Attenuated Mycoplasma bacteria
Genetically modified Mycoplasma bacteria with specific genetic mutations address the need for an attenuated strain with reduced pathogenicity and immunogenicity, enhancing its suitability as a research tool and delivery vehicle for molecular cargo.
Patent Information
- Application Number
- JP2022556566
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-03-19
- Filing Date
- 2021-03-19
- Publication Date
- 2025-06-16
- Estimated Expiration
- 2041-03-19
AI Technical Summary
There is a need for an attenuated Mycoplasma pneumoniae strain that can be used as a research tool and/or as a delivery vehicle for molecular cargo, with improved characteristics for reduced pathogenicity and immunogenicity.
The development of a genetically modified Mycoplasma bacterium with specific genetic mutations, including deletions, substitutions, and insertions in genes such as MPN133, MPN372, and others, to reduce pathogenicity and immunogenicity while maintaining viability and the ability to secrete bioactive compounds.
The attenuated Mycoplasma strain demonstrates reduced toxicity and immunogenicity, with a significant reduction in inflammatory responses and tissue damage, making it suitable for various medical applications, including as a delivery vehicle for molecular cargo.
Smart Images

Figure 0007692927000025 
Figure 0007692927000026 
Figure 0007692927000027
Abstract
Description
Technical Field
[0001] Field of the Invention The present invention relates to the field of molecular biology, and more specifically, to the fields of genome engineering and synthetic biology. Aspects of the present invention relate to attenuated Mycoplasma bacteria.
Background Art
[0002] Background of the Invention In recent years, there has been (again) interest in using living organisms, particularly bacteria, as delivery vehicles for introducing various types of payloads into host organisms (Akin et al., Bacteria-mediated delivery of nanoparticles and cargo into cells, Nature Nanotechnology, 2007). Several organisms, such as Escherichia coli or Saccharomyces cerevisiae, have been proposed to function as such delivery vehicles. These organisms have been traditionally preferred due to their ease of growth under laboratory conditions and high recombination efficiency. It is important that the bacteria are non-pathogenic to the host organism, and usually, high recombination efficiency is often an important determinant in the selection of delivery bacteria because genetic perturbations must be introduced into the bacteria to reduce their toxicity or immunogenicity.
[0003] Advances in the field of genome manipulation have now made it possible to design more bacterial species to efficiently function as such delivery vehicles. One genus of bacteria that has particularly benefited from these advances is the genus Mycoplasma. The genus Mycoplasma consists of a group of bacteria that have several unique characteristics (e.g., lack of a cell wall, a streamlined genome, and a mutant genetic code where the codon UGA is translated as tryptophan instead of a stop codon) (Razin et al., Molecular biology and pathogenicity of Mycoplasmas, Microbiology and Molecular Biology Reviews, 1998). These characteristics contribute to an improved biosafety and a limitation in the ability of horizontal gene transfer, which are often pointed out in the art. Furthermore, in theory, since the genome size of Mycoplasma bacteria is small, it is convenient to devise an optimal gene framework that constitutes a reduced or minimal set of genes while maintaining a specific desired function of Mycoplasma when used as a delivery vehicle (Lluch-Senar et al., Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium, Molecular Systems Biology, 2015). However, attenuated Mycoplasma strains with improved characteristics for this purpose have not been reported to date. Therefore, the characterization of attenuated Mycoplasma strains is insufficient. However, such characterization would enable further research for utilizing Mycoplasma bacteria in many medical applications (e.g., using Mycoplasma as a means of producing heterologous proteins within a host organism at a desired location).
[0004] One particularly interesting Mycoplasma strain is Mycoplasma pneumoniae. In addition to the traits described above for the general Mycoplasma genus, M. pneumoniae has a small genome of 816 kb, a reduced metabolic network and genetic network, and thus has a low risk of being subject to unwanted interference from any virtually engineered circuits. In addition, M. pneumoniae is a mild pathogen that can be eliminated by available antibiotics and is one of the most thoroughly characterized bacteria. However, despite being so well understood, little is known about the physiology of M. pneumoniae. M. pneumoniae is a causative agent of atypical pneumonia and other extrapulmonary lesions in humans. The number of drug-resistant infections is steadily increasing (Beeton et al., Mycoplasma pneumoniae infections, 11 countries in Europe and Israel, 2011 to 2016, Eurosurveillance, 2020). The immune response of the infected organism acts like a double-edged sword, not only playing an antibacterial role in the early stages of infection but also causing tissue damage as a persistent effect in many types of bacterial infections, and the number of studies reporting this is increasing. An M. pneumoniae mouse model has been established, and studies targeting the correlation between the immune response and lung injury have revealed that lung injury is reduced by immunosuppression in this model (Shi et al., Immunosuppression reduces lung injury cause by Mycoplasma pneumoniae infection, Scientific Reports, 2019).
[0005] However, another problem in the development of attenuated strains of mycoplasmas and bacteria in general is the finding that several genes encoding undesirable gene products (e.g., pathogenicity determinants) are essential genes that cannot be easily removed (Lluch-Senar et al., Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium, Molecular Systems Biology, 2015). Therefore, attenuated strains often are based on multiple genetic modifications, and desired properties can be achieved by combining them. However, the results of combining several genetic modifications in Mycoplasma are unpredictable.
SUMMARY OF THE INVENTION
PROBLEMS TO BE SOLVED BY THE INVENTION
[0006] Therefore, the need for an attenuated Mycoplasma (pneumoniae) strain that can be used as a research tool and / or as a delivery vehicle for molecular cargo remains unmet.
MEANS FOR SOLVING THE PROBLEMS
[0007] SUMMARY OF THE INVENTION Through extensive experimental optimization, the inventors have identified a set of genes that can be removed or inactivated to obtain an attenuated Mycoplasma strain that still survives and is capable of secreting bioactive compounds when introduced into a host organism. Thus, as demonstrated by the examples illustrating certain representative embodiments of the present invention, the present invention relates to an attenuated Mycoplasma strain comprising a combination of genetic mutations that result in a desired phenotype. Furthermore, the inventors describe several particularly interesting attenuated Mycoplasma strains for use as pharmaceuticals or vaccines. Thus, the present invention addresses the unmet need for Mycoplasma strains that are less pathogenic and yet viable.
[0008] Accordingly, the present invention provides the following aspects: Aspect 1. A genetically modified Mycoplasma bacterium, wherein the Mycoplasma bacterium has a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon of a Ca2+-dependent cytotoxic nuclease gene (MPN133) or its equivalent and / or an ADP-ribosyltransferase CARDS gene (MPN372) or its equivalent in its genome, and the deletion, substitution, and / or insertion reduces the pathogenicity and / or immunogenicity of the Mycoplasma bacterium compared to a reference Mycoplasma bacterium having the same genomic sequence, provided that the reference Mycoplasma bacterium does not contain the deletion, substitution, and / or insertion in one or more nucleotides of the operon, the genetically modified Mycoplasma bacterium.
[0009] Aspect 2. The genetically modified Mycoplasma bacterium according to Aspect 1, wherein the bacterium further comprises one or more nucleotide deletions, substitutions, and / or insertions in one or more genes or operons encoding a protein capable of inducing Guillain-Barré in a host organism, preferably in one or more genes or operons (MPN257) encoding UDP-glucose 4-epimerase or its equivalents and / or in one or more genes or operons (MPN483) encoding glycosyltransferase or its equivalents.
[0010] Aspect 3. A genetically modified Mycoplasma bacterium, wherein the bacterium comprises a functional modification in one or more genes or operons encoding a protein capable of inducing Guillain-Barré, and the protein is capable of inducing Guillain-Barré by producing an immunogenic lipid in a host organism or by assisting in the production of this immunogenic lipid.
[0011] Aspect 4. The genetically modified Mycoplasma bacterium according to Aspect 3, wherein the Mycoplasma bacterium comprises one or more nucleotide deletions, substitutions, and / or insertions in an operon or gene (MPN257) encoding UDP-glucose 4-epimerase or its equivalents and / or in a gene or operon (MPN483) encoding glycosyltransferase or its equivalents.
[0012] Aspect 5. The Mycoplasma bacterium contains one or more nucleotide deletions, substitutions, and / or insertions in an operon or gene (MPN257) encoding UDP-glucose 4-epimerase or its equivalent, and contains a substitution in an operon or gene (MPN483) encoding glycosyltransferase or its equivalent. Preferably, the Mycoplasma bacterium contains one or more nucleotide deletions, substitutions, and / or insertions in an operon or gene (MPN257) encoding UDP-glucose 4-epimerase or its equivalent, and contains a substitution of a complete operon or complete gene (MPN483) encoding glycosyltransferase, which is a functional fragment of the operon, gene, or equivalent. The genetically modified Mycoplasma bacterium according to any one of Aspects 2 to 4.
[0013] Aspect 6. The substitution of MPN483 or its equivalent is M. genitalium MG_517, M. agalactiae MAGA_RS00300, and / or B. subtilis ugtP. The genetically modified Mycoplasma bacterium according to Aspect 5.
[0014] Aspect 7. The bacterium further contains deletions, substitutions, and / or insertions in a gene or operon encoding a peroxide-producing protein, preferably in a gene or operon encoding glycerol 3-phosphate oxidase, more preferably in a gene or operon (MPN051) encoding glycerol-3-phosphate dehydrogenase or its equivalent. The genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 6.
[0015] Aspect 8. The Mycoplasma bacteria are M. adleri, M. agalactiae, M. agassizii, M. alkalescens, M. alligatoris, M. alvi, M. amphoriforme, M. anatis, M. anseris, M. arginine, M. arthritidis, M. auris, M. bovigenitalium, M. bovirhinis, M. bovis, M. bovoculi, M. bucale, M. buteonis, M. californicum, M. canadense, M. canis, M. capricolum, M. capricolum subsp. capricolum, M. capricolum subsp. capripneumoniae, M. caviae, M. cavipharyngis, M. ciconiae, M. citelli, M. cloacale, M. collis, M. columbinasale, M. columbinum, M. columborale, M. conjunctivae, M. corogypsi, M. cottewii, M. cricetuli, M. crocodili, M. cynos, M. dispar, M. edwardii, M. elephantis, M. equigenitalium, M.equigenitalium), M. equirhinis, M. falconis, M. fastidiosum, M. faucium, M. felifaucium, M. feliminutum, M. felis, M. feriruminatoris, M. fermentans, M. flocculare, M. gallinaceum, M. gallinarum, M. gallisepticum, M. gallopavonis, M. gateae, M. genitalium, M. glycophilum, M. gypis, M. haemocanis, M. haemofelis, M. haemomuris, M. hominis, M. hyopharyngis, M. hyopneumoniae, M. hyorhinis, M. hyosynoviae, M. iguana, M. imitans, M. indiense, M. iners, M. iowae, M. lagogenitalium, M. leachii, M. leonicaptivi, M. leopharyngis, M. lipofaciens, M. lipophilum, M. maculosum, M. meleagridis, M. microti, M. moatsii, M. mobile, M. molare, M. mucosicanis (M.selected from the group consisting of M. canis, M. muris, M. mustelae, M. mycoides, M. mycoides subsp. capri, M. mycoides subsp. mycoides, M. neophronis, M. neurolyticum, M. opalescens, M. orale, M. ovipneumoniae, M. ovis, M. oxoniensis, M. penetrans, M. phocicerebrale, M. phocidae, M. phocirhinis, M. pirum, M. pneumoniae, M. primatum, M. pullorum, M. pulmonis, M. putrefaciens, M. salivarium, M. simbae, M. spermatophilum, M. spumans, M. sturni, M. sualvi, M. subdolum, M. suis, M. synoviae, M. testudineum, M. testudinis, M. tullyi, M. verecundum, M. wenyonii, M. yeatsii, and M. coccoides; preferably, the Mycoplasma bacterium is M. pneumoniae, M. genitalium, M. hyorhinis, M. bovis, M. agalactiae (M.A genetically modified Mycoplasma bacterium according to any one of aspects 1 to 7, selected from the group consisting of M. agalactiae, M. gallisepticum, and M. feriruminatoris.
[0016] Aspect 9. The Mycoplasma bacterium is an M. pneumoniae bacterium, preferably M. pneumoniae M129 - B7, a genetically modified Mycoplasma bacterium according to any one of aspects 1 to 8.
[0017] Aspect 10. The bacterium further comprises one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding a second (surface) nuclease, preferably in a gene or operon encoding membrane nuclease A (MPN491) or its equivalent, a genetically modified Mycoplasma bacterium according to any one of aspects 1 to 9.
[0018] Aspect 11. The bacterium comprises one or more nucleotide deletions, substitutions, and / or insertions in one or more genes or operons encoding cell adhesion proteins, preferably in one or more genes or operons selected from the group consisting of MPN141, MPN142, MPN453, MPN447, MPN309, MPN310, and MPN452, or any one equivalent thereof among MPN141, MPN142, MPN453, MPN447, MPN309, MPN310, and MPN452, a genetically modified Mycoplasma bacterium according to any one of aspects 1 to 10.
[0019] Aspect 12. The genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 11, wherein the bacterium further comprises one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding an immunogenic protein capable of inducing an immune response in a host organism, preferably in a gene or operon (MPN400) encoding the conserved hypothetical protein MPN_400 or its equivalent.
[0020] Aspect 13. The genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 12, wherein the bacterium further comprises one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding a protein that inhibits the growth of the bacterium in a bioreactor, preferably in a gene or operon (MPN294) encoding the chaperone protein YajL or its equivalent.
[0021] Aspect 14. The bacterium further includes one or more nucleotide deletions, substitutions, and / or insertions in one or more genes or operons encoding lipoproteins, preferably in one or more genes or operons selected from the group consisting of MPN141, MPN142, MPN152, MPN162, MPN199, MPN200, MPN224, MPN233, MPN271, MPN284, MPN288, MPN293, MPN333, MPN372, MPN415, MPN447, MPN592, MPN597, MPN602, MPN611, MPN011, MPN052, MPN054, MPN058, MPN083, MPN084, MPN097, MPN098, MPN363, MPN369, MPN408, MPN411, MPN436, MPN439, MPN442, MPN444, MPN456, MPN467, MPN489, MPN506, MPN523, MPN582, MPN585, MPN586, MPN587, MPN588, MPN590, MPN591, MPN592, MPN639, MPN640, MPN641, MPN642, MPN643, MPN644, MPN645, MPN646, MPN647, MPN648, MPN649, MPN650, MPN654, or their equivalents. The genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 13.
[0022] Aspect 15. The bacterium includes one or more nucleotide deletions, substitutions, and / or insertions in prolipoprotein diacylglyceryl transferase and prolipoprotein signal peptidase, preferably in the prolipoprotein diacylglyceryl transferase gene MPN224 and the prolipoprotein signal peptidase gene MPN293, or their operons, or the equivalents of MPN224 and MPN293. The genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 14.
[0023] Aspect 16. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 15, further comprising one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding a carcinogenic protein, preferably in a gene or operon (MPN415) encoding a high-affinity transport system protein p37 or its equivalent.
[0024] Aspect 17. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 16, further comprising one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding an RNA polymerase factor, preferably in a gene or operon (MPN626) encoding a putative RNA polymerase sigma-D factor or its equivalent.
[0025] Aspect 18. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 17, further comprising one or more nucleotide deletions, substitutions, and / or insertions in one or more genes or operons encoding a secreted Mycoplasma gene product, preferably in one or more genes or operons selected from the group consisting of MPN400, MPN036, MPN592, MPN509, MPN647, MPN084, MPN625, MPN213, MPN489, MPN142, MPN444, MPN642, MPN398, MPN491, MPN083, MPN141 or their equivalents.
[0026] Aspect 19. The reduction in pathogenicity and / or immunogenicity is characterized by a reduction in toxicity of at least 30%, preferably at least 50%, more preferably at least 75%, most preferably at least 90% when the bacterium is introduced into a host organism, preferably into the respiratory system of the host organism, compared to a reference Mycoplasma bacterium, said reference Mycoplasma bacterium having the same genomic sequence, provided that the reference Mycoplasma bacterium does not contain the deletion, substitution, and / or insertion of said one or more nucleotides in its genomic sequence, preferably, the reference Mycoplasma bacterium is M. pneumoniae M129 - B7, the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 18.
[0027] Aspect 20. The reduction in toxicity is evaluated by measuring the inflammatory response in the lung, preferably by measuring inflammatory cytokines, by measuring lung lesions, and / or by measuring hemorrhagic lesions in the mammary gland and / or lung, the genetically modified Mycoplasma bacterium according to Aspect 19.
[0028] Aspect 21. The Mycoplasma bacterium contains a nucleotide sequence encoding a foreign gene product or a functional fragment thereof, preferably, the nucleotide sequence is contained in the genomic sequence of the Mycoplasma bacterium, the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 20.
[0029] Aspect 22. The foreign gene product or its functional fragment is a protein, preferably a therapeutic protein, a protein involved in specific attachment to a host protein, an enzyme, an immunogenic protein, or a DNA-binding protein, more preferably, the (therapeutic protein or immunogenic protein) is expressed on the surface of the Mycoplasma bacterium and / or secreted by the Mycoplasma bacterium, the genetically modified Mycoplasma bacterium according to Aspect 21.
[0030] Aspect 23. The bacterium is obtained by introducing one or more deletions, substitutions, and / or insertions of the one or more nucleotides into one or more genes or operons of the Mycoplasma bacterium genome by random transposon insertion or recombinant DNA technology, preferably by a genome manipulation method, more preferably by a recombinase and / or nuclease-based genome manipulation method, the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 22.
[0031] Aspect 24. The genome containing one or more deletions, substitutions, and / or insertions of one or more nucleotides is partially obtained by chemical synthesis, preferably completely obtained, the genetically modified Mycoplasma bacterium according to any one of Aspects 1 to 23.
[0032] Aspect 25. The Mycoplasma bacterium according to any one of Aspects 1 to 24 for use as a pharmaceutical.
[0033] Aspect 26. The Mycoplasma bacterium according to any one of Aspects 1 to 24 for use as a vaccine.
[0034] Aspect 27. The Mycoplasma bacterium for use according to aspect 26, which exhibits on its surface at least one, preferably at least two, more preferably at least three distinct exogenous proteogenic sequences.
[0035] Aspect 28. The Mycoplasma bacterium for use according to aspect 27, wherein the at least one exogenous proteogenic sequence is an exogenous antigenic sequence.
[0036] Aspect 29. The Mycoplasma bacterium according to any one of aspects 1 to 24 for use in modulating the composition of the lung microbiome of a subject.
[0037] Aspect 30. A method for producing an attenuated Mycoplasma bacterium, comprising introducing one or more nucleotide deletions, substitutions, and / or insertions into at least two genes or operons encoding gene products independently selected from the group consisting of cell adhesion proteins, lipid synthesis enzymes that produce immunogenic products, redox enzymes, nucleases, toxins, lipoproteins, inflammation control proteins, immunogenic proteins, or cancer-inducing proteins.
[0038] Aspect 31. The method according to aspect 30, wherein the functional modification is introduced into live Mycoplasma bacteria by random transposon insertion, or by site-specific recombinases and / or site-specific nucleases.
[0039] Aspect 32. The method according to aspect 30 or 31, wherein the method comprises preparing a synthetic genome or a part thereof and transferring the synthetic genome (or part thereof) into a naturally occurring Mycoplasma bacterium.
[0040] Aspect 33. The method according to aspect 32, further comprising the step of inactivating, preferably degrading, and / or removing the original genome of the living Mycoplasma bacteria.
[0041] Aspect 34. Use of the attenuated Mycoplasma bacteria according to any one of aspects 1 to 24 for the production of at least one exogenous gene product or a fragment thereof.
[0042] Aspect 35. A pharmaceutical composition comprising the genetically modified Mycoplasma bacteria according to any one of aspects 1 to 24.
[0043] Aspect 36. The genetically modified Mycoplasma bacteria according to any one of aspects 1 to 24, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in at least one gene or operon selected from the group consisting of Table 1, preferably in at least two genes or operons.
[0044] Aspect 37. A kit of parts comprising the genetically modified Mycoplasma bacteria according to any one of aspects 1 to 24.
[0045] Aspect 38. A method of treating a disease using the genetically modified Mycoplasma bacteria according to any one of aspects 1 to 24.
[0046] Aspect 39. Use of the genetically modified Mycoplasma bacteria according to any one of aspects 1 to 24 for the manufacture of a pharmaceutical.
[0047] Aspect 40. A genetically modified Mycoplasma bacteria comprising the P30 exposure sequence disclosed herein, preferably, the P30 exposure sequence is constituted as part of a heterologous gene inserted into the Mycoplasma bacteria.
Brief Description of Drawings
[0048] Brief Description of Drawings
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Mode for Carrying Out the Invention
[0049] Detailed Description of the Invention As used herein, the singular forms "a", "an", and "the" include both the singular and plural referents unless the context clearly dictates otherwise.
[0050] The terms "comprising", "comprises", and "comprised of" as used herein are synonymous with "including", "includes", or "containing", "contain" and are inclusive and open-ended and do not exclude additional members, elements, or method steps not recited. These terms also encompass "consisting of" and "consisting essentially of" which have well-established meanings in the patent terminology law.
[0051] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within that range, as well as the recited endpoints. This applies to numerical ranges regardless of whether the range is introduced by the expression "from...to...", or the expression "between...and...", or another expression.
[0052] The term "about" or "approximately" as used herein when referring to measurable values such as parameters, amounts, durations, and the like means including variations from the specified value as long as it is appropriate to carry out the invention of the present disclosure, for example, including variations of not more than ±10%, preferably not more than ±5%, more preferably not more than ±1%, and even more preferably not more than ±0.1% of the specified value. It should be understood that the value itself referred to by the modifying phrase "about" or "approximately" is also specifically and preferably disclosed.
[0053] The terms "one or more" or "at least one" (e.g., one or more members or at least one member within a group of members) are clear in themselves, but by way of further illustration, this term encompasses, in particular, any one of said members, or any two or more of said members, e.g., any three or more, four or more, five or more, six or more, or seven or more, etc., of said members, and references up to and including all of said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7, or more.
[0054] In this specification, for the purpose of explaining the context of the present invention, a discussion of the background to the present invention is included. This should not be construed as an admission that any of the documents referred to were publicly available, known, or part of common general knowledge in any country at the time of the priority date of any of the claims.
[0055] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by identifying citation. All documents cited herein are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents specifically referred to herein are incorporated by reference.
