Oligonucleotide derivative or its salt

Abstract

The present invention provides an oligonucleotide derivative or a salt thereof comprising a cyclic oligonucleotide and a linear oligonucleotide, wherein the cyclic oligonucleotide and the linear oligonucleotide have complementary base sequences and form a complex via hydrogen bonds between the complementary base sequences, and provides an oligonucleotide derivative or a salt thereof, as well as a method for producing the same.

Description

[Technical field]

[0001] The present invention relates to an oligonucleotide derivative or a salt thereof. Specifically, the present invention relates to an oligonucleotide derivative or a salt thereof that has improved resistance to degradation by enzymes in a living body. [Background technology]

[0002] Small interfering RNA (hereinafter referred to as siRNA) is involved in RNA interference (hereinafter referred to as RNAi) and is an RNA that functions as a guide for suppressing the expression of a target gene (Non-Patent Document 1). siRNA can selectively suppress (knock down) the expression of a protein that is expressed by messenger RNA (mRNA) through the cleavage of the mRNA, and is therefore expected to be applied to medicine (Non-Patent Document 2). One of the challenges facing the application of siRNA to medicines is its instability in vivo, namely, its susceptibility to degradation by nucleases.

[0003] In order to improve resistance to degradation by nucleases, Patent Document 1 discloses a single-stranded circularized nucleic acid or a dumbbell-shaped nucleic acid. The nucleic acid has the characteristic of being less susceptible to degradation by nucleases because it has no RNA terminus. Furthermore, Patent Document 2 discloses that siRNA is constructed within a cell by co-administering to the cell two circular nucleic acids having complementary sequences that are designed to open in the cell. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2008-278784 A [Patent Document 2] JP 2014-143923 A [Non-patent literature]

[0005] [Non-Patent Document 1] Nature, Vol. 411, No. 6836, pp. 494-498 (2001) [Non-Patent Document 2] Nature Reviews Cancer, volume 11, pages 59-67 (2011) Summary of the Invention [Problem to be solved by the invention]

[0006] However, although the circular nucleic acids disclosed in Patent Documents 1 and 2 have been reported to have improved stability against nucleases, there is little information available regarding gene silencing, and there is a strong demand for circularized nucleic acids with strong knockdown activity.

[0007] An object of the present invention is to provide a novel oligonucleotide derivative that is resistant to nucleases and has strong knockdown activity. [Means for solving the problem]

[0008] The present invention includes the following embodiments. [1] An oligonucleotide derivative or a salt thereof comprising a cyclic oligonucleotide and a linear oligonucleotide, An oligonucleotide derivative or a salt thereof, in which a cyclic oligonucleotide and a linear oligonucleotide have complementary base sequences and form a complex via hydrogen bonds between the complementary base sequences. [2] The oligonucleotide derivative or a salt thereof according to [1], wherein the cyclic oligonucleotide has a length of 10 to 40 bases. [3] The oligonucleotide derivative or a salt thereof according to [1] or [2], wherein the cyclic oligonucleotide contains at least one phosphorothioate bond. [4] The oligonucleotide derivative or a salt thereof according to any one of [1] to [3], wherein the cyclic oligonucleotide contains at least one 2'-modified nucleotide. [4-1] 2'-modified nucleotides have the 2'-OH group of ribose as -OR, -R, -R'OR, -SH, -SR, or -NH 2 , -NHR, -NR 2 , -N 3 , -CN, -F, -Cl, -Br and -I (R is alkyl or aryl, preferably alkyl having 1 to 6 carbon atoms; R' is alkylene, preferably alkylene having 1 to 6 carbon atoms; -NR 2 The oligonucleotide derivative or a salt thereof according to [4], which is a 2'-modified nucleotide substituted with a substituent selected from the group consisting of: [4-2] The oligonucleotide derivative or a salt thereof according to [4], wherein the 2'-modified nucleotide is a 2'-modified nucleotide in which the 2'-OH group of ribose is substituted with a substituent selected from the group consisting of -F, a methoxy group, and an ethoxy group. [4-3] The oligonucleotide derivative or salt thereof according to [4], wherein the 2'-modified nucleotide is a 2'-modified nucleotide in which the 2'-OH group of ribose is substituted with a substituent selected from the group consisting of a 2-(methoxy)ethoxy group, a 3-aminopropoxy group, a 2-[(N,N-dimethylamino)oxy]ethoxy group, a 3-(N,N-dimethylamino)propoxy group, a 2-[2-(N,N-dimethylamino)ethoxy]ethoxy group, a 2-(methylamino)-2-oxoethoxy group, a 2-(N-methylcarbamoyl)ethoxy group, and a 2-cyanoethoxy group. [5] The oligonucleotide derivative or salt thereof according to any one of [1] to [4-3], wherein the base length of the cyclic oligonucleotide is the same as or longer than the base length of the linear oligonucleotide. [6] The oligonucleotide derivative or a salt thereof according to any one of [1] to [5], wherein the cyclic oligonucleotide is represented by formula 1. Formula 1: [ka] (In the formula, L1 and L2 represent linkers; n1 and n2 each independently represent an integer of 0 to 10; M represents a portion containing a chemical structure that is cleaved by the intracellular environment; X represents an oligonucleotide. [6-1-1] The oligonucleotide derivative or a salt thereof according to [6], wherein the cyclic oligonucleotide has a length of 10 to 40 bases. [6-1-2] The oligonucleotide derivative or a salt thereof according to [6] or [6-1-1], wherein the cyclic oligonucleotide contains at least one phosphorothioate bond. [6-1-3] The oligonucleotide derivative or a salt thereof according to any one of [6] to [6-1-2], wherein the cyclic oligonucleotide contains at least one 2'-modified nucleotide. [6-2-1] The oligonucleotide derivative or a salt thereof according to any one of [6] to [6-1-3], wherein the intracellular environment is an enzyme present within the cell. [6-2-2] The oligonucleotide derivative or a salt thereof according to any one of [6] to [6-1-3], wherein the intracellular environment is intracellular pH. [6-2-3] The oligonucleotide derivative or a salt thereof according to any one of [6] to [6-2-2], wherein n1 and n2 each independently represent an integer of 0 to 8. [7] The oligonucleotide derivative or a salt thereof according to any one of [6] to [6-2-3], wherein the chemical structure cleaved in response to an intracellular environment is -SS-, -SC(O)- or -C(O)-S-. [8] The oligonucleotide derivative or a salt thereof according to any one of [6] to [7], wherein M is selected from the group consisting of formulae 3-1 to 3-6. [ka] (In the formula, R1 and R2 each independently represent a hydrogen atom or a C1-C3 alkyl, or R1 and R2 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3 and R4 each independently represent a hydrogen atom or a C1-C3 alkyl, or R3 and R4 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; n5 to n8 each independently represent an integer of 0 to 10; n9 and n10 each independently represent an integer of 1 to 4; Y1 to Y4 each independently represent a bond, -NR5-, -O-, or -S-; R5 represents a hydrogen atom, a C1-C3 alkyl, or a C2-C4 alkanoyl. [ka] (In the formula, R1' and R2' each independently represent a hydrogen atom or a C1-C3 alkyl, or R1' and R2' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3' and R4' each independently represent a hydrogen atom or a C1-C3 alkyl, or R3' and R4' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R5' and R6' are each independently a hydrogen atom or a C1-C3 alkyl group at each carbon atom to which they are attached; n5' and n6' each independently represent an integer of 1 to 10. [8-1-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-1. [8-1-2] The oligonucleotide derivative or a salt thereof according to [8-1-1], wherein R1 to R4 are each independently a hydrogen atom or a C1-C3 alkyl. [8-1-3] The oligonucleotide derivative or a salt thereof according to [8-1-1] or [8-1-2], wherein Y3 and Y4 are a bond or -O-. [8-1-4] The oligonucleotide derivative or a salt thereof according to any one of [8-1-1] to [8-1-3], wherein the sum of n5 and n7 is an integer of 0 to 5. [8-1-5] The oligonucleotide derivative or a salt thereof according to any one of [8-1-1] to [8-1-4], wherein the sum of n6 and n8 is an integer of 0 to 5. [8-2-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-2. [8-2-2] The oligonucleotide derivative or a salt thereof according to [8-2-1], wherein Y1 and Y2 are each independently a bond or -O-. [8-2-3] The oligonucleotide derivative or a salt thereof according to [8-2-1] or [8-2-2], wherein Y3 and Y4 are bonds. [8-2-4] The oligonucleotide derivative or a salt thereof according to any one of [8-2-1] to [8-2-3], wherein the sum of n5 and n7 and the sum of n6 and n8 are 0. [8-2-5] The oligonucleotide derivative or a salt thereof according to any one of [8-2-1] to [8-2-4], wherein n9 is 2 when Y1 is -O-, and 3 when Y1 is a bond. [8-2-6] The oligonucleotide derivative or a salt thereof according to any one of [8-2-1] to [8-2-5], wherein n10 is 2 when Y2 is -O-, and 3 when Y2 is a bond. [8-3-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-3. [8-3-2] The oligonucleotide derivative or a salt thereof according to [8-3-1], wherein R3 and R4 are hydrogen. [8-3-3] The oligonucleotide derivative or a salt thereof according to [8-3-1] or [8-3-2], wherein Y1 is a bond or -O-. [8-3-4] The oligonucleotide derivative or a salt thereof according to any one of [8-3-1] to [8-3-3], wherein Y3 and Y4 are bonds. [8-3-5] The oligonucleotide derivative or a salt thereof according to any one of [8-3-1] to [8-3-4], wherein the sum of n5 and n7 is 0. [8-3-6] The oligonucleotide derivative or a salt thereof according to any one of [8-3-1] to [8-3-5], wherein the sum of n6 and n8 is 5. [8-3-7] The oligonucleotide derivative or a salt thereof according to any one of [8-3-1] to [8-3-6], wherein n9 is 2 when Y1 is -O-, and 3 when Y1 is a bond. [8-4-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-4. [8-4-2] The oligonucleotide derivative or a salt thereof according to [8-4-1], wherein R1 and R2 are hydrogen atoms. [8-4-3] The oligonucleotide derivative or a salt thereof according to [8-4-1] or [8-4-2], wherein Y2 is a bond or -O-. [8-4-4] The oligonucleotide derivative or a salt thereof according to any one of [8-4-1] to [8-4-3], wherein Y3 and Y4 are bonds. [8-4-5] The oligonucleotide derivative or a salt thereof according to any one of [8-4-1] to [8-4-4], wherein the sum of n5 and n7 is 5. [8-4-6] The oligonucleotide derivative or a salt thereof according to any one of [8-4-1] to [8-4-5], wherein the sum of n6 and n8 is 0. [8-4-7] The oligonucleotide derivative or a salt thereof according to any one of [8-4-1] to [8-4-6], wherein n10 is 2 when Y2 is -O-, and 3 when Y2 is a bond. [8-5-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-5. [8-5-2] The oligonucleotide derivative or a salt thereof according to [8-5-1], wherein R1' and R2' are hydrogen atoms. [8-5-3] The oligonucleotide derivative or a salt thereof according to [8-5-1] or [8-5-2], wherein R3' and R4' are hydrogen atoms. [8-5-4] The oligonucleotide derivative or a salt thereof according to any one of [8-5-1] to [8-5-3], wherein R5' is independently a hydrogen atom or methyl for each carbon atom to which it is bonded. [8-5-5] The oligonucleotide derivative or a salt thereof according to any one of [8-5-1] to [8-5-4], wherein R6' is a hydrogen atom. [8-5-6] The oligonucleotide derivative or a salt thereof according to any one of [8-5-1] to [8-5-5], wherein n5' is 2. [8-5-7] The oligonucleotide derivative or a salt thereof according to any one of [8-5-1] to [8-5-6], wherein n6' is 2. [8-6-1] The oligonucleotide derivative or a salt thereof according to [8], wherein M is a group represented by formula 3-6. [8-6-2] The oligonucleotide derivative or a salt thereof according to [8-6-1], wherein R1' and R2' are hydrogen atoms. [8-6-3] The oligonucleotide derivative or a salt thereof according to [8-6-1] or [8-6-2], wherein R3' and R4' are hydrogen atoms. [8-6-4] The oligonucleotide derivative or a salt thereof according to any one of [8-6-1] to [8-6-3], wherein R5' is independently a hydrogen atom or methyl for each carbon atom to which it is bonded. [8-6-5] The oligonucleotide derivative or a salt thereof according to any one of [8-6-1] to [8-6-4], wherein R6' is a hydrogen atom. [8-6-6] The oligonucleotide derivative or a salt thereof according to any one of [8-6-1] to [8-6-5], wherein n5' is 2. [8-6-7] The oligonucleotide derivative or a salt thereof according to any one of [8-6-1] to [8-6-6], wherein n6' is 2. [8-7] The oligonucleotide derivative or a salt thereof according to any one of [6] to [7], wherein M is a moiety consisting of 2 to 6 amino acid residues. [8A] The oligonucleotide derivative or a salt thereof according to any one of [6] to [8-7], wherein L1 and L2 are each independently selected from the group consisting of formulae 2-1 to 2-4. [ka] (In the formula, n3 and n4 each independently represent an integer of 1 to 15. Ak represents a C2-C22 alkylene group which may have a substituent; Base represents a hydrogen atom, an optionally substituted adeninyl, an optionally substituted guaninyl, an optionally substituted cytosinyl, an optionally substituted thyminyl, or an optionally substituted uracinyl; Q represents a hydrogen atom, a hydroxyl group, a halogen atom, or a C1-C4 alkyloxy group which may have a substituent; Z represents an oxygen atom or a sulfur atom. [8A-1-1] The oligonucleotide derivative or a salt thereof according to [8A], wherein one Z is an oxygen atom and the other Z is a sulfur atom. [8A-1-2] The oligonucleotide derivative or salt thereof according to [8A] or [8A-1-1], wherein the substituent in the optionally substituted C2-C22 alkylene is selected from the group consisting of an optionally substituted aryl group, an optionally substituted amino group, and an optionally substituted alkoxy group. [8A-1-3] The oligonucleotide derivative or a salt thereof according to [8A-1-2], wherein the optionally substituted aryl group is represented by the following structure: [ka] [8A-1-4] The oligonucleotide derivative or a salt thereof according to [8A-1-2], wherein the amino group which may have a substituent is represented by the following structure: [ka] [8A-1-5] The oligonucleotide derivative or a salt thereof according to [8A-1-2], wherein the optionally substituted alkoxy group is represented by the following structure: [ka] [8A-1-6] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-5], wherein n4 is an integer of 1 to 3. [8A-1-7] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-6], wherein Base is uracinyl which may have a substituent. [8A-1-8] The oligonucleotide derivative or a salt thereof according to [8A-1-7], wherein the optionally substituted uracinyl is represented by the following structure: [ka] [8A-1-9] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-8], wherein Q is a hydrogen atom or a C1-C4 alkyloxy group. [8A-1-10] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-9], wherein n3 is 3. [8A-2-1] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-10], wherein L1 is formula 2-1. [8A-2-2] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-10], wherein L1 is formula 2-2. [8A-2-3] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-10], wherein L1 is formula 2-3. [8A-2-4] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-1-10], wherein L1 is formula 2-4. [8A-3-1] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-2-4], wherein L2 is formula 2-1. [8A-3-2] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-2-4], wherein L2 is formula 2-2. [8A-3-3] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-2-4], wherein L2 is formula 2-3. [8A-3-4] The oligonucleotide derivative or a salt thereof according to any one of [8A] to [8A-2-4], wherein L2 is formula 2-4. [9] The oligonucleotide derivative or a salt thereof according to any one of [6] to [8A-3-4], which has at least one targeting compound.

[10] The oligonucleotide derivative or a salt thereof according to [9], wherein the targeting compound is bound to at least one of L1 and L2.

[11] The oligonucleotide derivative or a salt thereof according to [9] or

[10] , wherein the targeting compound is selected from the group consisting of cholesterol, tocopherol, docosahexaenoic acid, myristic acid, palmitic acid and N-acetyl-D-galactosamine.

[12] A pharmaceutical composition comprising the oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] .

[13] The pharmaceutical composition described in

[12] , which is administered intravenously or subcutaneously.

[14] A method for treating or preventing a disease, comprising administering to a patient in need thereof the oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , or the pharmaceutical composition according to

[12] or

[13] .

[15] An agent for suppressing expression of a target gene using RNA interference (RNAi), comprising the oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] .

[16] A cyclic oligonucleotide having formula 4, comprising at least one phosphorothioate bond. Formula 4: [ka] (In the formula, L3 and L4 represent linkers; m1 and m2 each independently represent an integer of 0 to 10; M2 represents a portion containing a chemical structure that is cleaved by the intracellular environment; X2 represents an oligonucleotide. [16-1-1] The cyclic oligonucleotide according to

[16] , having a length of 15 to 40 bases. [16-1-2] A cyclic oligonucleotide according to

[16] or [16-1-1], comprising at least one phosphorothioate bond. [16-1-3] The cyclic oligonucleotide according to any one of

[16] to [16-1-2], comprising at least one 2'-modified nucleotide. [16-2-1] The cyclic oligonucleotide according to any one of

[16] to [16-1-3], wherein the intracellular environment is an enzyme present within the cell. [16-2-2] The cyclic oligonucleotide according to any one of

[16] to [16-1-3], wherein the intracellular environment is intracellular pH. [16-2-3] The cyclic oligonucleotide according to any one of

[16] to [16-2-2], wherein m1 and m2 each independently represent an integer of 0 to 8.

[17] The cyclic oligonucleotide according to any one of

[16] to [16-2-3], wherein the chemical structure that is cleaved depending on the intracellular environment is -SS-, -SC(O)- or -C(O)-S-.

[18] The cyclic oligonucleotide according to any one of

[16] to

[17] , wherein M2 is selected from the group consisting of formulae 6-1 to 6-6. [ka] (In the formula, R1a and R2a each independently represent a hydrogen atom or a C1-C3 alkyl, or R1a and R2a together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3a and R4a each independently represent a hydrogen atom or a C1-C3 alkyl, or R3a and R4a together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; n5a to n8a each independently represent an integer of 0 to 10; n9a and n10a each independently represent an integer of 1 to 4; Y1a to Y4a each independently represent a bond, -NR5a-, -O-, or -S-; R5a represents a hydrogen atom, a C1-C3 alkyl or a C2-C4 alkanoyl. [ka] (In the formula, R1a' and R2a' each independently represent a hydrogen atom or a C1-C3 alkyl, or R1a' and R2a' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3a' and R4a' each independently represent a hydrogen atom or a C1-C3 alkyl, or R3a' and R4a' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R5a' and R6a' are each independently a hydrogen atom or a C1-C3 alkyl at each carbon atom to which they are attached; n5a' and n6a' each independently represent an integer of 1 to 10.) [18-1-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-1. [18-1-2] The cyclic oligonucleotide according to [18-1-1], wherein R1a to R4a are each independently a hydrogen atom or a C1-C3 alkyl. [18-1-3] The cyclic oligonucleotide according to [18-1-1] or [18-1-2], wherein Y3a and Y4a are a bond or -O-. [18-1-4] The cyclic oligonucleotide according to any one of [18-1-1] to [18-1-3], wherein the sum of n5a and n7a is an integer of 0 to 5. [18-1-5] The cyclic oligonucleotide according to any one of [18-1-1] to [18-1-4], wherein the sum of n6a and n8a is an integer of 0 to 5. [18-2-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-2. [18-2-2] The cyclic oligonucleotide according to [18-2-1], wherein Y1a and Y2a are each independently a bond or -O-. [18-2-3] The cyclic oligonucleotide according to [18-2-1] or [18-2-2], wherein Y3a and Y4a are bonds. [18-2-4] The cyclic oligonucleotide according to any one of [18-2-1] to [18-2-3], wherein the sum of n5a and n7a and the sum of n6a and n8a are 0. [18-2-5] The cyclic oligonucleotide according to any one of [18-2-1] to [18-2-4], wherein n9a is 2 when Y1a is -O-, and 3 when Y1a is a bond. [18-2-6] The cyclic oligonucleotide according to any one of [18-2-1] to [18-2-5], wherein n10a is 2 when Y2a is -O-, and 3 when Y2a is a bond. [18-3-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-3. [18-3-2] The cyclic oligonucleotide according to [18-3-1], wherein R3a and R4a are hydrogen. [18-3-3] The cyclic oligonucleotide according to [18-3-1] or [18-3-2], wherein Y1a is a bond or -O-. [18-3-4] The cyclic oligonucleotide according to any one of [18-3-1] to [18-3-3], wherein Y3a and Y4a are bonds. [18-3-5] The cyclic oligonucleotide according to any one of [18-3-1] to [18-3-4], wherein the sum of n5a and n7a is 0. [18-3-6] The cyclic oligonucleotide according to any one of [18-3-1] to [18-3-5], wherein the sum of n6a and n8a is 5. [18-3-7] The cyclic oligonucleotide according to any one of [18-3-1] to [18-3-6], wherein n9a is 2 when Y1a is -O-, and 3 when Y1a is a bond. [18-4-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-4. [18-4-2] The cyclic oligonucleotide according to [18-4-1], wherein R1a and R2a are hydrogen atoms. [18-4-3] The cyclic oligonucleotide according to [18-4-1] or [18-4-2], wherein Y2a is a bond or -O-. [18-4-4] The cyclic oligonucleotide according to any one of [18-4-1] to [18-4-3], wherein Y3a and Y4a are bonds. [18-4-5] The cyclic oligonucleotide according to any one of [18-4-1] to [18-4-4], wherein the sum of n5a and n7a is 5. [18-4-6] The cyclic oligonucleotide according to any one of [18-4-1] to [18-4-5], wherein the sum of n6a and n8a is 0. [18-4-7] The cyclic oligonucleotide according to any one of [18-4-1] to [18-4-6], wherein n10a is 2 when Y2a is -O-, and 3 when Y2a is a bond. [18-5-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-5. [18-5-2] The cyclic oligonucleotide according to [18-5-1], wherein R1a' and R2a' are hydrogen atoms. [18-5-3] The cyclic oligonucleotide according to [18-5-1] or [18-5-2], wherein R3a' and R4a' are hydrogen atoms. [18-5-4] The cyclic oligonucleotide according to any one of [18-5-1] to [18-5-3], wherein R5a' is, independently for each bonded carbon atom, a hydrogen atom or methyl. [18-5-5] The cyclic oligonucleotide according to any one of [18-5-1] to [18-5-4], wherein R6a' is a hydrogen atom. [18-5-6] The cyclic oligonucleotide according to any one of [18-5-1] to [18-5-5], wherein n5a' is 2. [18-5-7] The cyclic oligonucleotide according to any one of [18-5-1] to [18-5-6], wherein n6a' is 2. [18-6-1] The cyclic oligonucleotide according to

[18] , wherein M2 is formula 6-6. [18-6-2] The cyclic oligonucleotide according to [18-6-1], wherein R1a' and R2a' are hydrogen atoms. [18-6-3] The cyclic oligonucleotide according to [18-6-1] or [18-6-2], wherein R3a' and R4a' are hydrogen atoms. [18-6-4] The cyclic oligonucleotide according to any one of [18-6-1] to [18-6-3], wherein R5a' is, independently for each bonded carbon atom, a hydrogen atom or methyl. [18-6-5] The cyclic oligonucleotide according to any one of [18-6-1] to [18-6-4], wherein R6a' is a hydrogen atom. [18-6-6] The cyclic oligonucleotide according to any one of [18-6-1] to [18-6-5], wherein n5a' is 2. [18-6-7] The cyclic oligonucleotide according to any one of [18-6-1] to [18-6-6], wherein n6a' is 2. [18-7] The cyclic oligonucleotide according to any one of

[16] to

[17] , wherein M2 is a moiety consisting of 2 to 6 amino acid residues. [18A] The cyclic oligonucleotide according to any one of

[16] to [18-7], wherein L3 and L4 are each independently selected from the group consisting of formulae 5-1 to 5-4. [ka] (In the formula, n3a and n4a each independently represent an integer of 1 to 15. Ak' represents a C2-C22 alkylene group which may have a substituent; Base' represents a hydrogen atom, an optionally substituted adeninyl, an optionally substituted guaninyl, an optionally substituted cytosinyl, an optionally substituted thyminyl, or an optionally substituted uracinyl; Qa represents a hydrogen atom, a hydroxy group, a halogen atom, or a C1-C4 alkyloxy group which may have a substituent; Za represents an oxygen atom or a sulfur atom. [18A-1-1] The cyclic oligonucleotide according to [18A], wherein one Za is an oxygen atom and the other Za is a sulfur atom. [18A-1-2] The cyclic oligonucleotide according to [18A] or [18A-1-1], wherein the substituent in the optionally substituted C2-C22 alkylene is selected from the group consisting of an optionally substituted aryl group, an optionally substituted amino group, and an optionally substituted alkoxy group. [18A-1-3] The cyclic oligonucleotide according to [18A-1-2], wherein the aryl group which may have a substituent is represented by the following structure: [ka] [18A-1-4] The cyclic oligonucleotide according to [18A-1-2], wherein the amino group which may have a substituent is represented by the following structure: [ka] [18A-1-5] The cyclic oligonucleotide according to [18A-1-2], wherein the alkoxy group which may have a substituent is represented by the following structure: [ka] [18A-1-6] The cyclic oligonucleotide according to any one of [18A] to [18A-1-5], wherein n4a is an integer of 1 to 3. [18A-1-7] The cyclic oligonucleotide according to any one of [18A] to [18A-1-6], wherein Base' is uracinyl which may have a substituent. [18A-1-8] The cyclic oligonucleotide according to [18A-1-7], wherein the optionally substituted uracinyl is represented by the following structure: [ka] [18A-1-9] The cyclic oligonucleotide according to any one of [18A] to [18A-1-8], wherein Qa is a hydrogen atom or a C1-C4 alkyloxy group. [18A-1-10] The cyclic oligonucleotide according to any one of [18A] to [18A-1-9], wherein n3a is 3. [18A-2-1] The cyclic oligonucleotide according to any one of [18A] to [18A-1-10], wherein L3 is formula 5-1. [18A-2-2] The cyclic oligonucleotide according to any one of [18A] to [18A-1-10], wherein L3 is formula 5-2. [18A-2-3] The cyclic oligonucleotide according to any one of [18A] to [18A-1-10], wherein L3 is formula 5-3. [18A-2-4] The cyclic oligonucleotide according to any one of [18A] to [18A-1-10], wherein L3 is formula 5-4. [18A-3-1] The cyclic oligonucleotide according to any one of [18A] to [18A-2-4], wherein L4 is formula 5-1. [18A-3-2] The cyclic oligonucleotide according to any one of [18A] to [18A-2-4], wherein L4 is formula 5-2. [18A-3-3] The cyclic oligonucleotide according to any one of [18A] to [18A-2-4], wherein L4 is formula 5-3. [18A-3-4] The cyclic oligonucleotide according to any one of [18A] to [18A-2-4], wherein L4 is formula 5-4.

