Lactic acid bacteria detection primer set and detection method using the primer set

Abstract

The present invention provides a primer set capable of specifically identifying the lactic acid bacteria strain EF-2001 and a detection method using the primer set. [Solution] A primer set for detecting lactic acid bacteria strain EF-2001, comprising oligonucleotides consisting of combinations of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 10 and 11, SEQ ID NO: 13 and 14, SEQ ID NO: 16 and 17, SEQ ID NO: 19 and 20, SEQ ID NO: 22 and 23, SEQ ID NO: 25 and 26, and / or SEQ ID NO: 28 and 29, or oligonucleotides consisting of combinations of SEQ ID NO: 1 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, SEQ ID NO: 10 and 12, SEQ ID NO: 13 and 15, SEQ ID NO: 16 and 18, SEQ ID NO: 19 and 21, SEQ ID NO: 22 and 24, SEQ ID NO: 25 and 27, and / or SEQ ID NO: 28 and 30.

Description

Technical Field

[0001] The present invention relates to a method for detecting specific lactic acid bacteria. Specifically, it relates to a primer set for detecting Enterococcus faecalis EF-2001 strain and a detection method using the primer set.

Background Art

[0002] Lactic acid bacteria are known to have various effects. In recent years, as probiotics, they have various health-maintaining effects such as intestinal regulation effects, immunity improvement effects, and anti-tumor effects by improving the intestinal flora, and thus are utilized as useful microbial resources that are deeply related to human health.

[0003] On the other hand, among Enterococcus faecalis, which is a kind of lactic acid bacteria, there are also bacterial cells known to cause opportunistic infections. As opportunistic pathogens, they can cause various diseases ranging from urinary tract infections to life-threatening infections such as bacteremia, endocarditis, and meningitis. Therefore, it is extremely important to distinguish between bacterial cells that can be used as probiotics and pathogenic bacterial cells.

Summary of the Invention

Means for Solving the Problems

[0004] It has been reported that the EF-2001 strain, which is one of Enterococcus faecalis, has various biological regulatory activities including anti-inflammatory and immunomodulatory activities, and is widely used as a probiotic in supplements and functional foods. The present invention provides a primer set that can specifically, rapidly, and simply identify the lactic acid bacterium Enterococcus faecalis EF-2001 strain and a detection method using the primer set.

