. WT and all mutants, although the phosphorylation sites varied among them (Fig. 10A, 17A). WT This variation is at least partly related to the cellular context, since the phosphorylation sites in p53 also differ between MCF-7 and CAL-51 (Figures 10A, 17A). Since there are no common phosphorylation sites, we next used phostag WB, which detects global phosphorylation and determines the cellular location of phosphor-p53. R280K (MDA-MB-231), p53 R175H (SKBR3), and p53 WTWe focused on CAL-51 cells. PEPD KD-induced fluorescent-p53 (WT and mutant) was absent from the cytosol or mitochondria, but occurred in the nucleus (Figure 10B). We removed all PEPD from nuclear extracts by IP and measured fluorescent-p53 in the precipitate and supernatant, but fluorescent-p53 (WT and mutant) was detected only in the supernatant (Figure 17B), indicating that p53 is phosphorylated after detachment from PEPD. Next, we transfected cells with PG13-luc or MG15-luc together with pRL-TK to control for transfection efficiency, and then treated them with siRNA for 48 hours. PEPD siRNA inhibited reporter expression from PG13-luc, but not in CAL-51 cells (p53 WT ) and 3.3-5.6-fold in cells harboring a p53 mutant (Figure 10C). In contrast, PEPD siRNA had little effect on reporter expression from MG 15-luc in all cells. Using ChIP-qPCR, we found that p53 expression in the promoter of the CDKN1A gene (encoding p12) was significantly reduced in cells treated with PEPD siRNA for 48 h. WT Binding of each p53 mutant to the p53 binding site was increased by 7.6- to 10.2-fold, and p53 binding was observed in the promoter of the BBC3 gene (encoding PUMA). WT We further demonstrated that binding of each p53 mutant to the binding site was increased by 5.9- to 7.6-fold ( Fig. 10D ).

[0057] Taken together, the above results, together with others previously shown, suggest that p53 mutants, when released from PEPD by PEPD KD, are phosphorylated and express p53 in their promoters. WT By binding to the p53 binding site WT The reactivated transcriptional activity of p53 mutants reveals that activated p53 regulates target genes. WT It is almost indistinguishable from that of

[0058] [Example 11] This example shows the effect of PEPD KD on the refolding and reactivation of p53 mutants, and the role of K373 acetylation. The results are shown in Figures 11 and 18. The results show that K373 acetylation is essential for the reactivation of p53 mutants, which refold once separated from PEPD, driven by K373 acetylation. p53 WT It is well known that acetylation of p53 is important for its activation. We measured the effect of PEPD KD on acetylation at various lysine residues in p53 mutants by WB. PEPD KD with siRNA induced acetylation at various sites, but only K373 acetylation was common to all mutants, K370 acetylation did not occur, and K372 acetylation was almost unchanged (Figure 11A). In SKBR3 cells (p53 R175H ) and MDA-MB-231 cells (p53 R280K ), it was shown that K373 acetylation occurs in the mutant in the nucleus and mitochondria, but not in the cytosol (Fig. 11B, 18A). We next investigated whether K373 acetylation occurs before or after the mutant detaches from PEPD. Since PEPD is not present in mitochondria, nuclear extracts were analyzed. We removed all PEPD from nuclear extracts using IP and measured Ac-K373-p53 mutant in the precipitate and supernatant by WB. As a result of PEPD KD, Ac-K373-p53 mutant was only present in the supernatant (Fig. 18B). Thus, K373 acetylation occurs after the mutant detaches from PEPD. C646 is known to inhibit p300 / CBP, which acetylates p53. C464 prevented PEPD siRNA from killing all cell lines carrying p53 mutants (Fig. 11C, 18C). C464 also inhibited K373 acetylation of mutant p53 and p53 in all cell lines despite the severe PEPD KD. WTInduction of target proteins, including p21 and PUMA, was blocked (Figures 11D, 18D). To further clarify the role of K373 acetylation in the reactivation of p53 mutants, we introduced the K373R mutation into each p53 mutant and reactivated MDA-MB-231 (p53 KO ) cells were expressed with the mutants and then subjected to PEPD KD by siRNA for 96 hours. The K373R mutation rendered each p53 mutant almost completely unresponsive to PEPD KD, as assessed by cell survival and induction of p21 and PUMA (Figures 11E, 11F, 18E, 18F). Thus, K373 acetylation is a key molecular switch for reactivation of p53 mutants by PEPD KD.