[19] A linear oligonucleotide comprising at least one phosphorothioate bond, as represented by formula 7. Formula 7: [ka] (In the formula, X2, L3, L4, m1 and m2 are as defined in any of

[16] , [16-2-3] and [18A] to [18A-3-4]; W1 and W2 are moieties that contain or result in functional groups that react with each other to form a chemical structure that is cleaved by the intracellular environment. [19-1] The cyclic oligonucleotide according to

[19] , wherein the intracellular environment is an enzyme present within the cell. [19-2] The cyclic oligonucleotide according to

[19] , wherein the intracellular environment is intracellular pH.

[20] The linear oligonucleotide according to any one of

[19] to [19-2], wherein the chemical structure that is cleaved depending on the intracellular environment is -SS-, -SC(O)- or -C(O)-S-. [twenty one] W1 and W2 are each independently -A1-SS-A2 or -B1-COO-B2 (except when W1 and W2 are simultaneously -B1-COO-B2); A1 and B1 are each independently a C2-C10 alkylene optionally having a substituent; A2 is an optionally substituted C1-C10 alkyl; B2 is a hydrogen atom or a C1-C6 alkyl which may have a substituent, and is a linear oligonucleotide described in any one of

[19] to

[20] .

[22] An expression inhibitor of a target gene using RNA interference (RNAi), which contains a linear oligonucleotide described in any one of

[19] to

[21] .

[23] A method for producing a cyclic oligonucleotide described in any one of

[16] to [18A-2-4], which includes cyclizing a linear oligonucleotide described in any one of

[19] to

[21] .

[24] A method for producing an oligonucleotide derivative or a salt thereof described in any one of [1] to

[11] , which includes complexing a cyclic oligonucleotide described in any one of

[16] to [18A-2-4] with a linear oligonucleotide having a base sequence complementary to the cyclic oligonucleotide via a hydrogen bond.

[0009] The present invention further includes the following embodiments. [25-1] An oligonucleotide derivative or a salt thereof described in any one of [1] to

[11] , a cyclic oligonucleotide described in any one of

[16] to [18A-3-4], or a linear oligonucleotide described in any one of

[19] to

[21] for use in the treatment of a disease. [25-2] An oligonucleotide derivative or a salt thereof described in any one of [1] to

[11] , a cyclic oligonucleotide described in any one of

[16] to [18A-3-4], or a linear oligonucleotide described in any one of

[19] to

[21] for use in suppressing the expression of a target gene. [26-1] A pharmaceutical composition for use in the treatment of a disease, which contains an oligonucleotide derivative or a salt thereof described in any one of [1] to

[11] , a cyclic oligonucleotide described in any one of

[16] to [18A-3-4], or a linear oligonucleotide described in any one of

[19] to

[21] . [26-2] A pharmaceutical composition for use in suppressing expression of a target gene, comprising an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] . [27-1] Use of an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] for treating a disease. [27-2] Use of an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] , for suppressing expression of a target gene. [28-1] Use of an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] in the manufacture of a medicament for treating a disease. [28-2] Use of an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] in the manufacture of a pharmaceutical for inhibiting the expression of a target gene. [29-1] An oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] , for use in producing a medicament for treating a disease. [29-2] An oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] , for use in producing a pharmaceutical for inhibiting the expression of a target gene. [30-1] A method for treating a disease, comprising administering to a subject in need thereof an effective amount of an oligonucleotide derivative or a salt thereof according to any one of [1] to

[11] , a cyclic oligonucleotide according to any one of

[16] to [18A-3-4], or a linear oligonucleotide according to any one of

[19] to

[21] . [30-2] A method for suppressing expression of a target gene, comprising administering to a subject in need thereof an effective amount of an oligonucleotide derivative or a salt thereof described in any of [1] to

[11] , a cyclic oligonucleotide described in any of

[16] to [18A-3-4], or a linear oligonucleotide described in any of

[19] to

[21] . Effect of the Invention

[0010] According to the present invention, it is possible to provide a novel oligonucleotide derivative that is resistant to degradation by nucleases and has strong knockdown activity. [Brief description of the drawings]

[0011] [Figure 1]FIG. 1 shows the knockdown activity of compound 1 and compound 2 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes. The test results are shown when HPRT1_dsRNA1, HPRT1_dsRNA2, and compounds 1 and 2 were added to mouse primary hepatocytes at concentrations of 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, respectively, and Medium shows the test results of the siRNA-unintroduced group (control group). The vertical axis shows the relative ratio of the HPRT1 mRNA amount of each siRNA-introduced sample to the HPRT1 mRNA amount of Medium (control group) as 1, as mean ± standard deviation with n=3. HPRT1_dsRNA1 and HPRT1_dsRNA2 are negative control groups for compound 1 and compound 2, respectively. [Diagram 2] FIG. 2 shows the knockdown activity of compound 3 against B2M target in mouse primary hepatocytes. The test results are shown when B2M_dsRNA and compound 3 were added to mouse primary hepatocytes at concentrations of 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative ratio of the B2M mRNA amount of each siRNA-introduced sample to the B2M mRNA amount of Medium (control group) as 1, expressed as the mean ± standard deviation with n=3. B2M_dsRNA is the negative control group for compound 3. [Diagram 3]FIG. 3 shows the knockdown activity of compound 4 and compound 5 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes. The test results are shown when HPRT1_dsRNA3, HPRT1_dsRNA4, and compounds 4 and 5 were added to mouse primary hepatocytes at concentrations of 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative ratio of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of Medium (control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA3 and HPRT1_dsRNA4 are negative control groups for compound 4 and compound 5, respectively. [Figure 4] FIG. 4 shows the knockdown activity of compound 6 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes. The test results are shown when HPRT1_dsRNA5 and compound 6 were added to mouse primary hepatocytes at concentrations of 0.3 μmol / L, 0.1 μmol / L, 0.03 μmol / L, and 0.01 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative ratio of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of Medium (control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA5 is the negative control group for compound 6. [Diagram 5]FIG. 5 shows the knockdown activity of compound 6 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in HeLa cells. The test results are shown when HPRT1_dsRNA5 and compound 6 were added to HeLa cells at concentrations of 3 μmol / L, 1 μmol / L, 0.3 μmol / L, and 0.1 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (negative control group). The vertical axis shows the relative proportion of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of the Medium group (negative control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA5 was used as a negative control group for compound 6. [Figure 6] FIG. 6 shows the knockdown activity of compound 6 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in HepG2 cells. The test results are shown when HPRT1_dsRNA5 and compound 6 were added to HepG2 cells at concentrations of 3 μmol / L, 1 μmol / L, 0.3 μmol / L, and 0.1 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative ratio of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of Medium (control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA5 is the negative control group for compound 6. [Figure 7]FIG. 7 shows the knockdown activity of compound 6 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in HuH-7 cells. The test results are shown when HPRT1_dsRNA5 and compound 6 were added to HuH-7 cells at concentrations of 3 μmol / L, 1 μmol / L, 0.3 μmol / L, and 0.1 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative proportion of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of Medium (control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA5 is the negative control group for compound 6. [Figure 8] FIG. 8 shows the knockdown activity of compound 6 against hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in RAW264.7 cells. The results are shown when HPRT1_dsRNA5 and compound 6 were added to RAW264.7 cells at concentrations of 3 μmol / L, 1 μmol / L, 0.3 μmol / L, and 0.1 μmol / L, respectively, and Medium shows the test results for the siRNA-unintroduced group (control group). The vertical axis shows the relative proportion of the HPRT1 mRNA amount of each of the above siRNA-introduced samples when the HPRT1 mRNA amount of Medium (control group) is set to 1, as the mean ± standard deviation with n=3. HPRT1_dsRNA5 is the negative control group for compound 6. [Figure 9] 9 shows the remaining rate of the antisense strand of compound 6 targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in rat serum. The horizontal axis shows the reaction time from the start of adding HPRT1_dsRNA5 and compound 6 to rat serum. The vertical axis shows the relative remaining rate at each time, expressed as the average ± standard deviation with n=3, when the amount of antisense strand at the start of the reaction is taken as 100%. HPRT1_dsRNA5 was used as a negative control for compound 6. [Figure 10]FIG. 10 shows the remaining rate of the antisense strand of compound 6 targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in an exonuclease-containing solution. The horizontal axis shows the reaction time from the start of adding HPRT1_dsRNA5 and compound 6 to the exonuclease-containing solution. The vertical axis shows the relative remaining rate at each time, expressed as the average ± standard deviation with n=3, when the amount of antisense strand at the start of the reaction is taken as 100%. HPRT1_dsRNA5 is a negative control group for compound 6. [Figure 11] FIG. 11 shows knockdown activity of phosphatase and tensin homolog deleted from chromosome 10 (PTEN) target by compound 7 and Factor 9 target by compound 8 in mouse primary hepatocytes. [Figure 12] FIG. 12 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 13] FIG. 13 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 14] FIG. 14 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 15] FIG. 15 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 16] FIG. 16 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 17] FIG. 17 shows the knockdown activity of each compound against the HPRT1 target in HeLa cells. [Figure 18] FIG. 18 shows the knockdown activity of compound 47 on the HPRT1 target in HeLa cells. [Figure 19] FIG. 19 shows the knockdown activity of compounds 48 and 49 of the HPRT1 target in mouse primary hepatocytes. [Figure 20] FIG. 20 shows the knockdown activity of compound 50 of the B2M target in mouse primary hepatocytes. [Figure 21]FIG. 21 shows the knockdown activity of compound 51 on the HPRT1 target in HeLa cells. [Figure 22] FIG. 22 shows the knockdown activity of compound 52 targeting PTEN and compound 53 targeting Factor 9 in mouse primary hepatocytes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] <Oligonucleotide derivatives> The present invention relates to an oligonucleotide derivative comprising a cyclic oligonucleotide and a linear oligonucleotide, the cyclic oligonucleotide and the linear oligonucleotide having complementary base sequences, and the cyclic oligonucleotide and the linear oligonucleotide forming a complex through hydrogen bonds of the complementary base sequences. In this specification, the oligonucleotide derivative of the present invention is also referred to as a nucleic acid complex.

[0013] In the present invention, cyclic oligonucleotides and linear oligonucleotides are used, but regardless of whether they are cyclic or linear, the oligonucleotide may be any molecule that is a polymer of nucleotides, such as DNA, which is a polymer of deoxyribonucleotides, RNA, which is a polymer of ribonucleotides, and chimeric nucleic acids, which are polymers of DNA and RNA. The oligonucleotide may be a nucleotide polymer containing a molecule having a function equivalent to that of a nucleotide in place of all or a part of the nucleotides, or a nucleotide polymer in which at least one nucleotide such as a deoxyribonucleotide or ribonucleotide is replaced with a molecule having a function equivalent to that of a nucleotide in DNA, RNA, or chimeric nucleic acid. Uracil (U) in RNA is unambiguously interpreted as thymine (T) in DNA. Of the nucleotides constituting the oligonucleotide, all the nucleotides may have the same function as nucleotides, or some of the nucleotides may have the same function as nucleotides.

[0014] Molecules having functions equivalent to those of nucleotides include, for example, nucleotide derivatives in which nucleotides have been modified. The use of nucleotide derivatives has the advantages, but is not limited to, of improving or stabilizing nuclease resistance, increasing affinity with complementary nucleic acid, and / or increasing cell permeability, compared to DNA or RNA. Examples of nucleotide derivatives include sugar-modified nucleotides, phosphodiester bond-modified nucleotides, base-modified nucleotides, and nucleotides in which two or more of the sugar moiety, phosphodiester bond, and base are modified simultaneously.

[0015] The sugar-modified nucleotide may be any nucleotide in which part or all of the chemical structure of the sugar of the nucleotide is modified or substituted with any substituent, or substituted with any atom, but 2'-modified nucleotides are preferably used. Examples of 2'-modified nucleotides include those in which the 2'-OH group of ribose is -OR, -R, -R'OR, -SH, -SR, or -NH 2 , -NHR, -NR 2 , -N 3 (azido), -CN (cyano), -F, -Cl, -Br and -I, where R is alkyl or aryl, preferably alkyl having 1 to 6 carbon atoms, R' is alkylene, preferably alkylene having 1 to 6 carbon atoms, and -NR 2 and the two R may be the same or different). As the 2'-modified nucleotide, a 2'-modified nucleotide in which the 2'-OH group of ribose is substituted with -F, a methoxy group or an ethoxy group is preferably used. Examples of the 2'-modified nucleotide include 2'-modified nucleotides in which the 2'-OH group of ribose is substituted with a substituent selected from the group consisting of a 2-(methoxy)ethoxy group, a 3-aminopropoxy group, a 2-[(N,N-dimethylamino)oxy]ethoxy group, a 3-(N,N-dimethylamino)propoxy group, a 2-[2-(N,N-dimethylamino)ethoxy]ethoxy group, a 2-(methylamino)-2-oxoethoxy group, a 2-(N-methylcarbamoyl)ethoxy group, and a 2-cyanoethoxy group.

[0016] As another embodiment of sugar-modified nucleotides, bridged nucleic acids (BNAs) having two cyclic structures by introducing a bridged structure into the sugar moiety can also be suitably used. Examples of sugar-modified nucleotides include locked nucleic acids (LNAs) in which the 2'-position oxygen atom and the 4'-position carbon atom are bridged via a methylene [Tetrahedron Letters, 38, 873 (1997) and Tetrahedron, 54, 3607 (1998)], ethylene bridged nucleic acids (ENAs) [Nucleic Acid Research, 32, e175 (2004)], constrained ethyl (cEt) [The Journal of Organic Chemistry 75, 1569 (2010)], amido-bridged nucleic acid (AmNA) [Chem Bio Chem 13, 2513 (2012)], and 2'-O, 4'-c-spirocyclopropylene bridged nucleic acid (scpBNA) [Chem. Commun., 51, 9737 (2015)]. Examples of sugar-modified nucleotides include peptide nucleic acid (PNA) [Acc. Chem. Res., 32, 624 (1999)], oxypeptide nucleic acid (OPNA) [J. Am. Chem. Soc., 123, 4653 (2001)], and peptide ribonucleic acid (PRNA) [J. Am. Chem. Soc., 122, 6900 (2000)].

[0017] A phosphodiester bond modified nucleotide may be any nucleotide in which a part or all of the chemical structure of the phosphodiester bond of a nucleotide is modified or substituted with any substituent, or substituted with any atom. Examples of phosphodiester bond-modified nucleotides include nucleotides in which a phosphodiester bond has been replaced with a phosphorothioate bond, nucleotides in which a phosphodiester bond has been replaced with a phosphorodithioate bond, nucleotides in which a phosphodiester bond has been replaced with an alkylphosphonate bond, and nucleotides in which a phosphodiester bond has been replaced with a phosphoroamidate bond, and preferably nucleotides in which a phosphodiester bond has been replaced with a phosphorothioate bond.

[0018] A base-modified nucleotide may be any nucleotide in which a part or all of the chemical structure of the base of the nucleotide is modified or substituted with any substituent, or substituted with any atom. Examples of base-modified nucleotides include nucleotides in which the oxygen atom in the base is replaced with a sulfur atom, nucleotides in which the hydrogen atom is replaced with an alkyl group having 1 to 6 carbon atoms or a halogen group, nucleotides in which the methyl group is replaced with a hydrogen atom, a hydroxymethyl group, or an alkyl group having 2 to 6 carbon atoms, and nucleotides in which the amino group is replaced with an alkyl group having 1 to 6 carbon atoms, an alkanoyl group having 1 to 6 carbon atoms, an oxo group, a hydroxy group, or the like. Examples of base-modified nucleotides include nucleotides in which cytosine (C) is replaced with 5-methylcytosine (5-mC).

[0019] In the cyclic or linear oligonucleotides in the nucleotide derivatives, the oligonucleotide portion may simultaneously have two or more of the substitutions described as sugar-modified nucleotides, phosphodiester bond-modified nucleotides and base-modified nucleotides.

[0020] An oligonucleotide containing a base sequence complementary to a part of the base sequence of the mRNA of a target gene, preferably the mRNA of a human target gene, is called an antisense strand, and an oligonucleotide containing a base sequence complementary to the base sequence of the antisense strand is called a sense strand. The sense strand can pair with the antisense strand to form a double strand. As the sense strand, an oligonucleotide itself consisting of a partial base sequence of the mRNA of a target gene, preferably the mRNA of a human target gene, may be used. The cyclic oligonucleotide of the present invention may comprise either antisense strand or sense strand, but preferably comprises sense strand.When cyclic oligonucleotide comprises antisense strand, preferably comprises linear nucleotide comprises sense strand, and when cyclic oligonucleotide comprises sense strand, more preferably comprises antisense strand.

[0021] In the oligonucleotide derivative of the present invention, the cyclic oligonucleotide and the linear oligonucleotide have complementary base sequences, and form a complex via hydrogen bonds between the complementary base sequences. The oligonucleotide derivative of the present invention has resistance to nucleases due to the formation of a complex between a cyclic oligonucleotide and a linear oligonucleotide. In the nucleic acid complex, the cyclic oligonucleotide and the linear oligonucleotide may form a double strand in whole or in part at the complementary base sequence portion. In the present invention, the cyclic oligonucleotide has a structure that is cleaved in cells, and is cleaved and converted into a linear double-stranded oligonucleotide after being delivered to a specific cell. The linear double-stranded oligonucleotide is generally considered to show a strong knockdown activity by forming a complex with an intracellular protein called RNA induced silencing complex (RISC) and then inducing target mRNA cleavage by RISC.

[0022] In the present invention, when referring to an antisense strand and a sense strand, the antisense strand is complementary to a partial base sequence of the mRNA of a target gene, and the sense strand is complementary to the antisense strand. In the present invention, the cyclic oligonucleotide and the linear oligonucleotide have complementary base sequences. As used herein, "complementary" refers not only to a case in which the base sequences of one oligonucleotide and the other oligonucleotide are completely complementary to each other, but also to a case in which the base sequences may have 30% or less, 20% or less, or 10% or less mismatched bases. One oligonucleotide and the other oligonucleotide may have 1 to 8, preferably 1 to 6, 1 to 4, or 1 to 3, and particularly 2 or 1 mismatch bases in their complementary base sequences. As used herein, for example, one oligonucleotide having a complementary base sequence to another oligonucleotide may have a base sequence in which one or more bases have been substituted, added and / or deleted from the completely complementary base sequence.

[0023] In the oligonucleotide derivatives of the present invention, the mutually complementary base sequences of the cyclic oligonucleotide and the linear oligonucleotide are generally 15 to 27 base pairs, preferably 15 to 25 base pairs, and more preferably 19 to 23 base pairs. There is no particular limitation as long as hydrogen bonds are formed in the complementary base sequences of the cyclic oligonucleotide and the linear oligonucleotide, but as long as the bases in the oligonucleotide of the cyclic oligonucleotide and the bases in the oligonucleotide of the linear oligonucleotide face each other so as to form hydrogen bonds, they may form base pairs or may be mismatched. When either the cyclic oligonucleotide or the linear oligonucleotide has an antisense strand, the oligonucleotide having the antisense strand may have a mutually complementary base sequence of usually 15 to 27 base pairs, and may also have a base sequence of 1 to 7 bases, preferably 2 to 4 bases, more preferably 2 bases, at the 3' end of the base sequence.

[0024] The cyclic oligonucleotide used in the present invention may comprise only an oligonucleotide and a chemical structure that is cleaved in vivo to cause cyclic formation, or the oligonucleotide may be linked to the chemical structure that is cleaved in vivo via a linker to cause cyclic formation of the oligonucleotide. The oligonucleotide of the cyclic oligonucleotide may be an oligonucleotide consisting of only nucleotides, an oligonucleotide containing a nucleotide derivative, or an oligonucleotide modified with a component other than nucleotides or nucleotide derivatives. The oligonucleotide of the cyclic oligonucleotide preferably has a base sequence of 15 to 80 bases, more preferably has a base sequence of 15 to 40 bases, and even more preferably has a base sequence of 15 to 30 bases.

[0025] The linear oligonucleotide used in the present invention is composed of an oligonucleotide, and the term "linear" means that the entire structure of the linear oligonucleotide is a straight single-stranded structure. A linear oligonucleotide may be an oligonucleotide consisting of only nucleotides, an oligonucleotide containing nucleotide derivatives, or an oligonucleotide that has been modified with a component other than nucleotides or nucleotide derivatives. The linear oligonucleotide preferably has a base sequence of 15 to 80 bases in length, more preferably has a base sequence of 15 to 40 bases in length, even more preferably has a base sequence of 19 to 30 bases in length, and even more preferably has a base sequence of 19 to 25 bases in length.

[0026] In the oligonucleotide derivatives of the present invention, the base length of the cyclic oligonucleotide is preferably the same as or longer than the base length of the linear oligonucleotide. The cyclic oligonucleotide and the linear oligonucleotide each have a preferred base sequence of 15 to 80 bases in length, and the length of the oligonucleotide portion in the cyclic oligonucleotide is preferably 1 to 10 bases longer than the base length of the linear oligonucleotide, more preferably 2 to 8 bases longer, and even more preferably 4 to 6 bases longer.

[0027] The cyclic oligonucleotide of the present invention is preferably an oligonucleotide represented by formula 1. Formula 1: [ka] (In formula 1, L1 and L2 represent a linker, n1 and n2 each independently represent an integer of 0 to 10, M represents a portion including a chemical structure that is cleaved by the intracellular environment, and X represents an oligonucleotide.) The intracellular environment includes, for example, enzymes present within the cell, intracellular pH, and the like.

[0028] In formula 1, n1 and n2 may each independently be an integer from 0 to 8, an integer from 0 to 6, an integer from 0 to 4, an integer from 1 to 8, an integer from 2 to 8, an integer from 3 to 8, or an integer from 4 to 8.

[0029] In formula 1, when n1 and n2 are both 0, L1 and L2 do not exist, forming a cyclic oligonucleotide as shown in formula 1-1. Formula 1-1: [ka] (In formula 1-1, M and X have the same meanings as those in formula 1.)

[0030] When L1 and L2 are absent, X is preferably linked to M at the 5' and 3' ends of the oligonucleotide, respectively.