[0056] Unless otherwise defined, all terms (e.g., technical and scientific terms) used in the disclosure of the present invention shall have the meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As further guidance, definitions of terms are included to better appreciate the teachings of the present invention. Where a particular term is defined in relation to a particular aspect or embodiment of the present invention, such meaning or sense is intended to apply throughout this specification (i.e., also in the context of other aspects or embodiments of the present invention) unless otherwise defined. For example, an embodiment directed to a product is also applicable to corresponding features of a method and use.
[0057] In the following sections, various aspects or embodiments of the present invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect or embodiment, unless expressly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature indicated as being preferred or advantageous.
[0058] References throughout this specification to "one embodiment" or "an embodiment" mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, although they may. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments, as will be apparent to those skilled in the art from this disclosure. Additionally, some embodiments described herein include some features of other embodiments but not others, and combinations of features of various embodiments are intended to be within the scope of the present invention and to form various embodiments, as will be understood by those skilled in the art. For example, in the appended claims, alternative combinations of the claimed embodiments are included, as will be understood by those skilled in the art.
[0059] Amino acids are referred to herein by their full names, their three-letter abbreviations, or their one-letter abbreviations.
[0060] "Mycoplasma", "Mycoplasma bacteria", or "Mycoplasmas", when used interchangeably herein, refers to the genus Mycoplasma of the Mollicutes class, characterized by the absence of a cell wall around the cell membrane. Thus, the plasma membrane forms the outer boundary of the Mycoplasma bacterial cell. Due to the absence of a cell wall, Mycoplasma has a diverse range of shapes from circular to rectangular and is known to exhibit pleomorphism. "Pleomorphism", as used herein, is a term used in histology and cytopathology to describe cells and / or their nuclei that may include variable size, shape, and staining. Cultivable Mycoplasma species typically form small umbonate colonies on agar. The exact shape of Mycoplasma can depend on a number of parameters such as osmotic pressure, the nutritional quality of the culture medium, and the growth phase. Certain Mycoplasma bacteria can be filamentous during the initial growth phase and exponential growth phase, or when attached to a surface or other cells. This filamentous shape can be transient, and under certain conditions, the filaments can branch or fragment into chains of cocci or individual cells. Another species is typically spherical and does not grow a filamentous phase. Certain species grow special attachment tip structures that are involved in the process of colony formation and / or contribute to pathogenicity. Mycoplasma bacteria contain 16S and 70S ribosomes and a replication disk to assist in the replication process and the isolation of genetic material. Mycoplasma bacteria can live as saprophytes or more commonly as parasites. The term "saprophyte" refers to chemoheterotrophic extracellular digestion that occurs in the processing of decaying organic matter. Mycoplasma bacteria are generally described as one of the smallest and simplest self-replicating organisms currently known.The genomes of naturally occurring Mycoplasma vary from about 500 kilobases (kb) to 1500 kb and are described as having a GC content of 23 to 41 mole percent (mol%).
[0061] Techniques for the enrichment and / or isolation of Mycoplasma bacteria from humans, various species of animals, and cell cultures are widely described in the art and are known to those of skill in the art (Tully and Razin, Molecular and diagnostic procedures in Mycoplasmology, Vol. 2, 1996). Those of skill in the art also recognize that the minimum criteria for the description of new species have been outlined (Brown et al., Revise standards for description of new species of the class Mollicutes (division Tenericutes), International Journal of Systematic and Evolutionary Microbiology, 2007).
[0062] A number of Mycoplasma species have been described and include the following non-exhaustive list: M. adleri, M. agalactiae, M. agassizii, M. alkalescens, M. alligatoris, M. alvi, M. amphoriforme, M. anatis, M. anseris, M. arginine, M. arthritidis, M. auris, M. bovigenitalium, M. bovirhinis, M. bovis, M. bovoculi, M. bucale, M. buteonis, M. californicum, M. canadense, M. canis, M. capricolum, M. capricolum subsp. capricolum, M. capricolum subsp. capripneumoniae, M. caviae, M. cavipharyngis, M. ciconiae, M. citelli, M. cloacale, M. collis, M. columbinasale, M. columbinum, M. columborale, M. conjunctivae, M. corogypsi, M. cottewii, M. cricetuli, M. crocodili, M. cynos, M. dispar, M. edwardii, M. elephantis, M.Mycoplasma equigenitalium, M. equirhinis, M. falconis, M. fastidiosum, M. faucium, M. felifaucium, M. feliminutum, M. felis, M. feriruminatoris, M. fermentans, M. flocculare, M. gallinaceum, M. gallinarum, M. gallisepticum, M. gallopavonis, M. gateae, M. genitalium, M. glycophilum, M. gypis, M. haemocanis, M. haemofelis, M. haemomuris, M. hominis, M. hyopharyngis, M. hyopneumoniae, M. hyorhinis, M. hyosynoviae, M. iguana, M. imitans, M. indiense, M. iners, M. iowae, M. lagogenitalium, M. leachii, M. leonicaptivi, M. leopharyngis, M. lipofaciens, M. lipophilum, M. maculosum, M. meleagridis, M. microti, M. moatsii, M. mobile, M. molare, M.M. mucosicanis, M. muris, M. mustelae, M. mycoides, M. mycoides subsp. capri, M. mycoides subsp. mycoides, M. neophronis, M. neurolyticum, M. opalescens, M. orale, M. ovipneumoniae, M. ovis, M. oxoniensis, M. penetrans, M. phocicerebrale, M. phocidae, M. phocirhinis, M. pirum, M. pneumoniae, M. primatum, M. pullorum, M. pulmonis, M. putrefaciens, M. salivarium, M. simbae, M. spermatophilum, M. spumans, M. sturni, M. sualvi, M. subdolum, M. suis, M. synoviae, M. testudineum, M. testudinis, M. tullyi, M. verecundum, M. wenyonii, M. yeatsii, and M. coccoides. When the term Mycoplasma is used herein, it includes the following non-limiting list of candidate species: Moeniiplasma glomeromycotorum, M. aoti, M.M. corallicola, M. erythrocervae, M. girerdii, M. haematoparvum, M. haemobos, M. haemocervae, M. haemodidelphidis, M. haemohominis, M. haemolamae, M. haemomacaque, M. haemomeles, M. haemominutum, M. haemomuris subsp. musculi, M. haemomuris subsp. ratti, M. haemovis, M. haemozalophi, M. kahaneii, M. ravipulmonis, M. struthiolus, M. turicensis, M. haemotarandirangiferis, M. preputii, and others, e.g., M. insons, M. sphenisci, M. vulturis, and M. zalophi, M.(zalophi). Further, the term Mycoplasma further includes any strain or species of Mycoplasma generated by gene synthesis or chemical synthesis, or any kind of rational design and / or rearrangement of the genomic sequences of naturally occurring Mycoplasma. Thus, this term also includes strains and species of Mycoplasma that are referred to in the art as "synthetic Mycoplasma", or "Mycoplasma laboratorium", "Mycoplasma synthia", or more simply "Synthia" (Gibson et al., Creation of a bacterial cell controlled by a chemically synthesized genome, Science, 2010). Thus, in certain embodiments described throughout this specification, the Mycoplasma species that are the subject of the present invention have, as their genomic sequence, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% overall sequence identity to the genomic sequence of naturally occurring Mycoplasma bacteria.
[0063] Preferred Mycoplasma bacteria in the context of the present invention include Mycoplasma selected from the group consisting of M. pneumoniae, M. genitalium, M. hyorhinis, M. bovis, M. agalactiae, M. gallisepticum, and M. feriruminatoris.
[0064] Throughout the present disclosure, "reference Mycoplasma bacteria" are referred to. Those skilled in the art will readily recognize that in the context of the present invention, such references and their synonyms are intended to designate the same Mycoplasma bacteria as the genetically modified Mycoplasma bacteria described in the relevant embodiments, which are the same as or considered the same by those skilled in the art as the described Mycoplasma bacteria, provided that the reference Mycoplasma bacteria do not include the specific genomic modifications described herein. Thus, it is further apparent that suitable reference Mycoplasma bacteria are of the same species as the genetically modified bacteria. For example, isolated (non-genetically modified) M. pneumoniae is considered a suitable reference bacterium for the genetically modified M. pneumoniae bacteria according to the present invention; isolated (non-genetically modified) M. bovis bacteria are suitable reference bacteria for the genetically modified M. bovis bacteria according to the present invention; isolated (non-genetically modified) M. genitalium bacteria are suitable reference bacteria for the genetically modified M. genitalium bacteria according to the present invention. Such reference bacteria can be subcultures of Mycoplasma cultures isolated from actual cultures that serve as the starting population for the genomic manipulation process. Alternatively, suitable reference Mycoplasma bacteria can be obtained from commercial providers such as the American Tissue Culture Collection (ATCC). In particular, in the context of M. pneumoniae, the preferred reference M. pneumoniae strain is the ATCC M129-B7 strain (ATCC identifier 29342).
[0065] Methods and tools for verifying sequence homology or sequence identity between different sequences of amino acids or nucleic acids are known to those skilled in the art, and non-limiting tools such as Protein BLAST, ClustalW2, SIM alignment tool, TranslatorX, and T-Coffee can be mentioned. The percentage of identity between two sequences may show slight variations depending on the algorithm selection and parameters. The term "sequence identity" refers to the relationship between sequences at the nucleotide (or amino acid) level. The expression "% identical" is determined by comparing sequences (e.g., two or more sequences) optimally aligned over the entire comparison window, and portions of the sequences within this comparison window may include insertions or deletions when compared to a reference sequence for the optimal alignment of this sequence. This reference sequence does not include insertions or deletions. A reference window is selected, and then the number of nucleotides (or amino acids) that are identical between the sequences within this window is determined. The "%" identity is calculated by dividing the number of identical nucleotides (or amino acids) by the number of nucleotides (or amino acids) within this window and multiplying by 100. Unless otherwise indicated, sequence identity is calculated over the entire length of the reference sequence.
[0066] The Mycoplasma genes of interest are referred to throughout this specification by their MPN (M. pneumoniae) numbers. Those skilled in the art will recognize that this MPN nomenclature is the standard method of gene annotation in the art, and that gene and / or protein names can be readily derived from publicly available sources such as the M. pneumoniae database at http: / / mympn.crg.eu / essentiality.php or (academic) publications (e.g., but not limited to, Lluch-Senar et al., Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium, Molecular Systems Biology, 2015). It is clear that the MPN numbers are intended to cover Mycoplasma genes from a variety of strains, such as the non-limiting exemplary strains shown above. Although the preferred method for identifying the location of genomic perturbations targeted throughout this disclosure is by reference to the MPNs described above, it will be apparent to those skilled in the art that alternative annotations and classifications can be used to identify the same or substantially the same genes. For example, a further non-limiting system commonly used to annotate a particular gene product is the IUBMB enzyme nomenclature. By way of illustration and not limitation, MPN483 is classified as an enzyme corresponding to IUBMB EC 2.4.1.47 because MPN483 can be considered a glycosyltransferase. Similarly, MPN257 is classified as an enzyme corresponding to IUBMB EC 5.1.3.2 because MPN257 can be considered an epimerase. References and tools for associating a particular enzyme activity with a particular IUBMB EC number are readily available in the art (e.g., McDonald et al., ExplorEnz: the primary source of the IUBMB enzyme list, Nucleic Acids Research, 2009).Accordingly, when referring to a particular MPN number in this specification, such reference also encompasses the corresponding enzymes of Mycoplasma bacteria of homologous molecular species classified by the same IUBMB EC number. Furthermore, it is clear that Mycoplasma bacteria that do not contain the MPN gene itself are also contemplated. In this embodiment, functional modifications of equivalent genes of said species are contemplated.
[0067] In addition, means and methods for expressing proteins, means and methods for inhibiting protein expression, construction of suitable expression vectors, and methods for contributing to the establishment of any biological framework containing cells that mediate the expression of one or more genes encoded in such expression vectors, many additional techniques routinely used in molecular biology are known to those skilled in the art and are described in the art on many occasions (e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th Ed., Cold Spring Harbor Laboratory Press, 2012). Methods for transforming Mycoplasma bacteria, although a genus of bacteria that has historically been more difficult to transform, are also described in the art (Minion and Kapke, Transformation of Mycoplasmas, Mycoplasma protocols, 1998).
[0068] Methods and protocols for introducing nucleotide sequences into bacteria (i.e., methods of bacterial transformation) are known to those skilled in the art (Johnston et al., Bacterial transformation: distribution, shared mechanisms and divergent control, Nature reviews Microbiology, 2014). The term "transformation" refers to the genetic change in a cell that results from the direct uptake and incorporation of foreign genetic material. Transformation is a horizontal gene transfer process and is commonly used in the context of introducing foreign DNA into bacterial, yeast, plant, animal, or human cells. Cells capable of taking up foreign DNA are called competent cells. While the term "transfection" is more common for these cells, in other embodiments, transformation can refer to the insertion of new genetic material into animal and human cells.
[0069] Non-limiting examples of suitable transformation methods applicable to bacteria include heat shock transformation and electroporation. In heat shock transformation, typically, artificial competence is induced by making the cells permeable to DNA by exposing them to non-physiological conditions. In such typical transformation experiments, the cells are incubated in a solution containing divalent cations, often under cold conditions, and then the cells are exposed to heat shock. There is a theory that the exposure of the cells to divalent cations weakens the structure of the cell surface, making the DNA (more) permeable. This heat shock causes a thermal imbalance across the membrane, forcing the entry of DNA through the pores of the cell (i.e., the attachment zones or Bayer junctions) or the damaged cell wall. An alternative method for inducing transformation is by electroporation, in which a hypothesis has been put forward that pores are created in the cell membrane. In electroporation, bacterial cells are exposed to an electric field of 10 - 20 kv / cm for a short period. After the shock, the pores are removed by the cell membrane repair mechanism.
[0070] Unless otherwise specified, as used herein, references to any peptide, polypeptide, protein, or nucleic acid, or fragments thereof, also generally include modified forms of said peptide, polypeptide, protein, or nucleic acid, or fragments thereof (e.g., those having post-expression modifications including the non-limiting examples below): phosphorylation, glycosylation, lipidation, methylation, cysteinylation, sulfonation, glutathionylation, acetylation, oxidation of methionine to methionine sulfoxide or methionine sulfone, combinations thereof.
[0071] The term "attenuated", as described herein, may be used interchangeably with terms such as "weakened" and "diminished". The term "attenuated strain" is commonly used in the art and refers to a weakened disease agent (i.e., an attenuated pathogen). An attenuated bacterium is a bacterium that is weakened, less active, and less pathogenic compared to its conventionally existing counterpart. Multiple types of vaccines against various diseases are based on the inclusion of attenuated strains of bacteria or viruses that can still induce an immune response to produce immunity but do not cause disease. The attenuated Mycoplasma bacteria according to embodiments of the present invention represent genetically modified Mycoplasma bacteria in which the expression of a gene whose gene product is responsible for a certain degree of pathogenicity or toxicity is modified to reduce or abolish the adverse effects of said gene on or in an infection target.
[0072] Ca 2+Certain Mycoplasma (pneumoniae) genes, such as the dependent cytotoxic nuclease gene (MPN133) and the ADP-ribosyltransferase CARDS gene (MPN372), have been described in the art as being involved in the toxins of one or more Mycoplasma strains. Thus, genetically modified Mycoplasma bacteria may contain functional modifications in the MPN133 gene and / or operon. This genetically modified Mycoplasma bacteria may contain deletions, substitutions, and / or insertions of one or more nucleotides in the MPN133 gene and / or operon. Alternatively, genetically modified Mycoplasma bacteria may contain functional modifications in the MPN372 gene and / or operon. This genetically modified Mycoplasma bacteria may contain deletions, substitutions, and / or insertions of one or more nucleotides in the MPN372 gene and / or operon. However, the inventors have observed an unexpected synergistic effect when both genes are disrupted (i.e., when generating a single Mycoplasma strain containing mutations in at least MPN133 and MPN372), and have confirmed that, as observed by the inventors, the in vivo survival rate of the resulting Mycoplasma bacteria is maintained.
[0073] Accordingly, a first aspect of the present invention is a genetically modified Mycoplasma bacterium, which contains a functional modification in an operon encoding a Ca2+-dependent cytotoxic nuclease gene (MPN133) and an ADP-ribosyltransferase CARDS gene (MPN372) in its genome, and the functional modification attenuates the Mycoplasma bacterium, that is, reduces the pathogenicity and / or immunogenicity of the Mycoplasma bacterium as compared with a reference Mycoplasma bacterium, and the reference Mycoplasma bacterium has the same genomic sequence, provided that the reference Mycoplasma bacterium does not contain deletions, substitutions, and / or insertions in one or more nucleotides of the operon. The present invention is directed to the genetically modified Mycoplasma bacterium. In an alternative and complementary aspect, the present invention is a genetically modified Mycoplasma bacterium, which contains deletions, substitutions, and / or insertions of one or more nucleotides in an operon encoding a Ca2+-dependent cytotoxic nuclease gene (MPN133) and an ADP-ribosyltransferase CARDS gene (MPN372) in its genome, which reduce the pathogenicity and / or immunogenicity of the Mycoplasma bacterium as compared with a reference Mycoplasma bacterium, and the reference Mycoplasma bacterium has the same genomic sequence, provided that the reference Mycoplasma bacterium does not contain deletions, substitutions, and / or insertions in one or more nucleotides of the operon. The present invention is directed to the genetically modified Mycoplasma bacterium. In certain embodiments of the above aspect, due to the functional modification, the expression level of MPN133 and / or MPN372 is reduced by 50%, preferably 60%, preferably 75%, preferably 90%, preferably 95%, preferably 100%. In certain embodiments, the expression of MPN133 and / or MPN372 has disappeared due to this functional modification.Accordingly, genetically modified Mycoplasma bacteria that do not transcribe and / or translate the MPN133 and / or MPN372 genes may be contemplated.
[0074] When the terms "functional modification" or "functional mutation" are used interchangeably herein, they refer to any kind of nucleotide mutation that functionally modifies the resulting sequence or its gene product. Thus, a functional modification encompasses any insertion, deletion, or substitution of one or more nucleotides at one or more defined genomic positions. In other words, a functional modification can be any of a deletion, insertion, and / or substitution, or can be caused by a deletion, insertion, and / or substitution. Thus, in the context of a functional modification, the words "e.g., a deletion, insertion, and / or substitution" can be used interchangeably with "caused by a deletion, insertion, and / or substitution". It will be apparent to those skilled in the art that such functional modifications are caused by one or more deletions, insertions, and / or substitutions. The defined genomic positions can be annotated by designation of a gene or an operon containing the gene. Alternatively, the genomic positions of the functional modifications can be indicated by any other suitable annotation means (e.g., but not limited to, the IUBMB enzyme nomenclature). Those skilled in the art will recognize that any of these modifications, or combinations of modifications, are contemplated herein. Preferred functional modifications in a gene or operon are modifications that inactivate the gene (i.e., an inactivating mutation) and / or substitutions (i.e., gene substitution, or substitution of a functional gene fragment), and further modifications that substitute a complete operon. More specific non-limiting examples of modifications are insertions or deletions that induce a frameshift in the reading frame of a gene, or insertions or deletions that disrupt or remove a start codon or a Shine-Dalgarno sequence from a gene or an operably linked operon. The Shine-Dalgarno sequence, and methods for detecting it, are described in detail in the art (in particular, as described in Godbey, An introduction to biotechnology; the science, technology and medical applications, 2015). A frameshift mutation is caused, for example, by the insertion or deletion of any non-multiple-of-"3" or non-equal-to-"0" integer number of nucleotides.
[0075] In certain embodiments where the functional modifications such as deletions, insertions, and / or substitutions are not considered essential for the survival and / or growth of Mycoplasma bacteria, one of ordinary skill in the art will recognize that gene excision of the original gene or operon is contemplated in the context of the present invention. In alternative embodiments where the functional modifications such as deletions, insertions, and / or substitutions are introduced into essential genes, the essential gene or operon can be partially or completely replaced with an alternative gene or a fragment of a gene that contains the same or a similar function. Preferably, the alternative gene or fragment of a gene has the same or a similar function in or against Mycoplasma bacteria, but is less harmful to the host organism infected with Mycoplasma bacteria. A number of functional modifications such as deletions, insertions, and / or substitutions can be considered combinations of the mutations described above, and thus it will be apparent to one of ordinary skill in the art that they are included in what is disclosed herein. Further contemplated modifications are inversions or partial inversions of sequences that occur in the genome of Mycoplasma bacteria prior to the start of the process used to introduce one or more functional modifications. In certain embodiments, the functional modifications such as deletions, insertions, and / or substitutions can include the insertion of a coding or non-coding barcode into one or more genes or operons that are useful for identifying, detecting, or verifying the modified Mycoplasma bacteria, or screening a population of Mycoplasma bacteria that are subjected to a process that can be used to introduce one or more functional modifications such as deletions, insertions, and / or substitutions to identify the Mycoplasma bacteria that are precisely modified or potentially modified in the desired form. In certain embodiments, the inserted or substituted nucleotides encode one or more selectable markers.
[0076] "Selectable marker", "selectable marker", or "phenotypic marker", as used herein, refers to a gene that confers a trait suitable for artificial selection by one of ordinary skill in the art. Commonly used selectable markers are prokaryotic or eukaryotic antibiotic resistance genes (including, but not limited to, ampicillin, chloramphenicol, tetracycline, kanamycin, blasticidin, neomycin, or puromycin). Alternatively, fluorescent markers such as (modified) GFP, YFP, CFP, or mCherry are contemplated. One of ordinary skill in the art will recognize that combinations of selectable markers within a single modified Mycoplasma bacterium, and even within a single genetically modified locus, are also contemplated.
[0077] In alternative embodiments, the expression level of one or more genes is altered by functional modifications such as deletions, insertions, and / or substitutions. In further embodiments, the expression level of one or more genes is downregulated by 1.5-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more than 10-fold by said functional modifications. In certain embodiments, the expression level of a target gene or operon is conditionally altered by functional modifications such as deletions, insertions, and / or substitutions, i.e., it is altered when one or more criteria are met. For example, in an exemplary embodiment, a compound is engineered to be dependent on the expression level of one or more genes by functional modifications such as deletions, insertions, and / or substitutions. In certain embodiments, the target gene or operon comprises an inducible promoter (preferably a Tet-on or Tet-off promoter), and transcription of this target gene or operon is subject to transcriptional activation controlled by tetracycline. Inducible promoters and expression systems, as well as suitable tetracycline derivatives, are described (in particular, as described in Krueger et al., Tetracycline derivatives: alternative effectors for Tet transregulators, BioTechniques, 2018). In certain embodiments where a nucleotide is inserted or substituted, the newly introduced nucleotide is an artificial nucleotide generally known in the art as a xeno nucleic acid (XNA) (Pinheiro and Holliger, Towards XNA biotechnology: new materials from synthetic genetic polymers, Trends in biotechnology, 2014). In certain embodiments, the functional modifications such as deletions, insertions, and / or substitutions are present in a regulatory sequence or include the introduction or removal of a regulatory sequence.
