Treatment for feline infectious peritonitis
The use of calcium channel blockers in a pharmaceutical composition effectively inhibits FIPV replication, addressing the inadequacies of current treatments for feline infectious peritonitis and reducing mortality rates.
Patent Information
- Application Number
- JP2020193457
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2020-11-20
- Publication Date
- 2025-06-05
- Estimated Expiration
- 2040-11-20
AI Technical Summary
Current methods are inadequate for effectively preventing and treating feline infectious peritonitis (FIP), a highly fatal disease in domestic cats.
A pharmaceutical composition containing calcium channel blockers, such as L-type calcium antagonists (e.g., verapamil, tetrandrine, amlodipine) or calcium chelators (e.g., BAPTA), is used to inhibit the proliferation of feline infectious peritonitis virus (FIPV) by affecting calcium concentrations in endosomes.
The use of calcium channel blockers significantly inhibits FIPV replication and proliferation, offering a potential treatment and prevention method for FIP, thereby reducing mortality rates among affected cats.
Smart Images

Figure 0007688886000010 
Figure 0007688886000011 
Figure 0007688886000012
Abstract
Description
[Technical field]
[0001] The present invention relates to a therapeutic agent and a method for treating feline infectious peritonitis. [Background technology]
[0002] Feline coronavirus (FCoV) is classified as a member of the Coronaviridae family of the Nidovirales order. Coronaviruses are virologically enveloped, positive-sense, single-stranded RNA viruses.
[0003] FCoV infection is common in domestic cats, especially in group-housed facilities. Most cats infected with FCoV are asymptomatic or show only mild enteritis, but some cats can develop feline infectious peritonitis (FIP).
[0004] FIP is an extremely fatal disease that develops in approximately 7% of domestic cats, and causes neurological lesions, pleural and ascites effusion, and death from peritonitis and anemia. However, the detailed mechanisms of infection and onset have not yet been elucidated, and progress in basic research on feline infectious peritonitis virus (FIPV) is necessary to develop effective treatment and prevention methods. FIP is classified into a wet type (exudative type) characterized by multiple serositis and vasculitis, and a dry type (non-exudative type) characterized by multiple granulomatous lesions in each organ. Cases showing characteristics of both types have also been reported. Clinical symptoms are highly variable, and these changes depend on the severity of vasculitis and granulomatous lesions. Common clinical symptoms include fever, depression, loss of appetite, and weight loss that do not respond to antibiotics.
[0005] There is no specific definitive method for diagnosing FIPV. When diagnosing FIPV, the cat's breeding background, medical history, the aforementioned clinical symptoms, biochemical test results, and viral gene analysis data by real-time PCR using biological materials (blood and exudates) are the diagnostic criteria, and a comprehensive judgment is made based on these.
[0006] In addition, there is no established effective treatment for FIP. Currently, supportive therapy is carried out with the aim of suppressing inflammation and excessive immune responses, but clinical effects cannot be expected to be very significant.
[0007] Many host factors are required for viral replication and may serve as targets for antiviral therapy. 2+ is closely related to the expression of various cellular functions, and previous reports have shown that it is important for Ebola virus cell entry (Non-Patent Document 1).
[0008] When Ebola virus enters a cell by specific binding to a receptor on the cell surface, it is transported into the cell by macropinocytosis, and then transported to early endosomes and late endosomes while being packaged in endosomal vesicles, and finally the virus particles are released into the cytoplasm.
[0009] In addition, two-pore channels (TPCs) are endosome-localized calcium channels that are activated by nicotinic acid adenine dinucleotide phosphate (NAADP) and are involved in the control of endosomal vesicle transport (Non-Patent Document 2). Thus, inhibition of TPCs inhibits the transport of Ebola virus particles, and TPCs are required for Ebola virus entry into cells (Non-Patent Document 1).