[0005] Therefore, the present disclosure provides the following. (Item 1) A primer set for specifically detecting a nucleic acid derived from the lactic acid bacterium Enterococcus faecalis EF-2001 strain, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 2 or 3, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 5 or 6, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8 or 9, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11 or 12, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14 or 15, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17 or 18, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 or 21, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23 or 24, a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26 or 27, or a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29 or 30, A primer set comprising the same. (Item 2) A primer set for specifically detecting a nucleic acid derived from the lactic acid bacterium Enterococcus faecalis EF-2001 strain, (a) Primer set (1) for amplifying a part of the nucleotide sequence of SEQ ID NO: 51: Forward primer CGAAAAGGATGTAGTCAGCGG (SEQ ID NO: 1) Reverse primer CCGAAGGCGAAACAGAGGAT (SEQ ID NO: 2) (b) Primer set (2) for amplifying a part of the nucleotide sequence of SEQ ID NO: 51: Forward primer CGAAAAGGATGTAGTCAGCGG (SEQ ID NO: 1) Reverse primer CCCAGACATAATCGCATGGC (SEQ ID NO: 3) (c) Primer set (3) for amplifying a part of the nucleotide sequence of SEQ ID NO: 52: Forward primer GCGGCTGCACAATTTATTGC (SEQ ID NO: 4) Reverse primer AGAATACTTGGGCGGTCGTG (SEQ ID NO: 5) (d) Primer set (4) for amplifying a part of the nucleotide sequence of SEQ ID NO: 52: Forward primer GCGGCTGCACAATTTATTGC (SEQ ID NO: 4) Reverse primer AATTCAGCTTCGCTAGATAAGGC (SEQ ID NO: 6) (e) Primer set (5) for amplifying a part of the nucleotide sequence of SEQ ID NO: 53: Forward primer CGCGTATGACTTGCAATCGA (SEQ ID NO: 7) Reverse primer AGGATTGTTTGACGGTGCAA (SEQ ID NO: 8) (f) Primer set (6) for amplifying a part of the nucleotide sequence of SEQ ID NO: 53: Forward primer CGCGTATGACTTGCAATCGA (SEQ ID NO: 7) Reverse primer ACATGAGATAGTTGGGGTAGACA (SEQ ID NO: 9) (g) Primer set (7) for amplifying a part of the nucleotide sequence of SEQ ID NO: 54: Forward primer CTTCAGAGAGCTGGGCGAAG (SEQ ID NO: 10) Reverse primer TACTTTTTAGCTGCCCGCCC (SEQ ID NO: 11) (h) Primer set (8) for amplifying a part of the nucleotide sequence of SEQ ID NO: 54: Forward primer CTTCAGAGAGCTGGGCGAAG (SEQ ID NO: 10) Reverse primer GGGTTGTAGCCCTACCCGAT (SEQ ID NO: 12) (i) Primer set (9) for amplifying a part of the nucleotide sequence of SEQ ID NO: 55: Forward primer CGTAACGTGACATTGCGGAC (SEQ ID NO: 13) Reverse primer ATGCCAGTACGTCGCGTTAA (SEQ ID NO: 14) (j) Primer set (10) for amplifying a part of the nucleotide sequence of SEQ ID NO: 55: Forward primer CGTAACGTGACATTGCGGAC (SEQ ID NO: 13) Reverse primer CGATTGTCAACTAATTGTGCCGA (SEQ ID NO: 15) (k) Primer set (11) for amplifying a part of the nucleotide sequence of SEQ ID NO: 56: Forward primer CATGGCTTGCCGTTTCACAA (SEQ ID NO: 16) Reverse primer ACCGCAACAACTACATACTACCA (SEQ ID NO: 17) (l) Primer set (12) for amplifying a part of the nucleotide sequence of SEQ ID NO: 56: Forward primer CATGGCTTGCCGTTTCACAA (SEQ ID NO: 16) Reverse primer ACCAAAAGGAACGCTACCAGT (SEQ ID NO: 18) (m) Primer set (13) for amplifying a part of the nucleotide sequence of SEQ ID NO: 57: Forward primer TCAGCATAATCCCCAGACGT (SEQ ID NO: 19) Reverse primer AATGAACGCCCTTCAGCAGA (SEQ ID NO: 20) (n) Primer set (14) for amplifying a part of the nucleotide sequence of SEQ ID NO: 57: Forward primer TCAGCATAATCCCCAGACGT (SEQ ID NO: 19) Reverse primer GGCTCCTCTACCTGAACAAACT (SEQ ID NO: 21) (o) Primer set (15) for amplifying a part of the nucleotide sequence of SEQ ID NO: 58 Forward primer GCGTTCAAACTGTTCTGGTGT (SEQ ID NO: 22) Reverse primer TACAAGGCTTGCGAGGTAGC (SEQ ID NO: 23) (p) Primer set (16) for amplifying a part of the nucleotide sequence of SEQ ID NO: 58 Forward primer GCGTTCAAACTGTTCTGGTGT (SEQ ID NO: 22) Reverse primer GCTGCAATGGAAAGCAAATCG (SEQ ID NO: 24) (q) Primer set (17) for amplifying a part of the nucleotide sequence of SEQ ID NO: 59 Forward primer AGGCATATGGGTCATCTGCT (SEQ ID NO: 25) Reverse primer GAGCATCACAGAGCCTCGAA (SEQ ID NO: 26) (r) Primer set (18) for amplifying a part of the nucleotide sequence of SEQ ID NO: 59 Forward primer AGGCATATGGGTCATCTGCT (SEQ ID NO: 25) Reverse primer AGAGATTTTTCAGTATTGCTGGGT (SEQ ID NO: 27) (s) Primer set (19) for amplifying a part of the nucleotide sequence of SEQ ID NO: 60 Forward primer CGTTGGGTGTGCAGAAATGG (SEQ ID NO: 28) Reverse primer TGTACCGTCAACCTCGTTCG (SEQ ID NO: 29) or (t) Primer set (20) for amplifying a part of the nucleotide sequence of SEQ ID NO: 60 Forward primer CGTTGGGTGTGCAGAAATGG (SEQ ID NO: 28) Reverse primer AACGGGTTGCGACTCTTTTT (SEQ ID NO: 30) A primer set selected from the group consisting of (Item 3) A kit for detecting Enterococcus faecalis EF-2001 strain, comprising the primer set according to Item 1 or 2. (Item 4) A method for specifically detecting a nucleic acid derived from Enterococcus faecalis EF-2001 strain, comprising: amplifying a nucleic acid fragment using the primer set according to Item 1 or 2; and detecting the nucleic acid fragment obtained in the amplifying step. A method comprising the above steps. (Item 5) A lactic acid bacterium composition comprising: a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 1 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 2; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 4 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 5; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 7 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 8; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 10 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 11; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 13 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 14; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 16 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 17; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 19 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 20; a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 22 and a pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 23; A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 26, and / or A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 29 Not amplified by one or more primer sets selected from the group consisting of, and A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 3, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 6, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 9, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 12, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 15, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 18, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 21, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 24, A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 27, and / or A pair of oligonucleotides comprising the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 30 A lactic acid bacterium composition comprising a nucleic acid fragment amplified by one or more primer sets selected from the group consisting of. (Item 6) The composition according to item 5, which does not amplify by the primer set of the oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and the oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17, and contains a nucleic acid fragment amplified by the primer set of the oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and the oligonucleotide containing the nucleotide sequence of SEQ ID NO: 18. (Item 7) The composition according to item 5 or 6, which contains a heat-treated lactic acid bacterium product obtained by heat-treating the lactic acid bacterium Enterococcus faecalis EF-2001 strain at at least about 70°C. (Item 8) The composition according to any one of items 5 to 7, which contains a heat-treated lactic acid bacterium product obtained by heat-treating the lactic acid bacterium Enterococcus faecalis EF-2001 strain at at least about 90°C. (Item 9) A method for producing a lactic acid bacterium composition, comprising: heating the lactic acid bacterium Enterococcus faecalis EF-2001 strain to obtain a plurality of lots of heat-treated lactic acid bacterium products; extracting a nucleic acid fragment in one of the lots of the heat-treated lactic acid bacterium products; amplifying the nucleic acid fragment using at least one of the primer sets according to item 1 or 2; detecting the nucleic acid fragment obtained in the amplifying step; selecting the lot of the heat-treated lactic acid bacterium product in which the nucleic acid fragment is detected and the method includes. (Item 10) The method according to item 9, wherein the heating is heating at at least about 70°C. (Item 11) The method according to item 9 or 10, wherein the heating is heating at at least about 90°C. (Item 12) The nucleic acid fragment is a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 3 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 6, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 9, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 12, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 15, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 18, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 21, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 24, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 27, and / or A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 30 amplified by one or more primer sets selected from the group consisting of, and A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 2, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 5, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23, A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26, and / or A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29 The method according to any one of items 9 to 11, which is not amplified by one or more primer sets selected from the group consisting of (Item 13) A polynucleotide characterized by being amplified by a primer set for detecting Enterococcus faecalis EF-2001 strain, A polynucleotide represented by SEQ ID NO: 31, which is amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 2, A polynucleotide represented by SEQ ID NO: 32, which is amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 3, A polynucleotide represented by SEQ ID NO: 33, which is amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 5, A polynucleotide represented by SEQ ID NO: 34, which is amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 6, A polynucleotide represented by SEQ ID NO: 35, which is amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8, A polynucleotide represented by SEQ ID NO: 36, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 9. A polynucleotide represented by SEQ ID NO: 37, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11. A polynucleotide represented by SEQ ID NO: 38, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 12. A polynucleotide represented by SEQ ID NO: 39, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14. A polynucleotide represented by SEQ ID NO: 40, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 15. A polynucleotide represented by SEQ ID NO: 41, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17. A polynucleotide represented by SEQ ID NO: 42, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 18. A polynucleotide represented by SEQ ID NO: 43, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20. A polynucleotide represented by SEQ ID NO: 44, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 21. A polynucleotide represented by SEQ ID NO: 45, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23. A polynucleotide represented by SEQ ID NO: 46, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 24. A polynucleotide represented by SEQ ID NO: 47, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26. A polynucleotide represented by SEQ ID NO: 48, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 27. A polynucleotide represented by SEQ ID NO: 49, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29, or A polynucleotide represented by SEQ ID NO: 50, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 30.

[0006] In the present disclosure, it is intended that one or more of the above features may be provided in combination in addition to the explicitly stated combinations. Further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading the following detailed description as needed.

[0007] In addition, the features and remarkable effects of the present disclosure other than those described above will be made clear to those skilled in the art by referring to the sections of the embodiments of the invention and the drawings below.

Advantages of the Invention

[0008] According to the present invention, it becomes possible to simply and rapidly detect the lactic acid bacterium Enterococcus faecalis EF-2001 strain without recognizing strains closely related to the Enterococcus faecalis EF-2001 strain, which is very useful.