[0078] "Operon", as used herein, refers to a functional unit of DNA that includes a population of genes where all genes are controlled by a single promoter. It will be apparent to those skilled in the art that genes from an operon are co-transcribed. The genes transcribed from an operon can be transcribed into a single mRNA strand and translated together in the cytoplasm, or spliced to produce monocistronic mRNA, which can be translated separately. Those skilled in the art understand that multiple genetic elements within an operon are operably linked. The term "operably linked" refers to multiple genetic elements that are linked as part of the same nucleic acid molecule and are appropriately positioned and oriented such that transcription is initiated from a promoter. DNA that is operably linked to a promoter is under the transcriptional initiation control of the promoter or is functionally combined with it.
[0079] As used herein, the term "promoter" refers to the region of DNA that initiates transcription of a particular gene, and thus enables the gene to be translated. The promoter is recognized by RNA polymerase, and transcription is then initiated. Thus, the promoter contains a DNA sequence that binds directly to RNA polymerase or is involved in the recruitment of RNA polymerase. The promoter sequence may also include one or more regions of DNA (i.e., enhancer regions) that can bind to proteins (i.e., trans-acting factors) to increase the transcription level of genes in a gene population. Enhancers (typically present at the 5' end of the coding region) can also be separated from the promoter sequence and can be present, for example, within the intron region of a gene or 3' to the coding region of a gene. The promoter can be located in the vicinity of the start codon of the gene and, in a preferred embodiment, can be located on the same strand and typically upstream (5') of the gene. Promoters can vary in size and are preferably about 100 to 1000 nucleotides in length. In certain embodiments, the promoter can be a constitutive promoter. A constitutive promoter is understood by those skilled in the art to be a promoter that has a constant expression under standard culture conditions, i.e., a promoter that expresses a gene product at a constant expression level. In alternative embodiments, the promoter can be an inducible (conditional) promoter.
[0080] In certain embodiments, the genetically modified Mycoplasma bacteria described herein include functional modifications such as deletions, insertions, and / or substitutions in at least one gene or operon containing a gene selected from the group consisting of Table 1. Therefore, the modified Mycoplasma bacteria described herein may include functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and at least one additional gene or operon selected from the group consisting of Table 1, preferably at least two additional genes or operons, preferably at least four additional genes or operons, preferably at least five additional genes or operons, preferably at least six additional genes or operons.
[0081]
Table 1
[0082]
Table 2
[0083]
Table 3
[0084]
Table 4
[0085]
Table 5
[0086]
Table 6
[0087] The modified Mycoplasma bacteria described herein may contain functional modifications such as deletions, insertions, and / or substitutions in at least one gene or operon that includes MPN133, MPN372, and genes classified in the art as genes involved in contributing to pathogenicity (i.e., pathogenicity genes). In certain embodiments, the modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in at least one gene, preferably at least two genes, preferably at least three genes, preferably at least four genes, preferably at least five genes, preferably at least six genes, that include MPN133, MPN372, and at least one gene known to be involved in Mycoplasma (pneumoniae) pathogenicity. Mycoplasma pathogenicity genes have been described in the art by Lluch-Senar et al. (Comparative "-omics" in Mycoplasma pneumoniae Clinical Isolates Reveals Key Virulence Factors, PLOS one, 2015). In further embodiments, the recombinant Mycoplasma bacteria typically contain a modified locus encoding a Ca 2+ -dependent cytotoxic nuclease, and this modified locus contains genetic elements that allow for efficient insertion of foreign genes.
[0088] In certain embodiments, the genetically modified Mycoplasma bacteria described herein include functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding a peroxide-producing protein, preferably in a gene encoding glycerol 3-phosphate oxidase. In certain embodiments, this peroxide-producing protein is glycerol 3-phosphate dehydrogenase (MPN051). In certain embodiments, this modified Mycoplasma bacteria includes functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN051. In alternative embodiments, this modified Mycoplasma bacteria includes functional modifications such as deletions, insertions, and / or substitutions in MPN051. In certain aspects where the modified Mycoplasma bacteria includes functional modifications such as deletions, insertions, and / or substitutions in MPN051, the MPN051 gene or operon may be replaced, or at least partially replaced, with a genetic element encoding a glyceraldehyde dehydrogenase (e.g., the gpsA enzyme or a functional fragment thereof) capable of producing DHAP from G3P without producing peroxide. In a preferred embodiment, gpsA is the Mycoplasma penetrans gpsA protein characterized by Uniprot entry Q8EWH5. In further additional aspects, it is contemplated that the genetically modified Mycoplasma bacteria includes functional modifications such as deletions, insertions, and / or substitutions that result in truncation of the MPN051 gene product.
[0089] "Peroxide-producing protein", as used herein, refers to any protein that is directly or indirectly involved in the production of peroxide in Mycoplasma. For example, it has been disclosed in the art that M. pneumoniae attaches to the surface of ciliated airway cells and forms colonies. During this process, the bacterium produces a large amount of hydrogen peroxide as a product of glycerol metabolism, and this hydrogen peroxide plays an important role in the cytotoxicity of host cells (Schmidl et al., A trigger enzyme in Mycoplasma pneumoniae: impact of the glycerophosphodiesterase GlpQ on virulence and gene expression, PLOS Pathogens, 2011). Those skilled in the art recognize that the production of peroxide is an undesirable characteristic of Mycoplasma and that it is attenuated and / or less toxic when introduced into a host organism. Accordingly, genetically modified Mycoplasma bacteria may contain functional modifications in a nuclease gene or an operon encoding a nuclease gene, and a gene or operon encoding a toxin, and a gene or operon encoding a protein involved in peroxide production.
[0090] In certain embodiments, the genetically modified Mycoplasma described herein contains functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding a second nuclease gene. In certain embodiments, the functional modifications such as deletions, insertions, and / or substitutions are present in the surface nuclease gene. In further embodiments, the further functional modifications such as deletions, insertions, and / or substitutions are the membrane nuclease A (MPN491). Accordingly, the genetically modified Mycoplasma bacteria may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN491.
[0091] The term "nuclease" (also known as "nucleodepolymerase" and "polynucleotidase"), as used herein, refers to a group of enzymes (i.e., molecular scissors) that effect cleavage of the phosphodiester bonds between nucleotides of nucleic acids. Nuclease capable of inducing single-strand and double-strand breaks are both described in the art. It is known that there is a great diversity among various nucleases in terms of structure and function. A nuclease can be an endonuclease that produces oligonucleotides as a result of its activity, or an exonuclease that has single nucleotides as cleavage products.
[0092] In certain embodiments, the genetically modified Mycoplasma described herein includes functional modifications such as deletions, insertions, and / or substitutions in one or more genes or operons encoding cell adhesion proteins. In preferred embodiments, the gene or operon encoding the cell adhesion gene is selected from the group consisting of MPN141, MPN142, MPN453, MPN447, MPN310, MPN452, MPN309. In certain embodiments, this modified Mycoplasma bacterium includes functional modifications such as deletions, insertions, and / or substitutions in the genes or operons of MPN133 and MPN372, and in one or more genes or operons selected from the group consisting of MPN141, MPN142, MPN453, MPN447, MPN310, MPN452, MPN309. In certain embodiments, this modified Mycoplasma bacterium has functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN142. In certain aspects, the modified Mycoplasma bacterium may include functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, MPN051, and MPN142. In certain aspects, the genetically modified Mycoplasma bacterium may include functional modifications such as deletions, insertions, and / or substitutions in MPN453. In further embodiments, the genetically modified Mycoplasma bacterium may include functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, MPN453, and optionally in MPN051. In further aspects, the genetically modified Mycoplasma bacterium may include functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN453, and MPN453.
[0093] As used herein, the term "cell adhesion" in the context of cell adhesion proteins refers to any protein that contributes to or aids in the adhesion of Mycoplasma to the tissues of a host organism. For example, in the case of Mycoplasma pneumoniae being contemplated, a cell adhesion protein within the context defined herein is any protein that contributes to or aids in the adhesion of M. pneumoniae to the respiratory epithelium of a host organism (preferably to sialoglycoproteins and / or sulfated glycolipids of epithelial cells). Preferably, this adhesion is caused by specialized organelles that include adhesins and accessory proteins as described in the art (Shimizu, Inflammation-inducing factors of Mycoplasma pneumoniae, Frontiers in microbiology, 2016). In certain embodiments, a genetically modified Mycoplasma bacterium that contains a functional modification in a gene or operon encoding a protein involved in cell adhesion is characterized by improved growth in a biomanufacturing vessel such as, by way of non-limiting example, a fermenter. In further embodiments, this genetically modified Mycoplasma bacterium is characterized by the ability to grow in suspension.
[0094] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in one or more genes encoding immunogenic proteins capable of inducing an immune response in a host organism. In further embodiments, this immunogenic protein is the conserved hypothetical protein MPN400. Thus, this modified Mycoplasma bacteria may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN400. Alternatively, this modified Mycoplasma bacteria may contain functional modifications in MPN133, MPN372, MPN400, and MPN051. Alternatively, this genetically modified Mycoplasma bacteria may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, MPN294, and MPN400. Also contemplated are genetically modified Mycoplasma bacteria containing functional modifications such as deletions, insertions, and / or substitutions in MPN372 and MPN294.
[0095] As used in the context of this specification, an immune reaction is a reaction that occurs in vivo by a host organism that has been exposed to a foreign organism for the purpose of combating the foreign invading organism. In certain prior art documents, an immune reaction is generally described as repelling or inhibiting the growth or survival of a foreign organism in a host organism. Alternatively, it is known in the art that the purpose of an immune reaction is to protect the host organism from the invading organism. One of ordinary skill in the art generally understands that an immune reaction leads to an improvement in the health of the infected organism. However, in certain cases, this improvement in the health status of the infected organism is characterized by a prior temporary decline in the health of the infected organism. The inventors contemplate both genes encoding gene products that can elicit a innate immune reaction and genes encoding gene products that can elicit an adaptive immune reaction. It will be apparent to one of ordinary skill in the art that an "immune reaction" can be the result of a reaction of a host organism to one or more distinct immunogenic factors. Examples of immunogenic proteins are proteins expressed on the surface of a pathogen, proteins released by a pathogen, or metabolites of foreign proteins.
[0096] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in a gene or operon that encodes a protein that contributes to or causes the development of an autoimmune disease in a host organism. In further embodiments, this autoimmune disease is an autoimmune neuropathy. In further embodiments, this autoimmune disease is Guillain-Barré syndrome, which is presumed to be caused by monogalactosylceramide. However, studies by the inventors have demonstrated that the patient antibodies actually recognize mainly dihexosylceramide and not monogalactosylceramide. This finding is important when aiming to develop Mycoplasma bacteria that have a minimal likelihood of causing Guillain-Barré syndrome in patients or even no possibility of leading to Guillain-Barré syndrome in any patient. Thus, in certain aspects, the genetically modified Mycoplasma bacteria may contain functional modifications such as deletions, insertions, and / or substitutions in MPN257, which encodes UDP-glucose 4-epimerase. In other aspects, the genetically modified Mycoplasma bacteria may contain functional modifications such as deletions, insertions, and / or substitutions in MPN483, which encodes a processive UDP-glycosyltransferase. In further aspects, the genetically modified Mycoplasma described herein may contain functional modifications such as deletions, insertions, and / or substitutions in both MPN257 and MPN483. In further aspects, the genetically modified Mycoplasma may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133 and / or MPN372, in addition to the functional modifications such as deletions, insertions, and / or substitutions in MPN257 and / or MPN483, and further optionally may also contain functional modifications such as deletions, insertions, and / or substitutions in MPN051.In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications in MPN257 and / or MPN483, and further contain functional modifications such as deletions, insertions, and / or substitutions in at least 1 gene selected from the group consisting of Table 1, preferably at least 2 genes, preferably at least 4 genes, preferably at least 5 genes, preferably at least 6 genes, preferably at least 3 genes. In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in MPN257 and / or MPN483, and further contain such functional modifications in MPN051 as well as in at least 1 gene selected from the group consisting of Table 1, preferably at least 2 genes, preferably at least 4 genes, preferably at least 5 genes, preferably at least 6 genes, preferably at least 3 genes.
[0097] "Guillain-Barre syndrome", as indicated herein, refers to an autoimmune disease that affects the peripheral nervous system. Guillain-Barre syndrome is characterized in the art as a rapidly developing polyradiculoneuropathy typically associated with sensory symptoms and weakness that often leads to quadriplegia (Donofrio, Guillain-Barre syndrome, Continuum: lifelong learning in neurology, 2017). Features during neurological examination are decreased muscle strength and decreased or absent tendon reflexes (hyporeflexia or areflexia, respectively). However, some patients may show normal reflexes in the affected limb prior to the onset of areflexia, and in some cases the reflexes may be exaggerated. Some of the patients further develop weakness of the respiratory muscles leading to respiratory failure, which can be detrimental to patients with additional medical conditions including, but not limited to, pneumonia. In addition, some of the patients exhibit a disrupted autonomic nervous system. A preceding respiratory infection by M. pneumoniae has been reported in some cases, but the role of M. pneumoniae in the etiology of GBS remains unclear. M. pneumoniae infection is associated with GBS, is more frequent in children than in adults, induces antibodies against galactocerebroside (GalC), and among these antibodies, in particular, anti-GalC IgG may contribute to the etiology of GBS. Until the present study conducted by the present inventors, this antibody was hypothesized to mainly recognize monogalactosylceramide. However, the present inventors have obtained compelling evidence that this antibody actually recognizes dihexose-ceramide. Antibodies against GalC associated with evidence of M. pneumoniae infection are also associated with encephalitis and other neurological disorders. Accordingly, a further object of the present invention is to develop and characterize a Mycoplasma (pneumoniae) strain with a reduced risk of inducing Guillain-Barre syndrome in a subject after administration of the bacterium.
[0098] For those skilled in the art, when the deletion of MPN257 prevents the formation of galactosylceramide and galactosyldiacylglycerol, and the deletion of MPN483 prevents the other two glycosyltransferases (MOPN028 and MPN075) from catalyzing these reactions, the formation of monohexose-ceramide and monohexose diacylglycerol is prevented; if these are possible, the formation of dihexose-ceramide and dihexose diacylglycerol is prevented (MPn483 is a progressive glycosyltransferase). Therefore, if dihexose ceramide containing galactose is the cause of autoimmunity, the deletion of MPN257 and / or MPN483 eliminates the possibility that M. pneumoniae induces autoimmunity and causes Guillain-Barré syndrome.
[0099] However, single or double knockout of MPN483 in M. pneumoniae strains adversely affects the growth of said M. pneumoniae. Without wishing to be bound by theory, this observation may be due to the accumulation of toxic ceramides in M. pneumoniae. Thus, in certain embodiments, genetically modified Mycoplasma bacteria contain functional modifications such as deletions, insertions, and / or substitutions in either MPN483, or both MPN483 and MPN257. In certain embodiments, said Mycoplasma bacteria may contain an exogenous gene sequence or operon encoding gene products from one or more different Mycoplasma species that can partially or completely negate the reduced growth rate of the above-described MPN483 and / or MPN257 knockouts while preventing the formation of galatosylceramide or galatosyldiacylglycerol. By way of example, suitable exogenous genes that can (partially) reverse the consequences of inactivation or deletion of MPN483 include, but are not limited to, glycosyltransferases from homologous molecular species Mycoplasma species such as: M. genitalium MG_517 (a homolog of MPN4893 that preferentially uses UDP-glucose over UDP-galactose), M. agalactiae MAGA_RS00300 (a homolog of MPN483 in Mycoplasma agalactiae that does not contain a homolog of MPN257 and thus does not produce UDP-galactose), B. subtilis utgP (a processive glycosyltransferase that uses only UDP-glucose), or any combination thereof. Unexpectedly, the inventors have demonstrated that MG_517, MAGA_RS00300, and to a lesser extent utgP, can alleviate the suboptimal growth rate of M. pneumoniae strains lacking a functional MPN483 gene.The decrease in growth rate is more evident in the mutant strain lacking functional MPN483 compared to the mutant lacking functional MPN257. Thus, the preferred genetically modified Mycoplasma bacteria are M. pneumoniae bacteria that do not contain either the functional MPN483 gene or the MPN257 gene, and the enzymatic activity of MPN483 is partially or completely replaced by the insertion of MG_517, MAGA_RS00300, and / or utgP, M. pneumoniae bacteria.
[0100] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding a protein that inhibits the growth of said bacteria in a bioreactor. Thus, said functional modifications such as deletions, insertions, and / or substitutions can improve the growth of the genetically modified Mycoplasma in the bioreactor. In a further embodiment, this gene or operon encodes the chaperone protein YajL (MPN294). In certain embodiments, this modified Mycoplasma bacterium contains functional modifications such as deletions, insertions, and / or substitutions in MPN372 and MPN294. In a further embodiment, this modified Mycoplasma bacterium contains functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN294, and optionally contains functional modifications such as deletions, insertions, and / or substitutions in MPN051. In certain embodiments, the growth rate of said modified bacteria in the bioreactor is increased by the introduction of one or more functional modifications such as deletions, insertions, and / or substitutions. In certain embodiments, one or more functional modifications such as deletions, insertions, and / or substitutions change the growth pattern of Mycoplasma bacteria from an adherent growth pattern to a suspension growth pattern. The modified Mycoplasma bacterium may contain one or functional modifications such as deletions, insertions, and / or substitutions that change the morphology of the Mycoplasma bacterium. In certain embodiments, the genetically modified Mycoplasma bacteria have a doubling time that is at least 20%, preferably at least 25%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 75% reduced (i.e., shorter) compared to Mycoplasma bacteria that do not contain the combination of said functional modified genes.Genetically modified Mycoplasma bacteria may, in certain embodiments, include one or more functional modifications such as deletions, insertions, and / or substitutions that decrease the doubling time of the modified bacteria only when certain nutrients are present in the culture medium or growth location. Those skilled in the art recognize that any comparative analysis between different strains should be performed under the same culture conditions. Genetically modified Mycoplasma bacteria may include functional modifications such as deletions, insertions, and / or substitutions in genetic elements (e.g., but not limited to MPN294) that allow for inducible control of gene expression.
[0101] The terms "doubling time" and "generation time" are standard terms in the art and refer to the time it takes for the number of bacteria to double during a specific period known as the generation time. The generation time varies between different organisms. Non-limiting examples of physical factors include pH, temperature, pressure, and water content. Nutritional factors include, for example, the amounts of carbon, nitrogen, sulfur, and phosphorus. When evaluating the doubling time of genetically modified bacteria in a host organism, it is clear that an equivalent host organism is required to evaluate the doubling time. Those skilled in the art recognize that numerous parameters (e.g., but not limited to, the immune status, age, weight, food intake, gender, etc. of the host organism) can affect the bacterial doubling time in the host organism. The fact that bacterial growth can be characterized by different phases is well described in the art, and within this, the log phase (or logarithmic or exponential phase) indicates the growth period during which the bacteria are doubling. If growth is not limited, doubling continues at a constant rate, and thus, both the number of cells and the rate of population increase repeat within a given period. The slope of this line indicates the growth rate of the organism.
[0102] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in one or more genes encoding lipoproteins. In further embodiments, the gene or operon encoding the lipoprotein is selected from the group consisting of MPN141, MPN142, MPN152, MPN162, MPN199, MPN200, MPN224, MPN233, MPN271, MPN284, MPN288, MPN293, MPN333, MPN372, MPN415, MPN447, MPN592, MPN597, MPN602, MPN611, MPN011, MPN052, MPN054, MPN058, MPN083, MPN084, MPN097, MPN098, MPN363, MPN369, MPN408, MPN411, MPN436, MPN439, MPN442, MPN444, MPN456, MPN467, MPN489, MPN506, MPN523, MPN582, MPN585, MPN586, MPN587, MPN588, MPN590, MPN591, MPN592, MPN639, MPN640, MPN641, MPN642, MPN643, MPN644, MPN645, MPN646, MPN647, MPN648, MPN649, MPN650, MPN654.In certain embodiments, this modified Mycoplasma bacterium contains functional modifications such as deletions, insertions, and / or substitutions in a lipoprotein-encoding gene or operon selected from the group consisting of MPN133, MPN372, and MPN141, MPN142, MPN152, MPN162, MPN199, MPN200, MPN224, MPN233, MPN271, MPN284, MPN288, MPN293, MPN333, MPN372, MPN415, MPN447, MPN592, MPN597, MPN602, MPN611, MPN011, MPN052, MPN054, MPN058, MPN083, MPN084, MPN097, MPN098, MPN363, MPN369, MPN408, MPN411, MPN436, MPN439, MPN442, MPN444, MPN456, MPN467, MPN489, MPN506, MPN523, MPN582, MPN585, MPN586, MPN587, MPN588, MPN590, MPN591, MPN592, MPN639, MPN640, MPN641, MPN642, MPN643, MPN644, MPN645, MPN646, MPN647, MPN648, MPN649, MPN650, MPN654, and optionally further contains functional modifications such as deletions, insertions, and / or substitutions in MPN051. In further embodiments, the genetically modified Mycoplasma bacterium described herein contains functional modifications such as deletions, insertions, and / or substitutions in the prolipoprotein diacylglyceryl transferase gene (MPN224) or operon, and / or in the lipoprotein peptide gene MPN293 or operon. This genetically modified Mycoplasma may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133 and / or MPN372 in addition to the functional modifications such as deletions, insertions, and / or substitutions in MPN224 and / or MPN293, and optionally the functional modifications such as deletions, insertions, and / or substitutions in MPN051.
[0103] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding an oncogenic protein. In further embodiments, such functional modifications such as deletions, insertions, and / or substitutions are contained in a gene or operon (MPN415) encoding the high-affinity transport system protein p37. In certain embodiments, the modified Mycoplasma bacteria contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN415, and optionally, in MPN051. In one aspect, the genetically modified Mycoplasma bacteria contemplated herein are Mycoplasma bacteria that contain functional modifications such as deletions, insertions, and / or substitutions in MPN415.