[0010] FIPV is an enveloped virus, like Ebola virus. Enveloped viruses invade host cells by fusing the envelope with the cell membrane. In coronaviruses, the spike (S) protein performs this function. Previous reports have revealed that, depending on the type of structural change in the S protein, some coronaviruses fuse with the cell surface membrane when invading cells, while others fuse with the endosomal membrane via the endosome. The S protein of FIPV has the latter property. [Prior art documents] [Non-patent literature]
[0011] [Non-Patent Document 1] Sakurai Y. et al., Science. 2015 Feb 27;347(6225):995-8. doi: 10.1126 / science.1258758 [Non-Patent Document 2] Bethan.S.Kilpatrick, Cell Reports February 14, 2017 Summary of the Invention [Problem to be solved by the invention]
[0012] Conventional methods have not been able to sufficiently prevent and / or treat FIP, and so a new method capable of effectively preventing and / or treating FIP has been desired.
[0013] An object of the present invention is to provide a pharmaceutical composition capable of efficiently inhibiting the proliferation of FIPV and a method for treating FIP using the pharmaceutical composition. [Means for solving the problem]
[0014] Since FIPV uses endosomes for cell entry, it was suggested that TPCs localized in endosomes may be necessary during cell entry. Based on the analysis of the viral replication mode, the inventors predicted that calcium antagonists that affect the calcium concentration in endosomes would have antiviral activity, and 2+ We investigated whether inhibition of the channel affects viral replication. As a result of cell culture experiments, we found that certain calcium antagonists dramatically inhibit the proliferation of FIP virus (FIPV) and suppress the intracellular proliferation of FIPV, thus completing the present invention.
[0015] That is, the present invention is as follows. [1] A therapeutic or preventive agent for feline infectious peritonitis in felines, which contains as an active ingredient a calcium channel blocker that is an L-type calcium antagonist or a calcium chelator. [2] A therapeutic or preventive agent according to [1], wherein the L-type calcium antagonist is selected from the group consisting of verapamil, tetrandrine and amlodipine, and the calcium chelator is BAPTA. [3] A therapeutic or prophylactic agent according to [1] or [2] that suppresses the replication of feline infectious peritonitis virus (FIPV) in the body of a feline. [4] A method for treating or preventing feline infectious peritonitis in a feline, comprising administering to the feline a calcium channel blocker that is an L-type calcium antagonist or a calcium chelator. [5] A method for treating or preventing [4], wherein the L-type calcium antagonist is selected from the group consisting of verapamil, tetrandrine and amlodipine, and the calcium chelator is BAPTA. [6] A method for treating or preventing [4] or [5] by suppressing the replication of feline infectious peritonitis virus (FIPV) in a feline. [7] A pharmaceutical composition for suppressing the proliferation of feline infectious peritonitis virus (FIPV) in felines, comprising as an active ingredient a calcium channel inhibitor that is an L-type calcium antagonist or a calcium chelator. [8] The pharmaceutical composition of [7], wherein the L-type calcium antagonist is selected from the group consisting of verapamil, tetrandrine and amlodipine, and the calcium chelator is BAPTA. [9] A method for inhibiting the proliferation of feline infectious peritonitis virus (FIPV) in a feline, comprising administering to the feline a calcium channel blocker that is an L-type calcium antagonist or a calcium chelator.
[10] A method for inhibiting the proliferation of feline infectious peritonitis virus (FIPV) in a feline animal according to [9], wherein the L-type calcium antagonist is selected from the group consisting of verapamil, tetrandrine and amlodipine, and the calcium chelator is BAPTA. Effect of the Invention
[0016] The therapeutic or preventive agent of the present invention can save the lives of many cats suffering from FIP, and can particularly reduce the FIP mortality rate among cat breeders and pet shops. [Brief description of the drawings]
[0017] [Figure 1-1] FIG. 1 shows the results of a toxicity test of Ca channel inhibitors (verapamil, tetrandrine, gabapentin, and amlodipine) to fcwf-4. [Figure 1-2] FIG. 1 shows the results of a toxicity test of Ca channel inhibitors (diltiazem, Trans-Ned19, BAPTA) to fcwf-4. [Diagram 2] FIG. 1 shows the effect of Ca channel inhibitors on FIPV replication. [Diagram 3] FIG. 1 shows the results of measuring virus titer by the TCID50 method. [Figure 4] FIG. 1 shows the effect of suppressing TPC1 gene expression in knockdown cells. [Diagram 5] FIG. 1 shows the inhibitory effect of FIPV gene expression in knockdown cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0018] The present invention will be described in detail below.