[0059] We investigated whether PEPD binds to p53 mutants and restores them to the wild-type conformation. Antibodies Pab1620 and Pab240 are widely used to detect p53 in the “wild-type” and “denatured” conformations, respectively, even though the exact folding state of the protein is unknown. We confirmed that Pab1620 and Pab240 specifically detect the “wild-type” and “denatured” conformations, respectively (Figure 18G). p53 R175H It is known that p53 exists in a completely “denatured” conformation. Indeed, IP and subsequent WB revealed that p53 in SKBR3 cells R175H We showed that PEPD binds to Pab240 but not to Pab1620 (Fig. 11G and 11H). R175H (Fig. ​(Fig.11H)). R175H showed that approximately 40% of p53 remains in a "denatured" conformation. R175H The molecule switched from the “denatured” to the “wild-type” conformation after 48 h of PEPD siRNA treatment (Figure 11I). Approximately 40% of p53 R175H Refolding of p53 first binds to PEPD in SKBR3 R175H This closely matched the proportion of all p53 R175HThis indicates that the molecule refolds after being released from PEPD. R248Q , p53 R273H , and p53 R280K We also tested Pab1620 and Pab240. Whole cell lysates were subjected to IP with Pab240 or Pab1620, and analysis of the supernatants by WB confirmed complete pull-down of each p53 mutant (Figure 18H). Analysis of the precipitates by WB showed that each mutant was present mainly in the "wild-type" conformation, with the remainder in the "denatured" conformation (Figure 18H), consistent with previous reports. PEPD was pulled down with each p53 mutant by both Pab1620 and Pab240, but mainly by Pab1620 (Figure 18H). Thus, PEPD binds to p53 mutants independently of their conformation and does not induce refolding of the mutants. However, PEPD KD increased the levels of the "wild-type" conformation of the three mutants (Figure 18I), a relatively small increase that is in close agreement with the relatively small pool of mutant molecules that are initially present in the "denatured" conformation. Notably, PEPD KD does not change the total levels of p53 mutants (Figure 7B). Therefore, the mutant molecules in the "denatured" conformational state can all change to the "wild-type" conformation after detachment from PEPD. Taken together, our results indicate that PEPD binding to p53 mutants does not change their conformation, but the mutants refold after detachment from PEPD.

[0060] C646 blocked the PEPD KD-induced conformational changes that transformed all four p53 mutants from “denatured” to “wild-type” (Figures 11J, 18J). KO ) cells, p53 R175H / K373R , p53 R248Q / K373R , p53 R273H / K373R , or p53 R280K / K373RWe expressed p53 mutants in 10- and 20-fold transfections and then treated them with scrambled or PEPD siRNA. The K373R mutation did not alter the binding of each p53 mutant to PEPD, but completely blocked the conformational change of the mutants induced by PEPD KD (Figs. 11K, 18K). Thus, K373 acetylation, which occurs after the p53 mutants are released from PEPD, promotes their refolding. R175H / K373R , and p53 R280K / K373R Using this method, we identified MDA-MB-231(p53 KO ) cells were not enriched in mitochondria when the cells were treated with PEPD siRNA (Figures S11L, 18L). Taken together, K373 acetylation is essential for reactivation of both transcription-dependent and -independent tumor suppressor functions of mutant p53 by PEPD KD.