[0104] As used herein, the term "oncogenic protein" refers to any protein present in Mycoplasma bacteria that, when introduced into or expressed in a host organism (preferably a mammal), significantly increases the risk that the organism will develop cancer, characterized by increased and / or uncontrolled division of one or more cell types present in the host organism.
[0105] In certain embodiments, the genetically modified Mycoplasma bacteria described herein include functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding an RNA polymerase factor. In further embodiments, this gene or operon encodes a putative RNA polymerase sigma-D factor (MPN626). In certain embodiments, this modified Mycoplasma bacterium includes functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, MPN626, and optionally in MPN051. This genetically modified Mycoplasma bacterium may include functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding a protein involved in DNA replication. In one aspect, the genetically modified Mycoplasma bacterium contemplated herein is a modified Mycoplasma bacterium that includes functional modifications such as deletions, insertions, and / or substitutions in MPN626. In a further aspect, the genetically modified Mycoplasma bacterium described herein includes a modified locus that normally encodes an RNA polymerase sigma-D factor, and this modified locus includes genetic elements that enable efficient insertion of foreign genes.
[0106] In certain embodiments, the genetically modified Mycoplasma bacteria described herein contain functional modifications such as deletions, insertions, and / or substitutions in a gene or operon encoding a secreted Mycoplasma gene product (preferably, a secreted Mycoplasma protein). In further embodiments, the functional modifications such as deletions, insertions, and / or substitutions are present in a gene or an operon encoding a gene selected from the group consisting of MPN400, MPN036, MPN592, MPN509, MPN647, MPN084, MPN625, MPN213, MPN489, MPN142, MPN444, MPN642, MPN398, MPN491, MPN083, and MPN141. In further embodiments, this modified Mycoplasma bacterium contains functional modifications such as deletions, insertions, and / or substitutions in MPN133 and MPN372, and in one or more additional genes selected from the group consisting of MPN400, MPN036, MPN592, MPN509, MPN647, MPN084, MPN625, MPN213, MPN489, MPN142, MPN444, MPN642, MPN398, MPN491, MPN083, MPN141, and optionally contains functional modifications such as deletions, insertions, and / or substitutions in MPN051. This genetically modified Mycoplasma bacterium may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, and MPN400. Further, this genetically modified Mycoplasma bacterium may contain functional modifications such as deletions, insertions, and / or substitutions in MPN133, MPN372, MPN400, and MPN051.
[0107] As used herein, "secreted gene product" refers to any gene product secreted by a cell (in the context of this specification, a bacterial cell, preferably a Mycoplasma bacterium). It is clear that "secreted gene product" refers to (partially) degraded gene products such as metabolites in addition to full-length gene products such as proteins.
[0108] In certain embodiments, the degree of attenuation of the genetically modified Mycoplasma described herein is indicated by the reduction in the virulence of the Mycoplasma bacteria when introduced into a host organism as compared to a reference Mycoplasma bacterium, which is a naturally occurring (wild-type) Mycoplasma bacterium that does not contain genetic functional modifications such as deletions, insertions, and / or substitutions. A preferred reference Mycoplasma bacterium is M. pneumoniae M129-B7. In certain embodiments, this virulence is reduced by 10%, preferably 25%, preferably 50%, preferably 60%, preferably 70%, preferably 85%, preferably 90%, preferably 95% when introduced into a host organism. In certain embodiments, the reduction in virulence is shown by the modified Mycoplasma bacterium when introduced into the respiratory system (preferably the lungs) of the host product, as compared to the virulence of the wild-type Mycoplasma bacterium.
[0109] In certain aspects, genetically modified Mycoplasma bacteria are envisioned that contain deletions of one or more genomic regions containing one or more genes disclosed herein. By way of non-limiting illustration, the genetically modified Mycoplasma bacteria can contain deletions from MPN490 to, for example, optionally MPN505. Alternatively, by way of illustrative example, the genetically modified Mycoplasma bacteria can contain deletions from MPN490 to, for example, optionally MPN506.
[0110] In certain embodiments, the genetically modified Mycoplasma bacteria described herein are Mycoplasma pneumoniae bacteria. Transformation protocols specific to M. pneumoniae are disclosed in the art (Krishnakumar et al., Targeted chromosomal knockouts in Mycoplasma pneumoniae, Applied and environmental microbiology, 2010). In certain embodiments, the Mycoplasma pneumoniae bacteria contain one or more artificial genetic elements that facilitate genomic insertion of a nucleotide sequence encoding a gene capable of producing a foreign gene product. In further embodiments, the genetically modified Mycoplasma bacteria are Mycoplasma bacteria isolated from a subject diagnosed with or suspected of having pneumonia. In further embodiments, the Mycoplasma bacteria are isolated from the respiratory system (e.g., lungs or trachea) of the subject.
[0111] In certain embodiments, the genetically modified Mycoplasma bacteria described herein comprise a nucleotide sequence encoding an exogenous gene product or a functional fragment thereof. In preferred embodiments, the nucleotide sequence is contained within the genomic sequence of the Mycoplasma bacteria. This exogenous gene product may be codon-optimized for expression in Mycoplasma. This exogenous gene product may be controlled by a naturally occurring Mycoplasma promoter. Alternatively, the nucleotide sequence encoding the exogenous gene product or a functional fragment thereof is part of a non-genomically integrated expression vector. Non-limiting examples of expression vectors described in the art include: plasmids, optional non-replicating plasmids, phagemids, bacteriophages, bacteriophage-derived vectors, artificial chromosomes, minicircles, lentiviral vectors, retroviral vectors, adenoviral vectors or adeno-associated viral vectors, piggyback vectors, or tol2 vectors. Further, those skilled in the art will appreciate that plasmid DNA or recombinant DNA is generally referred to in the art as complementary DNA, and further as the abbreviation "cDNA". Thus, this nucleotide sequence may be part of a bicistronic or polycistronic expression construct. Optionally, the exogenous gene product is an artificially designed gene product. In certain embodiments, this exogenous gene product is a protein. In certain embodiments, the exogenous gene product is the original glycosyltransferase, or the original UDP-glucose epimerase, or a combination of glycosyltransferase and UDP-glucose epimerase, and / or a replacement thereof. For example, the MPN483 gene may be replaced with M. genitalium MG_517, M. agalactiae MAGA_RS00300, and / or B. subtilis UgtP.
[0112] As used herein, "gene product" refers to any molecule directly derived from a gene or a functional fragment of a gene. One of ordinary skill in the art will recognize that the term "gene product" can also refer to products derived from operons not naturally present in Mycoplasma bacteria, as indicated by the terms "heterologous gene product" or "exogenous gene product". Thus, the term can encompass any protein of biotechnological interest.
[0113] In certain embodiments, the gene product comprises one or more control sequences. As used interchangeably herein, "control sequence" or "regulatory sequence" refers to any nucleotide sequence capable of decreasing or increasing the expression of a particular gene. This control can be imposed by affecting the transcription rate, translation rate, or by altering the stability of the sequence. In further embodiments, the polynucleotide sequence comprises control elements including, but not limited to: enhancers, selectable markers, origins of replication, linker sequences, polyA sequences, terminator sequences, and degradation sequences. Non-limiting examples of particularly suitable control sequences can be naturally occurring Mycoplasma secretion signals or secretion signals that can be non-naturally occurring Mycoplasma sequences, the latter being described in detail in WO 2016 / 135281.
[0114] In certain embodiments, the genetically modified Mycoplasma bacteria described herein may include the insertion of one or more genes encoding a protein, wherein the protein is selected from the group consisting of Mycoplasma pulmonis Vsa (e.g., Vsa having Uniprot database entry entry Q50279), Mycoplasma penetrans GpsA (Uniprot database entry Q8EWH5), and Mycoplasma hypopneumoniae P97 (Uniprot database entry Q49542).
[0115] In a further embodiment, the exogenous gene product or a functional fragment thereof is a protein. In a preferred embodiment, the exogenous gene product is a therapeutic protein, a protein involved in specific attachment to a host protein, an enzyme, an immunogenic protein, or a DNA-binding protein. In a further embodiment, the therapeutic protein or immunogenic protein is expressed on the surface of the Mycoplasma bacterium and / or secreted by the Mycoplasma bacterium. The gene product encoded by the heterologous nucleotide can be any protein or peptide having an advantageous effect on the Mycoplasma bacterium, the infected host, or the environment. In certain embodiments, the exogenous gene product is a fusion protein. In certain embodiments where the exogenous genetic product or a functional fragment thereof is a fusion protein, the protein comprises a protease site between two or more functional fragments of the protein. It will be apparent to those skilled in the art that ligation of multiple nucleotide sequences encoding a particular protein and subsequent separation of multiple copies of the protein by a protease is a suitable but non-limiting method for increasing the amount of protein produced. In certain embodiments, the exogenous gene product or a functional fragment thereof binds to a protein expressed by the host organism. In a further embodiment, the exogenous gene product or a functional fragment thereof binds to a protein expressed by the host cell depending on a particular tissue and / or cell type. In a further embodiment, the exogenous gene product or a functional fragment thereof binds to a protein expressed by the host cell on the membrane of a particular cell type. In an alternative embodiment, the exogenous gene product or a functional fragment thereof binds to a protein expressed by a separate pathogenic or non-pathogenic organism present in the host cell. In a further embodiment, the exogenous gene product or a functional fragment thereof binds to a protein expressed by a separate pathogenic or non-pathogenic organism present in the respiratory tract of the host organism. In a further embodiment, the exogenous gene product or a functional fragment thereof is cytotoxic to the separate pathogenic or non-pathogenic organism present in the respiratory tract of the host organism.In further embodiments, the exogenous gene product or a functional fragment thereof inhibits the replication of the separate pathogenic or non-pathogenic organism present in the host organism. In certain embodiments, the exogenous gene product is a DNA-binding protein that specifically binds to a DNA sequence not present in the host organism. In further embodiments, the exogenous gene product or a functional fragment thereof is a designer nuclease.
[0116] The terms "therapeutic protein" or "therapeutic peptide" are considered clear to those skilled in the art, and those skilled in the art understand that a wide range of therapeutic proteins are described in the art. Therapeutic proteins can be classified into the following five major groups: (a) the group that replaces a protein that is lacking or abnormal; (b) the group that enhances existing pathways; (c) the group that provides new functions or activities; (d) the group that interferes with molecules or organisms; and (e) the group that delivers other compounds or proteins such as radionuclides, cytotoxic drugs, or effector proteins. Alternatively, therapeutic proteins can also be grouped based on molecular types including antibody-based drugs, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, engineered protein scaffolds, enzymes, growth factors, hormones, interferons, interleukins, and thrombolytic agents. Therapeutic proteins and therapeutic peptides can also be classified based on the following molecular mechanisms of action: (a) non-covalently binding to a target such as a monoclonal antibody; (b) affecting covalent bonds such as an enzyme; and (c) exerting activity without specific interactions (e.g., serum albumin). The separation described above and the contribution of each group to the state of the art are described in the scientific literature (Dimitrov, Therapeutic proteins, Methods in Molecular Biology, 2012). Non-limiting examples of classes of therapeutic proteins include cytokines, antibodies, nanobodies, (soluble) receptors, antibody-like protein scaffolds, and functional fragments thereof. Thus, in a further embodiment where the gene product is a protein, this gene product may further comprise a peptide or protein tag sequence encoded by a nucleotide. Non-limiting examples of commonly used peptide tag sequences are AviTag, C-tag, calmodulin-tag, polyglutamic acid tag, E-tag, Flag-tag, HA-tag, His-tag, Myc-tag, NE-tag, Rho1D4-tag, S-tag, SBP-tag, Softag 1, Softag 3, Spot-tag, Strep-tag, TC tag, Ty tag, V5 tag, VSV-tag, Xpress tag, isopeptag, SpyTag, SnoopTag, DogTag, and SdyTag.In a further embodiment, the gene product comprises a peptide or protein tag sequence encoded by at least two nucleotides.
[0117] In an alternative embodiment, the exogenous gene product or a functional fragment thereof is an oligonucleotide sequence. In a further embodiment, the exogenous gene product is an RNA molecule. In a further embodiment, the exogenous gene product or a functional fragment thereof is a ribozyme.
[0118] In certain embodiments, a genetically modified Mycoplasma bacterium comprises one or more exogenous gene products such as a protein. In certain embodiments, the protein is capable of interacting with a protein expressed by a separate bacterium present in the host organism. In a further embodiment, the separate bacterium present in the host organism is a pathogenic bacterium or is considered pathogenic in the art. In certain embodiments, the separate (pathogenic) bacterium is present in the lungs of the host organism. In a further embodiment, the protein capable of interacting with the separate bacterium in the host organism is expressed on the surface of the Mycoplasma bacterium. In an alternative embodiment, the protein capable of interacting with the separate bacterium in the host organism is secreted by the Mycoplasma bacterium.
[0119] In certain embodiments, the genetically modified Mycoplasma bacteria are obtained by introducing said functional modifications such as deletions, insertions, and / or substitutions into one or more genes of the Mycoplasma bacterial genome by recombinant DNA technology. In further embodiments, this recombinant DNA technology is a genome engineering method. In further embodiments, this genome engineering method is a recombinase and / or nuclease-based genome engineering method. In certain embodiments, the genetically modified Mycoplasma bacteria are obtained by template-mediated genome engineering by introducing said functional modifications such as deletions, insertions, and / or substitutions into one or two genes of the Mycoplasma bacteria. In further embodiments, this template-mediated genome engineering includes the steps of contacting the Mycoplasma bacterial genome with a nuclease and / or recombinase, and further providing an oligonucleotide sequence containing a homologous region adjacent to the desired genetic modification. In further embodiments, this oligonucleotide sequence is provided to the Mycoplasma bacteria simultaneously with the recombinase and / or nuclease. In certain embodiments, the genetically modified Mycoplasma bacteria are obtained by introducing said functional modifications such as deletions, insertions, and / or substitutions into one or more genes of the Mycoplasma bacterial genome by designer nucleases. In further embodiments, this designer nuclease specifically targets a gene encoding a target gene product or a regulatory gene sequence controlling the expression of this target gene product. A non-limiting example of a suitable recombinase is the Bacillus subtilis gp35 recombinase as defined herein.Non-limiting examples of suitable designer nucleases include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, restriction enzymes, and Clustered Regularly Interspace Short Palindromic Repeat (CRISPR). Methods for using designer nucleases and suitable constructs are described in detail in the art (Gaj et al., ZFN, TALEN, CRISPR / Cas-based methods for genome engineering, Trends in Biotechnology, 2013). In further embodiments, the genetically modified Mycoplasma bacteria described herein are obtained by a first step of incorporating the desired genomic alteration by gp35-mediated recombination, followed by a counter-selection step in which a designer nuclease targeting the wild-type (unmodified) sequence of the target locus is expressed or introduced into the Mycoplasma bacteria. In such embodiments, any cleavage of the targeted but unmodified genomic region in the Mycoplasma bacteria induces cell death of the Mycoplasma.
[0120] In certain embodiments, the genetically modified Mycoplasma bacteria described herein have a genomic sequence that is obtained, in part or in whole, by chemical synthesis. The chemical synthesis of oligonucleotide sequences has been described in detail many times in the art, for example, in Laikhter and Linse, The chemical synthesis of oligonucleotides, Biosynthesis, 2014. Those skilled in the art understand that genomes, minimal genomes, or rearranged genomes can be synthesized as described in the art (Gibson et al., Creation of a bacterial cell controlled by a chemically synthesized genome, Science, 2010). In certain embodiments, the genetically modified Mycoplasma bacteria described herein cannot grow without resources such as nutrients or antitoxins that are not essential for naturally occurring Mycoplasma bacteria. In certain embodiments, whether a genetically modified Mycoplasma bacterium can grow is determined by the supply of one or more non-naturally occurring amino acids and / or nucleotides. In certain embodiments, the genetically modified Mycoplasma bacterial strain has a rationally rearranged genome. Rearranged (bacterial) genomes have also been described in the art, and thus the concept of rearranged genomes is known to those skilled in the art (Bu et al., Rational construction of genome-reduced and high-efficient industrial Streptomyces chassis based on multiple comparative genomic approaches, Microbial cell factories, 2019).
[0121] In a further aspect, a kit of parts comprising living genetically modified Mycoplasma bacteria is envisioned. In a further embodiment, the living genetically modified Mycoplasma bacteria comprise genetic elements that facilitate genomic insertion of exogenous nucleotide sequences. In a further embodiment, the modified Mycoplasma bacteria comprise genomic nucleotide sequences encoding recombinases and / or nucleases. In a further embodiment, the modified Mycoplasma bacteria comprise a genomic nucleotide sequence encoding a gp35 recombinase. In a further embodiment, the modified Mycoplasma bacteria comprise a genomic nucleotide sequence encoding a protein having at least 65%, at least 70%, at least 75%, at least 80%, preferably at least 85%, at least 90%, at least 95% sequence identity to the amino acid sequence of GP35 recombinase from Bacillus subtilis bacteriophage SPP1 annotated with NCBI reference sequence NP_690727.1. In an alternative embodiment, the living genetically modified Mycoplasma bacteria comprise an extrachromosomal nucleotide sequence encoding a recombinase, preferably an extrachromosomal nucleotide sequence encoding a recombinase having at least 65%, at least 70%, at least 75%, at least 80%, preferably at least 85%, at least 90%, at least 95% sequence identity to the amino acid sequence of GP35 recombinase from Bacillus subtilis bacteriophage SPP1 annotated with NCBI reference sequence NP_690727.1.
[0122] In a further aspect, Mycoplasma bacteria as described herein are contemplated for use as a medicament. In certain embodiments, the Mycoplasma bacteria are live Mycoplasma bacteria. In alternative embodiments, the Mycoplasma bacteria are not alive or are considered alive by one of ordinary skill in the art at the time of use as a medicament. In certain embodiments, the Mycoplasma bacteria are used as a medicament when lyophilized. In certain embodiments, two or more genetically modified Mycoplasma bacteria having different genomic sequences are used simultaneously as a medicament. As used in the context of this specification, a medicament is understood to refer to a substance or drug used for diagnosing, treating, managing, or preventing a disease. In certain embodiments, live genetically modified Mycoplasma bacteria attenuated by said modification are used as a medicament, preferably, the Mycoplasma comprises functional modifications such as deletions, insertions, and / or substitutions in MPN133 and MPN372. In certain embodiments, the genetically modified Mycoplasma as described herein is used as an oral medicament. In a further embodiment, the genetically modified Mycoplasma as described herein is used as a medicament configured for administration by inhalation.
[0123] "Lyophilized", "freeze-dried", or "cryodesiccated" may be used interchangeably herein and refer to the condition and / or state of a sample, formulation, or product obtained by lyophilization means. Lyophilization is a dehydration process that involves freezing a product without disrupting the physical structure of the substance. Lyophilization at least includes the drying and sublimation steps of freezing. This sublimation step may include two-stage drying of a primary drying step and a secondary drying step. Lyophilization is commonly used in the manufacture of pharmaceuticals. In the freezing step, the substance is cooled to a temperature at which the solid, liquid, and gas phases of the substance can exist. A pharmaceutically active ingredient or product can be lyophilized to obtain chemical stability that allows storage at room temperature. The method of lyophilization is different from the conventional drying method that uses heat to evaporate water. The advantages of lyophilization can include, but are not limited to, improved aseptic operation, improved stability of the dry powder, removal of water without excessive heating of the product, and improved product stability in the dry state. Generally, the quality of the rehydrated lyophilized product is good and does not exhibit inferior (therapeutic) characteristics compared to non-lyophilized products.
[0124] In certain embodiments, the genetically modified Mycoplasma bacteria described herein are used as a pharmaceutical for treating respiratory diseases. In further embodiments, the genetically modified Mycoplasma bacteria are used as a pharmaceutical for treating cystic fibrosis, chronic obstructive pulmonary disease, or ventilator-associated pneumonia. In certain embodiments, the genetically modified Mycoplasma bacteria are used as a reservoir, container, or delivery vehicle for a foreign gene product (preferably a therapeutic protein). In certain embodiments using live genetically modified Mycoplasma bacteria, the bacteria can at least locally produce or present a therapeutic protein or immunogenic protein and are preferably considered live when they have the ability to grow in a host organism.
[0125] In certain embodiments, methods of treating a disease are contemplated that use the genetically modified Mycoplasma bacteria described herein. In further embodiments, methods of treating a subject diagnosed with or suspected of having a lung disease are contemplated. In certain embodiments, the method comprises contacting the subject with the live genetically modified bacteria described herein. In certain embodiments, the method comprises orally or nasally administering to the subject live or lyophilized genetically modified Mycoplasma bacteria. In further embodiments, the method comprises administering to the subject, by inhalation (e.g., using an inhaler), live or lyophilized genetically modified Mycoplasma bacteria. In certain embodiments, the treatment method comprises a single administration of the genetically modified Mycoplasma bacteria described herein to the subject. In alternative embodiments, the treatment method comprises periodic administration of the genetically modified Mycoplasma bacteria described herein to the subject. In further embodiments, separate genetically modified Mycoplasma are administered to the subject at various time points. In certain embodiments, live genetically modified Mycoplasma bacteria are administered to a subject diagnosed with a respiratory infection. In further embodiments, the modified Mycoplasma bacteria described herein are used as part of a combination therapy in a subject diagnosed with a respiratory infection.
[0126] In a further aspect, Mycoplasma bacteria as described herein are contemplated for use as a vaccine. In certain embodiments, the live genetically modified Mycoplasma bacteria as described herein are used as a vaccine. In certain embodiments, the modified Mycoplasma bacteria comprise a foreign gene product on their surface. In alternative embodiments, the Mycoplasma bacteria secrete a foreign gene product. In certain embodiments, the genetically modified Mycoplasma bacteria as described in any of the embodiments herein are used as a vaccine against respiratory infections. In certain embodiments, the genetically modified Mycoplasma bacteria as described herein are used as a vaccine, and the vaccine further comprises a substance suitable for inducing an immune response in a subject who has received vaccination against a separate disease, a live or inactivated pathogen, or an immunogenic protein. In certain embodiments, the vaccine further comprises an immunological adjuvant including, but not limited to, alum. Incorporation of adjuvants into vaccines is commonly used in the art and is thus known to those skilled in the art (e.g., Petrovsky, Comparative safety of vaccine adjuvants: a summary of current evidence and future needs, Drug Safety, 2015, and Del Giudice et al., Correlates of adjuvanticity: A review on adjuvants in licensed vaccines, Seminar in Immunology, 2018). In a further aspect, use of the genetically modified bacteria as described herein for the manufacture of a pharmaceutical is contemplated. In certain embodiments, use of the genetically modified bacteria as described herein for the manufacture of a pharmaceutical for the prevention or treatment of respiratory infections is contemplated.