[0031] L1 is not particularly limited as long as it has a structure that links the 5'-end of the oligonucleotide which is X to M, and may be a known structure used to modify the 5'-end or 3'-end in the synthesis of oligonucleotides. When present, L1 and L2 are preferably linked to X and to M, respectively, via a phosphodiester bond, a phosphorothioate bond or a phosphorodithioate bond.

[0032] L1 and L2 may have the same structure or different structures. In addition, when n1 and n2 are each an integer of 2 or more, the repeating structures of L1 and L2 may be the same structure or may be a structure in which different structures are linked together.

[0033] M in formula 1 represents a moiety that contains a chemical structure that is cleaved by the intracellular environment. As chemical structures that are cleaved depending on the intracellular environment, for example, the structures shown in Table 1 are known.

[0034] [Table 1]

[0035] As the chemical structure in M ​​that is cleaved depending on the intracellular environment, -SS-, -C(O)-S, and -SC(O)- are preferred.

[0036] M is preferably selected from the group consisting of formulas 3-1 to 3-6. [ka] (In the formula, R1 and R2 each independently represent a hydrogen atom or a C1-C3 alkyl, or R1 and R2 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3 and R4 each independently represent a hydrogen atom or a C1-C3 alkyl, or R3 and R4 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; n5 to n8 each independently represent an integer of 0 to 10; n9 and n10 each independently represent an integer of 1 to 4; Y1 to Y4 each independently represent a bond, -NR5-, -O-, or -S-; R5 represents a hydrogen atom, a C1-C3 alkyl, or a C2-C4 alkanoyl. [ka] (In the formula, R1' and R2' each independently represent a hydrogen atom or a C1-C3 alkyl, or R1' and R2' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3' and R4' each independently represent a hydrogen atom or a C1-C3 alkyl, or R3' and R4' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R5' and R6' are each independently a hydrogen atom or a C1-C3 alkyl group at each carbon atom to which they are attached; n5' and n6' each independently represent an integer of 1 to 10.

[0037] In formula 3-1, it is preferable that R1 to R4 each independently represent a hydrogen atom or a C1-C3 alkyl. In formula 3-1, Y3 and Y4 are preferably a bond or -O-. In formula 3-1, the sum of n5 and n7 is preferably an integer of 0-5. In formula 3-1, the sum of n6 and n8 is preferably an integer of 0-5.

[0038] In formula 3-2, it is preferable that Y1 and Y2 each independently represent a bond or -O-. In formula 3-2, Y3 and Y4 are preferably a bond. In formula 3-2, the sum of n5 and n7 and the sum of n6 and n8 are preferably 0. In formula 3-2, n9 is preferably 2 when Y1 is --O--, and is preferably 3 when Y1 is a bond. In formula 3-2, n10 is preferably 2 when Y2 is --O--, and is preferably 3 when Y2 is a bond.

[0039] In formula 3-3, R3 and R4 are preferably hydrogen. In formula 3-3, Y1 is preferably a bond or -O-. In formula 3-3, Y3 and Y4 are preferably a bond. In formula 3-3, the sum of n5 and n7 is preferably 0. In formula 3-3, the sum of n6 and n8 is preferably 5. In formula 3-3, n9 is preferably 2 when Y1 is --O--, and is preferably 3 when Y1 is a bond.

[0040] In formula 3-4, R1 and R2 are preferably hydrogen atoms. In formula 3-4, Y2 is preferably a bond or -O-. In formula 3-4, Y3 and Y4 are preferably a bond. In formula 3-4, the sum of n5 and n7 is preferably 5. In formula 3-4, the sum of n6 and n8 is preferably 0. In formula 3-4, n10 is preferably 2 when Y2 is --O--, and is preferably 3 when Y2 is a bond.

[0041] In formulas 3-5, R1' and R2' are preferably hydrogen atoms. In formula 3-5, R3' and R4' are preferably hydrogen atoms. In formulas 3-5, R5' is preferably a hydrogen atom or methyl, independently at each carbon atom to which it is bonded. In formula 3-5, R6' is preferably a hydrogen atom. In formula 3-5, n5' is preferably 2. In formula 3-5, n6' is preferably 2.

[0042] In formula 3-6, R1' and R2' are preferably hydrogen atoms. In formula 3-6, R3' and R4' are preferably hydrogen atoms. In formulae 3-6, R5' is preferably, independently at each carbon atom to which it is bonded, a hydrogen atom or methyl. In formula 3-6, R6' is preferably a hydrogen atom. In formula 3-6, n5' is preferably 2. In formula 3-6, n6' is preferably 2.

[0043] C1-C3 alkyl includes, for example, methyl, ethyl, propyl, isopropyl, and cyclopropyl. The C2-C4 alkanoyl has a structure in which a C1-C3 alkyl is bonded to a carbonyl group, and the C1-C3 alkyl portion in the C2-C4 alkanoyl has the same meaning as defined above. Examples of the ring having 3 to 6 carbon atoms include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0044] M may be a moiety consisting of 2 to 6 amino acid residues.

[0045] The structures of L1 and L2 are not particularly limited, but examples of L1 and L2 include structures of formulae 2-1 to 2-4. [ka] (In the formula, n3 and n4 each independently represent an integer of 1 to 15. Ak represents a C2-C22 alkylene group which may have a substituent; Base represents a hydrogen atom, an optionally substituted adeninyl, an optionally substituted guaninyl, an optionally substituted cytosinyl, an optionally substituted thyminyl, or an optionally substituted uracinyl; Q represents a hydrogen atom, a hydroxyl group, a halogen atom, or a C1-C4 alkyloxy group which may have a substituent; Z represents an oxygen atom or a sulfur atom.

[0046] In formulae 2-1 to 2-4, it is preferable that one Z is an oxygen atom and the other Z is a sulfur atom.

[0047] In Ak of ​​formula 2-1, examples of the substituent for the C2-C22 alkylene include an aryl group which may have a substituent, an amino group which may have a substituent, and an alkoxy group which may have a substituent. Examples of the aryl group which may have a substituent include the following structures. [ka] Examples of the amino group which may have a substituent include the following structures. [ka] Examples of the alkoxy group which may have a substituent include the following structures. [ka]

[0048] In formula 2-2, n4 may be an integer of 1 to 12, an integer of 1 to 9, an integer of 1 to 6, or an integer of 1 to 3.

[0049] In formula 2-3, Base is preferably uracinyl which may have a substituent. Examples of uracinyl which may have a substituent include the following structure. [ka]

[0050] In formula 2-3, Q is preferably a hydrogen atom or a C1-C4 alkyloxy group which may have a substituent, and more preferably a hydrogen atom or a C1-C4 alkyloxy group.

[0051] In formula 2-4, n3 may be an integer of 1 to 12, an integer of 1 to 9, an integer of 1 to 6, an integer of 1 to 3, or 3.

[0052] In formulas 2-1 to 2-4, Z - The counter ion is not particularly limited, but may be, for example, a proton (H + ), metal ions, ammonium ions, etc. Examples of the metal ion include alkali metal ions such as sodium ion and potassium ion, alkaline earth metal ions such as magnesium ion and calcium ion, aluminum ion, and zinc ion. Examples of the ammonium ion include ammonium ion and tetramethylammonium ion.

[0053] In the formulae 3-1 to 3-6, when L1 and L2 are present, the black circles are preferably linked by phosphodiester bonds or phosphorothioate bonds contained in L1 and L2, respectively. Specifically, the black circles in the formulae 3-1 to 3-6 are bonded to bonds represented as black circles from O (oxygen atom) bonded to P (phosphorus atom) in the structures represented by formulae 2-1 to 2-4 shown as suitable structures of L1 and L2. In this specification, when L1 and L2 are present, the black circle written above in the structures represented by Formulae 3-1 to 3-6 represents a bond to L1, and the black circle written below represents a bond to L2. In addition, the bond represented by a black circle from a carbon atom in the structures represented by Formulae 2-1 to 2-4 means a bond present at the 5'-end or 3'-end of the oligonucleotide, preferably a bond to a phosphodiester bond or a phosphorothioate bond.

[0054] In the present invention, when X and L1, and X and L2 are linked by a phosphodiester bond or a phosphorothioate bond (including the case where the cyclic oligonucleotide does not contain L1 or L2 and M is directly linked to X), the structure derived from the phosphodiester bond or phosphorothioate bond involved in the bond is understood to be the structure of the oligonucleotide. In the present invention, the 5'-end and / or 3'-end of the linear oligonucleotide may be modified with a phosphate group or a thiophosphate group.

[0055] In the present invention, the salt of an oligonucleotide derivative is not particularly limited, but examples thereof include acid addition salts, metal salts, ammonium salts, organic amine addition salts, and amino acid addition salts. Examples of the acid addition salts include inorganic acid salts such as hydrochloride, sulfate, phosphate, etc., and organic acid salts such as acetate, maleate, fumarate, citrate, methanesulfonate, etc. Examples of the metal salt include alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as magnesium salts and calcium salts, aluminum salts, and zinc salts. Examples of the ammonium salt include ammonium salt and tetramethylammonium salt. Examples of the organic amine addition salts include salts with organic amines such as morpholine and piperidine, and examples of the amino acid addition salts include salts with amino acids such as lysine, glycine and phenylalanine.

[0056] In the present invention, a targeting compound may be added to an appropriate site of the cyclic oligonucleotide and / or linear oligonucleotide. The targeting compound means a group derived from a compound capable of binding to a receptor expressed in a target cell. In the present invention, a targeting compound that becomes a target cell of the oligonucleotide may be selected. The targeting compound is preferably bound to at least one of L1 and L2. Examples of the targeting compound include cholesterol, tocopherol, docosahexaenoic acid, myristic acid, palmitic acid, and N-acetyl-D-galactosamine. As the targeting compound, several ligand-nucleic acid complexes have been reported that utilize N-acetyl-D-galactosamine (GalNAc) as a sugar ligand capable of binding to the asialoglycoprotein receptor (ASGPR) that is highly expressed in hepatocytes. (For example, Journal of American Chemical Society, 2014, Vol. 136, pp. 16958-16961, International Publication No. 2017 / 131236, etc.). Examples of the structure of L1 and L2 to which the targeting compound is bound include formula 8 or formula 9 below. Formula 8: [ka] (In the formula, Z has the same meaning as defined above.)

[0057] <Cyclic Oligonucleotide> The present invention also covers the cyclic oligonucleotide itself contained in the above oligonucleotide derivatives. The cyclic oligonucleotide is represented by formula 4, which contains at least one phosphorothioate bond. Formula 4: [ka] (In the formula, L3 and L4 represent linkers; m1 and m2 represent integers of 0 to 10; M2 represents a portion containing a chemical structure that is cleaved by the intracellular environment; X2 represents an oligonucleotide.

[0058] In formula 4, when m1 and m2 are both 0, L3 and L4 do not exist, forming a cyclic oligonucleotide as shown in formula 4-1. Equation 4-1: [ka] (In formula 4-1, M2 and X2 have the same meanings as those in formula 4.)

[0059] When L3 and L4 are absent, X2 is preferably linked to M2 at the 5' and 3' ends of the oligonucleotide, respectively.

[0060] Preferred embodiments of the cyclic oligonucleotide represented by formula 4 are as described for formula 1, formula 2-1 to formula 2-4, and formula 3-1 to formula 3-6, and L3, L4, m1, m2, M2, and X2 in formula 4 correspond to L1, L2, n1, n2, M, and X in formula 1, respectively.

[0061] <Linear oligonucleotides> The present invention is also directed to linear oligonucleotides, which are precursors of the above cyclic oligonucleotides, containing at least one phosphorothioate bond, as represented by formula 7. The linear oligonucleotides themselves also have knockdown activity. Formula 7: [ka] (In the formula, X2, L3, L4, m1, and m2 are as defined for Formula 4; W1 and W2 are moieties that contain or result in functional groups that react with each other to form a chemical structure that is cleaved by the intracellular environment.

[0062] The chemical structure that is cleaved by the intracellular environment is as described for M in formula 1.

[0063] It is preferred that W1 and W2 each independently represent -A1-SS-A2 or -B1-COO-B2 (except when W1 and W2 are simultaneously -B1-COO-B2). It is preferable that A1 and B1 each independently represent a C2-C10 alkylene group which may have a substituent. A2 is preferably an optionally substituted C1-C10 alkyl, and the substituent is preferably a hydroxyl group. B2 is preferably a hydrogen atom or an optionally substituted C1-C6 alkyl.

[0064] <Method of producing oligonucleotide derivatives> The above oligonucleotide derivative can be produced, for example, by a method comprising the steps of: cyclizing a linear oligonucleotide represented by formula 7 to form a cyclic oligonucleotide represented by formula 4; and complexing the cyclic oligonucleotide represented by formula 4 with a linear oligonucleotide having a base sequence complementary to the cyclic oligonucleotide via hydrogen bonds.

[0065] An example of a method for producing the oligonucleotide derivative of the present invention will be described below. Linear oligonucleotides can be produced by known chemical synthesis methods, such as the phosphoramidite method, the phosphorothioate method, the phosphotriester method, and the CEM method (see Nucleic Acids Research, 35, 3287 (2007)). Specifically, linear oligonucleotides can be synthesized using an ABI3900 high-throughput nucleic acid synthesizer (Applied Biosystems).

[0066] The cyclic oligonucleotide can be synthesized by referring to the method described in the Examples, and appropriately using reagents corresponding to structures corresponding to L1, L2 and M. The oligonucleotide portion of the cyclic oligonucleotide can be produced by the same method as that for the linear oligonucleotide. In addition, by using the solid phase method, structures corresponding to L1, L2 and M can be constructed on the solid phase, and then a structure in M ​​that is cleaved within the cell can be chemically constructed and the oligonucleotide can be circularized.

[0067] Solid-phase reagents and amidites for use in the solid-phase method are commercially available or can be obtained by known methods (Bioconjugate Chem., Vol. 20, No. 6, pp. 1065-1094, 2009) or methods equivalent thereto. In addition, the compound can also be produced by the following method. In the following production methods, if the defined groups change under the conditions of the production method or are inappropriate for carrying out the production method, the target compound can be produced by using a method for introducing and removing a protecting group commonly used in organic synthesis chemistry [for example, the method described in Protective Groups in Organic Synthesis, third edition, TW Greene, John Wiley & Sons Inc. (1999)]. In addition, the order of reaction steps such as introducing a substituent can be changed as necessary.

[0068] <Solid-phase reagent manufacturing method A> [ka] (In the formula, R3, R4, Y4, n6, and n8 are each as defined above, m1 represents an integer of 2 to 20, E represents a leaving group such as a chlorine atom, a bromine atom, an iodine atom, trifluoromethanesulfonyloxy, methanesulfonyloxy, benzenesulfonyloxy, p-toluenesulfonyloxy, or 2-nitrobenzenesulfonyloxy, T represents a hydrogen atom or a nitro group, Ac represents an acetyl group, DMTr represents a dimethoxytrityl group, and Po represents a solid-phase reagent such as CPG (controlled pore glass) or a polymer.)

[0069] Process 1 Compound (A2) can be produced by reacting compound (A1) with one equivalent or more of p,p'-dimethoxytrityl chloride in pyridine solvent, optionally in the presence of a co-solvent, at a temperature between 0°C and the boiling point of the solvent for 5 minutes to 100 hours. Examples of the co-solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, tetrahydrofuran, 1,2-dimethoxyethane, dioxane, N,N-dimethylformamide (DMF), N,N-dimethylacetamide, N-methylpyrrolidone, water, and the like, which may be used alone or in combination. Compound (A1) is commercially available, or can be obtained by a known method (e.g., 4th Edition, Experimental Chemistry Lecture Series 19 "Synthesis of Organic Compounds I", Maruzen (1992) and 4th Edition, Experimental Chemistry Lecture Series 20 "Synthesis of Organic Compounds II", Maruzen (1992)) or a method similar thereto.

[0070] Process 2 Compound (A3) can be produced by reacting compound (A2) with one equivalent or more of a halogenating reagent or a sulfonylation reagent in a solvent in the presence of one equivalent or more of a base at a temperature between -20°C and the boiling point of the solvent used for 5 minutes to 24 hours. Examples of halogenating and sulfonylation reagents include thionyl chloride, sulfuryl chloride, phosphorus trichloride, phosphorus pentachloride, phosphorus oxychloride, phosphorus tribromide, hydrogen bromide, hydrogen iodide, methanesulfonyl chloride (MsCl), methanesulfonic anhydride, p-toluenesulfonyl chloride (TsCl), o-nitrobenzenesulfonyl chloride (NsCl), trifluoromethanesulfonic anhydride, and the like. Examples of the solvent include methanol, ethanol, dichloromethane, chloroform, 1,2-dichloroethane, toluene, ethyl acetate, acetonitrile, diethyl ether, tetrahydrofuran, 1,2-dimethoxyethane, dioxane, N,N-dimethylformamide (DMF), N,N-dimethylacetamide, N-methylpyrrolidone, pyridine, water, and the like, which may be used alone or in combination. Examples of the base include cesium carbonate, potassium carbonate, potassium hydroxide, sodium hydroxide, sodium methoxide, potassium tert-butoxide, triethylamine, diisopropylethylamine, N-methylmorpholine, pyridine, 1,8-diazabicyclo[5.4.0]-7-undecene (DBU), N,N-dimethyl-4-aminopyridine (DMAP), and the like.

[0071] Process 3 Compound (A4) can be produced by reacting compound (A3) with 1 equivalent or more of thioacetic acid or thioacetic acid S-potassium salt in a solvent, optionally in the presence of 0.01 to 30 equivalents of an additive, at a temperature between room temperature and the boiling point of the solvent used, for 5 minutes to 100 hours. As the solvent, those exemplified in step 2 can be used. Examples of the additive include sodium iodide, potassium iodide, tetrabutylammonium iodide (TBAI), tetrabutylammonium chloride, and 18-crown-6-ether.

[0072] Process 4 Compound (A5) can be produced by reacting compound (A4) in the presence of 1 to 100 equivalents of a primary or secondary amine without or in a solvent at a temperature between room temperature and the solvent used for 5 minutes to 100 hours. As the solvent, those exemplified in step 2 can be used. Examples of primary amines include methylamine, ethylamine, etc. Examples of secondary amines include diethylamine, diisopropylamine, piperidine, etc.

[0073] Process 5 Compound (A7) can be produced by reacting compound (A5) with one equivalent or more of compound (A6) in a solvent, optionally in the presence of a base, at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 100 hours. As the solvent, those exemplified in step 2 can be used. Examples of the base include those exemplified in step 2. Compound (A6) can be produced by the following step 5-1. [ka] (In the formula, m1 and T are as defined above.) Compound (A10) can be obtained as a commercially available product.

[0074] Process 6 Compound (A8) can be produced by reacting compound (A7) with one equivalent or more of succinic anhydride in a solvent in the presence of one equivalent or more of a base at a temperature between room temperature and the boiling point of the solvent used for 5 minutes to 100 hours. As the solvent, those exemplified in step 2 can be used. Examples of the base include those exemplified in step 2.

[0075] Process 7 Compound (A9) can be produced by reacting compound (A8) with a terminally aminated solid-phase reagent without a solvent or in the presence of 1 to 50 equivalents of a base, a condensing agent and, if necessary, 0.01 to 30 equivalents of an additive, at a temperature between room temperature and the boiling point of the solvent used, for 5 minutes to 200 hours, and then isolating the solid-phase reagent once and further reacting it in a mixed solution of acetic anhydride / pyridine at room temperature to 200°C for 5 minutes to 100 hours. As the solvent, those exemplified in step 2 can be used. Examples of the base include those exemplified in step 2. Examples of the condensing agent include 1,3-dicyclohexanecarbodiimide (DCC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), N,N'-carbonyldiimidazole (CDI), N,N'-diisopropylcarbodiimide (DIC), benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate, (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate, O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU), O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HBTU), and 2-chloro-1-methylpyridinium iodide. Examples of additives include 1-hydroxybenzotriazole (HOBt) and 4-dimethylaminopyridine (DMAP). Aminated solid-phase reagents include, for example, long-chain alkylamine controlled pore glass (LCAA-CPG), which are commercially available.

[0076] Compound (A5) can also be produced by the following step 8. [ka] (In the formula, R3, R4, Y4, n6, n8, and DMTr are each defined as above.) Compound (A5) can be produced in the same manner as in step 1 using compound (A11). Compound (A11) is commercially available or can be obtained by a known method (e.g., Bioconjugate Chem., Vol. 22, No. 4, pp. 717-727, 2011; 4th Edition, Experimental Chemistry Lecture 24, "Synthesis of Organic Compounds VI," Maruzen (1992)) or a method similar thereto.

[0077] Among the compounds (A11), the compound (A11-a) in which R4 is hydrogen, n6 is 1, n8 is 1 and Y4 is a bond can be prepared by the following method. [ka] (In the formula, R3 and Ac are defined as above.) Process 9 Compound (A13) can be produced in the same manner as in step 3 using compound (A12). Compound (A12) is available as a commercially available product.

[0078] Step 10 Compound (A11-a) can be produced by reacting compound (A13) with a reducing agent in a solvent at a temperature between −20° C. and the boiling point of the solvent used for 5 minutes to 100 hours. The reducing agent is lithium borohydride (LiBH 4 ), sodium borohydride (NaBH 4 ), sodium cyanoborohydride (NaBH 3 CN), lithium triethylborohydride (LiBHEt 3 ), lithium aluminum hydride (LAH), diisobutylaluminum hydride (DIBAL), etc. As the solvent, those exemplified in step 2 can be used.

[0079] Compound (A7) can also be produced by the following method. [ka] (In the formula, R3, R4, Y4, E, n6, n8, m1 and DMTr are each defined as above, and Ts represents a p-toluenesulfonyl group.)

[0080] Process 5-2 Compound (A4') can be produced by reacting compound (A3) in a solvent in the presence of 1 to 100 equivalents of potassium p-toluenethiosulfonate, and optionally in the presence of an additive, at a temperature between 0°C and the boiling point of the solvent used for 5 minutes to 48 hours. As the solvent, those exemplified in step 2 can be used. Examples of the additives include those exemplified in step 3.

[0081] Process 5-3 Compound (A7) can be produced in the same manner as in step 5 using compound (A4') and compound (A10).

[0082] <Solid-phase reagent manufacturing method B> [ka] (In the formula, Y2, Y4, n6, n8, n10, m1, DMTr, Ac and Po are each defined as above.)

[0083] Compound (B9) can be prepared in the same manner as in the preparation method A of the solid phase reagent, except that compound (A1) and compound (A4) are replaced with compound (B1) and compound (B4), respectively. Compound (B1) is commercially available, or can be obtained by a known method (for example, 4th Edition, Experimental Chemistry Lecture Series 19 "Synthesis of Organic Compounds I", Maruzen (1992) and 4th Edition, Experimental Chemistry Lecture Series 20 "Synthesis of Organic Compounds II", Maruzen (1992)) or a method similar thereto.

[0084] Among the compounds (B4), (B4-a) in which Y2 is a bond, n6 is 0, n8 is 0 and Y4 is a bond can be produced by the following method. [ka] (In the formula, n10' represents an integer of 1 to 3, and Ac and DMTr are as defined above.)

[0085] Step 11 Compound (B11) can be produced in the same manner as in step 3 of Production Method A, using compound (B10). Compound (B10) is commercially available, or can be obtained by a known method (for example, "Synthesis of Organic Compounds III", 4th Edition, Experimental Chemistry Lecture Series 21, Maruzen (1992) and Journal of Organic Chemistry (J. Org. Chem.), Vol. 38, No. 14, pp. 2576-2578, 1973) or a method similar thereto.

[0086] Step 12 Compound (B12) can be produced using compound (B11) in the same manner as in step 10 of production method A.

[0087] Step 13 Compound (B4-a) can be produced in the same manner as in step 1 of Production Method A using compound (B12).

[0088] <Method C for producing a solid-phase reagent having a targeting compound> [ka] (In the formula, m1 and Po are defined as above, M1 and M2 each represent -COOH, -NHRa, -OH, -N3, -C≡CH or -SH, G represents -C(O)-NRa-, -NRa-C(O)-, -C(O)-S-, -SC(O)- or triazolediyl, Ra represents a hydrogen atom or a C1-C3 alkyl, Linker1, Linker2, Linker3 and Linker 4 represent linkers, Scaffold represents a structure having -Linker1-OH, -Linker2-OH and -Linker3-M1 as substituents, and Ligand represents a targeting compound.)

[0089] The scaffold is not particularly limited as long as it has a structure having -Linker1-OH, -Linker2-OH, and -Linker3-M1 as substituents.