Brief Description of Drawings

[0009]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Mode for Carrying Out the Invention

[0010] Hereinafter, the present disclosure will be described while showing the best mode. Throughout this specification, it should be understood that the singular expressions include the concepts of their plural forms unless otherwise specified. Therefore, it should be understood that the singular articles (for example, "a", "an", "the", etc. in English) include the concepts of their plural forms unless otherwise specified. Also, the terms used in this specification should be understood to be used in the meaning usually used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical terms and scientific and technical terms used in this specification have the same meaning as generally understood by those skilled in the art to which the present disclosure pertains. In case of contradiction, this specification (including the definitions) shall prevail.

[0011] The definitions of the terms particularly used in this specification and / or the basic technical content will be appropriately described below.

[0012] In this specification, "about" means ± 10% of the numerical value that follows.

[0013] (Preferred Embodiment) The preferred embodiments of the present disclosure will be described below. The embodiments provided below are provided for better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate modifications within the scope of the present disclosure in consideration of the description in this specification. Also, the following embodiments of the present disclosure can be used alone or in combination.

[0014] The primer set of the present invention can amplify a chromosomal DNA region having a base sequence specific to Enterococcus faecalis EF-2001 strain by PCR (polymerase chain reaction), and can specifically recognize and detect Enterococcus faecalis EF-2001 strain without recognizing strains closely related to Enterococcus faecalis EF-2001 strain.

[0015] The primer set of the present invention was designed by the following method. First, the sequence of the full-length genome of Enterococcus faecalis EF-2001 strain was determined using a hybrid assembly approach using Short Read from ThermoFisher IonPGM and Long Read from OxfordNanopore MinION. When determining the Draft Genome sequence obtained from this Short Read, gene fragments of 1 kbp or more that did not match when compared with the 42 strains in Table 1 below were narrowed down as gene sequences specific to EF-2001.

Table 1

[0016] <Regarding the primer set of the present invention> In one aspect of the present invention, the primer set of the present invention can include the following. A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 2 or 3 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 5 or 6 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8 or 9 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11 or 12 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14 or 15 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17 or 18 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 or 21 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23 or 24 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26 or 27 A pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29 or 30

[0017] In another aspect of the present invention, the primer set of the present invention can include the following. (a) Primer set (1) (contig1 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 51 (contig1): Forward primer CGAAAAGGATGTAGTCAGCGG (SEQ ID NO: 1) Reverse primer CCGAAGGCGAAACAGAGGAT (SEQ ID NO: 2) (b) Primer set (2) (contig1 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 51 (contig1): Forward primer CGAAAAGGATGTAGTCAGCGG (SEQ ID NO: 1) Reverse primer CCCAGACATAATCGCATGGC (SEQ ID NO: 3) (c) Primer set (3) (contig4 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 52 (contig4): Forward primer GCGGCTGCACAATTTATTGC (SEQ ID NO: 4) Reverse primer AGAATACTTGGGCGGTCGTG (SEQ ID NO: 5) (d) Primer set (4) (contig4 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 52 (contig4): Forward primer GCGGCTGCACAATTTATTGC (SEQ ID NO: 4) Reverse primer AATTCAGCTTCGCTAGATAAGGC (SEQ ID NO: 6) (e) Primer set (5) (contig7 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 53 (contig7): Forward primer CGCGTATGACTTGCAATCGA (SEQ ID NO: 7) Reverse primer AGGATTGTTTGACGGTGCAA (SEQ ID NO: 8) (f) Primer set (6) (contig7 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 53 (contig7): Forward primer CGCGTATGACTTGCAATCGA (SEQ ID NO: 7) Reverse primer ACATGAGATAGTTGGGGTAGACA (SEQ ID NO: 9) (g) Primer set (7) (contig11 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 54 (contig11): Forward primer CTTCAGAGAGCTGGGCGAAG (SEQ ID NO: 10) Reverse primer TACTTTTTAGCTGCCCGCCC (SEQ ID NO: 11) (h) Primer set (8) (contig11 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 54 (contig11): Forward primer CTTCAGAGAGCTGGGCGAAG (SEQ ID NO: 10) Reverse primer GGGTTGTAGCCCTACCCGAT (SEQ ID NO: 12) (i) Primer set (9) (contig13 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 55 (contig13): Forward primer CGTAACGTGACATTGCGGAC (SEQ ID NO: 13) Reverse primer ATGCCAGTACGTCGCGTTAA (SEQ ID NO: 14) (j) Primer set (10) (contig13 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 55 (contig13): Forward primer CGTAACGTGACATTGCGGAC (SEQ ID NO: 13) Reverse primer CGATTGTCAACTAATTGTGCCGA (SEQ ID NO: 15) (k) Primer set (11) (contig16 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 56 (contig16): Forward primer CATGGCTTGCCGTTTCACAA (SEQ ID NO: 16) Reverse primer ACCGCAACAACTACATACTACCA (SEQ ID NO: 17) (l) Primer set (12) (contig16 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 56 (contig16): Forward primer CATGGCTTGCCGTTTCACAA (SEQ ID NO: 16) Reverse primer ACCAAAAGGAACGCTACCAGT (SEQ ID NO: 18) (m) Primer set (13) (contig22 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 57 (contig22): Forward primer TCAGCATAATCCCCAGACGT (SEQ ID NO: 19) Reverse primer AATGAACGCCCTTCAGCAGA (SEQ ID NO: 20) (n) Primer set (14) (contig22 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 57 (contig22): Forward primer TCAGCATAATCCCCAGACGT (SEQ ID NO: 19) Reverse primer GGCTCCTCTACCTGAACAAACT (SEQ ID NO: 21) (o) Primer set (15) (contig25 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 58 (contig25): Forward primer GCGTTCAAACTGTTCTGGTGT (SEQ ID NO: 22) Reverse primer TACAAGGCTTGCGAGGTAGC (SEQ ID NO: 23) (p) Primer set (16) (contig25 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 58 (contig25): Forward primer GCGTTCAAACTGTTCTGGTGT (SEQ ID NO: 22) Reverse primer GCTGCAATGGAAAGCAAATCG (SEQ ID NO: 24) (q) Primer set (17) (contig31 long) for amplifying a part of the nucleotide sequence of SEQ ID NO: 59 (contig31): Forward primer AGGCATATGGGTCATCTGCT (SEQ ID NO: 25) Reverse primer GAGCATCACAGAGCCTCGAA (SEQ ID NO: 26) (r) Primer set (18) (contig31 short) for amplifying a part of the nucleotide sequence of SEQ ID NO: 59 (contig31): Forward primer AGGCATATGGGTCATCTGCT (SEQ ID NO: 25) Reverse primer AGAGATTTTTCAGTATTGCTGGGT (SEQ ID NO: 27) (s) Primer set (19) (contig43 long) for amplifying a part of the nucleotide sequence (contig43) of SEQ ID NO: 60: Forward primer CGTTGGGTGTGCAGAAATGG (SEQ ID NO: 28) Reverse primer TGTACCGTCAACCTCGTTCG (SEQ ID NO: 29) (t) Primer set (20) (contig43 short) for amplifying a part of the nucleotide sequence (contig43) of SEQ ID NO: 60: Forward primer CGTTGGGTGTGCAGAAATGG (SEQ ID NO: 28) Reverse primer AACGGGTTGCGACTCTTTTT (SEQ ID NO: 30)