[0019] The present invention relates to a therapeutic or preventive agent for feline infectious peritonitis (FIP) in a feline animal and a method for treating or preventing FIP in a feline mammal using the therapeutic or preventive agent. Furthermore, the present invention relates to a pharmaceutical composition for inhibiting the proliferation of feline infectious peritonitis virus (FIPV) or a method for inhibiting the proliferation of feline infectious peritonitis virus (FIPV).
[0020] Examples of felines that may be treated include domestic cats, African wildcats, sand cats, black-footed cats, European wildcats, gray cats, cheetahs, caracals, jaguarundi, ocelots, margays, lynxes, bobcats, Pallas's cats, Bengal wildcats, pumas, lions, jaguars, leopards, tigers, snow leopards, and clouded leopards.
[0021] Compounds used as active ingredients of the therapeutic agent of the present invention include calcium channel inhibitors. Calcium channel inhibitors antagonize the function of calcium channels present in vascular smooth muscles and suppress the action of calcium on vascular muscles. Examples of calcium channel inhibitors include calcium antagonists and calcium chelators. Calcium antagonists antagonize the function of calcium channels, and calcium chelators selectively bind to calcium.
[0022] The calcium antagonists and calcium chelators are capable of treating or preventing feline infectious peritonitis by inhibiting the replication and proliferation of feline infection peritonitis virus (FIPV).
[0023] Calcium antagonists used as an active ingredient of the therapeutic agent of the present invention include, specifically, L-type calcium antagonists. L-type calcium antagonists antagonize the function of calcium channels by blocking calcium influx through L-type calcium channels. L-type calcium antagonists include dihydroproline calcium antagonists, phenylalkylamine L-type calcium antagonists, etc., and specifically include verapamil, tetrandrine, amlodipine, nifedipine, nicardipine, manidipine, etc. Among these, verapamil, tetrandrine, or amlodipine is preferred.
[0024] Examples of calcium chelating agents include BAPTA (1,2-bis(o-aminophenoxide)ethane-N,N,N',N'-tetraacetic acid), EDTA (ethylenediaminetetraacetic acid), EGTA (glycol ether diaminetetraacetic acid), HEDTA (N'-(2-hydroxyethyl)ethylenediamine-N,N,N'-triacetic acid), NTA (nitrilotriacetic acid), etc. Among these, BAPTA, which is specific to calcium, is preferred.
[0025] As the active ingredient of the therapeutic agent of the present invention, salts of these calcium antagonists or calcium chelating agents can also be used.
[0026] Verapamil is a phenylalkylamine calcium channel blocker. Verapamil is (2RS)-5-[(3,4-Dimethoxyphenethyl)methylamino]-2-(3,4-dimethoxyphenyl)-2-(1-methylethyl)pentanenitrile (C 27 H 38 N 2 O 4 ) and its CAS registry number is 52-53-9.
[0027] [ka]
[0028] Tetrandrine is a bis-isoquinoline alkaloid. Tetrandrine is 6,6',7,12-tetramethoxy-2,2'-dimethyl-1 beta-berbaman (C 38 H 42 N 2 O 6 ) and its CAS registry number is 518-34-3.
[0029] [ka]
[0030] Amlodipine is a dihydropyridine calcium antagonist, and is represented by the following formula (III): (RS)-3-ethyl 5-methyl 2-[(2-aminoethoxy)methyl]-4-(2-chlorophenyl)-6-methyl-1,4-dihydropyridine-3,5-dicarboxylate (C 20 H 25 ClN 2 O 5 ) and its CAS registry number is 88150-42-9.
[0031] [ka]
[0032] BAPTA is an aminopolycarboxylic acid that forms ions with calcium. BAPTA is 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (C 22 H 24 N 2 O 10 ) and its CAS registry number is 85233-19-8.