[0061] [Example 12] This example shows the in vitro effect of PEPD KD on the proliferation and expression of key proteins in syngeneic tumors with and without expression of p53 mutants. The results are shown in Figure 12 and related to Figure 19. The data demonstrate that PEPD KD induced reactivated p53 mutants via intratumoral injection of PEPD siRNA significantly reduced the proliferation and expression of key proteins in MDA-MB-231-p53 cells. R280K , MDA-MB-231-p53 KO , or MDA-MB-231-p53 R175H In a relevant animal model with orthotopic breast tumors generated from the cells, we demonstrate robust inhibition of tumor growth.

[0062] First, we compared the effect of PEPD KD on syngeneic orthotopic tumors that differed only in p53 expression. R280K ) or MDA-MB-231(p53 KO ) cells were inoculated. The tumors were approximately 100 mm 3Intratumoral injections of scrambled or PEPD siRNA (10 pmol) were performed once every 3 days as soon as the tumor size reached 10 μg / mL. To minimize interference with siRNA distribution to tumor tissue, tumors were injected once every 3 days until the average tumor size in control mice reached approximately 550 mm. 3 The experiment was stopped when the MDA-MB-231(p53 KO ) tumors and MDA-MB-231(p53 R280K ) tumors were harvested from the mice 1 and 2 days after the last treatment, respectively. No adverse effects of siRNA on the mice were detected. Both types of tumors grew rapidly with scrambled siRNA. However, PEPD siRNA did not inhibit MDA-MB-231 (p53 R280K ) strongly inhibited tumor growth, with the mean tumor size and tumor weight at the end of the experiment being only 10.6% and 8.6% of those in the control group, respectively (Figures 12A, 12B). In contrast, PEPD siRNA inhibited MDA-MB-231 (p53 KO ) had no effect on tumor growth (Fig. 12C, 12D). Analysis of representative tumor samples by WB showed that PEPD levels were similar between the two tumor types, and PEPD siRNA caused significant PEPD KD in both tumors. R280K In MDA-MD-231 (p53) tumors, PEPD siRNA did not alter total p53 levels, but strongly upregulated p21, CD95, and BAK, downregulated BCL-2, and activated caspases (Fig. S12E), similar to the changes detected in vitro (Fig. 7B). KO ) PEPD siRNA had no effect on p21, CD95, BCL-2, BAK, and caspase 7 in tumors (FIG. 12E).

[0063] p53 R280K is a contact mutant, and therefore p53 R175H They also investigated p53, a conformational mutant that is completely "denatured." R175HMDA-MB-231 (p53 KO ) p53 transiently expressed in cells R175H However, p53 was reactivated by PEPD KD (Fig. 8B, 8C). R175H We generated MDA-MB-231 cells stably expressing several p53 R175H -expressing clones were screened by WB and their p53 R175 The level of p53 in SKBR3 R175 Clone #1 (Figure 19A) was selected, which showed similar levels of p53 R175H The advantage of using p53 is that it is a novel marker that is not responsive to PEPD KD in vitro and in vivo. KO We first demonstrated that PEPD siRNA inhibits the expression of p53 in MDA-MB-231 (p53 R175H ) cell proliferation (Fig. 19B). R175H ) cells were inoculated into the mammary fat pad of female SCID mice, and tumors grew rapidly. 3 When tumor size reached 10 μg / kg, intratumoral injections of scrambled or PEPD siRNA (10 pmol) were initiated and administered once every 3 days. The average tumor size in control mice was approximately 550 mm 3 The experiment was stopped when tumors reached 100%. Tumors were harvested from the mice 2 days after the last treatment. Again, siRNA did not cause any adverse effects on the mice. While tumors grew rapidly with scrambled siRNA, PEPD siRNA potently inhibited tumor growth, with the mean tumor size and tumor weight being only 28.9% and 25.9% of the control group, respectively, at the end of the experiment (Figure 12F, 12G). Analysis of representative tumor samples by WB showed that PEPD siRNA caused significant PEPD KD and did not change the levels of p53, but strongly upregulated p21, CD95, and BAK, downregulated BCL-2, and activated caspase 7 (Figure 12E), which may be related to the p53 KD.R175H This is consistent with the reactivation of