[0018] In addition, the primer sets that can be used in the detection method of the present invention also include primer sets composed of oligonucleotides having a nucleotide sequence substantially homologous to the nucleotide sequences of SEQ ID NOs: 1 to 30, depending on the base length, PCR conditions, etc. Here, "substantially homologous" means having a fragment length and homology such that it can function as a primer for PCR, etc., and preferably having a sequence identity of about 90% or more.

[0019] For example, the primer sets of the present invention do not necessarily have 100% homology with the nucleotide sequences of SEQ ID NOs: 1 to 30 depending on the purpose of use and conditions, and several bases may be different near the 5'-end of the primer for the target region. Even when such primers are used, it is possible to appropriately amplify the target DNA fragment by considering the annealing temperature, etc.

[0020] For example, when high specificity is required for the detection of Lactobacillus strain EF-2001, a completely homologous sequence region (the base sequences of SEQ ID NOs: 1 to 30) can be used, and PCR conditions that anneal only with such sequences can be selected. On the other hand, when relatively low-specificity conditions are acceptable, sequences that differ by several bases from the base sequences of SEQ ID NOs: 1 to 30 (for example, sequences having a sequence identity of about 90% or more) can be used, and PCR conditions that still allow annealing can be selected.

[0021] The primer set of the present invention can be synthesized by a conventional DNA synthesis method well known to those skilled in the art, for example, using a DNA synthesizer. Also, the primer of the present invention can be obtained by commissioning a DNA synthesis vendor for synthesis.

[0022] Using the primer set of the present invention, PCR is performed using the chromosomal DNA of the test bacterium contained in the sample as a template, and by determining the presence or absence of an amplification product, the Lactobacillus strain EF-2001 in the sample can be detected. That is, when a PCR reaction specific to the primer sequence occurs, the region (target region) sandwiched between the sequences corresponding to the sequences of each pair of primers in the chromosomal DNA of the Lactobacillus strain EF-2001 is amplified.

[0023] Therefore, if an amplification product is obtained using the primer set of the present invention, the test bacterium is identified as Lactobacillus strain EF-2001 or at least determined to contain Lactobacillus strain EF-2001.

[0024] In addition, when an amplification product is obtained, determination of the presence or absence of the amplification product may include determination of the length of the amplification product. For example, when using a primer set for detecting Lactobacillus strain EF-2001 containing oligonucleotides consisting of each combination of SEQ ID NO:1 and SEQ ID NO:2, SEQ ID NO:4 and 5, SEQ ID NO:7 and 8, SEQ ID NO:10 and 11, SEQ ID NO:13 and 14, SEQ ID NO:16 and 17, SEQ ID NO:19 and 20, SEQ ID NO:22 and 23, SEQ ID NO:25 and 26, or SEQ ID NO:28 and 29, if the test bacterium contains Lactobacillus strain EF-2001, amplification products of about 500 to about 600 bp are usually obtained for each. Also, when using a primer set for detecting Lactobacillus strain EF-2001 containing oligonucleotides consisting of each combination of SEQ ID NO:1 and SEQ ID NO:3, SEQ ID NO:4 and 6, SEQ ID NO:7 and 9, SEQ ID NO:10 and 12, SEQ ID NO:13 and 15, SEQ ID NO:16 and 18, SEQ ID NO:19 and 21, SEQ ID NO:22 and 24, SEQ ID NO:25 and 27, or SEQ ID NO:28 and 30, if the test bacterium contains Lactobacillus strain EF-2001, amplification products of about 100 to about 250 bp are usually obtained for each.

[0025] The amplification products obtained when using the primer set for detecting Lactobacillus strain EF-2001 containing the oligonucleotides of the present invention are as follows. SEQ ID NO:31: An amplification product amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO:1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO:2 SEQ ID NO:32: An amplification product amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO:1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO:3 SEQ ID NO:33: An amplification product amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO:4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO:5 SEQ ID NO:34: An amplification product amplified by a primer set consisting of a pair of an oligonucleotide containing the nucleotide sequence of SEQ ID NO:4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO:6 Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8 SEQ ID NO: 36: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 9 SEQ ID NO: 37: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11 SEQ ID NO: 38: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 12 SEQ ID NO: 39: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14 SEQ ID NO: 40: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 15 SEQ ID NO: 41: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17 SEQ ID NO: 42: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 18 SEQ ID NO: 43: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 SEQ ID NO: 44: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 21 SEQ ID NO: 45: Amplified product amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23 Amplification product amplified with a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 24, SEQ ID NO: 46 Amplification product amplified with a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26, SEQ ID NO: 47 Amplification product amplified with a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 27, SEQ ID NO: 48 Amplification product amplified with a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29, SEQ ID NO: 49 Amplification product amplified with a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 30, SEQ ID NO: 50

[0026] Moreover, each of the nucleotide sequences of SEQ ID NOs: 31 to 50 is a part of any of the nucleotide sequences of SEQ ID NOs: 51 to 60.

[0027] Since each of the primer sequences of SEQ ID NOs: 1 to 30, and the nucleotide sequences of SEQ ID NOs: 31 to 50 and SEQ ID NOs: 51 to 60 are sequences specific to Lactobacillus sp. EF-2001 strain, it is also possible to perform FISH method, Southern hybridization, dot hybridization, etc. using a part of these sequences as a DNA probe.

[0028] In the present invention, the detection of Lactobacillus sp. EF-2001 strain includes detecting whether Lactobacillus sp. EF-2001 strain is present in a sample, and when the test bacterium is a single species, identifying whether the test bacterium is Lactobacillus sp. EF-2001 strain.

[0029] In one embodiment of the present invention, the sample used for detecting Lactobacillus strain EF-2001 can be any sample in which Lactobacillus strain EF-2001 is present or may be present. For example, it can include mixed cultures of lactic acid bacteria, miso, soy sauce, alcoholic beverages such as wine, pickles, fermented foods containing microorganisms such as yogurt and cheese, feces of experimental animals such as mice and rats, and bacteria present in the environment such as soil. The test bacterium may be a single isolated species or a mixture containing multiple bacterial species.