[0090] Step 14 Compound (C3) can be produced by reacting compound (C1) and compound (C2) in a solvent in the presence of 1 to 50 equivalents of a base, 1 equivalent or more of a condensing agent and, if necessary, 0.01 to 30 equivalents of an additive, at a temperature between 0°C and the boiling point of the solvent used. As the solvent, those exemplified in step 2 can be used. Examples of the base include those exemplified in step 2. The condensing agent may be one exemplified in step 7. Examples of additives include those exemplified in step 7. Compound (C1) may be any compound having two -OH groups and a binding structure M1 with a targeting compound in the same molecule, and can be obtained as a commercially available product or by a known method (for example, corresponding structures are disclosed in WO 2015 / 006740 and WO 2015 / 105083) or a method similar thereto. Compound (C2) may be any compound having a binding structure M2 with a targeting compound, a linker, and a scaffold in the same molecule, and can be obtained as a commercially available product or by a known method (e.g., Therapeutic Delivery, Vol. 4, pp. 791-809 (2013)), or a method similar thereto.

[0091] In compound (C3), when G is triazolediyl, M1 in compound (C1) is -N3 or -C≡CH, and M2 in compound (C2) is -N3 or -C≡CH (however, M1 and M2 are not simultaneously -N3 or -C≡CH), and the compound can be produced by reacting compound (C1) and compound (C2) in a solvent in the presence of 0.01 to 10 equivalents of a metal catalyst and 0.01 to 10 equivalents of a reducing agent, with the addition of 0.01 to 10 equivalents of a reaction promoter as necessary, at a temperature between 0°C and the boiling point of the solvent used, for 5 minutes to 48 hours. Examples of the metal catalyst include copper(II) sulfate pentahydrate, copper(I) bromide, pentamethylcyclopentadienylbis(triphenylphosphine)ruthenium(II) chloride, and the like. The reducing agent includes sodium ascorbate, tris(2-carboxyethyl)phosphine (TCEP), and the like. The reaction accelerators include tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA), tris(2-benzimidazolylmethyl)amine ((BimH) 3 ) etc.

[0092] Step 15~Step 19 Compound (C4) can be produced using compound (C3) by the same methods as in steps 1 to 5, or by the same methods as in steps 1, 2, 5-2 and 5-3.

[0093] Step 20 and Step 21 Compound (C5) can be produced in the same manner as in steps 6 and 7 using compound (C4).

[0094] <Amidite Manufacturing Method D> [ka] (In the formula, R1, R2, Y3, n5, n7, m1, T, and DMTr are each defined as above, Xa represents a chlorine atom, a bromine atom, or an iodine atom, R c represents a protecting group that can be removed by treatment with a base, such as 2-cyanoethyl; R d represents an optionally substituted C1-C3 alkyl group.

[0095] Process 22 Compound (D1) can be produced in the same manner as in step 1 using compound (A6).

[0096] Process 23 Compound (D3) can be produced in the same manner as in step 5 using compound (D1) and compound (D2). Compound (D2) is available as a commercially available product or can be obtained by a method similar to the method for producing compound (A11).

[0097] Process 24 Compound (D6) can be produced by reacting compound (D3) with compound (D4) in the presence of a base in a solvent at a temperature between 0° C. and the boiling point of the solvent used for 10 seconds to 24 hours. Examples of the solvent include dichloromethane, acetonitrile, toluene, ethyl acetate, THF, 1,4-dioxane, DMF, and NMP, and these may be used alone or in combination. Examples of the base include triethylamine, N,N-diisopropylethylamine, pyridine, etc., which may be used alone or in combination. Compound (D6) can also be produced by reacting compound (D3) with compound (D5) in a solvent in the presence of a reaction promoter at a temperature between 0°C and the boiling point of the solvent used for 10 seconds to 24 hours. Examples of the solvent include acetonitrile, THF, etc., which may be used alone or in combination. Examples of the reaction accelerator include 1H-tetrazole, 4,5-dicyanoimidazole, 5-ethylthiotetrazole, and 5-benzylthiotetrazole. The compound (D4) and the compound (D5) can be obtained as commercial products.

[0098] <Method E for producing amidite> [ka] (In the formula, Y1, Y3, n5, n7, n9, m1, T, DMTr, Xa, R c and R d has the same meaning as above.)

[0099] Step 23f and Step 24f Compound (F6) can be produced in the same manner as in steps 23 and 24, except that compound (F2) is used instead of compound (D2). Compound (F2) is a commercially available product, or can be obtained by a method similar to the method for producing compound (A11).

[0100] <Amidite Manufacturing Method F> [ka] (In the formula, DMTr, Xa, R c , R d is as defined above, PG represents a protecting group, m2 represents an integer of 1 to 10, Rx represents a substituent possessed by a natural or non-natural α-amino acid residue, and Linker5 represents a linker connecting a hydroxyl group and a carboxyl group.

[0101] Process 25 Compound (G2) can be prepared in the same manner as in step 14 using an α-amino acid (G1) whose amino group is protected with an appropriate protecting group and p-aminobenzyl alcohol. p-Aminobenzyl alcohol and compound (G1) are commercially available. By repeatedly carrying out deprotection of the amino group of the obtained (G2) and subsequent condensation reaction with compound (G1), compound (G2) having a desired m2 value can be produced. The amino group can be deprotected appropriately using a method commonly used in organic synthetic chemistry [for example, the method described in Protective Groups In Organic Synthesis, Third Edition, by T. W. Greene, John Wiley & Sons Inc. (1999), etc.].

[0102] Process 26 Compound (G3) can be produced in the same manner as in step 1 using compound (G2).

[0103] Process 27 Compound (G4) can be produced by appropriately using the above-mentioned amino group deprotection method commonly used in organic synthesis chemistry.

[0104] Process 28 Compound (G6) can be produced in the same manner as in step 14 using compound (G4) and compound (G5). Compound (G5) is not particularly limited as long as it has a hydroxyl group and a carboxyl group in the same molecule, and can be obtained as a commercially available product.

[0105] Process 29 Compound (G7) can be produced in the same manner as in step 24 using compound (G6).

[0106] When the moiety M containing a chemical structure that is cleaved by the intracellular environment contains -SS-, a circular oligonucleotide can be prepared by the following method.

[0107] <Cyclic Oligonucleotide Production Method G> [ka] (In the formula, X is as defined above, Linker5 and Linker6 represent linkers, and the strip structure in the formula represents an oligonucleotide.)

[0108] Process 30 Condition a Compound (H2) can be produced by reacting compound (H1) in the presence of 1 equivalent or more of a base, optionally with 0.1 equivalent or more of an additive, at a temperature between -20°C and the boiling point of the solvent used, for 5 minutes to 120 hours. Examples of the solvent include methanol, ethanol, acetonitrile, tetrahydrofuran, dioxane, N,N-dimethylformamide (DMF), N,N-dimethylacetamide, N-methylpyrrolidone, pyridine, water, PBS, citrate buffer solution, Tris buffer solution, etc., which may be used alone or in combination. Examples of the base include cesium carbonate, potassium carbonate, sodium hydrogen carbonate, triethylamine, diisopropylethylamine, N-methylmorpholine, 1,8-diazabicyclo[5.4.0]-7-undecene (DBU) and the like. The additives include urea, magnesium chloride, potassium chloride, and the like.

[0109] condition b Compound (H2) can be produced by dissolving compound (H1) in a solvent, adding one or more equivalents of 2-(methoxythio)-3-nitropyridine (Npys-OMe) (manufactured by Kokusan Chemical Co., Ltd.), and reacting at a temperature between -20°C and the boiling point of the solvent used for 5 minutes to 120 hours. As the solvent, those described under condition a can be mentioned.

[0110] condition c Compound (H2) can be produced by dissolving compound (H1) in a solvent, adding one or more equivalents of KSH-OMe (Npys-OMe- CHEMMATRIX Regin) (manufactured by Kokusan Chemical Co., Ltd.), and reacting for 5 minutes to 120 hours at a temperature between -20°C and the boiling point of the solvent used. As the solvent, those described under condition a can be mentioned.

[0111] Compound (H1) can be produced by using commercially available reagents, or the solid phase reagent and amidite reagent described in the above production method, and by using a known chemical synthesis method or a method similar thereto. Known methods for chemically synthesizing oligonucleotides include, for example, the methods described below. (i) Tetrahedron (Tetrahedron, Vol. 48, No. 12, pp. 2223-2311 (1992); (ii) Current Protocols in Nucleic Acids Chemistry, John Wiley & Sons (2000–2017); (iii) Protocols for Oligonucleotides and Analogs, Human Press (1993); (iv) Chemistry and Biology of Artificial Nucleic Acids, Wiley-VCH (2012);

[0112] Oligonucleotides can be purified using a C18 reverse phase column or an anion exchange column, preferably a combination of the two columns. It is desirable for the purity of the purified oligonucleotide to be 90% or higher, and preferably 95% or higher.

[0113] In the present invention, a cyclic oligonucleotide and a linear oligonucleotide are mixed to produce an oligonucleotide derivative, which can be carried out by a conventional annealing reaction so that the cyclic oligonucleotide and the linear oligonucleotide form hydrogen bonds at their complementary base sequences. Preferably, the oligonucleotide derivative can be produced by mixing equal amounts of the cyclic oligonucleotide and the linear oligonucleotide in a buffer solution, for example, and leaving the mixture at 60 to 95° C. for 1 to 15 minutes, and then gradually lowering the temperature to room temperature. Thereafter, the oligonucleotide derivative can be converted into a salt by a conventional method.

[0114] The pharmaceutical composition of the present invention comprises an oligonucleotide derivative or a salt thereof. The pharmaceutical composition of the present invention is administered as a nucleic acid complex, which is recognized by a target cell and introduced into the cell. In the case of cyclic oligonucleotides, which have a chemical structure that is cleaved by the intracellular environment, the non-oligonucleotide structure is cleaved within the cell and converted into a linear double-stranded oligonucleotide. The linear double-stranded oligonucleotide is usually incorporated into a complex called RNA induced silencing complex (RISC), which cleaves the target mRNA and reduces or stops the expression of the target gene, thereby suppressing it and allowing it to be used to treat diseases related to the target gene. The oligonucleotide derivative or its salt of the present invention can be used as an agent for suppressing the expression of a target gene by utilizing RNA interference. In addition, the linear oligonucleotide represented by formula 7 can also be used as an agent for suppressing the expression of a target gene by utilizing RNA interference.

[0115] When the oligonucleotide derivative or a salt thereof of the present invention, or the pharmaceutical product of the present invention is used as a therapeutic or preventive agent, it is desirable to use the most effective administration route for treatment, and although not particularly limited, examples of the administration route include intravenous administration, subcutaneous administration, intrathecal administration, intratracheal administration, eye drop administration, intraocular administration, epicutaneous administration, oral administration and intramuscular administration, and preferably intravenous or subcutaneous administration. The dosage will vary depending on the condition and age of the subject, the route of administration, etc., but for example, the daily dosage converted into the antisense strand is 0.1 μg to 1000 mg, and it is more preferable to administer the daily dosage of 1 to 100 mg.

[0116] Suitable formulations as pharmaceutical compositions include, for example, injections. The prepared liquid can be used as is, for example, in the form of an injection, but the liquid can also be used after removing the solvent by, for example, filtration, centrifugation, etc., or the liquid can be freeze-dried and / or a liquid containing an excipient such as mannitol, lactose, trehalose, maltose, or glycine can be added and freeze-dried for use. In the case of injections, it is preferable to prepare the injections by mixing, for example, water, acid, alkali, various buffer solutions, physiological saline, or amino acid infusions with the liquid or the preparation from which the solvent has been removed or which has been lyophilized. It is also possible to prepare the injections by adding, for example, antioxidants such as citric acid, ascorbic acid, cysteine, or ethylenediaminetetraacetic acid (EDTA), or isotonicity agents such as glycerin, glucose, or sodium chloride. It is also possible to add a cryopreservative such as glycerin for cryopreservation.

[0117] The present invention also provides a method for treating or preventing a disease associated with a target gene, by administering an oligonucleotide derivative, or a salt thereof, or a pharmaceutical composition to a patient in need thereof, thereby reducing or stopping the expression of the target gene in the body and suppressing the same.

[0118] Specific examples of the cyclic oligonucleotide of the present invention are shown in Tables 2 to 6. However, the cyclic oligonucleotide of the present invention and the oligonucleotide derivative or salt thereof using the same are not limited to these. The strip-like structures in the tables represent oligonucleotides.

[0119] [Table 2]

[0120] [Table 3]

[0121] [Table 4]

[0122] [Table 5]

[0123] [Table 6] EXAMPLES

[0124] The present invention will now be described in detail with reference to examples, although the present invention is not limited to these examples.

[0125] The oligonucleotide derivatives of the present invention were synthesized according to the synthetic route shown in Scheme 1 below.

[0126] Scheme 1 [ka] (In the formula, Po has the same meaning as defined above.)

[0127] Example 1 HPRT1_csRNA1 (compound Ie) targeting HPRT1 was synthesized according to the following steps. Process 1 Commercially available 2'-OMe-A-CE phosphoramidite, 2'-OMe-G-CE phosphoramidite, 2'-OMe-C-CE phosphoramidite, 2'-OMe-U-CE phosphoramidite, 2'-FA-CE phosphoramidite, 2'-FG-CE phosphoramidite, 2'-F-Ac-C-CE phosphoramidite, 2'-FU-CE phosphoramidite, and Thiol-Modifier C6 SS (all 9 reagents, all obtained from Glen Research) were prepared to be 0.1 mol / L acetonitrile solutions. Nucleic acid synthesis was performed using 3'-Thiol-Modifier C3 SS CPG (compound Ia, Glen Research) as a solid-phase reagent and the prepared phosphoramidite acetonitrile solution, respectively, to obtain compound Ib as a crude product. Activator 42 (SAFC-PROLIGO) was used for the nucleotide elongation step, and the reaction time was 10 minutes. The nucleic acid synthesizer used was nS-8 manufactured by Gene Design.

[0128] Process 2 The crude product Ib obtained in step 1 was reacted with trichloroacetic acid to deprotect the trityl group. Then, the product was treated with a reagent in which an equal amount of 28% aqueous ammonia solution and 40% aqueous methylamine solution were mixed, and the product was cleaved from the solid-phase reagent. The crude product obtained was purified by reverse phase liquid chromatography (Waters, Xbridge (registered trademark) C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) to obtain compound Ic. ESI-MS Theoretical value 8775 Measured value 8778

[0129] Process 3 Compound Ic (45 nmol) obtained in step 2 was added to 50 mmol / L dithiothreitol (DTT) in Tris buffer and allowed to stand at room temperature for 18 hours. The reaction solution was purified with a NAP-10 column (GE Healthcare, product No. 17-0854-01) to obtain compound Id (1.5 mL).

[0130] Process 4 To the aqueous solution (1.5 mL) of compound Id obtained in step 3, 5 mol / L NaCl, triethylamine, and water were added so that the final concentrations were compound Id 70 μmol / L, NaCl 150 mmol / L, and triethylamine 8 mol%. Then, the mixture was left to stand at 55° C. for 18 hours. The reaction solution was concentrated under reduced pressure and purified by reverse phase liquid chromatography (Waters, Xbridge® C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) to obtain compound Ie (18 nmol, 2-step yield 40%). ESI-MS Theoretical value: 8551 Measured value: 8850

[0131] Process 5 Compound Ie obtained in step 4 was mixed with equal amounts of oligonucleotide HPRT1_asRNA1 prepared separately using a nucleic acid synthesizer, dissolved in a citrate buffer, and then allowed to stand at 85°C for 5 minutes. Compound 1 was then obtained by gradually lowering the temperature. To confirm that compound 1 formed a complex, size-exclusion chromatography (SEC) analysis and polyacrylamide gel electrophoresis (PAGE) analysis were carried out in the same manner as in the identification of normal siRNA. SEC analysis conditions Column: TOSOH G2000SWXL (5 μm, 7.8 mm I.D. × 30 cm) Solvent: 1X PBS Buffer (Nacalai Tesque) Flow rate: 1 mL / min Gradient, Time:isocratic, 20min Column temperature: 25℃ Detection wavelength: 260 nm Injection amount: 200 pmol / 1 sample (Reference: Journal of Pharmaceutical and Biomedical Analysis 136 (2017) 55-65.) PAGE analysis conditions Gel: Multi Gel II Mini 10 / 20 (13W) (414893, Cosmo Bio) Loading buffer: GelPilot(R) DNA Loading Dye, 5X (239901, Qiagen) Marker: DynaMarker® dsRNA Easy Load (DM185, BDL) Electrophoresis tank: AE-6500 (ATTO) Electrophoresis conditions: 150 V, 200 mA, 20.0 W, 60 min Running solvent: 1X TAE Buffer Gel stain: SYBR® Green II Nucleic Acid Gel Stain (50522, Lonza)

[0132] Example 2 Compound 2 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA2 and HPRT1_asRNA2 shown in Table 7.

[0133] Example 3 Compound 3 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to B2M_csRNA and B2M_asRNA shown in Table 7.

[0134] Example 4 Compound 4 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA3 and HPRT1_asRNA3 shown in Table 8.

[0135] Example 5 Compound 5 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA4 and HPRT1_asRNA4 shown in Table 8.

[0136] Example 6 Compound 6 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA5 and HPRT1_asRNA5 shown in Table 8.

[0137] In the following table, in the "Name" column, the upper line indicates the name of the nucleic acid complex, and the lower line indicates the name of the circular oligonucleotide / linear oligonucleotide or the sense strand / antisense strand that constitutes the nucleic acid complex. In the "Sequence" column, the upper line indicates the circular oligonucleotide or the sense strand, and the lower line indicates the linear oligonucleotide or the antisense strand. The base sequences of the oligonucleotide derivatives in Examples 1 to 6 and the oligonucleotides serving as negative controls are shown in Tables 7 and 8. The abbreviations in Tables 7 and 8 are as follows. The terminal V indicates a bond, and the S atom adjacent to the V is bonded to form -SS-, indicating a cyclic structure. SC6 = -(CH 2 ) 6 -S- C3S = -(CH 2 ) 3 -S- p = phosphorylation ^ = phosphorothioate modification m = 2'-OMe modification f = 2'-F modification The molecular weights of the cyclic oligonucleotide Ie and its precursor compound Ic in each Example are shown in Table 9. The molecular weights were measured by ESI-MS (Agilent Technologies, 1200 series) according to a conventional method.

[0138] [Table 7]

[0139] [Table 8]

[0140] [Table 9]

[0141] Example 7 Compound 7 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to PTEN_csRNA1 and PTEN_asRNA2 shown in Table 10.

[0142] Example 8 Compound 8 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to Factor9_csRNA1 and Factor9_asRNA2 shown in Table 10.

[0143] Example 9 Compound 9 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA6 and HPRT1_asRNA5 shown in Table 11.

[0144] Example 10 Compound 10 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA15 and HPRT1_asRNA5 shown in Table 12.

[0145] Example 11 Compound 11 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA16 and HPRT1_asRNA5 shown in Table 12.

[0146] Example 12 Compound 12 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA23 and HPRT1_asRNA5 shown in Table 14.

[0147] Example 13 Compound 13 was obtained in the same manner as in Example 1, except that the nucleic acid sequences were changed to HPRT1_csRNA24 and HPRT1_asRNA5 shown in Table 14.

[0148] Example 14 (Cyclic Oligonucleotide B and its Cyclic siRNA) Compound 14 was synthesized in the same manner as in Example 1, except that step 1 was performed by adding Spacer Phosphoramidite C3 (Glen Research) to the amidite described in step 1 of Example 1, and step 4 of Example 1 was changed to the following method. To an aqueous solution (1.5 mL) of 14d corresponding to compound Id in scheme 1, 5 mol / L NaCl aqueous solution, sodium bicarbonate, and water were added so that the final concentrations of compound 14d were 100 μmol / L, NaCl was 150 mmol / L, and sodium bicarbonate was 5 wt%. Then, the mixture was left to stand at 65° C. for 48 hours. The reaction solution was concentrated under reduced pressure and purified by reverse phase liquid chromatography (Waters, Xbridge® C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile), to obtain compound 14e (2-step yield 47%).

[0149] Example 15 (Cyclic Oligonucleotide C and its Cyclic siRNA) Compound 15 was synthesized in the same manner as in Example 1, except that DMT-ethane-Diol phosphoramidite (ChemGenes) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0150] Example 16 (Cyclic Oligonucleotide D and its Cyclic siRNA) Compound 16 was synthesized in the same manner as in Example 1, except that Spacer Phosphoramidite 9 (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0151] Example 17 (Cyclic Oligonucleotide E and its Cyclic siRNA) Compound 17 was synthesized in the same manner as in Example 15, except that the nucleic acid sequences were changed to HPRT1_csRNA10 and HPRT1_asRNA5 shown in Table 11.

[0152] Example 18 (Cyclic Oligonucleotide E and its Cyclic siRNA) Compound 18 was synthesized in the same manner as in Example 15, except that the nucleic acid sequences were changed to HPRT1_csRNA17 and HPRT1_asRNA5 shown in Table 12.

[0153] Example 19 (Cyclic Oligonucleotide F and Its Cyclic siRNA) Compound 19 was synthesized in the same manner as in Example 1, except that dSpacer CE Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0154] Example 20 (Cyclic Oligonucleotide G and its Cyclic siRNA) Compound 20 was synthesized in the same manner as in Example 1, except that PC Linker Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0155] Example 21 (Cyclic Oligonucleotide H and its Cyclic siRNA) Compound 21 was synthesized in the same manner as in Example 1, except that Amino-Modifer C6 dT (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0156] Example 22 (Cyclic Oligonucleotide I and its Cyclic siRNA) Compound 22 was synthesized in the same manner as in Example 15, except that the nucleic acid sequences were changed to HPRT1_csRNA14 and HPRT1_asRNA5 shown in Table 11.

[0157] Example 23 (Cyclic Oligonucleotide I and its Cyclic siRNA) Compound 23 was synthesized in the same manner as in Example 15, except that the nucleic acid sequences were changed to HPRT1_csRNA18 and HPRT1_asRNA5 shown in Table 12.

[0158] Example 24 (Cyclic Oligonucleotide J and its Cyclic siRNA) Compound 24 was synthesized in the same manner as in Example 1, except that 2'-OMe-U-Thiophosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0159] Example 25 (Cyclic Oligonucleotide K and Its Cyclic siRNA) Compound 25 was synthesized in the same manner as in Example 24, except that the nucleic acid sequences were changed to HPRT1_csRNA20 and HPRT1_asRNA5 shown in Table 13.

[0160] Example 26 (Cyclic Oligonucleotide L and Its Cyclic siRNA) Compound 26 was synthesized in the same manner as in Example 1, except that Spacer C12 CE Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0161] Example 27 (Cyclic Oligonucleotide M and Its Cyclic siRNA) Compound 27 was synthesized in the same manner as in Example 1, except that the amidite Rf3 synthesized in Reference Example 1 was added to the amidite described in Step 1 of Example 1, and Step 4 was changed to the method described in Example 14.

[0162] Example 28 (Cyclic Oligonucleotide N and its Cyclic siRNA) Compound 28 was synthesized in the same manner as in Example 1, except that PC Spacer Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0163] Example 29 (Cyclic Oligonucleotide O and Its Cyclic siRNA) PC Spacer Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 of Example 1 was changed to the following method. To an aqueous solution (1.5 mL) of 29d corresponding to compound Id in scheme 1, 5 mol / L aqueous NaCl solution, sodium bicarbonate, and water were added so that the final concentrations of compound 29d were 100 μmol / L, NaCl was 2 mol / L, and sodium bicarbonate was 5 wt%. The mixture was then left to stand at 65° C. for 72 hours. The reaction solution was concentrated under reduced pressure and purified by reverse phase liquid chromatography (Waters, Xbridge® C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) and size exclusion chromatography (Tosoh, TSKgel G2000SWXL, 7.8 mm x 300 mm, 1XPBS isocratic) to obtain compound 29e (20% yield in two steps). Except for the above, compound 29 was synthesized in the same manner as in Example 1.

[0164] Example 30 (Cyclic Oligonucleotide P and Its Cyclic siRNA) Compound 30 was synthesized in the same manner as in Example 15, except that the nucleic acid sequences were changed to HPRT1_csRNA34 and HPRT1_asRNA5 shown in Table 16.