[0033] [ka]
[0034] The salts of the above compounds include pharmacologically acceptable salts, such as acid addition salts or base addition salts, including besylate, hydrochloride, fumarate, tartrate, citrate, maleate, hydrobromide, camsylate, nicotinate, lactate, mesylate, gluconate, etc. Specific examples include verapamil hydrochloride, amlodipine hydrochloride, amlodipine besylate, etc.
[0035] The preventive or therapeutic agent for inflammatory diseases of the present invention may contain a pharma- ceutically acceptable carrier, diluent, etc. Examples of the carrier include, but are not limited to, physiological saline, phosphate buffered saline, phosphate buffered saline, glucose solution, buffered saline, etc.
[0036] The route of administration is not limited, and it can be administered orally or parenterally, such as subcutaneously, intramuscularly, intravenously, or rectally. It can be administered in various forms, such as tablets, powders, granules, fine granules, capsules, syrups, fine granules, sprays, emulsions, suppositories, injections, ointments, tapes, etc. For example, tablets, powders, granules, fine granules, capsules, etc. may contain excipients such as lactose, glucose, sucrose, mannitol, etc.; disintegrants such as starch and sodium alginate, etc.; lubricants such as magnesium stearate and talc, binders such as polyvinyl alcohol, hydroxypropyl cellulose, and gelatin, surfactants such as fatty acid esters, and plasticizers such as glycerin. Liquid preparations such as emulsions and syrups may contain water, sugars such as sucrose, sorbitol, and fructose; glycols such as polyethylene glycol and propylene glycol; fats and oils such as olive oil, sesame oil, and soybean oil; preservatives such as p-hydroxybenzoic acid esters; flavors such as strawberry flavor and peppermint. Injections may contain water; sugars such as sucrose, sorbitol, xylose, trehalose, and fructose; sugar alcohols such as mannitol, xylitol, and sorbitol; buffers such as phosphate buffer, citrate buffer, and glutamate buffer; surfactants such as fatty acid esters, and the like. The preventive or therapeutic agent for inflammatory diseases of the present invention may further contain a pH adjuster, an antioxidant, a stabilizer, a preservative, a thickener, a chelating agent, a moisturizer, a colorant, an isotonic agent, and the like.
[0037] The dosage can be appropriately set depending on the administration method, age, body weight, and medical condition of the feline animal to which it is applied, but is preferably 0.005 to 5 mg / kg body weight, more preferably 0.005 to 1 mg / kg body weight per administration. The administration method is not limited, but in the case of intravenous injection, 0.005 to 5 mg / kg body weight per administration can be dissolved in physiological saline or the like and administered.
[0038] The pharmaceutical composition may contain the compound at 0.1 to 50 (w / w) %, preferably 5 to 30 (w / w) %, based on the weight of the pharmaceutical composition.
[0039] A given dose may be given in a single administration or as two, three, four or more divided doses given at appropriate intervals per day.
[0040] The calcium channel blocker may be administered in combination with other prophylactic and / or therapeutic agents. "In combination" refers to use with one or more prophylactic and / or therapeutic agents. The use of the term "in combination" does not limit the order in which the calcium channel blocker and the prophylactic and / or therapeutic agents are administered to a subject. The first agent can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) administration of the second agent to the subject.
[0041] Other preventive and / or therapeutic agents that can be administered in combination include, but are not limited to, agents known to be used for the treatment and prevention of FIP, such as steroids, antibiotics, interferons, vitamins, nutrients, etc. Further, other preventive and / or therapeutic agents include RNAi molecules that target the mRNA of specific genes of FIPV (e.g., matrix gene and 3CLpro gene) (JP Patent Publication No. 2009-165356 and JP Patent Publication No. 2009-165357).
[0042] The effect of calcium channel inhibitor administration can be evaluated by the alleviation of FIP symptoms (severity, range, etc. of the affected area) compared to individuals not administered calcium channel inhibitors or before administration. The effect of calcium channel inhibitor administration can be evaluated by the decrease in the copy number of FIPV in the administered subject (expression amount of total FIPV mRNA or mRNA or protein of a specific gene (marker gene) indicating the copy number of FIPV) compared to individuals not administered calcium channel inhibitors or before administration. When the measurement subject is mRNA, it can be measured by Northern hybridization, RT-PCR, in situ hybridization, etc. When the measurement subject is protein, it can be measured by Western blotting, ELISA, measurement using a protein chip bound to an antibody, protein activity measurement, etc. EXAMPLES
[0043] The present invention will be specifically described with reference to the following examples, but the present invention is not limited to these examples.