[0030] In one embodiment of the present invention, when using dead bacteria as the test bacterium, DNA can be directly prepared from the sample and used for PCR. When using live bacteria, the test bacteria can be separated from the sample by colony isolation or the like, and then DNA is prepared from the test bacteria and used for PCR. The method for extracting nucleic acids from these samples can be, for example, a highly versatile kit capable of extracting nucleic acids from cultured cells such as animal cells, plant cells, and microorganisms, such as Kaneka Easy DNA Extraction Kit version 2, or a commercially available extraction kit (DNeasy Blood&Tissue kit (manufactured by QIAGEN), Isogen, etc.) after decomposing the cell wall with an enzyme such as Lysozyme or physically disrupting it with beads or the like. It is not particularly limited.

[0031] <Regarding the detection method of the present invention> In one aspect of the present invention, the method for detecting Lactobacillus strain EF-2001 of the present invention can include (1) a step of amplifying a nucleic acid fragment using the primer set of the present invention, and (2) a step of detecting the nucleic acid fragment obtained in step (1).

[0032] As the detection method of the present invention, specifically, for example, PCR method, FISH method, Southern hybridization, dot hybridization, etc. can be mentioned. Among them, the PCR method is preferable. In the detection method of Lactobacillus EF-2001 strain by the PCR method, it is also possible to use commonly used PCR reagents and equipment such as DNA polymerase, etc., other than using the primer set of the present invention, and it is not particularly limited.

[0033] In one embodiment, the DNA polymerase used for PCR is not particularly limited. For example, KOD FX Neo (manufactured by Toyobo Co., Ltd.), ExTaq (manufactured by Takara Bio Inc.) , KOD DNA polymerase (manufactured by Toyobo Co., Ltd.), KOD-plus-polymerase (manufactured by Toyobo Co., Ltd.), etc. are preferable.

[0034] In one embodiment, regarding the PCR reaction conditions, they can be appropriately set according to the optimum temperature of the DNA polymerase used, the length and type of the DNA to be synthesized, etc. However, in the case of cycle conditions, "90-98°C for 5-30 seconds (thermal denaturation / dissociation) → 55-60°C for 5-30 seconds (annealing) → 65-80°C for 30-60 seconds (synthesis / elongation)" can be set as one cycle, and a total of 20-40 cycles can be performed. For example, it is also possible to perform 25 cycles at "98°C for 10 seconds → 60°C for 30 seconds → 68°C for 30 seconds". In this case, the annealing temperature can be the temperature used in the primer design. However, for example, when using KOD FX Neo as the polymerase, depending on the primer size (for example, 20 mer or more), a two-step reaction without the annealing temperature can also be performed. Also, the amount ratio of the template DNA to the primer can be, for example, 0.3 μM of each primer for 200 ng of template DNA in the case of viable bacteria. In the case of dead bacteria, the band in electrophoresis can be made clearer by increasing the template DNA according to the heat treatment situation.

[0035] The presence or absence or size of the amplification product obtained by PCR can be determined by ordinary nucleic acid detection methods. For example, after electrophoresis by agarose electrophoresis, the amplification product can be detected by staining with ethidium bromide or SYBR Green I. Also, the amount of the amplification product can be determined by fluorescence intensity, and the molecular weight can be determined by comparison with a molecular weight marker. After cycle sequencing of the PCR product, the presence or absence of the amplification product can also be confirmed by measuring the base sequence and length using a DNA sequencer. Also, according to the real-time PCR method, the amplification reaction can be detected over time.

[0036] In one aspect of the present invention, the primer set of the present invention can be used as a kit for detecting Lactobacillus sp. EF-2001 strain in combination with other elements. Examples of other elements include any one or two or more of the reagents necessary for nucleic acid extraction, PCR, and detection of the amplification product. Further, this kit for detecting Lactobacillus sp. EF-2001 strain may contain, as a positive control, a DNA fragment having a part of the chromosomal DNA sequence of Lactobacillus sp. EF-2001 strain and capable of being amplified by the primer set of the present invention, and / or, as a negative control, a DNA fragment having a base sequence corresponding to the primer set of the present invention but having a mismatch of one or several bases.

[0037] As described above, the primer set of the present invention can be used for detecting Lactobacillus sp. EF-2001 strain. Also, by using the primer set of the present invention, when industrially manufacturing Lactobacillus sp. EF-2001 strain cells or food and drink products containing the same cells, the measurement of the number of bacteria and the control of the fermentation state can be easily performed.

[0038] <Regarding the lactic acid bacterium composition of the present invention> In one aspect of the present invention, the lactic acid bacteria composition of the present invention can contain a heat-treated product of lactic acid bacteria obtained by heating viable cells of the lactic acid bacterium Enterococcus faecalis EF-2001 strain. In one embodiment, the lactic acid bacteria composition of the present invention is preferably not amplified when any one or more of the primer sets for detecting lactic acid bacterium EF-2001 strain comprising oligonucleotides consisting of each combination of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 4 and 5, SEQ ID NO: 7 and 8, SEQ ID NO: 10 and 11, SEQ ID NO: 13 and 14, SEQ ID NO: 16 and 17, SEQ ID NO: 19 and 20, SEQ ID NO: 22 and 23, SEQ ID NO: 25 and 26, and / or SEQ ID NO: 28 and 29 are used, and is amplified when any one or more of the primer sets for detecting lactic acid bacterium EF-2001 strain comprising oligonucleotides consisting of each combination of SEQ ID NO: 1 and SEQ ID NO: 3, SEQ ID NO: 4 and 6, SEQ ID NO: 7 and 9, SEQ ID NO: 10 and 12, SEQ ID NO: 13 and 15, SEQ ID NO: 16 and 18, SEQ ID NO: 19 and 21, SEQ ID NO: 22 and 24, SEQ ID NO: 25 and 27, or SEQ ID NO: 28 and 30 are used, and contains a nucleic acid fragment.

[0039] As used herein, "the nucleic acid fragment is not amplified" or "the band disappears" means that when the nucleic acid fragment of lactic acid bacterium EF-2001 strain is amplified using the primer set for detecting lactic acid bacterium EF-2001 strain of the present invention, it is less than about 30% compared to the amplification efficiency or amplification amount of the nucleic acid fragment derived from untreated (for example, without heat treatment) lactic acid bacterium EF-2001 strain. In one embodiment, "the nucleic acid fragment is not amplified" or "the band disappears" means that when the nucleic acid fragment of lactic acid bacterium EF-2001 strain is amplified using the primer set for detecting lactic acid bacterium EF-2001 strain of the present invention, it is less than about 20%, preferably less than about 10%, or more preferably less than about 5% compared to the amplification efficiency or amplification amount of the nucleic acid fragment derived from untreated (for example, without heat treatment) lactic acid bacterium EF-2001 strain.