[0165] Example 31 (Cyclic Oligonucleotide Q and its Cyclic siRNA) Compound 31 was synthesized in the same manner as in Example 1, except that Amino-Modifer Serinol Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0166] Example 32 (Cyclic Oligonucleotide R and Its Cyclic siRNA) Compound 32 was synthesized in the same manner as in Example 1, except that Fmoc-Amino-DMT C-7 CE phosphoramidite (ChemGenes) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0167] Example 33 (Cyclic Oligonucleotide S and its Cyclic siRNA) Compound 33 was synthesized in the same manner as in Example 1, except that Alkyne-Modifer Serinol Phosphoramidite (Glen Research) was added to the amidite described in step 1 of Example 1, and step 4 was changed to the method described in Example 14.

[0168] Example 34 (Cyclic Oligonucleotide T and Its Cyclic siRNA) Compound 34 was synthesized in the same manner as in Example 33, except that the nucleic acid sequences were changed to HPRT1_csRNA37 and HPRT1_asRNA5 shown in Table 16.

[0169] Example 35 (Cyclic Oligonucleotide U and Its Cyclic siRNA) Compound 35 was synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in step 1 of Example 1 was changed to the modified CPG Rf12 synthesized in Reference Example 2, and step 4 was changed to the method described in Example 14.

[0170] Example 36 (Cyclic Oligonucleotide V and its Cyclic siRNA) Compound 36 was synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in step 1 of Example 1 was changed to the modified CPG Rf21 synthesized in Reference Example 3, and step 4 was changed to the method described in Example 14.

[0171] Example 37 (Cyclic Oligonucleotide W and its Cyclic siRNA) The Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to the amidite Rf41 synthesized in Reference Example 6, the 3'-Thiol-Modifier C3 SS CPG solid-phase reagent was changed to the modified CPG Rf12 synthesized in Reference Example 2, and step 4 of Example 1 was changed to the following method. To an aqueous solution (1.5 mL) of 37d corresponding to compound Id in scheme 1, 5 mol / L aqueous NaCl solution, triethylamine, and water were added so that the final concentrations of compound 37d were 100 μmol / L, NaCl was 2 mol / L, and triethylamine was 5 vol%. The mixture was then left to stand at 65° C. for 72 hours. The reaction solution was purified by reverse phase liquid chromatography (Waters, Xbridge® C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) and size exclusion chromatography (Tosoh, TSKgel G2000SWXL, 7.8 mm x 300 mm, 1XPBS isocratic) to obtain compound 37e (2-step yield 16%). Except for the above, compound 37 was synthesized in the same manner as in Example 1.

[0172] Example 38 (Cyclic Oligonucleotide X and Its Cyclic siRNA) Compound 38 was synthesized in the same manner as in Example 1, except that the Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to the amidite Rf46 synthesized in Reference Example 7, and step 4 was changed to the method described in Example 14.

[0173] Example 39 (Cyclic Oligonucleotide Y and Its Cyclic siRNA) Compound 39 was synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in step 1 of Example 1 was changed to the modified CPG Rf29 synthesized in Reference Example 4, and step 4 was changed to the method described in Example 14.

[0174] Example 40 (Cyclic Oligonucleotide Z and its Cyclic siRNA) Compound 40 can be synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in step 1 of Example 1 is changed to modified CPG Rf37 that can be synthesized in Reference Example 5, and step 4 is changed to the method described in Example 14.

[0175] Example 41 (Cyclic Oligonucleotide AA and Its Cyclic siRNA) Compound 41 was synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in step 1 of Example 1 was changed to DMT-C6 Disulfide lcaa CPG 500 Å (ChemGenes), and step 4 was changed to the method described in Example 14.

[0176] Example 42 (Cyclic oligonucleotide AB and its cyclic siRNA) Compound 42 was synthesized in the same manner as in Example 1, except that the Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to 5'-Thio-dI CEP (Berry & Associates), and step 4 was changed to the method described in Example 14.

[0177] Example 43 (Cyclic Oligonucleotide AC and Its Cyclic siRNA) Compound 43 was synthesized in the same manner as in Example 1, except that the Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to Thiol-modifer-oxa-C6-SS CEP (Berry & Associates) and step 4 was changed to the method described in Example 14.

[0178] Example 44 (Cyclic oligonucleotide AD and its cyclic siRNA) Compound 44 was synthesized according to the following Scheme 2.

[0179] Scheme 2 [ka] (In the formula, Po has the same meaning as defined above.)

[0180] Process 1 A crude product of 44b was obtained in the same manner as in step 1 of Example 1, except that Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to 5'-Carboxy-Modifier C5 (Glen Research).

[0181] Process 2 Compound 44c was obtained in a similar manner to Step 2 of Example 1. ESI-MS Theoretical value 9208 Measured value 9207

[0182] Process 3 Compound 44c (100 nmol) obtained in step 2 was dissolved in 200 uL of RNase-free water, and 200 uL of a separately prepared 30 mmol / L tris(2-carboxyethyl)phosphine hydrochloride (TCEP·HCl) / 10 mmol / L triethylamine acetate buffer was added and left to stand at room temperature for 12 hours. After the reaction, the crude product of compound 44d (400 uL) was obtained and used as it was in the next step. ESI-MS Theoretical value 9117 Measured value 9118

[0183] Process 4 To the reaction solution (400 uL) of compound 44d obtained in step 3, 5 mol / L NaCl and water were added so that the final concentrations of compound 44d were 100 μmol / L and NaCl were 450 mmol / L. The mixture was then left to stand at 60° C. for 48 hours. The reaction solution was purified by reverse phase liquid chromatography (Waters, XBridge (registered trademark) C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) to obtain compound 44e (15 nmol, 2-step yield 15%). ESI-MS Theoretical value 9100 Measured value 9102

[0184] Process 5 Compound 44 was obtained in the same manner as in step 5 of Example 1, except that the nucleic acid sequence was changed to HPRT1_asRNA5 shown in Table 8.

[0185] Example 45 (Cyclic Oligonucleotides AE and Their Cyclic siRNAs) Compound 45 was synthesized in the same manner as in Example 1, except that the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG described in Step 1 of Example 1 was changed to modified CPG Rf59 synthesized in Reference Example 9.

[0186] Example 46 (Cyclic oligonucleotide AF and its cyclic siRNA) Compound 46 can be synthesized according to Scheme 3 below.

[0187] Scheme 3 [ka] (In the formula, Po has the same meaning as defined above.)

[0188] Process 1 The crude product of 46b can be obtained in the same manner as in Step 1 of Example 1, except that Thiol-Modifier C6 SS described in Step 1 of Example 1 is changed to 5'-Hexynyl Phosphoramidite (Glen Research), the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG is changed to Azide-modified CPG (compound (46a), PRIMETECH), and the dipeptide amidite Rf65 synthesized in Reference Example 10 is used.

[0189] Process 2 The crude product 46b obtained in step 1 is treated with a reagent obtained by mixing equal amounts of 28% aqueous ammonia and 40% aqueous methylamine, and the crude product obtained by cleavage from the solid-phase reagent is purified by reverse phase liquid chromatography (Waters, XBridge (registered trademark) C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: acetonitrile gradient) to obtain compound 46c.

[0190] Process 3 Compound 46d can be obtained by using compound 46c obtained in step 2 according to the method described in Journal of Organic Chemistry, Vol. 73, pp. 287-290, 2008, or a synthetic method analogous thereto.

[0191] Process 4 Compound 46 can be obtained in the same manner as in step 5 of Example 1, except that the nucleic acid sequence is changed to HPRT1_asRNA5 shown in Table 8.

[0192] Example 47 (Cyclic oligonucleotide AG and its cyclic siRNA) Compound 47 can be synthesized according to Scheme 4 below.

[0193] Scheme 4 [ka] (In the formula, Po has the same meaning as defined above.)

[0194] Process 1 The crude product of 47b was obtained in the same manner as in step 1 of Example 1, except that Thiol-Modifier C6 SS described in step 1 of Example 1 was changed to 5'-Hexynyl Phosphoramidite (Glen Research) and the solid-phase reagent 3'-Thiol-Modifier C3 SS CPG was changed to Azide-modified CPG (compound 46a, PRIMETECH).

[0195] Process 2 The crude product 47b obtained in step 1 was treated with a reagent prepared by mixing equal amounts of 28% aqueous ammonia and 40% aqueous methylamine, and the crude product obtained by cleavage from the solid-phase reagent was purified by reverse phase liquid chromatography (Waters, Xbridge (registered trademark) C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: acetonitrile gradient) to obtain compound 47c.

[0196] Process 3 Compound 47c (70 nmol) obtained in step 2 was divided into 7 portions of 10 nmol each in 1.5 mL sample tubes, and 5 mol / L NaCl and water were added so that the final concentration of compound 47c was 50 μmol / L and NaCl was 200 mmol / L. Then, Cu wire (10-20 pieces, manufactured by Wako Pure Chemical Industries) was added to each tube, and the tube was placed in a heat block preheated to 80°C and left to stand for 3 minutes, and the heating was turned off and the tube was left to stand until it reached room temperature. The reaction solution in each tube was combined and subjected to simple purification using a NAP-10 column (manufactured by GE Healthcare), and then purified by reverse phase liquid chromatography (Waters, Xbridge (registered trademark) C18, 4.6 mm x 250 mm, solution A: 0.1% triethylammonium acetate buffer, solution B: gradient with acetonitrile) to obtain compound 47d (27.4 nmol, yield 39%). ESI-MS Theoretical value 9235 Measured value 9234

[0197] Process 4 Compound 47 was obtained in the same manner as in step 5 of Example 1, except that the nucleic acid sequence was changed to HPRT1_asRNA5 shown in Table 8.

[0198] The base sequences and molecular weights of the oligonucleotide derivatives of Examples 7 to 46 and the oligonucleotides as negative controls are shown in Tables 10 to 19. In each Example, the upper row shows the cyclic oligonucleotide, and the lower row shows the linear nucleotide. Each alphabet in the "cyclic structure" in the table indicates that the sequence has a cyclic structure corresponding to each alphabet in the "cyclic structure" described in Tables 2 to 6. In each negative control group, the upper row shows the sense strand, and the lower row shows the antisense strand. The abbreviations in Tables 10 to 19 are as follows. The Vs at both ends indicate that they are bonded to form a cyclic structure corresponding to the alphabet shown in the "cyclic structure" in the table. p = phosphorylation ^ = phosphorothioate modification m = 2'-OMe modification f = 2'-F modification

[0199] [Table 10]

[0200] [Table 11]

[0201] [Table 12]

[0202] [Table 13]

[0203] [Table 14]

[0204] [Table 15]

[0205] [Table 16]

[0206] [Table 17]

[0207] [Table 18]

[0208] [Table 19]

[0209] Reference example 1 Synthesis of amidite Rf3 [ka]

[0210] Step 1: Commercially available hexadecane-1,16-diol Rf1 (5.24 g, 20.3 mmol) was suspended in dehydrated pyridine (82 mL), 4,4'-dimethoxytrityl chloride (5.72 g, 16.9 mmol) was added, and the mixture was stirred at room temperature for 2 hours and 30 minutes. After the reaction was completed, dichloromethane and saturated aqueous sodium bicarbonate were added to quench the reaction. The organic layer was washed once with water and saturated saline, and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure to obtain a crude product (15.7 g) as a yellowish-white solid. The crude product was purified four times by column chromatography (Yamazen Hi-Flash column 3 L, developing solvent: n-heptane / ethyl acetate (2% triethylamine) = 90 / 10 → 70 / 30 → 50 / 50). The solvent was removed under reduced pressure, and the residue was subjected to azeotropic distillation with acetonitrile to obtain 16-(bis(4-methoxyphenyl)(phenyl)methoxy)hexadecan-1-ol Rf2 (4.25 g, 7.13 mmol, 5.9 wt% acetonitrile) as a yellow oil (yield 42%). ESI-MS (m / z): 584 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43 (d, J = 7.2 Hz, 2H), 7.33 - 7.16 (m, 7H), 6.84-6.81 (m, 4H), 3.78 (s, 6H), 3.64 (q, J = 6.4 Hz, 2H), 3.02 (t, J = 6.4 Hz, 2H), 1.64-1.53 ​​(m, 4H), 1.42-1.20 (m, 24H).

[0211] Step 2: Under an argon atmosphere, compound Rf2 (3.00 g, 5.35 mmol) was dissolved in dehydrated dichloromethane (41 mL) in a 20 mL eggplant flask. N,N-diisopropylethylamine (4.67 mL, 26.7 mmol) and 2-cyanoethyldiisopropylchlorophosphoramidite (1.90 g, 8.02 mmol) were added in an ice bath and stirred at room temperature for 1 hour. After the reaction was completed, the mixture was quenched by adding a saturated aqueous solution of sodium bicarbonate, and then extracted twice with dichloromethane. The combined organic layer was washed with water and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure to obtain the crude product (6.45 g) as a white oil. The crude product was purified by column chromatography (Yamazen NH column L, developing solvent: n-heptane / ethyl acetate = 90 / 10 → 70 / 30 → 50 / 50) to obtain 16-(bis(4-methoxyphenyl)(phenyl)methoxy)hexadecyl (2-cyanoethyl)diisopropylphosphoramidite Rf3 (3.78 g, 4.09 mmol) as a colorless oil (yield 77%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.45-7.43 (m, 2H), 7.43-7.25 (m, 6H), 7.21-7.19 (m, 1H), 6.84-6.81 (m, 4H), 3.90-3.80 (m, 2H), 3.79 (s, 6H), 3.68-3.55 (m, 4H), 3.02 (t, J = 6.8 Hz, 2H), 2.64 (t, J =6.4 Hz, 2H), 1.64-1.56 (m, 4H), 1.35-1.24 (m, 24H), 1.18 (dd, J = 4.0, 6.8 Hz, 12H). 31 P-NMR (CDCl 3 , 162 MHz) δ (ppm): 147.8

[0212] Reference example 2 Synthesis of modified CPG Rf12 [ka] (In the formula, Po has the same meaning as defined above.)

[0213] Compound Rf9 was synthesized according to the following step 7-1.

[0214] [ka]

[0215] Step 3: Using commercially available butane-1,3-diol Rf4 (1.0 g, 11.1 mmol), 4-(bis(4-methoxyphenyl)(phenyl)methoxy)butan-2-ol Rf5 (4.00 g, 9.51 mmol, 2.7 wt% ethyl acetate, 4.3 wt% n-heptane) was obtained as a pale yellow oil in the same manner as in Step 1 of Reference Example 1 (yield 86%). ESI-MS (m / z): 415.0 (M+Na). 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.42 (d, J = 7.2 Hz, 2H), 7.32-7.19 (m, 7H), 6.83 (d, J = 8.8 Hz, 4H), 4.00-3.95 (m, 1H), 3.79 (s, 6H), 3.38-3.19 (m, 2H), 2.95 (d, J = 2.8 Hz, 1H), 1.83-1.66 (m, 2H), 1.16 (d, J = 6.4 Hz, 3H).

[0216] Step 4: In a 300 mL flask under an argon atmosphere, compound Rf5 (4.00 g, 10.2 mmol) obtained in step 3 and dehydrated dichloromethane (50 mL) were added. Triethylamine (2.84 mL, 20.4 mmol) and methanesulfonyl chloride (1.20 mL, 15.3 mmol) were added under ice cooling, and the mixture was stirred at room temperature for 1 hour. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate and chloroform were added and the mixture was separated. The organic layer was dried over anhydrous sodium sulfate, and the solvent was concentrated under reduced pressure to obtain a crude product (5.30 g) containing 4-(bis(4-methoxyphenyl)(phenyl)methoxy)butan-2-yl methanesulfonate Rf6 as an orange oil. The crude product obtained was used directly in the next step. (Yield: quant.) ESI-MS (m / z): 493 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.40 (d, J = 7.6 Hz, 2H), 7.31-7.20 (m, 7H), 6.82 (d, J = 9.2 Hz, 4H), 5.04-5.00 (m, 1H), 3.79 (s, 6H), 3.23-3.14 (m, 2H), 2.75 (s, 3H), 1.97-1.88 (m, 2H), 1.43 (d, J = 6.4 Hz, 3H).

[0217] Step 5: The crude product (5.30 g) containing compound Rf6 obtained in step 4 and dehydrated N,N-dimethylformamide (96 mL) were added to a 200 mL flask and suspended. Potassium thioacetate (5.14 g, 45.1 mmol) and sodium iodide (0.170 g, 1.13 mmol) were added and stirred at 50 °C for 3 hours. After the reaction was completed, water was added and the mixture was extracted twice with n-heptane / ethyl acetate (1 / 1). The combined organic layer was dried over anhydrous sodium sulfate and the solvent was concentrated under reduced pressure to obtain the crude product (4.57 g) as an orange oil. The resulting residue was purified by silica gel column chromatography (Yamazen Hi-Flash Column L, developing solvent: n-heptane / ethyl acetate = 100 / 0 → 90 / 10 → 80 / 20) to obtain S-(4-(bis(4-methoxyphenyl)(phenyl)methoxy)butan-2-yl)ethanethioate Rf7 (3.98 g, 7.83 mmol, 11.3 wt% ethyl acetate) as an orange oil (two-step yield 70%). ESI-MS (m / z): 473.2 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.44-7.42 (m, 2H), 7.33-7.18 (m, 7H), 6.82 (d, J = 8.8 Hz, 4H), 3.79 (s, 6H), 3.76-3.71 (m, 1H), 3.18-3.07 (m, 2H), 2.26 (s, 3H), 1.90-1.79 (m, 2H), 1.25 (d, J = 7.2 Hz, 3H).

[0218] Step 6: In a 30 mL flask under an argon atmosphere, compound Rf7 (400 mg, 0.888 mmol) obtained in step 5 was dissolved in dehydrated methanol (3.6 mL). 40% methylamine / methanol solution (870 μL) was added and stirred for 1 hour. After the reaction was completed, the solvent was concentrated under reduced pressure to obtain a crude product (430 mg) as an orange oil. The residue was purified by silica gel column chromatography (Yamazen Hi-Flash column M, developing solvent: n-heptane / ethyl acetate = 90 / 10 → 70 / 30) to obtain 4-(bis(4-methoxyphenyl)(phenyl)methoxy)butane-2-thiol Rf8 (324 mg, 0.717 mmol, 9.5 wt% ethyl acetate) as a colorless oil. (Yield 81%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.44 - 7.42 (m, 2H), 7.33 - 7.20 (m, 7H), 6.82 (d, J = 8.8 Hz, 4H), 3.79 (s, 6H), 3.25 - 3.15 (m, 3H), 1.91 - 1.72 (m, 2H), 1.44 (d, J = 6.4 Hz,, 1H), 1.29 (d, J = 3.6 Hz, 3H).

[0219] Step 7-1: Under an argon atmosphere, 2,2'-dipyridyl disulfide (5.00 g, 22.7 mmol) was dissolved in dehydrated methanol (33 mL) in a 100 mL flask, and commercially available 3-mercaptopropan-1-ol Rf13 (1.39 g, 15.1 mmol) was added and stirred at room temperature for 4 hours. After the reaction was completed, the solvent was concentrated under reduced pressure to obtain a crude product (6.40 g) as a yellow oil. The crude product was purified twice by silica gel column chromatography (Yamazen Hi-Flash column L, developing solvent: n-heptane / ethyl acetate = 90 / 10 → 70 / 30 → 50 / 50 → 30 / 70) to obtain 3-(pyridin-2-yldisulfanyl)propan-1-ol Rf9 (2.20 g, 10.9 mmol) as a colorless oil. (Yield 72%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 8.48 - 8.46 (m, 1H), 7.66 - 7.61 (m, 2H), 7.14 - 7.09 (m, 1H), 3.81 (t, J = 6.0 Hz, 2H), 2.98 (t, J = 4.8 Hz, 2H), 2.41 (br, 1H), 1.99 - 1.92 (m, 2H).

[0220] Step 7-2: In a 50 mL flask under an argon atmosphere, the compound Rf8 (480 mg, 1.18 mmol) obtained in Step 6 and dehydrated methanol (12 mL) were added and suspended. To this mixture, the compound Rf9 (710 mg, 3.52 mmol) obtained in Step 7-1 and triethylamine (491 μL, 3.52 mmol) were added, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the solvent was concentrated under reduced pressure to obtain a crude product (1.29 g) as a yellow oil. The residue was purified by column chromatography (Yamazen High Flash Column M, developing solvent: n-heptane / ethyl acetate = 90 / 10 → 70 / 30 → 50 / 50) to obtain 3-((4-(bis(4-methoxyphenyl)(phenyl)methoxy)butan-2-yl)disulfanyl)propan-1-ol Rf10 (492 mg, 0.839 mmol, 15.0 wt% ethyl acetate) as a colorless oil. (Yield 62%) ESI-MS (m / z): 521.3 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43 (d, J = 7.9 Hz, 2H), 7.33-7.20 (m, 7H), 6.83 (d, J = 8.4 Hz, 4H), 3.79 (s, 6H), 3.71 (br, 2H), 3.24-3.03 (m, 3H), 2.73 (t, J = 7.2 Hz, 2H), 2.02-1.95 (m, 1H), 1.88 (quin, J = 6.8 Hz, 2H), 1.78-1.69 (m, 1H), 1.28-1.23 (m, 3H).

[0221] Step 8: In a 50 mL flask under an argon atmosphere, compound Rf10 (492 mg, 0.987 mmol) obtained in step 7 and dehydrated dichloromethane (10 mL) were added and dissolved. Triethylamine (2.75 μL, 1.97 mmol) and succinic anhydride (150 mg, 1.48 mmol) were added to this solution and stirred at room temperature for 2 hours. After the reaction was completed, the solvent was concentrated under reduced pressure to obtain the crude product (1.20 g) as a yellow oil. The resulting residue was purified by silica gel column chromatography (Yamazen Hi-Flash column M, developing solvent: chloroform / methanol (1% triethylamine) = 100 / 0 → 98 / 2 → 95 / 5 → 90 / 10 → 80 / 20), and then azeotroped with acetonitrile to obtain 4-(3-((4-(bis(4-methoxyphenyl)(phenyl)methoxy)butan-2-yl)disulfanyl)propoxy)-4-oxobutanoic acid Rf11 (630 mg, 0.863 mmol, 18.0 wt% triethylamine (1.3 eq.)) as a pale white oil (yield 87%). ESI-MS (m / z): 597 [MH]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.42 (d, J = 7.6 Hz, 2H), 7.32 - 7.20 (m, 7H), 6.82 (d, J = 8.8 Hz, 4H), 4.12 (t, J = 6.0 Hz, 2H), 3.79 (s, 6H), 3.23 - 3.02 (m, 3H), 2.67 (d, J = 7.6 Hz, 2H), 2.61 - 2.50 (m, 4H), 2.01 - 1.93 (m, 3H), 1.76 - 1.68 (m, 1H), 1.30 - 1.28 (m, 3H).

[0222] Step 9: Dehydrated acetonitrile (8.0 mL) was added to CPG resin (LCAA Controlled Pore Glass, 2.20 g), and then diisopropylcarbodiimide (52 μL, 334 μmol) and 1-hydroxybenzotriazole (5.42 mg, 40 μmol) were added. The container was then sealed and shaken at room temperature for 10 minutes. Compound Rf11 (81 mg (6.6 wt%, triethylamine (1.3 eq.), 111 μmol) obtained in step 8 was dissolved in a mixed solvent of dehydrated pyridine (0.67 mL) and anhydrous acetonitrile (2.0 mL), added to the CPG resin solution, sealed, and shaken and stirred at room temperature for 34 hours and 20 minutes. Diisopropylcarbodiimide (52 μL, 334 μmol) and 1-hydroxybenzotriazole (5.42 mg, 40 μmol) were added, sealed, and shaken and stirred at room temperature for 19 hours and 40 minutes. Diisopropylcarbodiimide (52 μL, 334 μmol) and 1-hydroxybenzotriazole (5.42 mg, 40 μmol) were added, sealed, and shaken and stirred at room temperature for 16 hours and 50 minutes. After filtering the solution from the CPG solution, the CPG resin was washed with methylene chloride → acetonitrile → The resin was washed with methylene chloride, and then dried by passing argon gas through it to obtain the modified CPG resin (1.75 g). A portion of the obtained CPG resin (12.0 mg) was treated with 2 wt% trichloroacetic acid-methylene chloride solution (25 mL) and the absorbance was measured. (Absorbance (503 nm) = 2.051, Loading 56.4 μmol / g, Loading was calculated according to Current Protocol in Nucleic Acid Chemistry, Unit 3.2.14.) This procedure was repeated two more batches using the same amount of CPG resin (2.20 g) to obtain modified CPG resins (1.85 g (Loading 55.0 μmol / g), 1.87 g, (Loading 57.4 μmol / g)), respectively. The obtained CPG resin (1.75 g) was added to a mixture of N-methylimidazole / tetrahydrofuran = 1 / 5.25 (22.0 mL) and a mixture of acetic anhydride / 2,6-lutidine / tetrahydrofuran = 1 / 1 / 8 (21.9 mL), and the mixture was shaken and stirred at room temperature for 16 hours. After filtering off the solution, the CPG resin was washed with methylene chloride → acetonitrile → methylene chloride, and dried by passing argon gas to obtain modified CPG Rf12 (1.64 g). A portion of the obtained CPG resin (12.5 mg) was treated with a 2 wt% trichloroacetic acid-methylene chloride solution (25 mL) and the absorbance was measured. (Absorbance (503 nm) = 2.117, Loading 55.9 μmol / g).