[0064] Of note, human colon cancer HCT116 cells (p53 WT ) and HCT116 cells (p53 KO In a pair of syngeneic tumors in mice derived from the mouse model, PEPD KD by intratumoral injection of siRNA reduced the p53 WT Inhibited tumor growth by 79% and was accompanied by strong activation of p53 target genes, but KO The PEPD knockdown did not affect tumor growth (Yang et al., Nature Communications 2017, 8, 2052). R175H and p53 R280K The in vivo tumor suppressor activity of p53 was suppressed by PEPD KD WT It is similar to that of

[0065] [Example 13] This example illustrates the use of PEPD, PEPD mutants, and p53 WT , p53 mutants, and cell line characterization are provided. The results are shown in FIG. 13, which is related to FIG. 6 and FIG.

[0066] [Example 14] This example shows how p53 in cells WT and its mutants. The results are shown in Figure 14 and related to Figure 6.

[0067] [Example 15] This example demonstrates the effects of PEPD KD on p53 and other protein levels, cell cycle progression, and apoptosis. The results are shown in Figure 15, which is related to Figures 7 and 9.

[0068] [Example 16] This example shows the expression of p53 in SKBR3 cells. R175H The results demonstrate the role of MDM2 in mitochondrial enrichment in .

[0069] [Example 17] This example shows the p53 WT and the effect of PEPD KD on phosphorylation of p53 mutants. The results are shown in FIG. 17 and are related to FIG.

[0070] [Example 18] This example demonstrates the effect of PEPD KD on the refolding of mutant p53 and the role of K373 acetylation in the refolding and reactivation of mutant p53. The results are shown in Figure 18 and are related to Figure 11.

[0071] [Example 19] In this embodiment, p53 R175H 19 provides characterization of MDA-MB-231 cells stably expressing IL-16. The results are shown in FIG. 19 and are related to FIG. 12.

[0072] The above examples are intended to illustrate particular embodiments and are not intended to limit the scope of the disclosure.

Claims

1. A composition for suppressing cancer growth by administration to cancer cells expressing a p53 mutant that promotes cancer growth, the composition comprising an RNAi agent that targets prolidase (PEPD) and inhibits expression of PEPD.

2. The composition described in claim 1, wherein the RNAi agent inhibits the formation of a complex comprising mutant p53 and PEPD.

3. The composition of claim 1 or claim 2, wherein the RNAi agent comprises an siRNA.

4. The composition according to claim 1 or claim 2, wherein the p53 mutant comprises a loss-of-function p53 mutant, a dominant-negative p53 mutant, or a gain-of-function p53 mutant.

5. 5. The composition of claim 4, wherein the p53 mutant comprises a loss-of-function p53 mutant, a dominant-negative p53 mutant, or a gain-of-function p53 mutant, optionally wherein the p53 mutant is selected from a mutation in p53 protein having at least one p53 amino acid alteration at amino acid R175, R248, R273, R280, or E285.

6. The composition of claim 5 , wherein the RNAi agent releases mutant p53 that was in a complex with PEPD from contact with PEPD.

7. The composition of claim 6, wherein the p53 mutant released from contact with PEPD is involved in the death of the cancer cells.

8. The composition of any one of claims 1 to 7, wherein the cancer cells are present in an individual diagnosed with a cancer comprising cancer cells expressing a p53 mutant.

9. The composition of claim 1 or claim 2, administered to an individual based on a determination that the individual has a cancer that expresses a p53 mutant.

10. The composition of claim 9 , wherein the cancer expressing a p53 mutant comprises a loss-of-function p53 mutant, a dominant-negative p53 mutant, or a gain-of-function p53 mutant.

11. 11. The composition of claim 10, wherein the p53 mutant comprises a mutation in the p53 protein selected from at least one p53 amino acid change at amino acid R175, R248, R273, R280, or E285.

Images