[0044] [Example 1] FIPV replication inhibition test using Ca channel inhibitors 1. Materials and Methods (1) Cell lines and cell culture methods used Cell line used: fcwf-4 (whole fetal fetal cells) The culture solution is DULBECCO'S MODIFIE'S MEDIUM (D-MEM, Wako, glucose 4500 mg / L, L-glutamine, NaHCO) with 5 (v / v)% or 10 (v / v)% fetal bovine serum. 3 The cells were seeded in a 10 cm dish (Roche) and incubated at 37°C, 5% CO 2 The cells were statically cultured under these conditions, and then passaged and maintained when they reached 80% confluence.
[0045] (2) Drugs used The drugs in Table 1 that have Ca channel blocking effects were used.
[0046] [Table 1]
[0047] (3) Toxicity test of Ca channel blockers on fcwf-4 10 ml of fcwf-4 in a 96-well plate (TPP) 4 Seed cells / well and incubate at 37℃, 5% CO 2 The cells were statically cultured in D-MEM supplemented with 10 (v / v)% fetal bovine serum under the following conditions. The next day, two-step dilutions of drug concentrations from 100 μM to 0.2 μM in D-MEM supplemented with 5 (v / v)% fetal bovine serum were added to the cultured cells, and the cells were statically cultured for another 20 hours. Then, 10 μl of Cell Counting KiT-8 (Dojindo Laboratories) was added to each well, and the cells were incubated at 37°C and 5% CO 2 The cells were incubated for 2 hours under these conditions. The absorbance at 450 nm was then measured using a Thermo Scientific Multiscan FC. The results are shown in Figure 1.
[0048] (4) Effect of Ca channel inhibitors on FIPV replication (i) FIPV infection and treatment with Ca channel inhibitors 2.5 × 10 fcwf-4 cells in 12 plates 5 The cells were seeded and incubated at 37°C, 5% CO 2 After 24 hours of incubation under these conditions, 500 μL of FIP virus (79-1146 strain) solution was added to each well at an MOI of 0.01, and the plates were incubated at 37°C, 5% CO 2 The wells were then left to stand for 30 minutes under the conditions described above. After standing, the virus-infected wells were washed three times, and 500 μL / well of a Ca channel inhibitor at each concentration was added by serial dilution. After 20 hours, when cell degeneration was observed, the cell culture supernatant was collected, and Cell Lysis Buffer (100 μL / well) was added to each well, and the cell lysate was collected.
[0049] (ii) Detection of viral proteins by Western blotting The recovered proteins were prepared as shown in Table 2, and SDS-PAGE and Western blotting were performed according to the procedures shown below.
[0050] [Table 2]
[0051] SDS-PAGE The electrophoresis gel was a Wako SuperSep Ace 12.5%-13 well gel, which was set in a Wako Easy Separator. 1×SDS PAGE Buffer was used as the electrophoresis buffer, and the prepared samples and markers were placed in each well, followed by electrophoresis at a constant voltage of 200 V for 70 minutes.
[0052] Membrane Pretreatment SP PVDF membrane (Wako) was used as the membrane for blotting. It was pretreated by soaking in methanol for 10 seconds, and then equilibrated in transfer buffer [Bjerrum & Schaffer (48 mM Tris, 39 mM glycine, 20 (w / v)% methanol)]. 3 MM filter paper (Bio-Rad) was also soaked in the transfer buffer.
[0053] Blotting After electrophoresis, the PVDF membrane and gel were sandwiched between the membrane and filter paper treated as described above, and this was set in a semi-dry blotting device (Transblot Turbo System) and electricity was applied at a constant voltage of 25 V and 1.0 A for 30 minutes.