[0223] Reference example 3 Synthesis of modified CPG Rf21 [ka] (In the formula, Po has the same meaning as defined above.)

[0224] Step 10: Under an argon atmosphere, commercially available trans-2-pentenal Rf14 (500 mg, 5.94 mmol) was dissolved in dehydrated tetrahydrofuran (3.0 mL). Thioacetic acid (635 μL, 8.92 mmol) was added to this solution and stirred at room temperature for 3 hours. After the reaction was completed, the reaction was quenched by adding a saturated aqueous solution of sodium bicarbonate and extracted with ethyl acetate. The organic layer was washed with saturated saline, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain S-(1-oxopentan-3-yl)ethanethioate Rf15 (875 mg) as a yellow oil. (Yield 86%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3, 400 MHz) δ (ppm): 9.70 (t, J = 2.0Hz, 1H), 3.92-3.86 (m, 1H), 2.74-2.71 (m, 2H), 2.33 (s, 3H), 1.77-1.62 (m, 2H), 0.98 (t, J = 7.2Hz, 3H).

[0225] Step 11: Under an argon atmosphere, sodium borohydride (340 mg, 8.91 mmol) and compound Rf15 (875 mg, 5.94 mmol) obtained in step 10 were added to a mixed solution of ethanol / water = 4 / 1 (20 mL) in an ice bath, and the mixture was stirred at room temperature for 40 minutes. After the reaction was completed, a saturated aqueous solution of ammonium chloride was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated saline and dried over anhydrous sodium sulfate. The obtained crude product was purified by column chromatography (Yamazen Hi-Flash column L, developing solvent: n-heptane / ethyl acetate = 90 / 10 → 50 / 50) to obtain 3-mercaptopentan-1-ol Rf16 (160 mg) as a colorless oil. (Yield 21%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 3.89-3.78 (m, 2H), 2.93-2.85 (m, 1H), 2.05-1.94 (m, 1H), 1.79-1.50 (m, 4H), 1.38 (d, J = 8.4 Hz, 1H), 1.02 (t, J = 7.2 Hz, 3H).

[0226] Step 12: Using the compound Rf16 (160 mg, 1.33 mmol) obtained in step 11, 3-(pyridin-2-yldisulfanyl)pentan-1-ol Rf17 (250 mg) was obtained as a colorless oil in the same manner as in step 7-1 of Reference Example 2 (yield 79%). ESI-MS (m / z): 230 [M+H]. 1H-NMR (CDCl 3 , 400 MHz) δ (ppm): 8.47 (d, J = 4.4 Hz, 1H), 7.62-7.51 (m, 2H), 7.13-7.10 (m, 1H), 4.13-4.01 (m, 1H), 3.85-3.77 (m, 2H), 3.08-3.01 (m, 1H), 2.00-1.91 (m, 1H), 1.82-1.66 (m, 3H), 1.02 (t, J = 8.0 Hz, 3H).

[0227] Step 13: Using the compound Rf17 (250 mg, 1.09 mmol) obtained in step 12, 2-((1-(bis(4-methoxyphenyl)(phenyl)methoxy)pentan-3-yl)disulfanyl)pyridine Rf18 (333 mg) was obtained as a colorless oil in the same manner as in step 1 of Reference Example 1. (Yield 51%) ESI-MS (m / z): 570 [M + K]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 8.40 (d, J = 4.8 Hz, 1H), 7.65 (d, J = 7.6 Hz, 1H), 7.51 (t, J = 7.6 Hz, 1H), 7.41 (d, J =7.6 Hz, 2H), 7.31-7.25 (m, 6H), 7.22-7.20 (m, 1H), 7.30 (t, J =7.6 Hz, 1H), 6.81 (d, J = 8.8 Hz, 4H), 3.79 (s, 6H), 3.24-3.14 (m, 2H), 2.99 (quin, J = 6.4 Hz, 1H), 1.89 (q, J = 6.0 Hz, 2H), 1.65-1.57 (m, 2H), 0.96 (t, J = 8.8 Hz, 3H).

[0228] Step 14: Compound Rf18 (333 mg, 0.626 mmol) obtained in step 13 was dissolved in dehydrated methanol (5.0 mL). Commercially available 3-mercapto-1-propanol Rf13 (43 μL, 0.501 mmol) was added to this solution and stirred at room temperature for 1 hour. Since the raw material remained, compound Rf13 (11 μL, 0.128 mmol) was added and stirred at room temperature for another 3 hours. After the reaction was completed, the reaction solution was concentrated to obtain the crude product as a yellow oil (0.69 g). The obtained crude product was purified by column chromatography (Yamazen Hi-Flash column M, developing solvent: n-heptane / ethyl acetate (2% triethylamine) = 95 / 5 → 80 / 20 → 70 / 30) to obtain 3-((1-(bis(4-methoxyphenyl)(phenyl)methoxy)pentan-3-yl)disulfanyl)propan-1-ol Rf19 (215 mg) as a colorless oil (yield 57%). ESI-MS (m / z): 552 [M + K]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.42 (d, J = 7.2 Hz, 1H), 7.33-7.20 (m, 7H), 6.82 (d, J = 8.8 Hz, 4H), 3.79 (s, 6H), 3.69 (q, J = 5.6 Hz, 2H), 3.20 (dt, J = 2.4, 7.2 Hz, 2H), 2.81 (quin, J = 6.4 Hz, 1H), 2.68 (t, J = 7.2 Hz, 2H), 1.94-1.83 (m, 4H), 1.63-1.57 (m, 2H), 1.35 (t, J = 5.6 Hz, 1H), 0.968 (t, J = 8.0 Hz, 3H).

[0229] Step 15: Using the compound Rf19 (215 mg, 0.354 mmol) obtained in step 14, 4-(3-((1-(bis(4-methoxyphenyl)(phenyl)methoxy)pentan-3-yl)disulfanyl)propoxy)-4-oxobutanoic acid Rf20 (210 mg, 6.6 wt% triethylamine (0.43 eq.)) was obtained as a colorless oil in the same manner as in step 8 of Reference Example 2 (yield 90%). ESI-MS (m / z): 612 [MH]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.41 (d, J = 7.6 Hz, 2H), 7.32-7.20 (m, 7H), 6.82 (d, J = 9.2 Hz, 4H), 4.13 (t, J = 6.0 Hz, 2H), 3.79 (s, 6H), 3.21-3.17 (m, 2H), 2.83-2.77 (m, 1H), 2.64-2.57 (m, 6H), 1.98-1.85 (m, 4H), 1.64-1.56 (m, 2H), 0.962 (t, J = 6.8 Hz, 3H).

[0230] Step 16: Using compound Rf20 (61 mg, 0.1 mmol) obtained in step 15 and CPG resin (LCAA Controlled Pore Glass, 2.20 g), modified CPG Rf21 (2.10 g) was obtained in the same manner as in step 9 of Reference Example 2. A portion of the obtained CPG resin (24.3 mg) was treated with a 2 wt% trichloroacetic acid-methylene chloride solution (25 mL) and the absorbance was measured. (Absorbance (503 nm) = 2.490, Loading 33.7 μmol / g)

[0231] Reference example 4 Synthesis of modified CPG Rf29 [ka] (In the formula, Po has the same meaning as defined above.)

[0232] Step 17: Using commercially available 2-cyclohexen-1-one Rf22 (5.00 g, 52 mmol), S-(3-oxocyclohexyl)ethanethioate Rf23 (8.83 g, 49.0 mmol, 4.4 wt% ethyl acetate) was obtained as an orange oil in the same manner as in Step 10 of Reference Example 3 (yield 94%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 3.89-3.82 (m, 1H), 2.72 (dd, J = 3.2, 14.4 Hz, 1H), 2.49-2.29 (m, 3H), 2.32 (s, 3H), 2.13 (br, 1H), 2.09-1.99 (m, 1H), 1.89-1.75 (m, 2H).

[0233] Step 18: Anhydrous tetrahydrofuran (100 mL) was added to a 500 mL flask under an argon atmosphere. After adding lithium aluminum hydride (1.95 g, 51.3 mmol) under ice cooling, compound Rf23 (8.83 g, 51.3 mmol) obtained in step 17 was added over 20 minutes under a salt ice bath. After the addition, the mixture was stirred for 1 hour under an ice bath (internal temperature 21 °C). After the reaction was completed, the mixture was quenched by adding a saturated aqueous ammonium chloride solution under ice cooling (internal temperature 5-10 °C) and extracted with ethyl acetate. The organic layer was washed with water and saturated saline, and dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure to obtain a crude product (7.18 g) as an orange oil. The residue was purified by column chromatography (Yamazen Hi-Flash column 3L, developing solvent: n-heptane / ethyl acetate = 80 / 20 → 70 / 30 → 50 / 50) to obtain S-(3-hydroxycyclohexyl)ethanethioate Rf24 (5.81 g, 30.0 mmol, 10 wt% ethyl acetate) as an orange oil (yield 59%). ESI-MS (m / z): 197.9 [M+Na].

[0234] Step 19: Using the compound Rf24 (2.90 g, 16.6 mmol) obtained in step 18, S-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)cyclohexyl)ethanethioate Rf25 (1.70 g, 3.44 mmol, 3.5 wt% acetonitrile) was obtained as a colorless amorphous substance in the same manner as in step 1 of Reference Example 1 (yield 21%). ESI-MS (m / z): 499.1 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.53-7.47 (m, 2H), 7.42-7.35 (m, 4H), 7.30-7.17 (m, 3H), 6.83-6.80 (m, 4H), 3.79 (s, 6H), 3.46-3.41 (m, 1H), 3.16-3.10 (m, 1H), 2.24 (s, 3H), 1.74 (br, 1H), 1.62-1.56 (s, 2H), 1.38-1.04 (m, 5H).

[0235] Step 20: Using the compound Rf25 (1.70 g, 3.57 mmol) obtained in step 19, 3-(bis(4-methoxyphenyl)(phenyl)methoxy)cyclohexane-1-thiol Rf26 (1.41 g, 2.80 mmol, 13.7 wt% ethyl acetate) was obtained as a colorless oil in the same manner as in step 6 of Reference Example 2 (yield 78%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3, 400 MHz) δ (ppm): 7.45-7.47 (m, 2H), 7.39-7.36 (m, 4H), 7.29-7.18 (m, 3H), 6.83-6.80 (m, 4H), 3.79 (s, 6H), 3.36-3.29 (m, 1H), 2.47-2.38 (m, 1H), 1.85-1.71 (m, 2H), 1.60-1.50 (m, 1H), 1.43 (d, J = 7.2 Hz, 1H), 1.31-1.05 (m, 4H), 1.18-0.90 (m, 1H).

[0236] Step 21: Using the compound Rf26 (780 mg, 3.87 mmol) obtained in step 20, 3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)cyclohexyl)disulfanyl)propan-1-ol Rf27 (457 mg, 0.785 mmol, 9.8 wt% ethyl acetate) was obtained as a colorless oil in the same manner as in step 7-2 of Reference Example 2. (Yield 41%) ESI-MS (m / z): 564.6 [M + K]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.51-7.48 (m, 2H), 7.41-7.37 (m, 4H), 7.30-7.18 (m, 3H), 6.84-6.80 (m, 4H), 3.79 (s, 6H), 3.75-3.69 (m, 2H), 3.40-3.32 (m, 1H), 2.70-2.61 (m, 2H), 2.39-2.31 (m, 1H), 1.96-1.80 (m, 2H), 1.69-1.43 (m, 4H), 1.28-0.983 (m, 4H).

[0237] Step 22: Using the compound Rf27 (215 mg, 0.354 mmol) obtained in step 21, 4-(3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)cyclohexyl)disulfanyl)propoxy)-4-oxobutanoic acid Rf28 (227 mg, 0.360 mmol, 7.2 wt% triethylamine (0.53 eq.)) was obtained as a colorless oil in the same manner as in step 8 of Reference Example 2 (yield 35%). ESI-MS (m / z): 623 [MH]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.53-7.47 (m, 2H), 7.42-7.35 (m, 4H), 7.30-7.18 (m, 3H), 6.85-6.79 (m, 4H), 4.16-4.10 (m, 2H), 3.79 (s, 6H), 3.40-3.30 (m, 1H), 3.02-2.96 (m, 1H), 2.63-2.56 (m, 6H), 2.41-2.30 (m, 1H), 2.01-1.90 (m, 2H), 1.84-1.78 (m, 1H), 1.70-1.58 (m, 2H), 1.45-1.39 (m, 1H), 1.28-0.96 (m, 4H).

[0238] Step 23: Using compound Rf28 (42.8 mg, 68.5 μmol) obtained in step 22 and CPG resin (LCAA Controlled Pore Glass, 1.20 g), modified CPG Rf29 (1.08 g) was obtained in the same manner as in step 9 of Reference Example 2. A portion of the obtained CPG resin (14.9 mg) was treated with a 2 wt% trichloroacetic acid-methylene chloride solution (25 mL) and the absorbance was measured. (Absorbance (503 nm) = 2.146, Loading 47.3 μmol / g).

[0239] Reference example 5 Synthesis of modified CPG Rf37 [ka] (In the formula, Po has the same meaning as defined above.)

[0240] Modified CPG Rf37 can be synthesized by the same synthesis method as in Reference Example 4 using commercially available 2H-pyran-3(6H)-one.

[0241] Reference example 6 Synthesis of amidite Rf41 [ka]

[0242] Step 24: Using the compound Rf9 (1.32 g, 6.56 mmol) obtained in step 7-1 of Reference Example 2, 2-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)pyridine Rf38 (2.96 g) was obtained as a colorless oil in the same manner as in step 1 of Reference Example 1. (Yield 90%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 8.45-8.44 (m, 1H), 7.69 (d, J = 0.8 Hz, , 1H), 7.67-7.58 (m, 1H), 7.42-7.40 (m, 2H), 7.31-7.25 (m, 6H), 7.22-7.16 (m, 1H), 7.08-7.04 (m, 1H), 6.84-6.79 (m, 4H), 3.78 (s, 6H), 3.15 (t, J = 6.0 Hz, 2H), 2.93 (t, J = 7.6 Hz, 2H), 2.00-1.96 (m, 2H).

[0243] Step 25: Using the compound Rf38 (2.49 g, 4.94 mmol) obtained in step 24 and commercially available 3-mercaptobutan-1-ol Rf39 (787 mg, 7.42 mmol), 3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)butan-1-ol Rf40 (1.86 g) was obtained as a colorless oil in the same manner as in step 7-2 of Reference Example 2. (Yield 67%) ESI-MS (m / z): 521.7 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.44-7.41 (m, 2H), 7.33-7.26 (m, 6H), 7.22-7.19 (m, 1H), 6.84-6.80 (m, 4H), 3.83-3.68 (m, 2H), 3.79 (s, 6H), 3.15 (t, J = 6.4 Hz, 2H), 3.02-2.94 (m, 1H), 2.80 (t, J = 6.8 Hz, 2H), 2.60 (t, J = 6.4 Hz, 1H), 2.01-1.92 (m, 2H), 1.80-1.71 (m, 1H), 1.41 (t, J = 5.6 Hz, 1H), 1.34 (d, J = 6.8 Hz, 3H).

[0244] Step 26: Using the compound Rf40 (380 mg, 0.762 mmol) obtained in step 25, 3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)butyl(2-cyanoethyl)diisopropylphosphoramidite Rf41 (230 mg, 0.300 mmol, 8.9 wt% AcOEt) was obtained as a colorless oil in the same manner as in step 2 of Reference Example 1 (yield 39%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3, 400 MHz) δ (ppm): 7.40-7.41 (m, 2H), 7.32-7.26 (m, 6H), 7.22-7.20 (m, 1H), 6.84-6.79 (m, 4H), 3.86-3.53 (m, 4H), 3.80 (s, 6H), 3.55-3.61 (m, 2H), 3.18-3.13 (m, 2H), 3.00-2.94 (m, 1H), 2.81-2.58 (m, 4H), 2.01-1.74 (m, 4H), 1.34 (dd, 1.2, 6.8 Hz, 3H), 1.29-1.22 (m, 2H), 1.17 (dt, J = 1.2, 4.8 Hz, 10H) 31 P-NMR (CDCl 3 , 162 MHz) δ (ppm): 148.3

[0245] Reference Example 7 Synthesis of アミダイトRf46

change

[0246] Project 27: 2,2'-Dithiobis(5-nitropyridine) (5.95 g, 19.2 mmol) was dissolved in dehydrated N,N-dimethylformamide (118 mL), and commercially available 3-mercaptopropan-1-ol Rf13 (1.18 g, 12.8 mmol) was added, followed by stirring at room temperature for 4 hours. Water was added to the reaction solution, and the mixture was extracted with isopropyl ether. Water was then added to the organic layer, which was then extracted with ethyl acetate. The organic layer was washed with saturated saline, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain a crude product (7.01 g) as a yellow solid. The crude product was suspended and washed in n-heptane / ethyl acetate = 50 / 50 to obtain a crude product (4.98 g) as an orange solid. The crude product was purified by column chromatography (silica amount: 90 g, developing solvent: n-heptane / ethyl acetate = 2 / 1 → 1 / 1 (1% triethylamine)) to obtain 3-((5-nitropyridin-2-yl)disulfanyl)propan-1-ol Rf42 (2.09 g) as a yellow oil (yield 66%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 9.28 (d, J = 1.6 Hz, 1H), 8.41 (dd, J = 2.4, 8.8 Hz, 1H), 7.89 (d, J = 8.8 Hz, 1H), 3.79 (t, J = 5.6 Hz, 2H), 2.99 (t, J = 8.8 Hz, 2H), 2.00-1.94 (m, 2H).

[0247] Step 28: Using the compound Rf42 (1.97 g, 8.00 mmol) obtained in step 27, 2-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)-5-nitropyridine Rf43 (3.99 g) was obtained as a pale yellow oil in the same manner as in step 1 of Reference Example 1. (Yield 91%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl3 , 400 MHz) δ (ppm): 9.24 (d, J = 1.6 Hz, 1H), 8.3 (dd, J = 2.8, 8.8 Hz, 1H), 7.85 (d, J = 8.8 Hz, 1H), 7.41-7.38 (m, 2H), 7.31-7.16 (m, 7H), 6.84-6. 80 (m, 4H), 3.79 (s, 6H), 3.18 (t, J = 6.0 Hz, 2H), 2.78 (t, J = 7.2 Hz, 2H), 1.97 (quin, J = 7.2 Hz, 2H).

[0248] Step 29: Using the compound Rf43 (4.13 g, 7.53 mmol) obtained in step 28 and commercially available 3-mercapto-3-methylbutan-1-ol Rf44 (1.36 g, 11.3 mmol), 3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)-3-methylbutan-1-ol Rf45 (3.72 g, 6.98 mmol) was obtained as a colorless liquid in the same manner as in step 7-2 of Reference Example 2. (Yield 93%) ESI-MS (m / z): 535.0 [M+Na]. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.34-7.40 (m, 2H), 7.33-7.26 (m, 6H), 7.22-7.18 (m, 1H), 6.84-6.80 (m, 4H), 3.79 (s, 6H), 3.79-3.75 (m, 2H), 3.14 (t, J = 6.4 Hz, 2H), 2.82 (t, J = 7.2 Hz, 2H), 1.96-1.86 (m, 4H), 1.44 (br, 1H), 1.32 (s, 6H).

[0249] Step 30: Using the compound Rf45 (1.00 g, 1.95 mmol) obtained in step 29, 3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)propyl)disulfanyl)-3-methylbutyl(2-cyanoethyl)diisopropylphosphoramidite Rf46 (1.15 g, 1.46 mmol) was obtained as a colorless oil in the same manner as in step 2 of Reference Example 1 (yield 75%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43-7.41 (m, 2H), 7.32-7.28 (m, 6H), 7.22-7.18 (m, 1H), 6.84-6.80 (m, 4H), 3.86-3.69 (m, 4H), 3.79 (s, 6H), 3.63-3.56 (m, 2H), 3.14 (t, J = 6.0 Hz, 2H), 2.81 (t, J =7.6 Hz, 2H), 2.61 (t, J = 6.4 Hz, 2H), 1.94 (quin, J = 7.6 Hz, 4H), 1.32 (s, 6H), 1.18 (dd, J = 4.8, 6.8 Hz, 12H). 31 P-NMR (CDCl 3 , 162 MHz) δ (ppm): 147.9

[0250] Reference example 8 Synthesis of carboxylic acid triethylamine salt Rf54 [ka]

[0251] Step 31: Using commercially available 2-(hydroxymethyl)-2-methylpropane-1,3-diol Rf47 (3.00 g, 25.0 mmol), 2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2-methylpropane-1,3-diol Rf48 (4.88 g, containing 5.4 wt% ethyl acetate, 10.9 mmol) was obtained as a pale yellow amorphous product in the same manner as in Step 1 of Reference Example 1 (yield 44%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43-7.41 (m, 2H), 7.34-7.19 (m, 7H), 6.85-6.82 (m, 4H), 3.79 (s, 6H), 3.69 (d, J = 11.2 Hz, 2H), 3.58 (d, J = 11.2 Hz, 2H), 3.14 (s, 2H), 2.32 (br, 2H), 0.834 (s, 3H).

[0252] Step 32: Under an argon atmosphere, compound Rf48 (4.88 g, containing 5.4 wt% ethyl acetate, 10.9 mmol) obtained in step 31 was dissolved in anhydrous tetrahydrofuran (50 mL) and cooled on ice. Sodium hydride (60% in mineral oil, 436 mg, 10.9 mmol), sodium iodide (168 mg, 1.12 mmol), and 1,4-dibromobutane Rf49 (1.29 ml, 10.9 mmol) were added in that order and stirred for 100 minutes under ice cooling. The ice bath was removed, and the mixture was stirred for 17 hours while being allowed to warm to room temperature. Since the reaction had progressed only by about 30%, the reaction solution was cooled on ice again, and sodium hydride (60% in mineral oil, 436 mg, 10.9 mmol) and 1,4-dibromobutane Rf49 (1.29 ml, 10.9 mmol) were added. The ice bath was immediately removed, and the mixture was stirred for 3 hours while gradually warming to room temperature. The raw material remained, but the reaction solution was ice-cooled and quenched by slowly adding saturated aqueous ammonium chloride (50 mL). Water (50 mL) was further added, and the mixture was extracted with ethyl acetate (0.15 L). The organic layer was washed with water (50 mL) and then with saturated saline (50 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a crude product as a yellow liquid. The crude product obtained was purified by column chromatography (Yamazen Hi-Flash column 3L, developing solvent: n-heptane / ethyl acetate = 100 / 0 → 0 / 100) to obtain 3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-((4-bromobutoxy)methyl)-2-methylpropan-1-ol Rf50 (3.24 g, containing 12 wt% ethyl acetate, 5.09 mmol) as a colorless viscous liquid. (Yield 47%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3, 400 MHz) δ (ppm): 7.43-7.41 (m, 2H), 7.32-7.16 (m, 7H), 6.85-6.82 (m, 4H), 3.79 (s, 6H), 3.55-3.38 (m, 6H), 3.08 (q, J = 10.8 Hz, 2H), 2.70 (t, J = 6.0 Hz, 1H), 1.91-1.84 (m, 2H), 1.72-1.65 (m, 2H), 1.23 (br, 2H), 0.884 (s, 3H).