[0127] In certain embodiments of using genetically modified Mycoplasma bacteria as a vaccine, the Mycoplasma bacteria present at least one exogenous proteinogenic sequence on their surface. The length, sequence composition, or origin of this exogenous proteinogenic sequence is not particularly limited in the context of the present invention. Preferably, the proteinogenic sequence is capable of inducing an immunogenic response in a subject that acts as a recipient of the genetically modified Mycoplasma bacteria. Such sequences are generally referred to in the art as "antigenic sequences" or "antigens". Thus, the term "exogenous" as used herein can be any peptide fragment of a protein, or a further mutagenized peptide fragment thereof. This protein can be expressed by one or more Mycoplasma species or by any other organism. Thus, it is contemplated that the genetically modified Mycoplasma bacteria described herein can act as a means for presenting any antigenic peptide to a recipient. This recipient is preferably a mammal (e.g., but not limited to, humans, cows, and livestock). In certain embodiments, the genetically modified Mycoplasma described herein can present more than one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably more than five exogenous proteinogenic sequences. In further embodiments, multiple exogenous proteinogenic sequences are presented as a fusion peptide on the surface of the genetically modified Mycoplasma bacteria. Clearly, the number of exogenous proteinogenic sequences is not particularly limited and need not even be from the same organism.
[0128] In a further aspect, the genetically modified Mycoplasma bacteria described herein are contemplated for use in modulating the composition of a subject's lung microbiome. In certain embodiments, the composition of the subject's lung microbiome after use of said Mycoplasma is at least 10%, preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% relative Mycoplasma concentration increase compared to the relative amount of Mycoplasma bacteria in the subject's lung microbiome prior to treatment. As has been described numerous times in the art (in particular, as described in O’Dwyer et al., The Lung Microbiome, Immunity and the Pathogenesis of Chronic Lung Disease, Journal of immunology, 2016), those skilled in the art recognize that changes in lung microbiome composition can dramatically affect the health status of a subject. In certain embodiments, the genetically modified Mycoplasma bacteria described herein are contemplated to modulate the composition of the lung microbiome, and due to this change in composition, the relative amount of one or more pathogenic bacteria is reduced below the threshold required to establish symptoms of the pathology.
[0129] In another aspect, contemplated herein is a method of producing an attenuated Mycoplasma bacterium, comprising introducing an inactivating modification into at least two genes or operons encoding gene products independently selected from the group consisting of cell adhesion proteins, lipid synthesis enzymes that produce immunogenic products, redox enzymes, nucleases, toxins, lipoproteins, inflammation regulatory proteins, immunogenic proteins, or cancer-inducing proteins. One of ordinary skill in the art will recognize that certain gene products described in the art may be classified into multiple categories as cited above. In a further embodiment, the inactivating modification described herein is introduced into live Mycoplasma bacteria by a site-specific recombinase, random transposon insertion, and / or a site-specific nuclease. In certain embodiments, the inactivating modification is introduced by a nuclease. In an alternative embodiment, the inactivating modification is introduced by a recombinase. In a further alternative embodiment, the inactivating modification is introduced by a catalytically inactive nuclease fused to a catalytic protein or a fragment of a protein comprising nuclease function. In certain embodiments, the inactivating modification is introduced by contacting Mycoplasma bacteria with a recombinase or nuclease and, in addition, providing the Mycoplasma bacteria with a nucleotide sequence comprising a desired modification flanked by two nucleotide regions homologous to regions flanking a target nucleotide sequence in the genomic sequence of the Mycoplasma bacteria. In certain embodiments, the method further comprises the step of selecting a genetically modified Mycoplasma bacterium. In a further embodiment, the selection step is based on a phenotypic trait presented by the Mycoplasma bacterium comprising the desired change. In certain further embodiments, the phenotypic trait confers (increases) resistance to one or more antibiotics when compared to Mycoplasma bacteria not comprising the change. In alternative further embodiments, the phenotypic trait is characterized by the expression of one or more fluorescent proteins.In yet further alternative embodiments, this phenotypic trait is a change in the growth form.
[0130] In further embodiments, the method further comprises preparing a synthetic genome or a part thereof and transferring the synthetic genome (or part thereof) into a naturally occurring Mycoplasma bacterium. In certain embodiments, a complete synthetic genome is synthesized in vivo and then introduced into a Mycoplasma bacterium. In alternative embodiments, the synthetic genome is synthesized in various segments or parts and ligated after introduction into the Mycoplasma bacterium. In certain embodiments, the synthetic genome coexists with the original genome of the Mycoplasma bacterium. In further embodiments, the method further comprises inactivating and / or removing the original genome of the living Mycoplasma bacterium. In preferred embodiments, inactivation of the original genome of the living Mycoplasma bacterium comprises degradation of the original genome. Exemplary methods for replacing a complete genome are described in the art (Lartigue et al., Genome transplantation in bacteria: changing on species to another, Science, 2007).
[0131] In a further aspect, the present disclosure contemplates the use of the attenuated Mycoplasma bacteria described herein for the production of at least one exogenous gene product or a fragment thereof. In certain embodiments, this exogenous gene product is produced by the Mycoplasma bacteria in a host organism. In alternative embodiments, the Mycoplasma bacteria are used for the production of at least one exogenous gene product in a biomanufacturing vessel, including but not limited to a bioreactor or fermenter. In certain embodiments, this exogenous gene product is a biological agent. As used herein, the term "biological agent" is used according to its generally accepted definition found in the art, i.e., a substance derived from a living organism used as a drug, vaccine, or pesticide. It is emphasized that the genetically modified Mycoplasma bacteria may be used for their own use as biological agents, or the modified Mycoplasma bacteria may be used only for the production of biological agents, or any combination thereof.
[0132] In another aspect, pharmaceutical compositions comprising the genetically modified Mycoplasma bacteria described herein are contemplated. In certain embodiments, the pharmaceutical composition comprises water for injection or physiological saline. The terms "pharmaceutical composition", "pharmaceutical formulation", and "pharmaceutical preparation" may be used interchangeably herein and include genetically modified Mycoplasma bacteria as an active pharmaceutical ingredient, formulated with pharmaceutically acceptable excipients, and manufactured or sold under approval by a government regulatory agency as part of a therapeutic regimen for the treatment of mammalian diseases. Those skilled in the art will understand that it is intended to describe a composition that contains a therapeutically effective amount of the genetically modified Mycoplasma bacteria or, when introduced as live bacteria into a host organism, contains at least an amount of the genetically modified Mycoplasma bacteria that can grow and express or deliver a therapeutically effective amount of the desired gene product and / or bacterial cargo.
[0133] As used herein, the term "therapeutically effective amount" refers to the amount of an active compound or agent that is required by a researcher, veterinarian, physician, or other clinician to elicit a biological or medical response (which may include the alleviation or complete elimination of symptoms associated with the disease or condition being treated) in a subject. Methods for determining a pharmaceutically effective amount are known in the art and are thus known to those skilled in the art. It is further apparent that the therapeutically effective amount is determined by the function of the particular subject in need of treatment. Additionally, expressions such as "subject in need of treatment" include any subject or group of subjects that can benefit from treatment of a given condition. Such subjects can include, but are not limited to, those diagnosed as being in a condition treatable by the genetically modified Mycoplasma bacteria, those having a tendency to develop the condition, and / or those in whom the condition should be prevented.
[0134] The terms "treating" or "treatment" include both therapeutic treatment of a disease or condition that has already developed (e.g., treatment of a lung disease that has already developed), and prophylactic or preventive measures, with the aim of preventing the occurrence, development, and progression of lung infections, etc., or preventing the occurrence of undesirable afflictions such as these or reducing the likelihood of this occurrence. Desirable or favorable clinical outcomes may include, but are not limited to: reduction of one or more symptoms or one or more biological markers, reduction in the extent of the disease, stabilization of the disease state (i.e., not worsening), delay or deceleration of the progression of the disease, remission or alleviation of the disease state, and the like. "Treatment" may also mean a longer survival period compared to the survival period predicted if not receiving treatment.
[0135] As used herein, the terms "therapeutic treatment" or "treatment", and the like, are intended to bring the subject's body or an element thereof from an undesirable physiological change or disorder, including but not limited to lung infection, to a desired state, e.g., to a state of lower severity or less discomfort (e.g., remission or alleviation), or to return to a normal and healthy state (e.g., restoration of the subject's health, physical integrity, and physical well-being), or to maintain the undesirable physiological change or disorder (i.e., not worsen; e.g., stabilization), or to prevent or decelerate progression to a more severe or serious state compared to the undesirable physiological change or disorder.
[0136] In certain embodiments, the pharmaceutical formulation further comprises one or more additional pharmaceutically active ingredients. In certain embodiments, the pharmaceutical formulation further comprises one or more non-active or inactive pharmaceutical ingredients, generally referred to in the art as excipients. In further embodiments, the pharmaceutical composition can be a lyophilized pharmaceutical composition.
[0137] The term "excipient", which is commonly referred to as "carrier" in the art, can denote all solvents, including but not limited to the following: diluents, buffers (e.g., neutral buffered saline, phosphate buffered saline, or optionally Tris-HCl, acetate buffer, or phosphate buffer), solubilizers (e.g., Tween 80, polysorbate 80), colloids, dispersion media, vehicles, fillers, chelating agents (e.g., EDTA or glutathione), amino acids (e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, sweeteners, colorants, flavorants, fragrances, thickeners, agents for achieving depot effects, coating agents, antifungal agents, preservatives (e.g., benzyl alcohol), antioxidants (e.g., ascorbic acid, sodium bisulfite), isotonic agents, absorption delaying agents, adjuvants, bulking agents (e.g., lactose, mannitol), and the like. The use of such media and agents for formulating pharmaceutical compositions is known in the art.
[0138] The terms "subject", "patient", and "subject in need" may be used interchangeably herein and refer to animals (preferably warm-blooded animals, more preferably vertebrates, even more preferably mammals (especially humans and non-human mammals, etc.)). The term "mammal" or "mammalian subject" refers to any animal so classified and thus includes, but is not limited to: humans, domestic animals, commercial animals, farm animals, zoo animals, sport animals, pets, and laboratory animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates, such as apes, monkeys, orangutans, and chimpanzees; canids, such as dogs and wolves; felids, such as cats, lions, and tigers; equids, such as horses, donkeys, and zebras; food animals, such as cattle, pigs, and sheep; ungulates, such as deer and giraffes; rodents, such as mice, rats, hamsters, and guinea pigs; and others. Preferred patients are human subjects. Particularly preferred are human subjects (including both genders and all age groups).
[0139] In certain embodiments, the pharmaceutical composition is a lyophilized composition that may need to be reconstituted prior to administration. In further embodiments, the pharmaceutical composition can be formulated into unit dosage forms, which can include, but are not limited to, hard capsules, soft capsules, tablets, coated tablets, such as lacquered tablets or sugar-coated tablets, granules, aqueous or oily solutions, syrups, emulsions, suspensions, ointments, pastes, lotions, gels, inhalants, or suppositories, and can be provided in any suitable packaging means known in the art, non-limiting examples of which are troches, sachets, pouches, bottles, films, sprays, microcapsules, implants, rods, or blister packs.
[0140] In addition, the present disclosure provides the following descriptions: Description 1. A genetically modified Mycoplasma bacterium, wherein the Mycoplasma bacterium contains a functional modification in its genome in the Ca2+-dependent cytotoxic nuclease gene (MPN133) and the ADP-ribosyltransferase CARDS gene (MPN372), and the functional modification attenuates the Mycoplasma bacterium.
[0141] Description 2. The genetically modified Mycoplasma bacterium according to Description 1, further comprising a functional modification in at least one gene, preferably in at least two genes selected from the group consisting of Table 1.
[0142] Description 3. The genetically modified Mycoplasma bacterium according to Description 1 or 2, further comprising a functional modification in a gene encoding a peroxide-producing protein, preferably in a gene encoding glycerol 3-phosphate oxidase, more preferably in the gene encoding glycerol 3-phosphate dehydrogenase (MPN051).
[0143] Description 4. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 3, further comprising a functional modification in a gene encoding a second (surface) nuclease, preferably in a gene encoding membrane nuclease A (MPN491).
[0144] Description 5. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 4, comprising a functional modification in one or more genes encoding a cell adhesion protein, preferably in one or more genes selected from the group consisting of MPN141, MPN142, MPN453, MPN447, MPN310, MPN452, MPN309.
[0145] Description 6. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 5, further comprising a functional modification in a gene encoding an immunogenic protein capable of inducing an immune response in a host organism, preferably in a gene encoding the conserved hypothetical protein MPN_400 (MPN400).
[0146] Description 7. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 6, further comprising a functional modification in one or more genes encoding a protein capable of inducing Guillain - Barré in a host organism, preferably in one or more genes encoding UDP - glucose 4 - epimerase (MPN257) and / or one or more genes encoding glycosyltransferase (MPN483).
[0147] Description 8. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 7, further comprising a functional modification in a gene encoding a protein that inhibits the growth of the bacterium in a bioreactor, preferably in a gene encoding a protein similar to the intracellular protease ThiJ / PfpI (MPN294).
[0148] Description 9. The bacterium further comprises a functional modification in one or more genes encoding lipoproteins, preferably in one or more genes selected from the group consisting of MPN141, MPN142, MPN152, MPN162, MPN199, MPN200, MPN224, MPN233, MPN271, MPN284, MPN288, MPN293, MPN333, MPN372, MPN415, MPN447, MPN592, MPN597, MPN602, MPN611, MPN011, MPN052, MPN054, MPN058, MPN083, MPN084, MPN097, MPN098, MPN363, MPN369, MPN408, MPN411, MPN436, MPN439, MPN442, MPN444, MPN456, MPN467, MPN489, MPN506, MPN523, MPN582, MPN585, MPN586, MPN587, MPN588, MPN590, MPN591, MPN592, MPN639, MPN640, MPN641, MPN642, MPN643, MPN644, MPN645, MPN646, MPN647, MPN648, MPN649, MPN650, MPN654, and is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 8.
[0149] Description 10. The bacterium comprises a functional modification in the prolipoprotein diacylglyceryl transferase gene MPN224 and the lipoprotein signal peptidase gene MPN293, and is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 9.
[0150] Description 11. The bacterium further comprises a functional modification in a gene encoding an oncogenic protein, preferably in the gene (MPN415) encoding the high-affinity transport system protein p37, and is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 10.
[0151] Description 12. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 11, further comprising a functional modification in a gene encoding an RNA polymerase factor, preferably in a gene (MPN626) encoding a putative RNA polymerase sigma-D factor.
[0152] Description 13. The bacterium is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 12, further comprising a functional modification in one or more genes encoding a secretory Mycoplasma gene product, preferably in one or more genes selected from the group consisting of MPN400, MPN036, MPN592, MPN509, MPN647, MPN084, MPN625, MPN213, MPN489, MPN142, MPN444, MPN642, MPN398, MPN491, MPN083, MPN141.
[0153] Description 14. The functional modification refers to the insertion, deletion, substitution of one or more nucleotides, or any combination thereof in the gene, and is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 13.
[0154] Description 15. Attenuation means that when the bacterium is introduced into a host organism, preferably when introduced into the respiratory system of the host organism, compared with a reference Mycoplasma bacterium, it shows a reduction in toxicity of at least 30%, preferably at least 50%, more preferably at least 75%, and most preferably at least 90%. The reference Mycoplasma bacterium is a naturally occurring (wild-type) Mycoplasma bacterium that does not contain a functional modification of the gene, and is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 14.
[0155] Description 16. The Mycoplasma bacterium is a Mycoplasma pneumoniae bacterium, which is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 15.
[0156] Description 17. The Mycoplasma bacterium contains a nucleotide sequence encoding a foreign gene product or a functional fragment thereof. Preferably, the nucleotide sequence is contained in the genomic sequence of the Mycoplasma bacterium, which is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 16.
[0157] Description 18. The foreign gene product or its functional fragment is a protein. Preferably, it is a therapeutic protein, a protein involved in specific attachment to a host protein, an enzyme, an immunogenic protein, or a DNA-binding protein. More preferably, the therapeutic protein or immunogenic protein is expressed on the surface of the Mycoplasma bacterium and / or secreted by the Mycoplasma bacterium, which is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 17.
[0158] Description 19. The bacterium is obtained by introducing the functional modification into one or more genes of the Mycoplasma bacterium genome by recombinant DNA technology, preferably by a genome manipulation method, more preferably by a recombinase and / or nuclease-based genome manipulation method, which is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 18.
[0159] Description 20. The genome containing one or more functional modifications is partially obtained by chemical synthesis, preferably completely obtained, which is the genetically modified Mycoplasma bacterium according to any one of Descriptions 1 to 19.
[0160] Description 21. Mycoplasma bacteria as described in any one of Descriptions 1 to 20 for use as a medicament.
[0161] Description 22. Mycoplasma bacteria as described in any one of Descriptions 1 to 20 for use as a vaccine.
[0162] Description 23. Mycoplasma bacteria as described in any one of Descriptions 1 to 20 for use in modulating the composition of the lung microbiome of a subject.
[0163] Description 24. A method for producing attenuated Mycoplasma bacteria, comprising introducing a functional modification into at least two genes encoding gene products independently selected from the group consisting of cell adhesion proteins, redox enzymes, nucleases, toxins, lipoproteins, inflammation control proteins, immunogenic proteins, or cancer-inducing proteins.
[0164] Description 25. The method according to Description 24, wherein the functional modification is introduced into living Mycoplasma bacteria by a site-specific recombinase and / or a site-specific nuclease.
[0165] Description 26. The method according to Description 24 or 25, wherein the method comprises preparing a synthetic genome or a part thereof and transferring the synthetic genome (or a part thereof) to a naturally occurring Mycoplasma bacterium.
[0166] Description 27. The method according to Description 26, wherein the method further comprises inactivating, preferably degrading, and / or removing the original genome of the living Mycoplasma bacteria.
[0167] Description 28. Use of the attenuated Mycoplasma bacteria as described in any one of Descriptions 1 to 20 for the production of at least one exogenous gene product or a fragment thereof.
[0168] Pharmaceutical composition comprising a genetically modified Mycoplasma bacterium according to any one of descriptions 1 to 20.
[0169] The present invention has been described with its specific embodiments, but in view of the above description, many changes, modifications, and variations will be apparent to those skilled in the art. Accordingly, all such changes, modifications, and variations are intended to be included within the spirit and broad scope of the appended claims. The aspects, embodiments, and descriptions disclosed herein of the present invention are further supported by the following non-limiting examples.
Example
[0170] Example 1. Method for producing a modified Mycoplasma strain 0.5 nmol of various editing oligos described herein were co-transformed with the pUC57PuroSelector plasmid into an M. pneumoniae strain that expresses GP35 from a constitutive promoter and Cre recombinase from an inducible Ptet promoter. Mock transformation without oligos served as a control condition to monitor non-specific plasmid integration. After transformation, the cells were allowed to recover in Hayflick medium at 37 °C for at least 3 hours.
[0171] Transient expression of Cre recombinase was mediated to incorporate the pUC57PuroSelector plasmid that enables the selection of edited clones. Accordingly, the total amount of co-transformation of oligo + plasmid was seeded into a T75 flask containing 25 ml of Hayflick medium supplemented with 5 ng / ml anhydrotetracycline and 3 μg / ml puromycin. The culture was grown in the presence of the inducer for a period of at least 12 hours and up to 72 hours. Then, cells in 500 μl of Hayflick medium were taken out from this flask, and half of the volume was spread onto a Hayflick 0.8% bacto agar plate containing 3 μg / ml puromycin. After the plate was incubated at 37 °C and 5% CO2 for a period of at least 10 days, the resulting colonies were screened.
[0172] In an alternative approach, Cre expression was induced directly on the bacto agar plate. In this methodology, after the recovery period following co-transformation, half of the volume was spread onto a Hayflick 0.8% bacto agar plate supplemented with 3 μg / ml puromycin and 1 ng / ml anhydrotetracycline. After the plate was incubated at 37 °C and 5% CO2 for a period of at least 10 days, the resulting colonies were screened.
[0173] Alternatively, this method enables the performance of gene complementation. For example, MPN483, which encodes the main glycosyltransferase found in the M. pneumoniae genome, was deleted with an editing oligo. Then, this deletion was complemented with a tailored version of the pUC57PuroSelector plasmid that cloned genes encoding various glycosyltransferase activities.
[0174] Similarly, MPN489, which encodes an essential lipoprotein, can be deleted with an editing oligo, and the viability of this cell can be restored by using a tailored version of the pUC57PuroSelector plasmid having a modified version of MPN489 that would prevent protein acylation. Specific genes are discussed in Section 2.
[0175] 2. Rational Design of Modified Mycoplasma Strains Through extensive experiments, the inventors have identified several genetically modified Mycoplasma strains with improved properties. In principle, an optimal genetically modified Mycoplasma strain should address multiple problems that may be envisioned when using Mycoplasma as a delivery vehicle or chassis for the local production of foreign gene products such as therapeutic proteins. These hurdles and solutions are detailed in the following sections. In this specification, various genetically modified Mycoplasma strains are indicated by an annotation of "chassis version" (abbreviated as "CV") followed by an integer. An overview of each CV is summarized in a summary table in Section 2.9 (Table 7), and an overview of the genetic background of each strain is also summarized. Some of the chassis described in this specification express a heterologous gp35 recombinase, which is used to facilitate genetic modification as shown and discussed in detail in a co-pending application. One of ordinary skill in the art will understand that the gp35 recombinase or its expression is not an essential requirement for obtaining or using a modified Mycoplasma strain, and that both chassis versions with gp35 and those without gp35 are envisioned as suitable genetically modified Mycoplasma strains for delivery or for the local production of a desired product.