[0040] In one embodiment, the lactic acid bacteria composition of the present invention can be heated to form heat-killed cells and made into a powdery dried cell body by freeze-drying, spray-drying, or drying with a drum dryer. This can enhance safety and storage stability, and it can be used in any food. The heating of Lactobacillus EF-2001 strain can be carried out at any time and temperature capable of obtaining heat-killed cells. For example, at a temperature of about 50°C or higher, about 60°C or higher, about 70°C or higher, about 80°C or higher, about 90°C or higher, about 100°C or higher, about 110°C or higher, or about 120°C or higher, and for example, for about 5 minutes or longer, about 10 minutes or longer, about 15 minutes or longer, about 20 minutes or longer, about 25 minutes or longer, about 30 minutes or longer, about 45 minutes or longer, or about 60 minutes or longer. Any combination of temperature and time may be used as long as heat sterilization or heat-killed cells can be obtained by heating.

[0041] In one embodiment of the present invention, when obtaining the lactic acid bacteria composition of the present invention, the lactic acid bacteria Enterococcus faecalis EF-2001 strain is heated at the above-described temperature and time to obtain a plurality of lots of heat-treated lactic acid bacteria products, and nucleic acid fragments are extracted from this heat-treated lactic acid bacteria product. Then, at least one of the primer sets of the present invention described elsewhere in this specification is used to amplify this nucleic acid fragment. Then, a lot of the heat-treated lactic acid bacteria product in which the amplified nucleic acid fragment is detected is selected, and the heat-treated lactic acid bacteria product contained in this lot can be used as the lactic acid bacteria composition of the present invention. For heating and nucleic acid amplification, equipment and techniques commonly used in this field can be employed. For example, equipment and techniques that can be used in the detection methods described elsewhere in this specification can be employed. When heating the cell bodies, generally, a first-class pressure vessel equipped with a stirrer can be used, and depending on the temperature, a second-class pressure vessel can also be used. Also, if the liquid volume is small, a small pressure vessel or the like can also be used. In other embodiments, a continuous sterilizer using plates or tubes as heat conductors can also be used.

[0042] In one embodiment of the present invention, the lactic acid bacteria composition of the present invention can be made such that the amount of TNF-α production increases by heating and stabilizing. Preferably, the lactic acid bacteria composition of the present invention is not amplified when any one or more of the primer sets for detecting lactic acid bacteria strain EF-2001 containing oligonucleotides consisting of each combination of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 4 and 5, SEQ ID NO: 7 and 8, SEQ ID NO: 10 and 11, SEQ ID NO: 13 and 14, SEQ ID NO: 16 and 17, SEQ ID NO: 19 and 20, SEQ ID NO: 22 and 23, SEQ ID NO: 25 and 26, and / or SEQ ID NO: 28 and 29 are used, and is amplified when any one or more of the primer sets for detecting lactic acid bacteria strain EF-2001 containing oligonucleotides consisting of each combination of SEQ ID NO: 1 and SEQ ID NO: 3, SEQ ID NO: 4 and 6, SEQ ID NO: 7 and 9, SEQ ID NO: 10 and 12, SEQ ID NO: 13 and 15, SEQ ID NO: 16 and 18, SEQ ID NO: 19 and 21, SEQ ID NO: 22 and 24, SEQ ID NO: 25 and 27, and / or SEQ ID NO: 28 and 30 are used, and contains a nucleic acid fragment.

[0043] In one embodiment, whether the amount of TNF-α production of the lactic acid bacteria composition of the present invention has increased can be confirmed using as an indicator that the band of the primer set for detecting long disappears and the band of the primer set for detecting short remains. For example, taking as an indicator that a nucleic acid fragment is not amplified by the primer set of SEQ ID NO: 16 and 17 (long) that amplifies a part of the nucleotide sequence of contig16 and a nucleic acid fragment is amplified by the primer set of SEQ ID NO: 16 and 18 (short), the lactic acid bacteria composition of the present invention that has been heat-treated and shows such amplification results can be considered to have an increased amount of TNF-α production.

[0044] In one embodiment of the present invention, the lactic acid bacteria composition of the present invention can be mixed with an optional diluent for placing each bacterial cell in an isolated state so that the bacterial cells do not aggregate when added to foods or the like and absorb water. The diluent is preferably not only in the form of fine powder but also as fluid as possible in order to facilitate uniform mixing with the bacterial cells. Considering the safety when added to foods, the influence on the flavor and properties of foods, etc., the diluent is preferably a polysaccharide or a protein. For example, as polysaccharides, natural polysaccharides such as lactose, polydextrose, cyclodextrin, corn starch, microcrystalline cellulose, starch, galactomannan, and their enzymatically treated hydrolysates can be mentioned. As proteins, soybean protein, casein, wheat gluten, egg white albumin, etc. can be mentioned, and any two or more of these can also be used in combination.

[0045] In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be adopted. The same applies to "or". When it is specified in this specification that it is "within the range" of "two values", the range includes the two values themselves. References such as scientific literature, patents, patent applications, etc. cited in this specification are incorporated herein by reference to the same extent as if each were specifically described in its entirety.

[0046] As described above, the present disclosure has been described by showing preferred embodiments for ease of understanding. Hereinafter, the present disclosure will be described based on examples. However, the above description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims.

Examples

[0047] (Example 1: Detection 1 of Lactobacillus EF-2001 Strain (Comparison with Enterococcus faecalis Subspecies)) (1) Test Strains As test strains, (A) Lactobacillus strain EF-2001 and (B) E. faecalis NBRC3971, (C) E. faecalis NBRC3989, (D) E. faecalis NBRC12970, (E) E. faecalis NBRC100480, (F) E. faecalis NBRC100482, (G) E. faecalis NBRC100483, (H) E. faecalis NBRC100484, which are Enterococcus faecalis subspecies, were used.

[0048] (2) Preparation of lactic acid bacteria DNA A buffer solution containing an enzyme such as lysozyme was added to the above-mentioned cells recovered from the culture solution of each cell to decompose the cell membrane. After treatment with proteinase and RNase, sodium acetate was added, and the precipitate precipitated with ethanol was rinsed with ethanol and then dried. A buffer solution such as TE was added thereto, and the resulting solution was used as a DNA solution for PCR. Also, the DNA solution can be prepared using a commercially available DNA extraction kit.