[0253] Step 33: Under an argon atmosphere, compound Rf50 (1.00 g, containing 12 wt% ethyl acetate, 1.58 mmol) obtained in step 32 was dissolved in anhydrous N,N-dimethylformamide (18 mL), sodium iodide (134 mg, 0.897 mmol) and sodium azide (233 mg, 3.59 mmol) were added, and the mixture was stirred at room temperature for 8 hours. The reaction solution was cooled on ice, and water (20 mL) was added. The mixture was extracted with a mixed solvent of n-heptane / ethyl acetate = 1 / 1 (50 mL), and washed twice with water (50 mL x 2). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product (0.89 g) as a colorless viscous liquid. The resulting crude product was purified by column chromatography (Yamazen Hi-Flash column M, developing solvent: n-heptane / ethyl acetate = 100 / 0 → 30 / 70) to obtain 3-(4-azidobutoxy)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2-methylpropan-1-ol Rf51 (720 mg, containing 4.3 wt% ethyl acetate, 1.33 mmol) as a colorless liquid (yield 84%). ESI-MS (m / z): 542 [M+Na]. 1 H-NMR (CDCl 3, 400 MHz) δ (ppm): 7.43-7.41 (m, 2H), 7.32-7.16 (m, 7H), 6.84-6.81 (m, 4H), 3.79 (s, 6H), 3.55-3.40 (m, 6H), 3.28-3.25 (m, 2H), 3.08 (q, J = 11.2 Hz, 2H), 1.63-1.57 (m, 4H), 0.882 (s, 3H).

[0254] Step 34: Under an argon atmosphere, compound Rf51 (1.00 g, 1.92 mmol) obtained in step 33 was dissolved in dehydrated methylene chloride (10 mL), the solution was cooled in an ice bath (internal temperature 5°C), 2,6-lutidine (1.21 mL, 10.4 mmol) and trifluoromethanesulfonic anhydride (0.39 ml, 2.31 mmol) were added, and the mixture was stirred for 1 hour while cooling in an ice bath. The mixture was quenched by adding ice water (0.10 L) and extracted with ethyl acetate (0.20 L). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product (1.25 g) as a red liquid. The crude product was dissolved in anhydrous N,N-dimethylformamide (10 mL), 18-crown-6 (1.22 g, 4.60 mmol) and potassium p-toluenethiosulfonate (0.87 g, 3.84 mmol) were added, and the mixture was sealed and stirred at room temperature for 20 hours. Water (0.10 L) was added to quench the reaction, and the mixture was extracted twice with heptane / ethyl acetate = 1 / 1 (0.15 L x 2). The organic layer was washed with water (0.10 L) and dried over anhydrous sodium sulfate. The crude product (1.35 g) was obtained by concentrating under reduced pressure. The resulting crude product was purified by column chromatography (Yamazen Hi-Flash column L, developing solvent: n-heptane / ethyl acetate = 100 / 0 → 80 / 20) to obtain S-(3-(4-azidobutoxy)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2-methylpropyl) 4-methylbenzenebenzenesulfonothioate Rf52 (1.07 g, 1.55 mmol) as a yellow liquid (two-step yield 81%). ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ( ppm): 7.78-7.75 (m, 2H), 7.38-7.33 (m, 2H), 7.29-7.18 (m, 9H), 6.85-6.78 (m, 4H), 3.80 (s, 6H), 3.31 (t, J = 5.6 Hz, 2H), 3.25-3.17 (m, 4H), 3.70 (d, J = 2.0 Hz, 2H), 2.88 (q, J = 8.8 Hz, 2H), 2.42 (s, 3H), 1.59-1.52 (m, 4H), 0.879 (s, 3H).

[0255] Step 35: Using the compound Rf52 (1.05 g, 1.52 mmol) obtained in step 34 and commercially available 3-mercaptopropan-1-ol Rf13 (0.16 mL, 1.83 mmol), 3-((3-(4-azidobutoxy)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2-methylpropyl)disulfanyl)propan-1-ol Rf53 (858 mg, 1.37 mmol) was obtained as a colorless liquid in the same manner as in step 7-2 of Reference Example 2. (Yield 90%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43-7.40 (m, 2H), 7.32-7.18 (m, 7H), 6.84-6.80 (m, 4H), 3.79 (s, 6H), 3.72 (q, J = 6.0 Hz, 2H), 3.39 (t, J = 7.2 Hz, 2H), 3.34 (dd, J =5.6, 14.0 Hz, 2H), 3.26 (t, J = 6.4 Hz, 2H), 2.97 (q, J = 7.2 Hz, 2H), 2.91 (dd, J = 5.6, 18.0 Hz, 2H), 2.75 (t, J = 8.8 Hz, 2H), 1.92 (quin, J = 5.6 Hz, 2H), 1.63-1.58 (m, 4H), 1.44 (br, 1H), 0.999 (s, 3H).

[0256] Step 36: Using the compound Rf53 (300 mg, 0.480 mmol) obtained in step 35, 4-(3-((3-(4-azidobutoxy)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2-methylpropyl)disulfanyl)propoxy)-4-oxobutanoic acid triethylamine salt Rf54 (373 mg, 0.432 mmol) was obtained as a colorless liquid in the same manner as in step 8 of Reference Example 2. (Yield: 90%) ESI-MS (m / z): 725.0 [MH]. 1H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.43 - 7.41 (m, 2H), 7.31 - 7.18 (m, 7H), 6.84 - 6.80 (m, 4H), 4.14 (t, 6.4 Hz, 2H), 3.79 (s, 6H), 3.39 - 3.24 (m, 6H), 2.97 (q, J = 7.2 Hz, 2H), 2.92 - 2.85 (m, 2H), 2.69 (t, J = 7.2 Hz, 2H), 2.61 - 2.50 (m, 4H), 1.98 (quin, J = 6.4 Hz, 2H), 1.62 - 1.57 (m, 4H), 0.990 (s, 3H).

[0257] Reference Example 9 Synthesis of Modified CPG Rf59 [Chemical formula] (In the formula, Po has the same meaning as described above.)

[0258] Step 37: Commercially available 3,6,9,12-tetraoxapentadec-14-yn-1-amine Rf55 (75.0 mg, 0.324 mmol) was dissolved in dehydrated methylene chloride (3.0 mL), cholesterol chloroformate Rf56 (582 mg, 1.30 mmol) and triethylamine (294 μL, 2.11 mmol) were added, the mixture was sealed, and stirred at room temperature for 2 hours and 10 minutes. The reaction mixture was quenched by adding methanol (10 mL) and stirring at room temperature for 5 minutes, and concentrated under reduced pressure to obtain the crude product (1.97 g). The resulting crude product was purified by column chromatography (Yamazen Hi-Flash column M, developing solvent: n-heptane / ethyl acetate = 100 / 0 → 60 / 40) to obtain (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl (3,6,9,12-tetraoxapentadec-14-yn-1-yl)carbamate Rf57 (129 mg, 0.201 mmol) as a colorless viscous liquid. (Yield 62%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 5.37 (d, J = 5.2 Hz, 1H), 5.17 (br, 1H), 4.50 (br, 1H), 4.21 (d, J = 2.4 Hz, 2H), 3.73-3.60 (m, 12H), 3.55 (t, J = 5.2 Hz, 2H), 3.36 (br, 2H), 2.43 (t, J = 2.4 Hz, 1H), 2.39-2.24 (m, 2H), 2.04-1.78 (m, 5H), 1.59-0.939 (m, 21H), 1.00 (s, 3H), 0.911 (d, J = 6.4 Hz, 3H), (dd, J = 2.0, 6.4 Hz, 6H), 0.675 (s,3H).

[0259] Project 38: Compound Rf57 (73 mg, 0.114 mmol) obtained in step 37 and carboxylic acid triethylamine salt Rf54 (110 mg, 0.137 mmol) obtained in Reference Example 8 were dissolved in methanol (2.0 mL), tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (12.0 mg, 0.023 mmol), sodium ascorbate (4.50 mg, 0.023 mmol), copper sulfate (II) (1.80 mg, 0.011 mmol) in dimethyl sulfoxide / water = 1 / 1 (2.0 mL) solution was added, the flask was sealed, and the mixture was stirred at room temperature for 15 minutes. Methanol (2 mL), water (1 mL), and dimethyl sulfoxide (1 mL) were further added, and the mixture was stirred at room temperature for 1 hour and 15 minutes while suspending insoluble matter with ultrasonic vibration once every 10 minutes. The reaction mixture was quenched with water (50 mL), extracted twice with methylene chloride (80 mL x 2), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the crude product (548 mg). The obtained crude product was purified by column chromatography (Yamazen Hi-Flash column M, developing solvent: chloroform (1% TEA) / methanol = 100 / 0 → 85 / 15), and the column extract was dissolved in acetonitrile and lyophilized to obtain 4-(3-((3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-((4-(4-(1-(((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15, 16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)oxy)-1-oxo-5,8, 11,14-Tetraoxa-2-azapentadecan-15-yl)-1H-1,2,3-triazol-1-yl)butoxy)methyl)-2-methylpropyl)disulfanyl)propoxy)-4-oxobutanoic acid Rf58 (144 mg, 98.0 mmol) was obtained as a colorless viscous liquid containing 3.8 wt% (0.55 eq.) triethylamine and 3.2 wt% dimethyl sulfoxide. (Yield 86%) ESI-MS (m / z): Not detected. 1 H-NMR (CDCl 3 , 400 MHz) δ (ppm): 7.57 (s, 1H), 7.42-7.40 (m, 2H), 7.31-7.17 (m, 7H), 6.83-6.79 (m, 4H), 5.36 (d, J = 5.2 Hz, 1H), 5.25 (br, 1H), 4.69 (s, 2H), 4.49 (br, 1H), 4.15 (t, J = 6.4 Hz, 2H), 3.79 (s, 6H), 3.71-3.59 (m, 12H), 3.55-3.53 (m, 2H), 3.40-3.36 (m, 8H), 3.03-2.86 (m, 4H), 2.67 (t, J = 7.2 Hz, 2H), 2.60 (s, 4H), 2.36-2.23 (m, 2H), 2.02-1.78 (m, 9H), 1.60-0.852 (m, 24H), 0.997 (s, 6H), 0.911 (d, J = 6.4 Hz, 3H), 0.863 (dd, J = 2.0, 6.8 Hz, 6H), 0.672 (s,3H).

[0260] Step 39: Using the compound Rf58 (64 mg, 44 μmol) obtained in step 38 and CPG resin (LCAA Controlled Pore Glass, 1.10 g), modified CPG Rf59 (1.05 g) was obtained in the same manner as in step 9 of Reference Example 2. A portion of the obtained CPG resin (8.67 mg) was treated with a 2 wt% trichloroacetic acid-methylene chloride solution (25 mL) and the absorbance was measured. (Absorbance (503 nm) = 1.065, Loading 40.4 μmol / g).

[0261] Reference example 10 Synthesis of dipeptide amidite Rf65 [ka]

[0262] Using commercially available Fmoc-Val-Cit-PAB [(9H-fluoren-9-yl)methyl ((S)-1-(((S)-1-((4-(hydroxymethyl)phenyl)amino)-1-oxo-5-ureidopentan-2-yl)amino)-3-methyl-1-oxobutan-2-yl)carbamate] Rf60, step 40 was carried out by the same synthetic method as step 1 of Reference Example 1, step 41 was carried out by a method commonly used in organic synthetic chemistry [for example, the method described in Protective Groups in Organic Synthesis, third edition, by TW Greene, John Wiley & Sons Inc. (1999), etc.], and step 42 was carried out by the method described in Journal of Medicinal Chemistry, Vol. 48, Dipeptide amidite Rf65 can be synthesized by the method described in, for example, pp. 6229-6235, 2005, or a synthetic method analogous thereto, and step 43 is the same synthetic method as in step 2 of Reference Example 1.

[0263] Example 48 Synthesis of linear siRNA (compound 48) Compound Ic obtained in step 2 of Example 1 was mixed with equal amounts of oligonucleotide HPRT1_asRNA1 prepared separately using a nucleic acid synthesizer, dissolved in a citrate buffer, and allowed to stand at 85° C. for 5 minutes. The temperature was then gradually lowered to obtain compound 48.

[0264] Example 49 Synthesis of linear siRNA (compound 49) Compound 49 was obtained in the same manner as in Example 48 using compound 2c obtained in step 2 of Example 2 and oligonucleotide HPRT1_asRNA1 separately prepared by a nucleic acid synthesizer.

[0265] Example 50 Synthesis of linear siRNA (compound 50) Compound 50 was obtained in the same manner as in Example 48 using compound 3c obtained in step 2 of Example 3 and oligonucleotide B2M_asRNA1 separately prepared by a nucleic acid synthesizer.

[0266] Example 51 Synthesis of pseudolinker-attached linear siRNA (compound 51) Compound 51 was obtained in the same manner as in Example 48 using compound 6c obtained in step 2 of Example 6 and oligonucleotide HPRT1_asRNA5 separately prepared by a nucleic acid synthesizer.

[0267] Example 52 Synthesis of linear siRNA (compound 52) Compound 52 was obtained in the same manner as in Example 48 using compound 7c obtained in step 2 of Example 7 and oligonucleotide PTEN_asRNA2 separately prepared by a nucleic acid synthesizer.

[0268] Example 53 Synthesis of linear siRNA (compound 53) Compound 53 was obtained in the same manner as in Example 48 using compound 8c obtained in step 2 of Example 8 and oligonucleotide Factor9_asRNA2 separately prepared using a nucleic acid synthesizer.

[0269] The base sequences and molecular weights of the oligonucleotide derivatives of Examples 48 to 53 and the negative control group are shown in Tables 20 to 23. In each Example, the upper row shows the sense strand, and the lower row shows the antisense strand. The abbreviations in Tables 20 to 23 are as follows. C6CSSC6 = CH 3 -(CH 2 ) 5 -SS-(CH 2 ) 6 - C3SSC3 = CH 3 -(CH 2 ) 2 -SS-(CH 2 ) 3 - p = phosphorylation ^ = phosphorothioate modification m = 2'-OMe modification f = 2'-F modification

[0270] [Table 20]

[0271] [Table 21]

[0272] [Table 22]

[0273] [Table 23]

[0274] Test Example 1: mRNA knockdown of circular siRNA targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes A medium for seeding mouse primary hepatocytes was prepared by adding an additive (Primary Hepatocyte Thawing and Plating Supplements, ThermoFisher, CM3000) to 500 mL of William's E Medium (no phenol red, Life Technologies, A1217601). A medium for incubation of mouse primary hepatocytes was prepared by adding an additive (Hepatocyte Matintenance Supplements, ThermoFisher, CM4000) to 500 mL of Williams' Medium E (no phenol red). Frozen commercially available primary mouse hepatocytes (Mouse (CD-1) Cryopreserved Hepatocytes, Plateable Male, Invitrogen, MSCP10) were thawed in a water bath at 37°C and then suspended in 10 mL of seeding medium. The suspended cells were centrifuged, the supernatant was removed, and the cells were then cultured at a density of 1.25 × 10 5 The cells were diluted to 100 cells / mL. Compound 1 and compound 2 were used as test samples, and HPRT1_dsRNA1 and HPRT1_dsRNA2 were used as comparative controls. The final concentrations were 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, and the experiment was carried out with N=3. The nucleic acid complex solution was diluted as follows. The nucleic acid complex solution was diluted with Optimem (Opti-MEM(R) I Reduced Serum Medium, Life Technologies, 31985-070) and citrate buffer (20 mM citrate (pH 7), 150 mM NaCl). 20 μL of the diluted nucleic acid complex solution was added to a Collagen I-coated 96-well flat-bottom plate (BD, 356407), and 20 μL of a diluted solution containing no nucleic acid was added to the negative control group. 80 μL of the cell solution was added to each well and incubated at 37°C, 5% CO 2 After culturing under these conditions for 24 hours, the cells were subjected to RNA extraction. A cell lysate containing RNA was prepared using a SuperPrep Cell Lysis Kit (SuperPrep (registered trademark) Cell Lysis & RT Kit for qPCR, Toyobo, SCQ-101), and a reverse transcription reaction was performed using the RT Kit for qPCR included in the kit according to the instructions attached to the kit to create cDNA. This cDNA was used as a template for PCR reaction, and the QuantStudio 12K Flex real-time PCR system (Applied Biosystems) was used to perform PCR reactions of the HPRT1 gene and the Actin β (hereinafter referred to as ACTB) gene as a control by the Taqman probe method to measure the amount of mRNA amplified, and the amount of ACTB mRNA amplified was used as an internal control to calculate the quasi-quantitative value of HPRT1 mRNA. The amounts of HPRT1 and ACTB mRNA amplified in the negative control group were also measured in the same manner, and the quasi-quantitative value of HPRT1 mRNA was calculated. The TaqMan probe Mm0154399_m1 (Applied Biosystems) was used to measure the HPRT1 gene, and Mm00607939_s1 (Applied Biosystems) was used to measure the ACTB gene. The reaction reagent used was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of HPRT1 mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 1. From these results, it was confirmed that the test samples (compound 1 and compound 2) exhibited stronger knockdown effects than the controls (HPRT1_dsRNA1 and HPRT1_dsRNA2).

[0275] Test Example 2: mRNA knockdown of circular siRNA targeting beta2-macroglobulin (B2M) in mouse primary hepatocytes A medium for seeding mouse primary hepatocytes was prepared by adding an additive (Primary Hepatocyte Thawing and Plating Supplements, ThermoFisher, CM3000) to 500 mL of William's E Medium (no phenol red, Life Technologies, A1217601). A medium for incubation of mouse primary hepatocytes was prepared by adding an additive (Hepatocyte Matintenance Supplements, ThermoFisher, CM4000) to 500 mL of William's E Medium. Frozen commercially available primary mouse hepatocytes (Mouse (CD-1) Cryopreserved Hepatocytes, Plateable Male, Invitrogen, MSCP10) were thawed in a water bath at 37°C and then suspended in 10 mL of seeding medium. The suspended cells were centrifuged, the supernatant was removed, and the cells were then cultured at a density of 1.25 × 10 5 The cells were diluted to 100 cells / mL. Compound 3 was used as a test sample, and B2M_dsRNA was used as a control. The final concentrations were 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, and the experiment was carried out with N=3. The nucleic acid complex solution was diluted as follows. The nucleic acid complex solution was diluted with Optimem (Opti-MEM(R) I Reduced Serum Medium, Life Technologies, 31985-070) and citrate buffer (20 mM citrate (pH 7), 150 mM NaCl). 20 μL of the diluted nucleic acid complex solution was added to a Collagen I-coated 96-well flat-bottom plate (BD, 356407), and 20 μL of a diluted solution containing no nucleic acid was added to the negative control group. 80 μL of the cell solution was added to each well and incubated at 37°C, 5% CO 2After that, the supernatant was removed, and 100 μL of incubation medium was added to each well. The cells were incubated at 37°C, 5% CO 2 After culturing under these conditions for 18 hours, the cells were subjected to RNA extraction. A cell lysate containing RNA was prepared using a SuperPrep Cell Lysis Kit (SuperPrep (registered trademark) Cell Lysis & RT Kit for qPCR, Toyobo, SCQ-101), and a reverse transcription reaction was performed using the RT Kit for qPCR included in the kit according to the instructions attached to the kit to create cDNA. This cDNA was used as a template for PCR reaction, and the B2M gene and the Actin β (hereinafter referred to as ACTB) gene as a control were subjected to PCR reaction using the QuantStudio 12K Flex real-time PCR system (Applied Biosystems) by the Taqman probe method to measure the amount of mRNA amplified, and the amount of mRNA amplified of ACTB was used as an internal control to calculate the quasi-quantitative value of B2M mRNA. The amounts of mRNA amplified of B2M and ACTB in the negative control group were also measured in the same manner, and the quasi-quantitative value of B2M mRNA was calculated. The TaqMan probe Mm00437762_m1 (Applied Biosystems) was used to measure the B2M gene, and Mm00607939_s1 (Applied Biosystems) was used to measure the ACTB gene. The reaction reagent used was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of B2M mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 2. From these results, it was confirmed that test sample compound 3 exhibited a stronger knockdown effect than the control B2M_dsRNA.

[0276] Test Example 3: mRNA knockdown of circular siRNA targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes A medium for seeding mouse primary hepatocytes was prepared by adding an additive (Primary Hepatocyte Thawing and Plating Supplements, ThermoFisher, CM3000) to 500 mL of William's E Medium (no phenol red, Life Technologies, A1217601). A medium for incubation of mouse primary hepatocytes was prepared by adding an additive (Hepatocyte Matintenance Supplements, ThermoFisher, CM4000) to 500 mL of William's E Medium. Frozen commercially available primary mouse hepatocytes (Mouse (CD-1) Cryopreserved Hepatocytes, Plateable Male, Invitrogen, MSCP10) were thawed in a water bath at 37°C and then suspended in 10 mL of seeding medium. The suspended cells were centrifuged, the supernatant was removed, and the cells were then cultured at a density of 1.25 × 10 5 The cells were diluted to 100 cells / mL. Compounds 4 and 5 were used as test samples, and HPRT1_dsRNA3 and HPRT1_dsRNA4 were used as comparative controls. The final concentrations were 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, and the experiment was carried out with N=3. The nucleic acid complex solution was diluted as follows. The nucleic acid complex solution was diluted with Optimem (Opti-MEM(R) I Reduced Serum Medium, Life Technologies, 31985-070) and citrate buffer (20 mM citrate (pH 7), 150 mM NaCl). 20 μL of the diluted nucleic acid complex solution was added to a Collagen I-coated 96-well flat-bottom plate (BD, 356407), and 20 μL of a diluted solution containing no nucleic acid was added to the negative control group. 80 μL of the cell solution was added to each well and incubated at 37°C, 5% CO 2 After that, the supernatant was removed, and 100 μL of incubation medium was added to each well. The cells were incubated at 37°C, 5% CO 2 After culturing under these conditions for 18 hours, the cells were subjected to RNA extraction. A cell lysate containing RNA was prepared using a SuperPrep Cell Lysis Kit (SuperPrep (registered trademark) Cell Lysis & RT Kit for qPCR, Toyobo, SCQ-101), and a reverse transcription reaction was performed using the RT Kit for qPCR included in the kit according to the instructions attached to the kit to create cDNA. This cDNA was used as a template for PCR reaction, and the QuantStudio 12K Flex real-time PCR system (Applied Biosystems) was used to perform PCR reactions of the HPRT1 gene and the Actin β (hereinafter referred to as ACTB) gene as a control by the Taqman probe method to measure the amount of mRNA amplified, and the amount of ACTB mRNA amplified was used as an internal control to calculate the quasi-quantitative value of HPRT1 mRNA. The amounts of HPRT1 and ACTB mRNA amplified in the negative control group were also measured in the same manner, and the quasi-quantitative value of HPRT1 mRNA was calculated. The TaqMan probe Mm0154399_m1 (Applied Biosystems) was used to measure the HPRT1 gene, and Mm00607939_s1 (Applied Biosystems) was used to measure the ACTB gene. The reaction reagent used was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of HPRT1 mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 3. From these results, it was confirmed that the test samples (compounds 3 and 4) exhibited stronger knockdown effects than the controls (HPRT1_dsRNA3 and HPRT1_dsRNA4).

[0277] Test Example 4: mRNA knockdown of circular siRNA targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes The same procedure as in Test Example 3 was repeated, except that the test sample was changed to Compound 6 and the control was changed to HPRT1_dsRNA 5. The test results are shown in FIG. From these results, it was confirmed that the test sample (compound 6) exhibited a stronger knockdown effect than the control (HPRT1_dsRNA5).

[0278] Test Example 5: mRNA knockdown in HeLa cells using circular siRNA targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) HeLa cells were suspended in RPMI 1640 medium (Life Technologies, A10491-01) containing 10% fetal bovine serum, and 100 μL of the cell suspension was seeded into each well of a culture plate (Nunc 96 microwell plate, 167008) so that 2,000 to 3,000 cells were obtained per well. The cells were then incubated at 37°C and 5% CO. 2 The cells were cultured under these conditions for 24 hours. Compound 6 was used as the test sample, and HPRT1_dsRNA5 was used as a control. The final concentrations were 1 μmol / L, 0.3 μmol / L, 0.1 μmol / L, and 0.03 μmol / L, with N=3. The nucleic acid complex solution was diluted as follows. The nucleic acid complex solution was diluted with Optimem (Opti-MEM(R) I Reduced Serum Medium, Life Technologies, 31985-070) and citrate buffer (20 mM citrate (pH 7), 150 mM NaCl). The supernatant was removed from the plate in which the cells were cultured, and 80 μL of serum-containing medium was added. 20 μL of the nucleic acid complex solution was then added to each well, and 20 μL of a diluted solution containing no nucleic acid was added to each well as a negative control. After that, the plates were incubated at 37°C and 5% CO 2 The cells were cultured under these conditions for 96 hours. RNA recovery and cDNA preparation were carried out in the same manner as in Test Example 1. The obtained cDNA was used as a template for PCR reaction, and a QuantStudio 12K Flex real-time PCR system (Applied Biosystems) was used to perform PCR reaction of the HPRT1 gene and the Actin β (hereinafter referred to as ACTB) gene as a control by Taqman probe method to measure the amount of mRNA amplified, and the amount of ACTB mRNA amplified was used as an internal control to calculate the quasi-quantitative value of HPRT1 mRNA. The amounts of HPRT1 and ACTB mRNA amplified in the negative control group were also measured in the same manner, and the quasi-quantitative value of HPRT1 mRNA was calculated. The TaqMan probe Hs02800695_m1 (Applied Biosystems) was used to measure the HPRT1 gene, and the TaqMan probe Hs01060665_g1 (Applied Biosystems) was used to measure the ACTB gene. The reaction reagent was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of HPRT1 mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 5. From these results, it was confirmed that the test sample (compound 6) exhibited a stronger knockdown effect than the control (HPRT1_dsRNA5).