[0176] 2.1. Cell Attachment The attachment of Mycoplasma (pneumoniae) to the respiratory epithelium involves the cell attachment of this organism to sialoglycoproteins and sulfated glycolipids of epithelial cells by specialized organelles composed of adhesins and accessory proteins (Waites et al., New insights into the pathogenesis and detection of Mycoplasma pneumoniae infections, Future microbiology, 2008). The major proteins that have been proven to be directly involved in receptor binding in the art are P1 adhesin (MPN142) and P30 adhesin (MPN453) (Chourasia et al., Delineation of immunodominant and cytadherence segment(s) of Mycoplasma pneumoniae P1 gene, BMC microbiology, 2014). P1-adhesin is a transmembrane protein and is mainly concentrated at the tip of the attachment organelle of Mycoplasma (pneumoniae). Mutant strains lacking P1 are unable to attach to animal cells and are non-pathogenic. The P1 adhesin requires the following other auxiliary proteins: P30 (MPN453) attachment factor-related proteins A (72 kDa), B (85 kDa), and C (37 kDa), HMW 1-3 polypeptides (MPN447, MPN310, MPN452), P40 and P90 (MPN142), and P65 (MPN309). All of these proteins are either non-essential genes or genes that contribute to the fitness of the bacteria.
[0177] The inventors have generated several Mycoplasma strains containing modified or inactivated MPN142 gene and / or MPN453 for the purpose of improving the following three aspects in the chassis design: 1) Avoidance of adhesion to improve chassis growth in suspension for production in a fermenter. Similarly, removal of these accessory proteins reduces the overall metabolic load, and the resulting chassis can grow faster compared to Mycoplasma strains in which the gene is still expressed. 2) Reduction of pathogenicity by reducing chassis adhesion to lung epithelial cell lines of a subject treated with the modified Mycoplasma bacteria of the present invention. However, the reduced adhesion ability may also imply that the chassis cells are more rapidly eliminated from the infected subject. As a result, a decrease in the effectiveness of Mycoplasma products and / or an increase in the minimum dose required are this virtual drawback. Furthermore, an increase in the dose required would further imply an increase in manufacturing costs. Therefore, this aspect needs to be evaluated on a case-by-case basis, characterized for each intended use, and an optimal chassis designed and realized. For example, in the context of vaccination, using a Mycoplasma strain that cannot adhere to the lung epithelial cells of the subject allows for better recognition by the immune system and enhanced response and protection. On the other hand, for example, in the context of treating other diseases such as cancer, continuous and local delivery of the therapeutic agent is important, and adhesion to tumor cells may be required. Therefore, the potential benefits of changing the adhesion characteristics of the Mycoplasma chassis described herein need to be evaluated on a case-by-case basis. 3) Induction (i.e., targeting, homing) of the chassis to specific cell types (e.g., pathogenic bacteria or tumor cells present in a host organism).
[0178] The following three combinations of cell adhesion gene modifications are of particular interest. One is to retain the intact adhesion mechanism that is surely retained in the human lung in order to secrete any active therapeutic agent in the lung tissue (for example, CV16). In the second strain, the MPN142 gene and the MPN453 gene are inactivated or depleted (for example, CV19). Using this strain, a further strain that exposes an antigen on the surface (for vaccination) or a further strain that exposes a heterologous protein that would bind to pathogenic bacteria causing lung infection can be generated. In this last scenario, the chassis may then be specifically induced at the focus of infection and delivered locally at the site of action of the therapeutic component (for example, CV3). In addition, when the infection is resolved, the chassis will be washed away. Thirdly, a strain expressing a heterologous protein that binds to a specific protein of cells in the target human or animal lung can be generated. This enables the development of a Mycoplasma infection model in animals that are not normally infected with Mycoplasma and may be used to study the etiology, drug delivery, etc. From the above, it is necessary to carefully evaluate on a case-by-case basis the merit of selecting an appropriate heterologous protein that enables expansion or change in an infectable host organism.
[0179] The inventors have developed and characterized exemplary strains CV16 (CV0 strain depleted of mpn453 (wild type having the gp35 gene)), CV19 (CV2 strain depleted of mpn453 (attenuated strain, see below), and CV3 (CV2 strain depleted of mpn142). The results of adhesion assays based on qPCR for these strains are shown in Table 1.
[0180] A study of the proteome of the CV16 variant (ΔP30 mpn453) versus the WT strain showed a significant decrease in the adherent p65 protein (MPN309), as well as many other changes affecting ribosomal and lipoprotein proteins. Therefore, depletion of MPN453 may affect the structure of the terminal organelles and may also affect other important proteins related to adhesion.
[0181] The growth rates of various strains were measured by determining the number of bacteria at various time points by qPCR. Notably, the CV19 and CV16 strains showed higher total bacterial numbers and biomass compared to their respective reference strains. Therefore, depletion of MPN453 also promotes growth in bioreactors such as fermenters, improving the efficiency of large-scale production. Optionally, the expression of MPN453 can be suppressed when growing in a fermenter and then induced prior to inoculation into the lungs of a host organism such as a patient.
[0182] Therefore, removal of integral membrane proteins enables increased production of heterologous secreted proteins. Western blot experiments suggest that removing P30 helps to have more heterologous proteins present on the membrane of modified Mycoplasma bacteria (Figure 2). This result is highly relevant to the further improvement of modified Mycoplasma bacteria for delivering therapeutic proteins to the lungs or using them as vaccines, because this shows higher efficiency, which in fact translates into a decrease in the amount of bacteria required to achieve a certain (clinical) effect, resulting in a reduced production volume required and ultimately a reduction in manufacturing costs.
[0183] In addition, it is demonstrated from experimental data that heterologous proteins expressed on the surface of modified Mycoplasma bacteria can recognize proteins of other bacteria. The first example is the SH3 domain of a bacteriocin that specifically recognizes the surface of Staphylococcus aureus. This SH3 domain can be expressed as such and can also be expressed as a chimeric protein containing two SH3 domains. In addition, in order to direct the chassis towards Pseudomonas aeruginosa, nanobodies can be expressed on the surface of Mycoplasma directed towards the flagella of this bacterium (Figures 2 and 3).
[0184] In addition, in this chassis, other adhesins from other Mycoplasma species are expressed to promote binding to the lungs of an animal model for performing in vivo assays. For example, the Vsa protein from Mycoplasma pulmonis (which infects mice) and the P97 protein from Mycoplasma hyopneumoniae (which infects pigs, Figure 4) can be expressed on the surface of the Mycoplasma strain respectively to promote the binding of said strain to mouse and pig epithelial cell lines.
[0185] The nucleotide sequences and amino acid sequences of the heterologously expressed proteins are shown in the attached Sequence Listing and Figure 19.
[0186] 2.2. Production of peroxides, and tissue lesions Mycoplasma pneumoniae, a causative agent of respiratory infections, is known to adhere to the surface of ciliated tracheal epithelial cells and form colonies. During this colony formation, a large amount of hydrogen peroxide is produced as a glycerol metabolite. This hydrogen peroxide has been demonstrated to be essential for the cytotoxicity of host cells (Schmidl et al., A Trigger Enzyme in Mycoplasma pneumoniae: Impact of the Glycerophosphodiesterase GlpQ on Virulence and Gene Expression, PLOS pathogens, 2011). When either glycerol or phosphatidylcholine is present in the cell culture medium, peroxides are produced. Figure 5 shows the corresponding metabolic pathway. GlpD (encoded by MPN051) catalyzes the oxidation of G3P to dihydroxyacetone phosphate (DHAP), which results in the production of hydrogen peroxide. GlpD is a non-essential enzyme (NE) when cells are cultured in the presence of glucose, but becomes an essential enzyme when cells are cultured in a medium containing glycerol or phosphatidylcholine as the sole carbon source. In the human lung, since one of the main components of surfactant is phosphatidylcholine, MPN051 is considered an essential gene in vivo. Therefore, the chassis cannot survive in the human lung by removing MPN051. To solve this problem, other enzymes of the Mycoplasma species that can catalyze the same reaction without using peroxides have been identified. One of these enzymes is GpsA from Mycoplasma penetrans. GpsA also catalyzes the reversible production of DHAP from G3P using NADP / NADPH (sn-glycerol 3-phosphate + NAD(P)+ = glycerone phosphate + NAD(P)H + H+).
[0187] The gpsA gene derived from M. penetrans was synthesized and configured to be controlled by the constitutive MG438 promoter. Using this gene construct, the MPN051 gene of M. pneumoniae in the CV2 chassis was replaced (new chassis CV8). When knocking out the MPN051 gene (Mycoplasma strain CV30), no peroxide is produced, and no peroxide is produced by the substitution with GpsA (Figure 6).
[0188] The nucleotide sequence and amino acid sequence of the heterologous expressed protein are shown in the attached sequence listing and Figure 19.
[0189] 2.3. Activation of the innate immune response When characterizing the pathogenic factors of M. pneumoniae, Kannan et al. identified surfactant protein A-binding (MPN372; CARDS), which is homologous to the S1 subunit of Bordetella pertussis toxin (Kannan et al., ADP-ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae represents unique virulence determinant among bacterial pathogens, Proceedings of the National Academy of Sciences of the USA, 2006). The MPN372 protein was found to catalyze adenosine diphosphate ribosylation (ADP-ribosylation) and have a vacuolating function in infected cells (Hardy et al., Analysis of pulmonary inflammation and function in the mouse and baboon after exposure to Mycoplasma pneumoniae CARDS toxin, PLOS one, 2009).
[0190] Mycoplasma pneumoniae (M. pneumoniae) lacks the metabolic machinery to produce purines and pyrimidines due to its limited genome size (816 kb). Thus, the endogenous nuclease activity of Mycoplasma is essential for its replication and survival (Razin et al., A partially defined medium for the growth of Mycoplasma. J Gen Microbiol, 1960). In addition, the M. pneumoniae nuclease MPN133 has a cytotoxic effect on mammalian cells and reveals a unique glutamate, lysine, and serine-rich region (EKS region) that is essential for nuclease binding and internalization but not for nuclease activity.
[0191] MPN372 is a non-essential gene and was depleted by GP35-mediated recombination (see CV1 chassis, Table 7). MPN133 is a non-essential gene and was similarly deleted by GP35-mediated recombination into the genetic background of the CV1 strain, thereby obtaining the CV2 strain (Table 7).
[0192] The attenuation levels of CV1 and CV2 were tested in a mouse mammary gland model (Figure 7A). It was observed that the WT strain caused a considerable amount of hemorrhagic lesions, while this was reduced in the Mycoplasma strains of CV1 and CV2. In addition, the number of Mycoplasma bacteria present in the tissue 4 days after infection was quantified by counting the colonies formed on agar plates (Figure 7B). The CFUs recovered for WT, CV1, and CV2 were comparable, and thus it was observed that depletion did not affect the maintenance of Mycoplasma in the tissue. Furthermore, the combined deletion of MPN133 and MPN372 had a synergistic effect, and the resulting double knockout (i.e., CV2) unexpectedly showed no substantial lesions, as shown in Figure 24. Finally, unexpectedly, these genetically engineered Mycoplasma can be maintained in the lungs of experimental animals such as mice and can produce recombinant proteins when further modified.
[0193] 2.4. Lipoprotein The inflammatory response induced by the host immune system is one of the main characteristics of M. pneumoniae infection and is a major cause of clinical symptoms. Analysis of the cell membrane of Mycoplasma bacteria has demonstrated that several lipoprotein surface antigens elicit a strong immune response (Christodoulides et al., The role of lipoproteins in Mycoplasma-mediated immunomodulation, Frontiers in microbiology, 2018) (Table 2). The diacylglycerol group of the lipoprotein activates the inflammasome through interaction with the TLR2 and TLR6 receptors. This protein also controls the colony formation and transmucosal translocation of Mycoplasma and promotes host immune evasion.
[0194]
Table 7
[0195] In prokaryotes, membrane lipoproteins are synthesized with a precursor signal peptide and cleaved by a specific lipoprotein signal peptidase (signal peptidase II). This peptidase recognizes a conserved sequence and cleaves upstream of the cysteine residue to which the glyceride-fatty acid lipid attaches (Figure 8). M. pneumoniae has the following two corresponding enzymes: MPN224 (prolipoprotein diacylglyceryl transferase (Lgt; EC 2.4.99.-)) and MPN293 (LspA; lipoprotein signal peptidase (EC 3.4.23.36)). M. pneumoniae further contains several proteins with sequence motifs recognized by both enzymes (lipobox: [LVI][ASTVI][GAS]C) (Table 3).
[0196]
Table 8
[0197]
Table 9
[0198] The lipoproteins cited above may activate the TLR2 receptor and / or the TLR6 receptor in the following two possible ways: 1) This protein may be released from bacteria due to cell lysis and / or 2) it is released into the medium by bacteria because it is often a protein of considerable size that is only membrane-fixed by two short lipid chains. In the first scenario, it is necessary to prevent the lipoylation and cleavage of the lipoproteins shown in Table 3. In the second scenario, it is necessary to target only the released protein. To verify whether the second hypothesis was correct, the data on the proteins preferentially found in the supernatant of M. pneumoniae cell cultures (Table 4) shown in the paper by Bernhard Paetzhold were analyzed. Several lipoproteins that are acylated at the Cys residue of the consensus signal but are released into the medium were identified (however, it cannot be completely excluded that these proteins are proteolytically cleaved on the surface and the released regions have been detected).
[0199]
Table 10
[0200] Possible strategies for reducing the response to lipoproteins are to use genome engineering techniques to delete genes that are non-essential and secreted into the medium (e.g., MPN083, MPN084, MPN592, MPN642, MPN647). Alternatively, Lgt and LspA can be inactivated or deleted, such that the lipoprotein remains anchored to the membrane via a transmembrane helical segment. However, this is not possible because both enzymes are essential in Mycoplasma. Another option is to replace the transmembrane helical segment of the lipoprotein that contains the lipobox sequence motif (LVI][ASTVI][GAS]C). This occurs in nature as well, such as in the exemplary homologous species of the MPN058 lipoprotein (Table 5). In the case of the S. aureus homologous species, the Cys essential for cleavage and acylation is lost, and the protein is anchored to the membrane via a transmembrane helix.
[0201]
Table 11
[0202] According to this hypothesis, it should be possible to replace the lipobox sequence motif ([LVI][ASTVI][GAS]C) of all essential lipoproteins of M. pneumoniae with sequences that are not cleaved and not modified at the time when MPN224 and MPN293 can be removed from the genome, thereby effectively eliminating protein lipoylation. A multiple sequence analysis of Mycoplasma proteins with one transmembrane segment was performed to confirm whether this transmembrane segment differed from those modified and cleaved in lipoproteins (Table 6).
[0203]
Table 12
[0204] Generally, lipoproteins can be observed to have shorter helical segments and a substantially higher proportion of G, S, and T when compared to proteins having one transmembrane segment. The protein exposed to the medium appears to have more positively charged residues at the N-terminus of the helical segment, and the opposite occurs in the protein facing the cytoplasm. The MPN489 gene was selected to explain that lipoproteins having a transmembrane processed segment can be replaced with a transmembrane segment without Cys. This gene was deleted and replaced with various MPN489s containing various N-terminal transmembrane sequences.
[0205] The nucleotide and amino acid sequences of rationally designed MPN489 are shown in the attached sequence listing and FIG. 19.
[0206] 2.5. Galactocerebroside Guillain-Barre syndrome (GBS) is an acute post-infectious immune-mediated polyneuropathy. A preceding respiratory infection by M. pneumoniae has been reported in some cases, but the role of M. pneumoniae in the etiology of GBS remains unclear. M. pneumoniae infection is associated with GBS, is more frequent in children than in adults, induces anti-galactose cerebroside (GalC) antibodies, and among these antibodies, in particular, anti-GalC IgG can contribute to the etiology of GBS (van den Berg et al., Guillain-Barre syndrome: pathogenesis, diagnosis, treatment and prognosis, Nature review neurology, 2014). Antibodies against GalC accompanying evidence of M. pneumoniae infection are also associated with encephalitis and other neuropathies (Kusunoki et al., Anti-Gal-C antibodies in GBS subsequent to Mycoplasma infection: evidence of molecular mimicry, Neurology, 2001).
[0207] Sphingoglycolipids (GSLs) are components of the plasma membranes of most eukaryotic cells. Sphingoglycolipids consist of a ceramide backbone linked to a carbohydrate polar head group via an O-glycosidic linkage to the C1-hydroxyl of ceramide. This polar head group consists of hexose and generally consists of galactose (galactosylceramide, GalCer) or glucose (glucosylceramide, GlcCer). Galactocerebroside is typically found in neural tissue, and glucosylceramide is found in other tissues. A notable property of cerebrosides is that their "melting point" is well above physiological body temperature, so that at this temperature the glycolipids have a quasi-crystalline structure. Cerebroside lipids are important for membrane integrity. The ratio between monoglycosyldiacylglycerol, which does not form a bilayer, and diglycosyldiacylglycerol, which readily forms a bilayer, contributes to the control of plasma membrane properties. M. pneumoniae can synthesize GalC by using glucose as a precursor (Figure 9). All of the enzymes involved in lipid biosynthesis in M. pneumoniae are either essential genes or genes involved in fitness. Key enzymes in the production of galactocerebroside are the MPN257 epimerase, which produces UDP-galactose from UDP-glucose, and the MPN483 processive glycosyltransferase, which preferentially (50-fold over α-glucose-diacylglycerol) incorporates UDP-galactose into β-galactose-diacylglycerol. Generally, UDP-galactose is preferred over UDP-glucose regardless of the acceptor.
[0208] All enzymes of the MPN483 family add sugars in a β-configuration, and some of these enzymes also connect sugars with β-1,6 linkages. In M. pneumoniae cells, only galactolipids are synthesized, and various glycolipids were obtained by in vitro assays using solubilized M. pneumoniae cells and solubilized recombinant E. coli cells expressing MPN483. With UDP-Gal as the glycosyl donor, DAG and GalβDAG are good acceptors, and the latter preferably gives Galβ1,6GalβDAG. With UDP-Glc as the donor, DAG and GalβDAG were acceptors, but not GlcβDAG. Furthermore, the main glycolipid synthesized in vivo by recombinant E. coli cells expressing MPN483 was identified as Glcβ1,6GalβDAG. The M. pneumoniae enzyme is mainly a galactosyltransferase and was concluded to have a higher diglycosyltransferase activity towards GalβDAG as an acceptor, but not to accept GlcβDAG as a substrate (Klement et al., A processive lipid glycosyltransferase in the small human pathogen Mycoplasma pneumoniae: involvement in host immune response, Molecular Microbiology, 2007). M. pneumoniae has homologous species of MPN257 (MG_118) and MPN483 (MG517).MG517 sequentially produces monoglycosylglycerol and diglycosyldiacylglycerol (Andres et al., Expression and characterization of a Mycoplasma genitalium glycosyltransferase in membrane glycolipid biosynthesis: potential target against mycoplasma infections, The Journal of biological chemistry, 2011). This enzyme in Escherichia coli (E. coli) mainly produces Glcβ1,6GlcβDAG but recognizes both UDP-glucose and UDP-galactose.
[0209] MPN483 is controlled by the presence of phosphatidylglycerol (PG). The amount of PG included in this assay has a great impact on the various lipids produced. At low PG levels, GalDAG is mainly produced, at high levels, GalGalDAG is mainly produced, and the total production amount and ratio change with the increase in PG content. MG_517 is activated by dioleoylphosphatidylglycerol (anionic phospholipid), and k(cat) increases linearly with the dioleoylphosphatidylglycerol concentration (Andres et al., Expression and characterization of a Mycoplasma genitalium glycosyltransferase in membrane glycolipid biosynthesis: potential target against mycoplasma infections, The Journal of biological chemistry, 2011). Therefore, both enzymes are controlled by anionic phospholipids, and when the concentration of anionic phospholipids changes, the activity of producing diglycosylated lipids (supporting bilayer formation) is likely to increase.
[0210] Based on the above, the replacement of galactosylceramide with glucosylceramide to avoid any autoimmune reactions resulting from the extra-neural exposure of galactosylceramide to the immune system is an interesting route for generating improved Mycoplasma strains. In principle, the simplest way to do this is to knock out galactose epimerase MPN257 that catalyzes the conversion of UDP-glucose to UDP-galactose, and then modify the ceramide that uses UDP-glucose to generate glucosylceramide using MPN483, or knock out enzyme MPN483 that prevents the formation of galactolipids. Although MPN483 is a strong adaptive gene as described above, it can be deleted. However, this deletion will probably impair the in vivo growth. To prevent this possibility, another strategy is to replace the MPN483 enzyme with an equivalent that uses only UDP-glucose as a substrate, and then knock out epimerase MPN257, because other genes downstream of this enzyme are non-essential. As a non-limiting example to prove this hypothesis, three different enzymes from three different organisms were selected. It is obvious to those skilled in the art that other additional genes are suitable for this replacement. The first approach was to replace MPN483 with a homologous molecular species from M. genitalium (MG_517) that seems to prefer glycolipids over galactolipids (see above). The second approach was to search for related Mycoplasma species that do not have a homologous molecular species of MPN257 epimerase, and thus, when a homologous molecular species of MPN483 exists, UDP-glucose should be preferentially used to produce glycolipids. For this purpose, M. agalactiae, for which essential research has been carried out, was selected (Montero-Bai et al., DNA research 2019). This homologous molecular species of MPN483 is MAGA_RS00300. The third possibility is to search for a processable glycosyltransferase enzyme that has already been characterized and uses only UDP-glucose as a substrate.For this purpose, the utgP enzyme from B. subtilis was selected. This enzyme synthesizes glycolipids in B. subtilis (Uniprot entry P54166) by the processive transfer of glucose from UDP-glucose to diacylglycerol. Finally, another possibility is to express the alMGS and alDGS enzymes from A. laidlawii, which have been shown to restore the phenotypic variants of UgtP knockout in B. subtilis. In A. laidlawii, α-glucose is linked to DG by alMGS, and then the next glucose is linked to MGlcDG via an α-1,2 bond by alDGS (Matsuoka et al., Suppression of abnormal morphology and extra cytoplasmic function sigma activity in Bacillus subtilis ugtP mutant cells by expression of heterologous glucolipid synthases from Acholeplasma laidlawii, 2016).
[0211] The MPN483 gene was replaced with itself or the above-described genes as a positive control to verify whether galactosylceramide could be removed from M. pneumoniae. The sequences of the heterologous genes and heterologous proteins are shown in the attached sequence listing and FIG. 19.
[0212] The characterization and further optimization of the resulting M. pneumoniae strains are detailed in Section 5 of this Example, and in addition to the MPN133 and MPN372 modifications, Mycoplasma (e.g., M. pneumoniae) bacteria are envisioned in which the GBS modification described above has been introduced. It is emphasized that not only Mycoplasma strains containing the MPN133 and / or MPN372 modifications are envisioned, but also Mycoplasma containing functional modifications such as deletions, insertions, and / or substitutions, etc., in order to reduce the risk that the recipient will develop GBS. The ultimate recovery of the gene into which the functional modification has been introduced will clearly depend on the specific use envisioned.