[0054] Antigen-antibody reaction (a) Blocking After the transfer, 10 mL of the blocking solution described below and the PVDF membrane were added and blocked by shaking overnight at 4°C. After blocking, the PVDF membrane was washed with TBST while being soaked for 5 minutes (blocking solution: TBST containing 5 (w / v)% skim milk (Morinaga Milk Industry)).
[0055] (b) Primary antibody reaction For the primary antibody reaction, the primary antibodies shown in Table 3 were diluted with Max Blot Solution 1 (TOYOBO), and the PVDF membrane and antibody dilution solution were placed in the solution and shaken at room temperature for 1 hour. After the primary antibody reaction, the PVDF membrane was washed three times with TBST for 5 minutes while shaking.
[0056] (c) Secondary antibody reaction For the secondary antibody reaction, the secondary antibody shown in Table 3 was diluted with Max Blot Solution 2 (TOYOBO), the PVDF membrane and the antibody dilution solution were placed in, and the mixture was shaken again at room temperature for 30 minutes. After the reaction, the PVDF membrane was washed in the same way as for the primary antibody.
[0057] [Table 3]
[0058] Chemiluminescence The antibody-reacted PVDF membrane and the antibody dilution solution were reacted with Immobilon Western Chemiluminescent HRP Substrate (MILLIPORE), and the bands were visualized with LA-3000 (FUJIFILM). The results are shown in Figure 2.
[0059] (iii) Measurement of viral titer by TCID50 method 50 μL of D-MEM supplemented with 5 (v / v)% fetal bovine serum was added to each well of the 96-well plate. The culture supernatant of the infected cells was diluted with D-MEM supplemented with 5 (v / v)% fetal bovine serum for 10 min. -4 25 μL of serially diluted 100 μL of each solution was added to the first column. Then, 25 μL of each solution was transferred from the first column to the second column. The same procedure was repeated up to the 11th column, resulting in 30 μL of each solution. n 3 serial dilutions of 11 ×10 -4The 12th row was used as a control for non-infected cells. Next, fcwf-4 cells in a 10 cm petri dish were resuspended in 6 mL of D-MEM supplemented with 5 (v / v)% fetal bovine serum, and 50 μL of this cell solution was added to each of the 96 wells. After 48 hours, the end point of cell degeneration was determined under a microscope. From the results, the TCID50 was calculated using the Körber formula (see below). The results are shown in Table 4 and Figure 3.
[0060]
number
[0061] 2.Results (i) Toxicity test results of Ca channel inhibitors on fcwf-4 The results are shown in Figure 1. Verapamil, tetrandrine, gabapentin, diltiazem, and Trans-Ned19 showed no toxicity at concentrations below 50 μM. Amlodipine and BAPTA showed no toxicity at concentrations below 25 μM and 2.5 μM, respectively.
[0062] (ii) Detection of viral proteins by Western blotting After infecting fcwf-4 cells with FIPV, Ca channel inhibitors were added and protein expression was confirmed by Western blotting. The results are shown in Figure 2. The drug concentrations of each Ca channel inhibitor used were adjusted based on the results of toxicity tests.
[0063] (Verapamil, Gabapentin, Diltiazem, Trans-Ned19: 50μM, 25μM, 12.5μM, 6.3μM, 3.2μM, 1.6μM, 0.8μM, 0.4μM, 0.2μM, Tetrandrine, Amlodipine: 25μM, 12.5μM, 6.3μM, 3.2μM, 1.6μM, 0.8μM, 0.4μM, 0.2μM, BAPTA: 5μM, 2.5μM, 1.2μM, 0.6μM, 0.3μM, 0.15μM) Verapamil, tetrandrine, amlodipine, and BAPTA suppressed FIPV replication, whereas gabapentin, diltiazem, and Trans-Ned19 did not.
[0064] (iii) Virus titer measurement results by TCID50 method The virus titer was measured using the TCID50 method when a Ca channel inhibitor was added. The results are shown in Table 4 and Figure 3. This measurement was performed only for drugs that showed a virus-suppressing effect based on the results of the Western blot method (verapamil, tetrandrine, amlodipine, BAPTA). In addition, experiments were performed independently for each drug.