[0049] (3) PCR reaction Using the DNA solution of the test strain obtained in (2) above as a template, a primer set consisting of pairs of oligonucleotides containing the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 (contig1), SEQ ID NO: 4 and SEQ ID NO: 5 (contig4), SEQ ID NO: 7 and SEQ ID NO: 8 (contig7), SEQ ID NO: 10 and SEQ ID NO: 11 (contig11), SEQ ID NO: 13 and SEQ ID NO: 14 (contig13), SEQ ID NO: 16 and SEQ ID NO: 17 (contig16), SEQ ID NO: 19 and SEQ ID NO: 20 (contig22), SEQ ID NO: 22 and SEQ ID NO: 23 (contig25), SEQ ID NO: 25 and SEQ ID NO: 26 (contig31), and SEQ ID NO: 28 and SEQ ID NO: 29 (contig43), and a primer set consisting of pairs of oligonucleotides containing the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 (contig1), SEQ ID NO: 4 and SEQ ID NO: 6 (contig4), SEQ ID NO: 7 and SEQ ID NO: 9 (contig7), SEQ ID NO: 10 and SEQ ID NO: 12 (contig11), SEQ ID NO: 13 and SEQ ID NO: 15 (contig13), SEQ ID NO: 16 and SEQ ID NO: 18 (contig16), SEQ ID NO: 19 and SEQ ID NO: 21 (contig22), SEQ ID NO: 22 and SEQ ID NO: 24 (contig25), SEQ ID NO: 25 and SEQ ID NO: 27 (contig31), and SEQ ID NO: 28 and SEQ ID NO: 30 (contig43), the PCR reaction was carried out according to the method of KOD FX Neo (Toyobo), a PCR reaction reagent kit. When the total volume of the PCR reaction solution was 50 μL, 25.0 μL of the 2× PCR buffer attached to the kit, 10.0 μL of 2 mM dNTPs, 1.0 U of DNA polymerase, 0.2 μL of the primer mixture, and a reaction solution containing 10 - 200 ng (in the case of live bacteria) or 10 - 400 ng (in the case of dead bacteria) of template DNA were preheated at 94°C for 10 seconds using a Thermal cycler GenAtlas (ASTEC), and then subjected to 25 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 68°C for 30 seconds.

[0050] Note that as a positive control, primers (F: SEQ ID NO: 61, R: SEQ ID NO: 62) designed such that the amplification product was 200 - 300 bp using the 16S rDNA of Lactobacillus strain EF-2001 as a template were used.

[0051] (4) Agarose electrophoresis The PCR product obtained by the PCR reaction was electrophoresed at 100 V for 30 minutes on a 1.4% agarose gel containing GelRed Nucleic Acid Gel Stain (FUJIFILN Co., Ltd.). Next, bands indicating the amplification of the PCR product were observed with a WSE-5400-UP Printgraph Classic (ATTO Co., Ltd.). The results are shown in Fig. 1.

[0052] As shown in Fig. 1, positive control bands of approximately 284 bp were observed for all subspecies of Enterococcus faecalis used here. However, bands of approximately 100 to approximately 250 bp and bands of approximately 500 to approximately 600 bp were observed only when the DNA of strain EF-2001 was used (Fig. 1(A)). It was confirmed that only the Lactobacillus EF-2001 strain among Enterococcus faecalis subspecies could be specifically detected by the primer set of the present invention.

[0053] <Example 2: Detection of Lactobacillus EF-2001 strain 2 (Comparison with other lactic acid bacteria)> As test strains, (A) Lactobacillus EF-2001 strain and other lactic acid bacteria (B) E. faecium Aus0004, (C) E. gallinarum LMG13129, (D) Lactobacillus rhamnosus NBRC3425, (E) L. plantarum NBRC15891, (F) L. paracasei NBRC15906, (G) L. lactis NBRC102622 were used, and the procedure was the same as in Example 1 in all other respects. The results are shown in Fig. 2.

[0054] As shown in Fig. 2, when using the DNA of Lactobacillus strain EF-2001, a positive control band of about 284 bp, a band of about 100 to about 250 bp, and a band of about 500 to about 600 bp were observed (Fig. 2(A)). For lactic acid bacteria other than Lactobacillus strain EF-2001, no bands were observed. Thus, it was confirmed that the primer set of the present invention can specifically detect only Lactobacillus strain EF-2001 among other lactic acid bacteria.

[0055] <Example 3: Detection of Lactobacillus strain EF-2001 3 (Live bacteria and heat-killed bacteria)> (1) Test strains Using Lactobacillus strain EF-2001 as the test strain, nucleic acids were detected using DNA extracted from three types of bacterial cells: live bacteria (culture solution in Fig. 3(A)), dead bacteria (solution after heat treatment in Fig. 3(B)), and dead bacteria (product raw powder in Fig. 3(C)) as templates. (2) Preparation of DNA, PCR conditions, and PCR primers were carried out in the same manner as in Examples 1 and 2. The results of agarose electrophoresis under the same conditions as in Examples 1 and 2 are shown in Fig. 3.

[0056] As shown in Fig. 3, a band of about 100 to about 250 bp was observed in both the live and dead bacteria of Lactobacillus strain EF-2001. It became clear that the primer set of the present invention exhibits specific detection ability not only for live bacteria of Lactobacillus strain EF-2001 but also for heat-treated bacteria (dead bacteria). This means that Lactobacillus strain EF-2001 can be detected not only in products using live Lactobacillus strain EF-2001 but also in products using heat-treated Lactobacillus strain EF-2001, which is a very useful result.

[0057] <Example 4: Band disappearance due to heating> Using Lactobacillus strain EF-2001 as the test strain, the disappearance of the bands of the primer set of the present invention due to heat treatment was confirmed. In addition to the untreated ones (live bacteria), Lactobacillus strain EF-2001 heat-treated at 70 °C, 90 °C, and 110 °C was used.

[0058] As an example, using SEQ ID NOs: 16 and 17 that amplify a part of the nucleotide sequence of contig16, and primers of SEQ ID NOs: 16 and 18, the amplification ability of the nucleic acid fragment was examined in the same manner as in Example 1 for PCR conditions and the like. The results are shown in FIG. 4.

[0059] As shown in FIG. 4, it was found that the primer set (long) of SEQ ID NOs: 16 and 17 had bands disappearing as the heating temperature increased. In products using the heat-treated Lactobacillus strain EF-2001, since a certain heat history is required, the disappearance of the bands of the primers that detect this long means that a certain heat history has been given, and this is a very useful result. On the other hand, the primer set (short) of SEQ ID NOs: 16 and 18 was able to confirm the bands during electrophoresis even when heated at 110°C.

[0060] <Example 5: Measurement of TNF-α production amount> Using the Lactobacillus strain EF-2001 as the test strain, the change in the TNF-α production amount of the Lactobacillus strain EF-2001 by heat treatment was confirmed. The untreated (live bacteria) and the Lactobacillus strain EF-2001 heat-treated at 110°C were used.