[0279] Test Example 6: mRNA knockdown of hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1)-targeted circular siRNA in human hepatocellular carcinoma (HepG2) cells HepG2 cells were suspended in MEM medium (Gibco, 11095-080) containing 10% fetal bovine serum, and 100 μL of the cell suspension was seeded into each well of a culture plate (Nunc 96 microwell plate, 167008) so that 2,000 to 3,000 cells were obtained per well. The cells were then incubated at 37 °C and 5% CO. 2 The cells were cultured under these conditions for 24 hours. Addition of nucleic acid, recovery of RNA, and preparation of cDNA were carried out in the same manner as in Test Example 5. The obtained cDNA was used as a template for PCR reaction, and a QuantStudio 12K Flex real-time PCR system (Applied Biosystems) was used to carry out PCR reaction of the HPRT1 gene and the GAPDH gene as a control by Taqman probe method to measure the amount of mRNA amplified, and the amount of GAPDH mRNA amplified was used as an internal control to calculate the quasi-quantitative value of HPRT1 mRNA. The amounts of HPRT1 and GAPDH mRNA amplified in the negative control group were also measured in the same manner, and the quasi-quantitative value of HPRT1 mRNA was calculated. The TaqMan probe Hs02800695_m1 (Applied Biosystems) was used to measure the HPRT1 gene, and Hs02758991_g1 (Applied Biosystems) was used to measure the GAPDH gene. The reaction reagent used was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of HPRT1 mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 6. From these results, it was confirmed that the test sample (compound 6) exhibited a stronger knockdown effect than the control (HPRT1_dsRNA5).

[0280] Test Example 7: mRNA knockdown of hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1)-targeted circular siRNA in human hepatoma-derived HuH-7 cells HuH-7 cells were suspended in DMEM medium (DMEM (Higl-Glc), Nacalai Tesque, 08458-16) containing 10% fetal bovine serum, and 100 μL of the cell suspension was seeded into each well of a culture plate (Nunc 96 microwell plate, 167008) so that 2,000 to 3,000 cells were obtained per well. The cells were then incubated at 37°C and 5% CO. 2 The cells were cultured under these conditions for 24 hours. The addition of nucleic acid, recovery of RNA, preparation of cDNA, and PCR reaction were carried out in the same manner as in Test Example 6. The test results are shown in FIG. From these results, it was confirmed that the test sample (compound 6) exhibited a stronger knockdown effect than the control (HPRT1_dsRNA5).

[0281] Test Example 8: mRNA knockdown of hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1)-targeted circular siRNA in mouse macrophage-like Rho 264.7 (RAW264.7) cells RAW264.7 cells were suspended in RPMI1640 Medium (Life Technologies, A10491-01) containing 10% fetal bovine serum, and 100 μL of the cell suspension was seeded into each well of a culture plate (Nunc 96 microwell plate, 167008) so that 2,000 to 3,000 cells were obtained per well. The cells were then incubated at 37°C and 5% CO 2 The cells were cultured under these conditions for 24 hours. Addition of nucleic acid, recovery of RNA, and preparation of cDNA were carried out in the same manner as in Test Example 6. The obtained cDNA was used as a template for PCR reaction, and the HPRT1 gene and the B2M gene as a control were subjected to PCR reaction by Taqman probe method using a QuantStudio 12K Flex real-time PCR system (Applied Biosystems), and the mRNA amplification amount was measured, and the mRNA amplification amount of B2M was used as an internal control to calculate the semi-quantitative value of HPRT1 mRNA. The mRNA amplification amounts of HPRT1 and B2M in the negative control group were also measured in the same manner, and the semi-quantitative value of HPRT1 mRNA was calculated. The TaqMan probe Mm01545399_m1 (Applied Biosystems) was used to measure the HPRT1 gene, and the TaqMan probe Mm00437762_m1 (Applied Biosystems) was used to measure the B2M gene. The reaction reagent used was TaqMan Gene Expression Master Mix (Applied Biosystems, 4369542), and the measurements were performed according to the attached protocols. The amount of target mRNA in the siRNA-introduced samples was calculated as a relative ratio when the amount of HPRT1 mRNA in the negative control group (siRNA-unintroduced group) was set to 1. The results of the relative ratio of the mRNA amount expressed as the mean ± standard deviation are shown in Figure 8. From these results, it was confirmed that the test sample (compound 6) exhibited a stronger knockdown effect than the control (HPRT1_dsRNA5).

[0282] Test Example 9: Evaluation of nucleic acid stability in serum A nucleic acid solution adjusted to 100 μM with citrate buffer (20 mM citrate (pH 7), 150 mM NaCl) was mixed with rat serum (Cedarlane, CL7000-50) in a 1:9 ratio and allowed to stand at 37°C for a specified period of time. From the obtained sample, cDNA complementary to the antisense strand of siRNA was prepared according to the protocol attached to the TaqMan MicroRNA Reverse Transcription Kit (Life technologies, 4366596) (RT primer sequence: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCTATGTCTG SEQ ID NO: 71). This cDNA was used as a template for PCR reaction, and the amount of siRNA antisense strand remaining in serum was calculated by the Taqman probe method using a QuantStudio 12K Flex real-time PCR system (Applied Biosystems) (forward primer sequence: CGCGCGCGATAAAATCTACAG SEQ ID NO: 72, reverse primer sequence: GTGCAGGGTCCGAGGT SEQ ID NO: 73, Taqman probe sequence: CTGGATACGACTCCTA SEQ ID NO: 74). The concentration at the start of the interaction with serum was taken as 100%, and the remaining rate after standing for a given period of time was expressed as a relative percentage in terms of mean ± standard deviation, and the results are shown in FIG. The remaining rate of the antisense strand 28 days after interaction with serum was higher for the test sample, Compound 6, than for the control sample, HPRT1_dsRNA5, confirming that the stability in serum was improved.

[0283] Test Example 10: Evaluation of nucleic acid stability in nuclease Nucleotide-degrading enzyme (Phosphodiesterase I from Crotalus adamanteus venom, Sigma-Aldrich, P3243-1VL) was added to reaction buffer (50 mM Tris / HCl, pH 7.5, 8 mM MgCl 2) to adjust the concentration to 1.2 U / mL. The nucleic acid solution adjusted to 20 μM with citrate buffer (20 mM citrate (pH 7), 150 mM NaCl) and the nuclease solution diluted 100-fold with reaction buffer were mixed in a 1:9 ratio and left to stand at 37°C for a specified time. The mixture was then heated at 95°C for 10 minutes to terminate the reaction. Preparation of cDNA and PCR reaction were carried out in the same manner as in Test Example 9, and the concentration at the start of interaction with the nuclease was taken as 100%, and the remaining rate of the antisense strand after leaving it for a specified period of time was expressed as the relative percentage, expressed as the average ± standard deviation, and is shown in Figure 10. The remaining rate of the antisense strand 24 hours after interaction with the nuclease was higher for the test sample, compound 6, than for the control sample, linear oligo HPRT1_dsRNA5, confirming that compound 6 has high stability in the nuclease.

[0284] Test Example 11: mRNA knockdown of circular siRNA targeting phosphatase and tensin homolog deleted from chromosome 10 (PTEN) and Factor 9 in mouse primary hepatocytes The experiment was carried out in the same manner as in Test Example 3, except that the test samples were changed to Compound 7 and Compound 8, and the negative control group was changed to PTEN_dsRNA1 and Factor9_dsRNA1. The test results are shown in FIG.

[0285] Test Example 12: mRNA knockdown in HeLa cells using circular siRNA targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) The same procedure as in Test Example 5 was carried out, except that the test samples were changed to Compounds 9 to 26, 28 to 35, 38, 39, 41 to 44, and 47. The test results are shown in Figures 12 to 18.

[0286] Test Example 13: mRNA knockdown of compounds 48 and 49 targeting hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) in mouse primary hepatocytes The same procedure as in Test Example 1 was carried out, except that the test samples were changed to Compounds 48 and 49. The test results are shown in FIG.

[0287] Test Example 14: mRNA knockdown of compound 50 targeting beta2-macroglobulin (B2M) in mouse primary hepatocytes The same procedure as in Test Example 2 was carried out, except that the test sample was changed to Compound 50. The test results are shown in FIG.

[0288] Test Example 15: Compound 51 targets hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) for mRNA knockdown in HeLa cells The same procedure as in Test Example 5 was carried out, except that the test sample was changed to Compound 51. The test results are shown in FIG.

[0289] Test Example 16: mRNA knockdown of compound 52 targeting phosphatase and tensin homolog deleted from chromosome 10 (PTEN) and compound 53 targeting factor 9 in mouse primary hepatocytes The same procedure as in Test Example 3 was carried out, except that the test samples were changed to Compound 52 and Compound 53. The test results are shown in FIG.

[0290] Test Example 17: In vivo mouse mRNA knockdown test of circular siRNA targeting HPRT1 Compound 6 synthesized in Example 6 and its negative control HPRT1_dsRNA5 were subjected to an in vivo evaluation test by the following method. Each synthetic nucleic acid was diluted with phosphate buffered saline (DPBS) (manufactured by Nacalai Tesque) according to the test. After acclimating mice (BALB / cA, obtained from CLEA Japan), each nucleic acid was intravenously administered to the mice at 20 mg / kg or 5 mg / kg. In addition, only DPBS was intravenously administered to the mice as a control group. Three days after administration, the animals were euthanized, and the quadriceps and liver were collected and frozen in liquid nitrogen. Total RNA was collected from each frozen sample using TRIzol RNA isolation reagents (manufactured by Life Technologies, catalog number 15596026) and MagNA Pure 96 (manufactured by Roche Life Sciences) according to the method described in the instructions attached to the product. Furthermore, cDNA was prepared by reverse transcription using the total RNA obtained as a template using a Transcriptor First Strand CDNA Synthesis Kit (Roche, catalog number 04897030001) according to the method described in the instructions attached to the product. The obtained cDNA was used as a template, and a Taqman (registered trademark) Gene Expression Assay's probe (Applied Biosystems) was used as a probe to carry out a PCR reaction according to the method described in the attached instruction manual using a quantstudio 12k flex real-time PCR system (ABI). The amount of mRNA amplified was measured by PCR reaction of the HPRT1 gene and GAPDH gene, and the amount of GAPDH amplified was used as an internal control to calculate the semi-quantitative value of HPRT1 mRNA. The semi-quantitative value of HPRT1 mRNA in the control group measured in the same manner was set to 1, and the expression rate of Hprt mRNA in each synthetic nucleic acid administration group was calculated from the semi-quantitative value of HPRT1 mRNA in each synthetic nucleic acid administration group. The expression inhibition rate of HPRT1 mRNA obtained is shown in Table 24.

[0291] [Table 24]

[0292] As is clear from Table 24, the compounds of the present invention more strongly inhibited the expression of the HPRT1 gene in the quadriceps muscle and liver than HPRT1_dsRNA5. [Industrial Applicability]

[0293] The oligonucleotide derivative of the present invention or a salt thereof can be administered to a mammal to treat various associated diseases in the living body. [Sequence List Free Text]

[0294] SEQ ID NO: 1: HPRT1_ssRNA1 in negative control groups 1 and 2 in Tables 7 and 20. SEQ ID NO: 2: HPRT1_ssRNA2 in negative control group 4 in Table 8. SEQ ID NO: 3: HPRT1_ssRNA3 in negative control group 6 in Tables 8, 18 and 22. SEQ ID NO: 4: HPRT1_ssRNA4 in negative control group 9 in Table 12. SEQ ID NO: 5: HPRT1_ssRNA5 in Example 48 of Table 20. SEQ ID NO: 6: HPRT1_ssRNA6 in Example 49 of Table 20. SEQ ID NO: 7: HPRT1_ssRNA7 in Example 51 of Table 22. SEQ ID NO: 8: HPRT1_asRNA1 in negative control group 1 of Tables 7, 17 and 20 and in Examples 1, 2, 45, 48 and 49. Sequence number 9: HPRT1_asRNA2 in negative control group 2 in Table 7. SEQ ID NO: 10: negative control group 4 in Table 8 and HPRT1_asRNA3 in Examples 4 and 5. Sequence number 11: HPRT1_asRNA4 in negative control group 5 in Table 8. SEQ ID NO: 12: HPRT1_asRNA5 in negative control groups 6 and 9 in Tables 8, 11-19 and 22 and Examples 6, 9-44, 46, 47 and 51. SEQ ID NO: 13: HPRT1_csRNA1 in Examples 1, 10, 11 and 18-24 of Tables 7 and 11-13. SEQ ID NO: 14: HPRT1_csRNA2 in Examples 2, 12, 13, 25, 26, 32, 35, 38, 39, 41 and 44 of Tables 7 and 13-15. SEQ ID NO: 15: HPRT1_csRNA3 in Examples 4, 27-34, 36, 42 and 43 of Tables 8 and 15-17. SEQ ID NO: 16: HPRT1_csRNA4 in Examples 5, 37, 40 and 45-47 of Tables 8 and 17-19. SEQ ID NO: 17: HPRT1_csRNA5 in Example 6 of Table 8. SEQ ID NO: 18: HPRT1_csRNA6 in Example 9 of Table 11. SEQ ID NO: 19: HPRT1_csRNA7 in Example 14 of Table 11. SEQ ID NO: 20: HPRT1_csRNA8 in Example 15 of Table 11. SEQ ID NO: 21: HPRT1_csRNA9 in Example 16 of Table 11. SEQ ID NO: 22: HPRT1_csRNA10 in Example 17 of Table 11. SEQ ID NO: 23: HPRT1_csRNA11 in Example 19 of Table 11. SEQ ID NO: 24: HPRT1_csRNA12 in Example 20 of Table 11. SEQ ID NO: 25: HPRT1_csRNA13 in Example 21 of Table 11. SEQ ID NO: 26: HPRT1_csRNA14 in Example 22 of Table 11. SEQ ID NO: 27: HPRT1_csRNA15 in Example 10 of Table 12. SEQ ID NO: 28: HPRT1_csRNA16 in Example 11 of Table 12. SEQ ID NO: 29: HPRT1_csRNA17 in Example 18 of Table 12. SEQ ID NO: 30: HPRT1_csRNA18 in Example 23 of Table 12. SEQ ID NO: 31: HPRT1_csRNA19 in Example 24 of Table 13. Sequence number 32: HPRT1_csRNA20 in Example 25 of Table 13. Sequence number 33: HPRT1_csRNA21 in Example 26 of Table 13. SEQ ID NO: 34: HPRT1_csRNA22 in Example 35 of Table 13. SEQ ID NO: 35: HPRT1_csRNA23 in Example 12 of Table 14. SEQ ID NO: 36: HPRT1_csRNA24 in Example 13 of Table 14. SEQ ID NO: 37: HPRT1_csRNA25 in Example 32 of Table 14. SEQ ID NO: 38: HPRT1_csRNA26 in Example 41 of Table 14. Sequence number 39: HPRT1_csRNA27 in Example 44 of Table 14. Sequence number 40: HPRT1_csRNA28 in Example 38 of Table 15. Sequence number 41: HPRT1_csRNA29 in Example 39 of Table 15. Sequence number 42: HPRT1_csRNA30 in Example 42 of Table 15. SEQ ID NO: 43: HPRT1_csRNA31 in Example 43 of Table 15. Sequence number 44: HPRT1_csRNA32 in Example 28 of Table 16. SEQ ID NO: 45: HPRT1_csRNA33 in Example 29 of Table 16. Sequence number 46: HPRT1_csRNA34 in Example 30 of Table 16. Sequence number 47: HPRT1_csRNA35 in Example 31 of Table 16. Sequence number 48: HPRT1_csRNA36 in Example 33 of Table 16. Sequence number 49: HPRT1_csRNA37 in Example 34 of Table 16. Sequence number 50: HPRT1_csRNA38 in Example 27 of Table 17. Sequence number 51: HPRT1_csRNA39 in Example 36 of Table 17. Sequence number 52: HPRT1_csRNA40 in Example 37 of Table 17. Sequence number 53: HPRT1_csRNA41 in Example 45 of Table 17. Sequence number 54: HPRT1_csRNA42 in Example 47 of Table 18. Sequence number 55: HPRT1_csRNA43 in Example 40 of Table 19. Sequence number 56: HPRT1_csRNA44 in Example 46 of Table 19. SEQ ID NO: 57: PTEN_ssRNA1 in negative control group 7 in Tables 10 and 23. Sequence number 58: PTEN_ssRNA2 in Example 52 of Table 23. SEQ ID NO: 59: PTEN_asRNA1 in negative control group 7 in Tables 10 and 23. SEQ ID NO: 60: PTEN_asRNA2 in Examples 7 and 52 of Tables 10 and 23. Sequence number 61: PTEN_csRNA1 in Example 7 of Table 10. SEQ ID NO: 62: Factor9_ssRNA1 in negative control group 8 in Tables 10 and 23. Sequence number 63: Factor9_ssRNA2 in Example 53 of Table 23. Sequence number 64: Factor9_asRNA1 in negative control group 8 in Tables 10 and 23. SEQ ID NO: 65: Factor9_asRNA2 in Examples 8 and 53 of Tables 10 and 23. Sequence number 66: Factor9_csRNA1 in Example 8 of Table 10. SEQ ID NO: 67: B2M_ssRNA1 in negative control group 3 in Tables 7 and 21. Sequence number 68: B2M_ssRNA2 in Example 50 of Table 21. Sequence number 69: B2M_asRNA1 in negative control group 3 in Tables 7 and 21 and Examples 3 and 50. SEQ ID NO: 70: B2M_csRNA1 in Example 3 of Table 7. Sequence number 71: RT primer in Test Example 9. Sequence number 72: forward primer in Test Example 9. SEQ ID NO: 73: Reverse primer in Test Example 9. SEQ ID NO: 74: TaqMan probe in Test Example 9.

Claims

1. An oligonucleotide derivative or a salt thereof comprising a cyclic oligonucleotide and a linear oligonucleotide, the cyclic oligonucleotide and the linear oligonucleotide have complementary base sequences, and the cyclic oligonucleotide and the linear oligonucleotide form a complex via hydrogen bonds between the complementary base sequences; The length of the circular oligonucleotide is 1 to 10 bases longer than the length of the linear oligonucleotide; The cyclic oligonucleotide is represented by formula 1 and comprises a sense strand, An oligonucleotide derivative or a salt thereof, wherein the linear nucleotide comprises an antisense strand and has a length of 19 to 30 bases. Formula 1: 【Chemistry 1】 (In the formula, L1 and L2 represent linkers; n1 and n2 each independently represent an integer of 0 to 10; M is a moiety that contains a chemical structure that is cleaved by the intracellular environment, said chemical structure being -SS-, -SC(O)- or -C(O)-S-; X represents an oligonucleotide.

2. 2. The oligonucleotide derivative or a salt thereof according to claim 1, wherein the cyclic oligonucleotide comprises at least one phosphorothioate bond.

3. 3. The oligonucleotide derivative or a salt thereof according to claim 1 or 2, wherein the cyclic oligonucleotide comprises at least one 2'-modified nucleotide.

4. The oligonucleotide derivative or a salt thereof according to any one of claims 1 to 3, wherein M is selected from the group consisting of formulae 3-1 to 3-6. 【Chemistry 2】 (In the formula, R1 and R2 each independently represent a hydrogen atom or a C1-C3 alkyl, or R1 and R2 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3 and R4 each independently represent a hydrogen atom or a C1-C3 alkyl, or R3 and R4 together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; n5 to n8 each independently represent an integer from 0 to 10; n9 and n10 each independently represent an integer of 1 to 4; Y1 to Y4 each independently represent a bond, -NR5-, -O-, or -S-; R5 represents a hydrogen atom, a C1-C3 alkyl group, or a C2-C4 alkanoyl group. 【Chemistry 3】 (In the formula, R1' and R2' each independently represent a hydrogen atom or a C1-C3 alkyl, or R1' and R2' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3' and R4' each independently represent a hydrogen atom or a C1-C3 alkyl, or R3' and R4' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R5' and R6' are each independently a hydrogen atom or a C1-C3 alkyl group at each carbon atom to which they are attached; n5' and n6' each independently represent an integer of 1 to 10.

5. The oligonucleotide derivative or a salt thereof according to any one of claims 1 to 4, which has at least one targeting compound.

6. The oligonucleotide derivative or a salt thereof according to claim 5, wherein the targeting compound is bound to at least one of L1 and L2.

7. 7. The oligonucleotide derivative or a salt thereof according to claim 5 or 6, wherein the targeting compound is selected from the group consisting of cholesterol, tocopherol, docosahexaenoic acid, myristic acid, palmitic acid and N-acetyl-D-galactosamine.

8. A pharmaceutical composition comprising the oligonucleotide derivative or a salt thereof according to any one of claims 1 to 7.

9. 9. The pharmaceutical composition of claim 8, which is administered intravenously or subcutaneously.

10. 8. An agent for suppressing expression of a target gene utilizing RNA interference (RNAi), comprising the oligonucleotide derivative or a salt thereof according to any one of claims 1 to 7.

11. A circular oligonucleotide represented by formula 4, comprising a sense strand, having a length of 20 to 40 bases, and containing at least one phosphorothioate bond. Formula 4: 【Chemistry 4】 (In the formula, L3 and L4 represent linkers; m1 and m2 each independently represent an integer of 0 to 10; M2 represents a portion containing a chemical structure that is cleaved by the intracellular environment; M2 is selected from the group consisting of formula 6-1 to formula 6-6; 【Chemistry 5】 (In the formula, R1a and R2a each independently represent a hydrogen atom or a C1-C3 alkyl, or R1a and R2a together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3a and R4a each independently represent a hydrogen atom or a C1-C3 alkyl, or R3a and R4a together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; n5a to n8a each independently represent an integer from 0 to 10, n9a and n10a each independently represent an integer of 1 to 4; Y1a to Y4a each independently represent a bond, -NR5a-, -O- or -S-; R5a represents a hydrogen atom, a C1-C3 alkyl or a C2-C4 alkanoyl. 【Chemistry 6】 (In the formula, R1a' and R2a' each independently represent a hydrogen atom or a C1-C3 alkyl, or R1a' and R2a' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R3a' and R4a' each independently represent a hydrogen atom or a C1-C3 alkyl, or R3a' and R4a' together with the carbon atom to which they are attached form a ring having 3 to 6 carbon atoms; R5a' and R6a' are each independently a hydrogen atom or a C1-C3 alkyl at each carbon atom to which they are attached; n5a' and n6a' each independently represent an integer of 1 to 10. X2 represents an oligonucleotide.

12. A linear oligonucleotide represented by formula 7, comprising a sense strand, having a length of 20 to 40 bases, and containing at least one phosphorothioate bond. Formula 7: 【Chemistry 7】 (In the formula, X2, L3, L4, m1 and m2 are as defined in claim 11; W1 and W2 are moieties that contain or result in functional groups that react with each other to form a chemical structure that is cleaved by the intracellular environment; W1 and W2 are each independently -A1-SS-A2 or -B1-COO-B2 (except when W1 and W2 are simultaneously -B1-COO-B2); A1 and B1 are each independently a C2-C10 alkylene optionally having a substituent; A2 is an optionally substituted C1-C10 alkyl; B2 is a hydrogen atom or an optionally substituted C1-C6 alkyl.

13. 13. A method for making the cyclic oligonucleotide of claim 11, comprising circularizing the linear oligonucleotide of claim 12.

14. A method for producing the oligonucleotide derivative or a salt thereof according to any one of claims 1 to 7, comprising conjugating the cyclic oligonucleotide according to claim 11 with a linear oligonucleotide having a base sequence complementary to the cyclic oligonucleotide via hydrogen bonding.

Images