[0065] Addition of verapamil, tetrandrine, amlodipine, or BAPTA after FIPV infection suppressed FIPV replication.
[0066] [Table 4]
[0067] [Example 2] Knockdown experiment of Two pore channel (TPC1) using shRNA 1. Preparation of knockdown plasmid for TPC1 gene The following oligonucleotides were synthesized to prepare shRNA against the coding region of feline TPC1, a target molecule of calcium antagonists. sh-fTPCN1-921-sense: GATCCAGCTGTACTTCATCATGAATTCAAGAGATTCATGATGAAGTACAGCTCGA (SEQ ID NO: 1) sh-fTPCN1-921-antisense: AGCTTCGAGCTGTACTTCATCATGAATCTCTTGAATTCATGATGAAGTACAGCTG (SEQ ID NO: 2) These oligonucleotides were annealed and then inserted into the HindIII-BamHI site of the pSilencer 4.1 CMV-puro (Ambion) vector. The insert sequence of the resulting vector was confirmed by sequence analysis. The constructed vector was then introduced into fcwf-4 cells, which were then selected with puromycin, and the resulting cell colonies were cloned.
[0068] 2. Suppression of feline TPC1 gene expression using shRNA method The cells obtained in the above experiment were plated in 12-well plates at 2.5 × 10 5 Seed and cultured at 37°C, 5% CO 2 After 24 hours of culture under these conditions, the cells were harvested and the TPC1 gene expression level was compared with that of the parent fcwf-4 cell line by real-time PCR. As a result, approximately 30-40% suppression of gene expression was observed (Figure 4).
[0069] 3. FIPV gene expression experiment in feline TPC1 gene knockdown cells The cell lines in which gene expression was suppressed in Figure 4 were plated on a 12-well plate at 2.5 × 10 5 Seed and cultured at 37°C, 5% CO 2 After 24 hours of culture under these conditions, the cells were infected with FIP virus (79-1146 strain) at an MOI of 0.01. 20 hours after cell degeneration was observed, the cells were harvested and the amount of viral gene expression was quantified using real-time PCR and compared with that of the parent fcwf-4 cell line. As a result, viral replication was reduced by 61.3% to 80% in each cell line (Figure 5). [Industrial Applicability]
[0070] L-type calcium antagonists and calcium chelators can be used as therapeutic or preventive agents for feline infectious peritonitis (FIP).
Claims
1. A therapeutic or preventive agent for feline infectious peritonitis in felines, comprising as an active ingredient a calcium channel inhibitor which is an L-type calcium antagonist selected from the group consisting of verapamil, tetrandrine and amlodipine, or a calcium chelator which is BATAP.
2. The therapeutic or preventive agent according to claim 1, which suppresses the proliferation of feline infectious peritonitis virus (FIPV) in the body of a feline.
3. A method for treating or preventing feline infectious peritonitis in a feline, comprising administering to the feline a calcium channel inhibitor which is an L-type calcium antagonist selected from the group consisting of verapamil, tetrandrine and amlodipine or a calcium chelator which is BATAP.
4. The method for treatment or prevention according to claim 3, which suppresses the proliferation of feline infectious peritonitis virus (FIPV) in the body of a feline.
5. A pharmaceutical composition for inhibiting the proliferation of feline infectious peritonitis virus (FIPV) in felines, comprising as an active ingredient a calcium channel inhibitor which is an L-type calcium antagonist selected from the group consisting of verapamil, tetrandrine and amlodipine, or a calcium chelator which is BATAP.
6. A method for inhibiting the proliferation of feline infectious peritonitis virus (FIPV) in a feline, comprising administering to the feline a calcium channel inhibitor which is an L-type calcium antagonist selected from the group consisting of verapamil, tetrandrine and amlodipine or a calcium chelator which is BATAP.
Citation Information
Patent Citations
Drugs for resisting novel coronavirus SARS-CoV-2 and application thereof
CN111728973A
Medicinal composition for treating and preventing feline infectious peritonitis and use thereof
JP2011032192A
Agent for inhibiting viral infection and / or treating infectious disease, and method for inhibiting viral infection and / or treating infectious disease
WO2011126071A1