[0061] First, TNF-α was induced using RAW264.7 cells. The RAW264.7 cell solution adjusted to 1.0×10 6 cells / mL was dispensed 100 μL per well into 96 wells and cultured in a 5% CO 2 incubator at 37°C for 24 hours. The culture supernatant was removed, washed with RPMI-1640 medium without FBS, and then 100 μL of the sample solution was added and reacted in a 5% CO 2 incubator at 37°C for 6 hours. The sample was prepared by using a 1 mg / mL EF-2001 solution in RPMI-1640 Medium with L-glutamine and sodium bicarbonale, liquid, sterile-filtered, suitable for cell culture (R8758-500ML; SIGMA) and appropriately diluted.

[0062] After 6 hours, the supernatant was collected and stored at -80°C until TNF-α measurement. After appropriately diluting the sample, the concentration of TNF-α induced and produced was measured according to the protocol of the "Mouse TNF-α Quantikine ELISA Kit". The results are shown in Fig. 5.

[0063] As shown in Fig. 5, it was confirmed that the production amount of TNF-α increased by applying heat treatment (110°C) to Lactobacillus strain EF-2001. This means that in products using the heat-treated Lactobacillus strain EF-2001, the production amount of TNF-α is increased. By combining with the result shown in Example 4 that the band of the primer for detecting long disappears and the band of the primer for detecting short remains by giving a certain heat history, it is shown that by confirming that the band of the primer for detecting long disappears and the band of the primer for detecting short remains, it can be an indicator of whether a Lactobacillus strain EF-2001 with an increased TNF-α production amount is obtained.

[0064] (Note) As described above, the present disclosure has been exemplified using the preferred embodiments of the present disclosure, but it is understood that the scope of the present disclosure should be interpreted only by the claims. It is understood that patents, patent applications, and other documents cited in this specification should be incorporated by reference into this specification as if the content itself were specifically described in this specification.

Industrial Applicability

[0065] By the method of the present invention, it becomes possible to simply, quickly, and specifically detect the Lactobacillus Enterococcus faecalis EF-2001 strain. Therefore, wide applications such as speculation of genes involved in various activities of the EF-2001 strain and development of functional foods and supplements using the genes can be expected.

Sequence Listing Free-Text

[0066] Sequence number 1: Forward primer in contig1 Sequence number 2: Reverse primer (long) in contig1 Sequence number 3: Reverse primer (short) in contig1 Sequence number 4: Forward primer in contig4 Sequence number 5: Reverse primer (long) in contig4 Sequence number 6: Reverse primer (short) in contig4 Sequence number 7: Forward primer in contig7 Sequence number 8: Reverse primer (long) in contig7 Sequence number 9: Reverse primer (short) in contig7 Sequence number 10: Forward primer in contig11 Sequence number 11: Reverse primer (long) in contig11 Sequence number 12: Reverse primer (short) in contig11 Sequence number 13: Forward primer in contig13 Sequence number 14: Reverse primer (long) in contig13 Sequence number 15: Reverse primer (short) in contig13 Sequence number 16: Forward primer in contig16 Sequence number 17: Reverse primer (long) in contig16 Sequence number 18: Reverse primer (short) in contig16 Sequence number 19: Forward primer in contig22 Sequence number 20: Reverse primer (long) in contig22 Sequence number 21: Reverse primer (short) in contig22 Sequence number 22: Forward primer in contig25 Array number 23: Reverse primer (long) in contig25 Array number 24: Reverse primer (short) in contig25 Array number 25: Forward primer in contig31 Array number 26: Reverse primer (long) in contig31 Array number 27: Reverse primer (short) in contig31 Array number 28: Forward primer in contig43 Array number 29: Reverse primer (long) in contig43 Array number 30: Reverse primer (short) in contig43 Array number 31: Amplification product (long) of contig1 Array number 32: Amplification product (short) of contig1 Array number 33: Amplification product (long) of contig4 Array number 34: Amplification product (short) of contig4 Array number 35: Amplification product (long) of contig7 Array number 36: Amplification product (short) of contig7 Array number 37: Amplification product (long) of contig11 Array number 38: Amplification product (short) of contig11 Array number 39: Amplification product (long) of contig13 Array number 40: Amplification product (short) of contig13 Array number 41: Amplification product (long) of contig16 Array number 42: Amplification product (short) of contig16 Array number 43: Amplification product (long) of contig22 Array number 44: Amplification product (short) of contig22 Array number 45: Amplification product (long) of contig25 Array number 46: Amplification product (short) of contig25 Array number 47: Amplification product (long) of contig31 Amplification product (short) of Contig 31 with Accession No. 48 Amplification product (long) of Contig 43 with Accession No. 49 Amplification product (short) of Contig 43 with Accession No. 50 Accession No. 51: Contig 1 Accession No. 52: Contig 4 Accession No. 53: Contig 7 Accession No. 54: Contig 11 Accession No. 55: Contig 13 Accession No. 56: Contig 16 Accession No. 57: Contig 22 Accession No. 58: Contig 25 Accession No. 59: Contig 31 Accession No. 60: Contig 43 Accession No. 61: Forward primer of positive control Accession No. 62: Reverse primer of positive control

Claims

【Claim 1】 A polynucleotide characterized by being amplified by a primer set for detecting Lactobacillus Enterococcus faecalis EF-2001 strain, a polynucleotide represented by SEQ ID NO: 31, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 2, a polynucleotide represented by SEQ ID NO: 32, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 3, a polynucleotide represented by SEQ ID NO: 33, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 5, a polynucleotide represented by SEQ ID NO: 34, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 4 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 6, a polynucleotide represented by SEQ ID NO: 35, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 8, a polynucleotide represented by SEQ ID NO: 36, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 9, a polynucleotide represented by SEQ ID NO: 37, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 11, a polynucleotide represented by SEQ ID NO: 38, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 10 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 12, a polynucleotide represented by SEQ ID NO: 39, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 14, a polynucleotide represented by SEQ ID NO: 40, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 13 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 15, A polynucleotide represented by SEQ ID NO: 41, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 17 A polynucleotide represented by SEQ ID NO: 42, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 18 A polynucleotide represented by SEQ ID NO: 43, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 A polynucleotide represented by SEQ ID NO: 44, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 19 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 21 A polynucleotide represented by SEQ ID NO: 45, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 23 A polynucleotide represented by SEQ ID NO: 46, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 22 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 24 A polynucleotide represented by SEQ ID NO: 47, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 26 A polynucleotide represented by SEQ ID NO: 48, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 25 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 27 A polynucleotide represented by SEQ ID NO: 49, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 29, or A polynucleotide represented by SEQ ID NO: 50, amplified by a primer set consisting of an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 and an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 30

Images