[0213] 2.6. Cancer The inventors have created several genetically modified Mycoplasma strains in which the number of genes encoding oncogenic proteins and optionally expressed when the Mycoplasma bacteria are expressed in a host organism is reduced.
[0214] 2.7. DNA Recombination The human pathogen *Mycoplasma genitalium* utilizes homologous recombination to generate antigenic diversity of the immunodominant MgpB and MgpC proteins (Iverson-Cabral et al., *mgpB* and *mgpC* sequence diversity in *Mycoplasma genitalium* is generated by segmental reciprocal recombination with repetitive chromosomal sequences, *Molecular Microbiology*, 2007, and Iverson-Cabral et al., Intrastrain heterogeneity of the *mgpB* gene in *Mycoplasma genitalium* is extensive in vitro and in vivo and suggests that variation is generated via recombination with repetitive chromosomal sequences, *Infection an immunity*, 2006). *Mycoplasma pneumoniae* is hypothesized to utilize a very similar mechanism. In *Mycoplasma genitalium*, the expression of the alternative sigma factor MG428 (MPN626 in *Mycoplasma pneumoniae*) has been shown to induce the expression of the recombination machinery and promote recombination (Torres-Puig et al., A novel sigma factor reveals a unique regulon controlling cell-specific recombination in *Mycoplasma genitalium*, *Nucleic acids research*, 2015).MPN626 controls the same genes involved in recombination as found in M. genitalium and is not expressed under normal growth conditions (Yus et al., Determination of the Gene Regulatory Network of a Genome-Reduced Bacterium Highlights Alternative Regulation Independent of Transcription Factors, 2019, Cell Systems). However, in vivo under certain conditions, this gene may be expressed and recombination may be induced. To rule out this possibility, the MPN626 gene was depleted and replaced with a landing platform adjacent to the Cre-Lox site to insert a DNA construct (CV8_L2). This mutant grows similarly to CV8 (see Table 9).
[0215] 2.8. Increase in cell doubling time M. pneumoniae divides every 8 - 10 hours under optimal in vitro culture conditions. Therefore, culturing bacteria in a fermenter takes a considerable amount of time and thus incurs a significant reagent cost. Therefore, having an M. pneumoniae strain that can grow faster could be very useful for biotechnological purposes. It is known that doubling the number of rRNA operons from 1 to 2 can increase the growth rate by about 20%. In addition, other genes that can increase the growth rate upon overexpression have been identified (Determinants of Growth Rate in Genome - reduced Bacteria, Carolina Gallo Lopez, Universitat Pompeu Fabra, 2018). Similarly, it has been demonstrated that ribosomes and genes encoding proteins involved in translation appear to be related to the rate of cell division in various Mycoplasma species. Therefore, doubling the rRNA operon and increasing the expression of ribosomal proteins by modifying the promoter are promising routes to obtain Mycoplasma strains with a faster cell division rate.
[0216] 2.9. Overview of Genetically Modified Mycoplasma Strains The overview of preferred Mycoplasma strains that have received particular attention is summarized in Table 7 below.
[0217]
Table 13
[0218]
Table 14
[0219] 2.10. Landing Platform for Cloning To facilitate cloning and ensure the same genomic environment for all gene fragments introduced into the genome of M. pneumoniae, a specific genomic element, further referred to herein as a "landing platform", is introduced into the bacterium. This landing platform is a DNA fragment (i.e., DNA sequence) containing an antibiotic resistance gene adjacent to non-compatible Cre-Lox sites. Thus, when a vector containing Cre recombinase and the desired gene fragment adjacent to the corresponding lox site is transformed, the antibiotic gene cassette is replaced with the desired DNA fragment. The sequences used for the generation of two such landing platforms in Mycoplasma (one located in the MPN626 gene and the other in the MPN133 gene) are shown in the accompanying sequence listing and Figure 19.
[0220] 3. Characterization assays for modified Mycoplasma strains. 3.1. Mouse mastitis model 3.1.a. Animal infection Seven-week-old female CD1 mice (Charles River International) were housed in the animal facilities of the Universidad Publica de Navarra (UPNA; registration code ES / 31-2016-000002-CR-SU-US) and given free access to water and food. The handling and procedures of the mice were carried out under the supervision of the UPNA’s Comite de Etica, experimentacion Animal y Bioseguridad (CEEAB) and the approval of the competent authority (Gobierno de Navarra), in accordance with current European and national regulations and FELASA and ARRIVE welfare guidelines.
[0221] CD1 lactating mice with an average weight of ±40 g 10 - 12 days after parturition were used. As described in the protocol by Brouillette et al., an infection model was implemented (Brouillette et al., Mouse mastitis model of infection for antimicrobial compound efficacy studies against intracellular and extracellular forms of Staphylococcus aureus. Veterinary Microbiology, 2004). Prior to bacterial inoculation, each animal was anesthetized by intraperitoneal administration of ketamine (100 mg / kg body weight; Imalgene; Merial Laboratorios, S.A.) and xylazine (10 mg / kg; Rompun; Bayer Health Care). The pups were removed and inoculated into the mammary gland in the right (R4) abdomen using a 100 μL syringe with a 33-gauge blunt needle (Hamilton). 100 μl of suspended ±1×10 9 CFU / ml of Mycoplasma or suspended protein was administered through the opening of the mammary gland (1×10 8 CFU / mouse).
[0222] 3.1.b. Dose - responsive mastitis model For each inoculation condition, 5 CD - 1 lactating mice were used. The doses tested (CFU / mouse) were 5×10 4 , and 1.3×10 5 , and 1×10 6On the 1st day after inoculation (PI) (for S. aureus) or the 4th day (for Mycoplasma), the animals were sacrificed, the mammary glands were aseptically excised, weighed, and homogenized in phosphate-buffered saline (PBS). In the case of S. aureus, the kidneys were pooled, weighed, and homogenized. For each of S. aureus or Mycoplasma, the bacterial count was determined by plating serial dilutions of the samples on Tryptic Soy Agar (TSA) supplemented with 100 mg / ml of ampicillin (VWR) (H-Amp agar) or Hayflick (BD) plates.
[0223] 3.1.c. Growth curve For each time point, five CD-1 lactating mice were used. The doses (CFU / mouse) tested for Mycoplasma WT were 1×10 5 or 1×10 6 and for S. aureus 15981 it was 5×10 4 On days 1, 4, and 8 post-infection, the animals were sacrificed, the mammary glands were aseptically excised, weighed, and homogenized in PBS. The bacterial count was evaluated as described above. In addition, the difference in growth between WT and the modified Mycoplasma strains was also evaluated. Therefore, the modified Mycoplasma strains (e.g., CV2 strain) at a dose of 1×10 5 (CFU / mouse) were tested on both days 1 and 8.
[0224] 3.1.d. Screening of the pathogenicity of selected strains Five CD-1 lactating mice were used and the experiment was performed twice to analyze the pathogenicity of the strains in a mastitis mouse model. The animals were anesthetized, the pups were removed, and a 100 μL volume of the bacterial suspension was administered via the nipple opening as detailed above. Four days after infection, the animals were sacrificed, the mammary glands were excised, sectioned, and subjected to bacterial counting (see above for description) and interleukin (IL) detection (see Section 4).
[0225] 3.1.e. Histopathological analysis Pathological histological analysis and lesion scoring were performed on a part of the mammary gland fixed with 10% formaldehyde (Sigma) solution. Non-infected (PBS-administered) animals were used as control conditions. Five longitudinal slices of tissue obtained every 2 - 3 mm were embedded in paraffin. Sections of 4 - 6 μm were stained with hematoxylin and eosin by standard procedures to examine histological features (e.g., adenomatous lesions, secretory duct lesions, or inflammatory lesions). Lesion scoring was performed using a scoring scale of 0 - 4 (0, none to very low; 1, mild; 2, moderate; 3, strong; 4, very strong).
[0226] 3.1.f. Extraction of total mammary gland RNA and real-time quantitative PCR (RT-qPCR) analysis The right mammary gland was homogenized using an Ultra-Turrax (IKA), and then total RNA was isolated using an RNeasy® Mini Kit (Qiagen) according to the manufacturer's instructions. RNA concentration was measured spectrophotometrically using a Nanodrop One device (Thermo-Scientific), and RNA integrity was confirmed by agarose gel electrophoresis. RNA samples with an absorbance 260:280 nm ratio of 1.8 - 2.1 were retained for real-time reverse transcription PCR. Complementary DNA (cDNA) from total mammary gland cells was synthesized from 1 μg of total RNA using SuperScript II Reverse Transcriptase reagent (Invitrogen). PCR amplification was performed using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara), and fluorescence was analyzed with an AriaMx Real-Time PCR System (Agilent Technologies). The relative amount of mRNA normalized using GAPDH as a housekeeping gene was obtained using the comparative threshold cycle (Ct) method. Primer pairs for the detection of TNF-a, KC (IL-8), INF-y, IL-1b, IL-4, IL-6, IL-17, IL-18, IL-22, and GapdH mRNA are shown (Table 8).
[0227]
Table 15
[0228] 3.1.g. Preventive treatment of mastitis model To evaluate the effectiveness of the preventive mastitis model, CD1 female mice were used as described above. At the time of animal anesthesia, 100 μl of the treatment was inoculated into the mammary gland. Therefore, about 1×10 9 100 μl of a suspension of Mycoplasma WTDBLys P3 or CV2DBLysP3 at about 1×10 8 CFU / ml, recombinant lysostaphin (25 μg / mouse), or PBS (untreated) was inoculated with a blunt-ended gauge (Hamilton) (1×10 5 CFU / mouse). Thirty minutes later, the mice were challenged with 100 μl of an S. aureus 15981 suspension at about 5×10 4 UFC / ml (5×10
[0229] 3.1.h. Statistical analysis In each analysis, a p-value of <0.05 was considered statistically significant. Analyses were performed using the GraphPad Prism software, version 5.01 (GraphPad Software) statistical package.
[0230] 3.2. Mouse lung infection model. 3.2.a. Mycoplasma pneumoniae healthy lung infection in mice Male or female CD1, C57Bl / 6, and Balb / C mice (18 - 22 g) at 4 - 6 weeks of age were purchased from Charles River Laboratories (France) and housed under pathogen - free conditions at the Institute of Agrobiotechnology facilities (registration number ES / 31 - 2016 - 000002 - CR - SU - US) and used at 25 - 28 g. The handling and procedures of the animals were carried out in accordance with current European regulations (Directive 86 / 609 / EEC) and national regulations (Real Decreto 53 / 2013), following FELASA and ARRIVE guidelines, under the approval of the Universidad Publica de Navarra (UPNa) Animal Experimentation Committee (Comite de Etica, Experimentacion Animal y Bioseguridad) and the local authority. Using the Mycoplasma pneumoniae strain, in mice pre - anesthetized with 2% isoflurane (ISOFLO, Covegan), 100 μl of a bacterial suspension containing approximately 0.5×1×10 8 CFU / ml (approximately 0.5 - 1×10 7 CFU / mouse) was administered by intratracheal infection. If necessary, CD1 mice were infected with approximately 1×10 10 CFU / ml (approximately 1×10 9 CFU / mouse). The infection was carried out in groups of at least 5 mice per strain and time point (n≧5). At 2 or 4 dpi, after euthanizing the mice by cervical dislocation, the lungs were excised. The left lung was individually weighed in a sterile bag (VWR) and homogenized 1:10 (wt / vol) with PBS. Each homogenate was serially diluted 10 - fold with PBS and plated in triplicate on Hayflick - Amp100 agar to determine the number of CFUs per lung and for the essentiality assay. The right lung was fixed in 10% neutral buffered formalin for histological analysis or stored at - 80 °C for RNA extraction. The outline of the experiment is shown in Table 9.
[0231]
Table 16
[0232] 3.2.b. Mycoplasma pneumoniae mouse pulmonary emphysema lung infection Intratracheal administration of porcine pancreatic elastase (PPE) (EPC, Elastin Products Company) induced pulmonary emphysema. First, 10 mg containing 1,350 elastase units (U) was suspended in 10 ml of physiological serum (SSF) to generate a stock volume (1 mg / ml, i.e., 135 U / ml). To induce pulmonary emphysema, 17 days before infection, a single dose of 90 μl containing 6 elastase U / mouse was administered (Artaechevarria et al., Longitudinal study of a mouse model of chronic pulmonary inflammation using breath hold gated micro-CT, European radiology, 2010; Artaechevarria et al., Evaluation of micro-CT for emphysema assessment in mice: comparison with non-radiological techniques, 2011; Fernandez-Calvet et al., Modulation of Haemophilus influenzae interaction with hydrophobic molecules by the VacJ / MlaA lipoprotein impacts strongly on its interplay with the airways, Scientific reports, 2018). If necessary, the mice were randomly divided into the following three groups (n = 5): (i) control mice with normal lung function; (ii) mice with pulmonary emphysema; (iii) elastase vehicle solution. Using various M. pneumoniae strains, in mice pre-anesthetized with 2% isoflurane (ISOFLO, Covegan), approximately 0.5 - 1×10 8 CFU / ml (about 0.5 - 1×10 7Mice were infected intratracheally by administration of 100 μl of a bacterial suspension containing [[CFU / mouse]]. The left lungs were individually weighed in a sterile bag (VWR) and homogenized 1:10 (wt / vol) with PBS. Each homogenate was serially diluted 10-fold with PBS and plated in triplicate on Hayflick-Amp100 agar to determine the number of CFU per lung and for the essentiality assay. The right lungs were fixed in 10% neutral buffered formalin for histological analysis or stored at -80 °C for RNA extraction.
[0233] Histological analysis confirmed the presence of pulmonary emphysema in PPE-treated animals (all, p < 0.0001). At 2 dpi, interstitial pneumonia with peribronchial infiltration was identified in PPPE / CV2+ lungs compared to PPE / CV2-lungs (both, p < 0.05). On the other hand, at 4 dpi, histological findings were equivalent between the PPE / CV2+ and PPE / CV2-groups despite the fact that the CV2 strain showed higher numbers in PPE-treated lungs compared to vehicle lungs. Lungs infected with the CV2 chassis showed the same inflammatory profile as that observed in non-infected lungs, regardless of the lung status, at all time points tested.
[0234] 3.2.c. Essentiality of infection assay The remaining amount of the lung homogenate of the infected animal was passed through a 0.45 μm filter, and 100 μl was inoculated into a T25 flask containing 5 ml of Hayflick-Amp100-Tet2. This solution was cultured until the broth turned orange (±72 hours). At this point, the supernatant was decanted, 3 ml of PBS was added to this flask, and a cell scraper was used to collect the adhered Mycoplasma from the bottom of this flask. The total amount was aliquoted into 1 ml and stored at -20 °C until further use. The aliquot was thawed at room temperature, and after centrifugation (13,000 rpm, 5 minutes), the obtained pellet was used to extract the genome using the DNeasy® UltraClean Microbial Kit (Qiagen) according to the manufacturer's instructions. The DNA concentration was measured spectrophotometrically using a Nanodrop One device (Thermo-Scientific), and the integrity of the sample DNA was confirmed by 1% agarose gel electrophoresis. The genetic background was verified by PCR using the following primer pairs: qPCR_P1_F (5’ACGATGATTACAGGCGGTTC) + qPCR_P1_R (5’GTTGGTGGCCTCTTGTTGAT); MPN142_F (5’TCCCAGCAAGTGTGAACCC) + MPN142_R (5’GTTTTCGCTCATCAGGTCG); CARDS_F (5’CAAAAACAAGGACCCCGTCG) + CARDS_R (5’CATTCAACCCAAACCAAAGC); MPN133_F (5’ATTTGTCTAAGCGAGCTTCC) + MPN133_R (5’TTAATCTGGTAAGCCATTCG).
[0235] 3.2.d. Extraction of total lung RNA and real-time quantitative PCR (RT-qPCR) analysis The right lung was homogenized using an Ultra-Turrax (IKA), and total RNA was isolated using the RNeasy® Mini Kit (Qiagen) according to the manufacturer's instructions. RNA concentration was measured spectrophotometrically using a Nanodrop One device (Thermo-Scientific), and the integrity of the sample RNA was confirmed by 1% agarose gel electrophoresis. RNA samples with an absorbance ratio of 260:280 nm between 1.8 and 2.1 were used for real-time reverse transcription PCR (RT). Complementary DNA (cDNA) from total lung cells was synthesized from 1 μg of total RNA using SuperScript II Reverse Transcriptase reagent (Invitrogen). PCR amplification was performed using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara), and fluorescence was analyzed with an AriaMx Real-Time PCR System (Agilent Technologies). The relative amount of mRNA normalized using GAPDH as a suitable housekeeping gene was obtained using the comparative threshold cycle (Ct) method (Livak et al., Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Litvak C(T)) Method, Methods, 2001). Primer pairs for the detection of RNF-α, KC (IL-8), IFN-γ, MCP-1, MIP-1a, TLR2, IL-1b, IL-4, IL-6, IL-12p35, IL-12p40, IL-18, IL-23, and GAPDH mRNA are shown in Table 8.
[0236] 3.2.e. Statistical analysis In each analysis, a p-value of less than 0.05 was considered statistically significant. Analyses were performed using the Prism software, version 8 for Mac (GraphPad Software) statistical package, as indicated in the legends of each figure.
[0237] 4. Further Characterization of the Modified Mycoplasma Strains After generation, a number of parameters were experimentally evaluated to further characterize the resulting genetically modified Mycoplasma strains. These parameters include growth rate, peroxide production, pathogenicity, infectivity, and the inflammatory response induced in the host organism.
[0238] 4.1. Growth Curve The cell doubling time was calculated using two different methods. In the first approach, after removing the initial and late points of the growth curve, the qPCR arbitrary unit values were log2-transformed and then linear fitting was performed. In the second approach, exponential fitting of the data was performed. In addition, the final biomass was calculated by quantifying the total protein amount. Furthermore, an indirect estimate of biomass increase was derived by determining the maximum difference in log2 qPCR values. A summary of the results is presented in Table 10.
[0239]
Table 17
[0240] 4.1. Proteomics From the proteomics experiments, it has been shown that the genetically modified Mycoplasma bacteria described herein contain a modified proteome expression signature that contributes to improved properties when the Mycoplasma bacteria are introduced into a host organism. This proteomics experiment is performed according to the following standard protocol.
[0241] For proteome samples of various mutant strains, Mycoplasma strains were grown in the exponential growth phase. The medium was removed and the cells were washed twice with PBS. Total protein extracts were obtained by lysing the cells with 200 μl of lysis buffer (4% SDS, 0.1 M DTT and 0.1 M Hepes). Total protein extracts from two biological replicates were analyzed by LC / MS / MS. Briefly, samples were dissolved in 6 M urea, reduced with 10 mM dithiothreitol (37 °C, 60 min), and alkylated with 20 mM iodoacetamide (25 °C, 30 min). Samples were diluted six-fold with 0.2 M NH4HCO3 and then digested overnight at 37 °C with trypsin (protein:enzyme ratio of 10:1). Peptides generated during digestion were desalted, evaporated to dryness, and dissolved in 0.1% formic acid. 2.5 μl aliquots of each fraction (amounts in the range of 0.17 - 4 μg) were loaded onto an LTQ-Orbitrap Velos (Thermofisher) equipped with a nano spray source (Thermofisher) after nanoLC separation on an EasyLC system (Proxeon). Peptides were separated on a reverse phase column, 75 μm × 250 mm (Nikkaki Biosciences Co., Ltd.) with a gradient of 5 - 35% acetonitrile in 0.1% formic acid at a flow rate of 0.3 mL / min for 60 min. Orbitrap Velos was operated in positive ion mode with a nano spray voltage of 2.2 kv and a source temperature of 325 °C. In addition, 20 μg of the total extract was digested and desalted, and 1 μg of the resulting peptides was analyzed by Orbitrap Velos Pro under the same conditions as the fractions but with a longer gradient (120 min). A total of three biological replicates were performed, and in two independent experiments, two technical replicates were performed for each strain. Spectra were assigned to peptides by using Mascot and a customized database containing all ORFs longer than 19 amino acids. Protein amounts were estimated using only the regions of the three best unique peptides.
[0242] From these experiments, changes in protein expression of endogenous Mycoplasma strain proteins can be observed upon gene deletion.
[0243] 4.2 Metabolomics and Lipidomics Specifically, for genetically modified Mycoplasma strains obtained for the purpose of reducing or eliminating the risk of developing Guillain-Barré syndrome, metabolomics experiments enable a complete characterization of changes in galactocerebroside composition. Lipids were analyzed as previously described (Simbari et al., Plasmalogen enrichment in exosomes secreted by a nematode parasite versus those derived from its mouse host: implications for exosome stability and biology. Journal of Extracellular Vesicles 2016; and Barbacini et al., Regulation of serum sphingolipids in Andean Children born and living at high altitude (3775 m). International Journal of Molecular Sciences, 2019) while making some of the changes described below.
[0244] Phospholipids and neutral lipids: A total of 750 μl of a methanol-chloroform (1:2, vol / vol) solution containing internal standard substances (16:0 D31_18:1 phosphocholine, 16:0 D31_18:1 phosphoethanolamine, 16:0 D31-18:1 phosphoserine, 17:0 lysophosphocholine, 17:1 lysophosphoethanolamine, 17:1 lysophosphoserine, 17:0 D5_17:0 diacylglycerol, 17:0 / 17:0 / 17:0 triacylglycerol, and C17:0 cholesteryl ester, 0.2 nmol each, Avanti Polar Lipids) was added to the sample. The sample was vortexed, sonicated until it appeared dispersed, and extracted overnight at 48 °C. The sample was then evaporated, transferred to a 1.5 ml Eppendorf tube after adding 0.5 ml of methanol, evaporated to dryness, and stored at -80 °C until analysis. Before analysis, 150 μl of methanol was added to the sample, centrifuged at 13,000 g for 3 minutes, and 130 μl of the supernatant was transferred to an ultra-high performance liquid chromatography (UPLC) vial and injected for analysis.
[0245] Sphingolipids: A total of 750 μl of a methanol-chloroform (2:1, vol / vol) solution containing internal standard substances (N-dodecanoylsphingosine, N-dodecanoylglucosylsphingosine, N-dodecanoylsphingosylphosphorylcholine, C17-dihydrosphingosine, 0.2 nmol each, Avanti Polar Lipids) was added to 0.5 mg of the protein lysate. The sample was extracted overnight at 48 °C and cooled. Then, 75 μl of 1 M KOH in methanol was added, and the mixture was incubated at 37 °C for 2 hours. After adding 75 μl of 1 M acetic acid, the sample was evaporated to dryness and stored at -80 °C until analysis. Before analysis, 150 μl of methanol was added to the sample, centrifuged at 13,000 g for 5 minutes, and 130 μl of the supernatant was transferred to a new vial and injected.
[0246] The lipids were analyzed by liquid chromatography-high resolution mass spectrometry (LC-HRMS). The LC-HRMS analysis was performed using an Acquity ultra-high performance liquid chromatography (UHPLC) system (Waters, USA) connected to a Time of Flight (LCT Premier XE) Detector. Full scan spectra from 50 to 1800 Da were acquired and individual spectra were summed to create data points at 0.2 s intervals. Mass accuracy and reproducibility at a resolution of 10,000 were maintained by using an independent reference spray by LockSpray interference. The lipid extract was injected into an Acquity UHPLC BEH C8 column (1.7 μm particle size, 100 mm × 2.1 mm, Waters, Ireland) at a flow rate of 0.3 mL / min and a column temperature of 30 °C. The mobile phase was as follows: methanol (A) containing 2 mM ammonium formate and 0.2% formic acid / water (B) containing 2 mM ammonium formate and 0.2% formic acid. The linear gradient was programmed as follows: 0.0 min: 20% B; 3 min: 10% B; 6 min: 10% B; 15 min: 1% B; 18 min: 1% B; 20 min: 20% B; 22 min: 20% B.
[0247] Definitive identification of the compounds was performed based on accurate mass measurements with an error <5 ppm and their LC retention times compared to those of standards (92%).
[0248] Quantification was performed using the extracted ion chromatograms of each compound using a 50 mDa window. The linear dynamic range was determined by injecting a mixture of internal standards and natural standards. Since standards for all identified lipids were not available, the amount of lipid is shown as pmol equivalents relative to each specific standard.
[0249] Sphingolipids (Cer, ceramide; SM, sphingomyelin; and glycoCer, monohexosylceramide and dihexosylceramide), glycerophospholipids (PC, phosphatidylcholine; PE, phosphatidylethanolamine; and PS, phosphatidylserine), diacylglycerol (DAG), and triacylglycerol (TAG) were annotated using "C, followed by total fatty acyl chain length: total number of unsaturated bonds" and "lipid subclass" (e.g., C32:2-PC). When the sphingoid base residue was dihydrosphingosine, the name included the "DH" prefix. Plasmalogens and lysophospholipids were annotated with O- and L.
[0250] With some modifications, as described by Boutin et al. (Tandem Mass Spectrometry Multiplex Analysis of Glucosylceramide and Galactosylceramide Isoforms in Brain Tissues at Different Stages of Parkinson Disease. Anal. Chem. 2016), separation of glucosylceramide and galactosylceramide was achieved using an Acquity UPLC BEH HILIC column (1.7 μm particle size, 100 mm × 2.1 mm, Waters). The same LC-HRMS as described above was used.
[0251] 4.3. Genomics Genomics experiments have shown that the genetically modified Mycoplasma bacteria described herein contain a modified genomic signature that contributes to improved characteristics when the Mycoplasma bacteria are introduced into a host organism. The same observations can be made regarding the transcriptome of the modified Mycoplasma bacteria.
[0252] 4.4. Peroxide production Replacement of GlpD with GpsA (chassis CV8) allowed the observation of the absence of peroxide production (Figure 6).
[0253] 4.5. Pathogenicity and Infectivity 4.5.1. Mammary Model When WT M. pneumoniae and various chassis were infected, no histopathological lesions were observed in the mouse mammary glands (see Table 11 below). The CV2 strain had few lesions, and the CV16 strain was observed to behave as a WT Mycoplasma bacterium with respect to its hemorrhagic phenotype. Table 11 shows the relative hemorrhagic phenotypes observed for various strains.
[0254] [Table 18]
[0255] The macroscopic hemorrhagic phenotypes related to the hemorrhagic phenotypes of various chassis are shown in Figure 10. The persistence of the strains in the mammary glands was also evaluated, and the results are shown in Figures 11 and 12.
[0256] Furthermore, for some strains, the inflammatory response in the mammary glands was also evaluated. The results obtained are shown in Table 12.
[0257] [Table 19]
[0258] A significant response was observed for KC (IL8) in all cases except for WT KO MPN133 (corresponding to CV31). Similar results were obtained for the TRL2 receptor. The responses to other factors varied depending on the Mycoplasma strain and did not appear to show a consistent pattern.
[0259] 4.5.2. Lung Model Pathological histological analysis was performed on the lungs of mice CD1 infected with the WT, CV2, and CV8 chassis, and the results obtained are shown in FIGS. 13, 14, and 15. By double-blind analysis, it was found that the CV8 chassis showed no pathogenicity, which is consistent with the control condition in which the same amount of PBS as the inoculum containing this bacterium was inoculated into the lungs. From this result, it can be further seen that the WT is pathogenic and the CV2 chassis has an intermediate phenotype.
[0260] To verify whether the deletion of a protein or part of any other undesirable trait hypothesized to be involved in the pathogenicity of M. pneumoniae affects the survival in the lungs of infected animals, the animals were sacrificed 2 to 4 days after infection, and the infection was caused by about 10 7 bacterial cells. Lung extracts were prepared and plated on Petri dishes with appropriate antibiotics. Then, the number of colonies (CFU) was counted.
[0261] Animals were infected with 1.4×107 CFU of the WT strain and 7.8×106 of the CV2 chassis (FIG. 16). When comparing the WT strain, CV2 strain, and CV8 strain, no significant difference was observed in the bacterial load on the 2nd and 4th days. This experiment was repeated with various Mycoplasma strains as shown in FIG. 17. Here, it was observed that the CV16 strain (mpn453) lacking the adhesion protein p30 was washed (i.e., cleared) at a faster rate compared to the WT strain, SV2 strain, and control CV16 strain, suggesting that adhesion in the lungs is necessary for the chassis to persist in the lungs of infected animals.
[0262] In addition, CD1 mice were infected with approximately 10 7 CFU and the inflammatory response was monitored. The induction of various markers of inflammation is shown in Table 13.
[0263]
Table 20
[0264] In CD1 mice, a mild inflammatory response could be observed. The main consistent result was a significant increase in KC (IL-8) with the WT strain, CV2 strain, and CV8 strain, and a more prominent response regarding MIP-1a when using WT Mycoplasma. This experiment was repeated using 10 7 and 10 9 CFU, and cytokine induction was measured by qPCR (Table 14).
[0265]
Table 21
[0266] 10 7 When the infection with WT at 10 CFU was repeated, in line with Table 13, significant signals regarding KC (IL-8), MIP1a, and MCP1 could be observed. By increasing the bacterial volume up to 10^9, a very prominent response could be observed for all markers except IL-4 and IL-12. Interestingly, even with an increase in dosage, there was no change in the MCP-1 expression level.
[0267] 4.6. Replication and maintenance in vivo. To evaluate the in vivo replication rate of WT and CV8 Mycoplasma strains, time-course experiments were conducted with various Mycoplasma strains equipped with suicide vectors (WT_vec and CV8_vec respectively). At various time points, sampling of the Mycoplasma population was performed. When the Mycoplasma bacteria replicated at the mid-time point, the amount of genomic DNA (gDNA) increased proportionally to the suicide vector DNA. qPCR was used to quantify Mycoplasma gDNA and suicide vector DNA. After the initial proof-of-concept test in vitro, 10 8In the lung tissue, bronchoalveolar lavage fluid (BALF), and serum of test mice infected with CFU, it was found that the ratio of Mycoplasma gDNA to the suicide vector increased over time. The results obtained for BALF are shown in Figure 25.
[0268] The clearance rates of the WT_vec strain and the CV8_vec strain calculated as the decrease in CFU at 24 hours were very similar for both strains, being 66.6% and 63.6% for the WT_vec sample and the CV8_vec sample respectively (considering the average value of CFU estimated from the Ct value using the CFU plated in this experiment as the standard). At 6 hours, the average vector / cell ratios were 0.91 and 1.36 for the WT_vec sample and the CV8_vec sample respectively. At 24 hours, these values decreased to 0.3 and 0.28. This implies that in the case of WT_vec, the number of vectors per cell decreased by 3-fold, while in the case of CV8_vec, this decrease was 4 - 5-fold. In the first replication, the decrease in this ratio is halved, and in the next it will be 4-fold. This implies that at 18 hours, WT_vec carried out approximately 1.5 - 2 replications, and CV8_vec carried out 2 - 2.5 replications. This represents the in vivo doubling times of 9 - 12 hours and 7 - 9 hours for WT_vec cells and CV8_vec cells respectively. The slight differences observed between the strains could be artifacts of the in vivo assay, as indicated by the error bars for CV8_vec at 6 hours.
[0269] 4.7. Mycoplasma Transfer to Other Tissues Further experiments were conducted to evaluate whether M. pneumoniae bacteria spread to other tissues after the first administration to the lung. Mice were given 10 6Individual wild-type Mycoplasma bacteria doses were inoculated, or PBS was seeded as a negative control. After 6 and 48 hours, blood, liver, spleen, kidney, and trachea were evaluated for the presence of Mycoplasma. Mycoplasma could be detected in the trachea, lungs, and BALF of the subject animals (Table 15). Mycoplasma was not detected in the blood, liver, spleen, or kidney of the infected animals at any time point. Therefore, it can be concluded that Mycoplasma infection does not spread to other tissues.
[0270]
Table 22
[0271] The infection doses of wild-type bacteria, CV2 bacteria, or CV8 bacteria were increased (10 8 ), and a second experiment was conducted. Consistent with the first experiment, Mycoplasma could only be detected in lung tissue, BAL, and trachea (Table 16). This observation could be made for any of the test bacterial strains.
[0272]
Table 23
[0273] 4.8. Confirmation of results in BALBc mice. Another strain of mouse (BALBc) was used to confirm the results. BALBc mice have been reported to show exacerbation of the immune response after M. pneumoniae infection. The lung infection experiments described above were repeated using the WT strain, CV2 strain, and CV8 strain. Interestingly, it was observed that all strains persisted well in BALBc mice compared to CD1 mice (Figure 18), suggesting that in this mouse model, Mycoplasma is maintained longer and may therefore be a better model for studying the immune response caused by Mycoplasma infection.
[0274] 5. Rational design of M. pneumoniae strains that minimize or avoid the risk of Guillain-Barré syndrome onset in recipient hosts. MPN257 and MPN483 have been classified as important adaptive genes (Lluch et al, Molecular Systems Biology, 2015). Nevertheless, individual deletions of each gene were feasible (data not shown). However, these deletions impair the growth of M. pneumoniae in vivo (Figure 20). The deletion of MPN483 has a dramatic effect on the growth rate (Figure 20), and this effect is smaller in strains lacking MPN257.
[0275] Therefore, MPN483 was replaced with UDP-glucose instead of UDP-galactose:MG_517 (MG-517), MAGA_RS00300, or another processive glycosyltransferase that preferentially uses ugtP to improve the growth rate and prevent the formation of galactosyl-cerebroside and galactosyl-diacylglycerol. Mass spectrometry revealed that these three proteins are expressed in M. pneumoniae (see Table 17). Each of these proteins is expressed at a higher expression level compared to the MPN483 expression level.
[0276]
Table 24
[0277] Replacement of MPN483 with either MG_517 or MAGA_RS00300 significantly improved growth against MPN483 deletion (Figure 21A, B), but the improvement by ugtP insertion was limited, and only a slight improvement in growth was observed when compared with the MPN483 knockout strain (Figure 21C).
[0278] Further mass spectrometry analysis confirmed the hypothesis that the deletion of MPN483 results in the accumulation of toxic ceramides in M. pneumoniae, which could be a possible cause of the slow growth (Figure 22). Ceramide accumulation was improved in the ugtP strain, and ceramides did not accumulate in the MPN257 KO strain, or the MG_517 strain and the MAGA_RS00300 strain, which showed improved growth when compared to the MPN483 KO strain or the ugtP strain. This indicates that MPN483, like MG_517 and MAGA_RS00300, is a major cause of cerebroside formation in M. pneumoniae. Figure 22C shows the total concentration of monohexoside-ceramide, and Figure 22E shows the total concentration of dihexoside-ceramide. The levels of monohexoside-ceramide and dihexoside-ceramide are inversely correlated in the cases of MG_517, MAGA_RS00300, and KO MPN257 compared to WT. In the MG_517 strain and the MPN257 KO strain, in contrast to the MAGA_RS00300 strain, there are more monohexosides and fewer dihexoside-ceramides present when compared to WT. The ugtP strain contains more dihexoside-ceramide and a much higher content of monohexoside-ceramide when compared to the WT strain. Only the WT strain and the MPN483 KO strain contain a significant amount of mono-galactosylceramide. In contrast, the MAGA_RS00300 strain contains approximately 8 - 10 times less mono-galactosylceramide, while MG_517 and ugtP did not contain mono-galactosylceramide. Higher concentrations of mono-glucosylceramide could be observed in the cases of the MPN257 KO strain, the MG_517 strain, and the ugtP strain.
[0279] In mass spectrometry, it is impossible to distinguish between the various possible dihexoside-cerebrosides (Glu-Glu; Gal-Gal; Glu-Gal; and Gal-Glu). This means that galactocerebroside could not be detected in MG_517, KO MPN257, and ugtP, and very low values were detected in the MAGA_RS00300 strain, but galactose could have been present in the dihexoside-cerebrosides. To clarify whether this is true, commercially available antibodies against galactocerebroside (Merck #G9152) and glucosylceramide (RAS-0010 glycobiotech) were used in the final dot blot experiment (Figure 23). In the case of the WT strain, MPN483 KO strain, and UgtP strain, a clear positive signal could be observed. This signal was decreased in MG_517, almost disappeared in MAGA_RS00300, and was absent in MPN257 KO. In fact, the KO of MPN257 completely eliminated cerebrosides with galactose, thus confirming that no other enzymes with similar activity are present. The dot blot also supports the presence of mono-galactocerebroside during the KO of MPN483, and thus the idea that MPN025 and MPN078 may be involved in the formation of monohexose-cerebrosides but not in the formation of dihexose-cerebrosides, which are produced exclusively by MPN483, is supported. In the case of the MG_517 strain and the ugtP strain, this finding suggests that there is no mono-galactocerebroside, but there may be dihexoside-cerebrosides with galactose bound to glucosylceramide. This does not seem to be the case for the MAGA_RS00300 strain, because the very weak signal that can be observed in the Western blot corresponds to a small amount of mono-galactocerebroside and not to the presence of dihexoside-cerebrosides with galactose.
[0280] Accordingly, as a conclusion, a beneficial M. pneumoniae strain that has a minimal possibility of developing Guillain-Barré syndrome in a recipient and grows well does not contain either a functional MPN257 gene or a functional MPN483 gene, and the function of the MPN483 gene is replaced by any glycosyltransferase that uses UDP-glucose instead of UDP-galactose (e.g., MAGA_RS00300, MG_517, or a combination thereof) in M. pneumoniae.
[0281] 6. Acknowledgment of Financial Support The project leading to this application has received funding from the European Union’s Horizon 2020 research and innovation programme and the European Research Council (ERC) under grant agreement numbers 634942 (MycoSynVac) and 670216 (MycoChassis), respectively.
Claims
1. A genetically modified Mycoplasma bacterium, wherein the Mycoplasma bacterium contains in its genome one or more nucleotide deletions, substitutions, and / or insertions in the operon of the Ca2+-dependent cytotoxic nuclease gene (MPN133) and the ADP-ribosyltransferase CARDS gene (MPN372), thereby causing deletion or inactivation of the gene, and the deletions, substitutions, and / or insertions result in a decrease in the pathogenicity and / or immunogenicity of the Mycoplasma bacterium compared to the reference M129-B7 Mycoplasma pneumoniae bacterium, and the decrease in pathogenicity and / or immunogenicity results in at least a 30% decrease in toxicity when introduced into a host organism compared to the reference M129-B7 Mycoplasma pneumoniae bacterium. , a genetically modified Mycoplasma bacterium.
2. The genetically modified Mycoplasma bacterium according to claim 1, wherein the bacterium further contains one or more nucleotide deletions, substitutions, and / or insertions in a gene or operon encoding a peroxide-producing protein.
3. The genetically modified Mycoplasma bacterium according to claim 2, wherein the gene or operon encoding the peroxide-producing protein is a gene or operon encoding glycerol 3-phosphate dehydrogenase (MPN051).
4. The genetically modified Mycoplasma bacterium according to claim 1 or 2, wherein the bacterium further contains one or more nucleotide deletions, substitutions, and / or insertions in one or more genes or operons encoding a protein capable of inducing Guillain-Barré in a host organism.
5. The Mycoplasma bacteria include M. adleri, M. agalactiae, M. agassizii, M. alkalescens, M. alligatoris, M. alvi, M. amphoriforme, M. anatis, M. anseris, M. arginine, M. arthritidis, M. auris, M. bovigenitalium, M. bovirhinis, M. bovis, M. bovoculi, M. buccale, M. buteonis, M. californicum, M. canadense, M. canis, M. capricolum, M. capricolum subsp. capricolum, M. capricolum subsp. capripneumoniae, M. caviae, M. cavipharyngis, M. ciconiae, M. citelli, M. cloacale, M. collis, M. columbinasale, M. columbinum, M. columborale, M. conjunctivae, M. corogypsi, M. cottewii, M. cricetuli, M. crocodili, M. cynos, M. dispar, M. edwardii, M. elephantis, M. equigenitalium, M.equigenitalium), M. equirhinis, M. falconis, M. fastidiosum, M. faucium, M. felifaucium, M. feliminutum, M. felis, M. feriruminatoris, M. fermentans, M. flocculare, M. gallinaceum, M. gallinarum, M. gallisepticum, M. gallopavon is, M. gateae, M. genitalium, M. glycophilum, M. gypis, M. haemocanis, M. haemofelis, M. haemomuris, M. hominis, M. hyopharyngis, M. hyopneumoniae, M. hyorhinis, M. hyosynoviae, M. iguana, M. imitans, M. indiense, M. iners, M. iowae, M. lagogenitalium, M. leachii, M. leonicaptivi, M. leopharyngis, M. lipofaciens, M. lipophilum, M. maculosum, M. meleagridis, M. microti, M. moatsii, M. mobile, M. molare, M. mukosikanis, M.Mucosicanis), M. muris, M. mustelae, M. mycoides, M. mycoides subsp. capri, M. mycoides subsp. mycoides, M. neophronis, M. neurolyticum, M. opalescens, M. orale, M. ovipneumoniae, M. ovis, M. oxoniensis, M. penetrans, M. phocicerebrale, M. phocidae, M. phocirhinis, M. pirum, M. pneumoniae, M. primatum, M. pullorum, M. pulmonis, M. putrefaciens, M. salivarium, M. simbae, M. spermatophilum, M. spumans, M. sturni, M. sualvi, M. subdolum, M. suis, M. synoviae, M. testudineum, M. testudinis, M. tullyi, M. verecundum, M. wenyonii, M. yeatsii, and M. coccoides, the genetically modified Mycoplasma bacterium according to any one of claims 1 to 3.
6. The bacterium according to any one of claims 1 to 5, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon encoding a second (surface) nuclease.
7. The bacterium according to any one of claims 1 to 6, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in one or more genes or operons encoding a cell adhesion protein.
8. The bacterium according to any one of claims 1 to 7, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon encoding an immunogenic protein capable of inducing an immune response in a host organism.
9. The bacterium according to any one of claims 1 to 8, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon encoding a protein that inhibits the growth of the bacterium in a bioreactor.
10. The bacterium according to any one of claims 1 to 9, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in one or more genes or operons encoding a lipoprotein.
11. The bacterium according to any one of claims 1 to 10, comprising a deletion, substitution, and / or insertion of one or more nucleotides in prolipoprotein diacylglyceryl transferase and prolipoprotein signal peptidase.
12. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 11, wherein the bacterium further comprises a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon encoding an oncogenic protein.
13. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 12, wherein the bacterium further comprises a deletion, substitution, and / or insertion of one or more nucleotides in a gene or operon encoding an RNA polymerase factor.
14. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 13, wherein the bacterium further comprises a deletion, substitution, and / or insertion of one or more nucleotides in one or more genes or operons encoding a secreted Mycoplasma gene product.
15. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 14, wherein the reduction in pathogenicity and / or immunogenicity is characterized by a reduction in toxicity of at least 50% when the bacterium is introduced into a host organism compared to a reference Mycoplasma bacterium.
16. The genetically modified Mycoplasma bacterium according to claim 15, wherein the reduction in toxicity is evaluated by measuring the inflammatory response in the lung.
17. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 16, wherein the Mycoplasma bacterium comprises a nucleotide sequence encoding a foreign gene product or a functional fragment thereof.
18. The genetically modified Mycoplasma bacterium according to claim 17, wherein the foreign gene product or the functional fragment thereof is a protein.
19. The bacterium is a genetically modified Mycoplasma bacterium according to any one of claims 1 to 18, obtained by introducing one or more deletions, substitutions, and / or insertions of the one or more nucleotides into one or more genes or operons of the Mycoplasma bacterium genome by recombinant DNA technology.
20. The genetically modified Mycoplasma bacterium according to any one of claims 1 to 19, wherein the genome comprising one or more deletions, substitutions, and / or insertions of one or more nucleotides is partially obtained by chemical synthesis.
21. The Mycoplasma bacterium according to any one of claims 1 to 20 for use as a medicament.
22. The Mycoplasma bacterium according to any one of claims 1 to 20 for use as a vaccine.
23. The Mycoplasma bacterium for use according to claim 22, which exhibits at least one distinct exogenous proteinogenic sequence on its surface.
24. The Mycoplasma bacterium for use according to claim 23, wherein the at least one exogenous proteinogenic sequence is an exogenous antigenic sequence.
25. The Mycoplasma bacterium according to any one of claims 1 to 20 for use in modulating the composition of the lung microbiome of a subject. **Claim 26** A method for producing an attenuated Mycoplasma bacterium, which is characterized in that the toxicity is reduced by at least 30% when introduced into a host organism as compared with Mycoplasma pneumoniae bacterium M129-B7. The method includes introducing one or more nucleotide deletions, substitutions, and / or insertions in one or more nucleotides in the operon of the Ca2+-dependent cytotoxic nuclease gene (MPN133) and the ADP-ribosyltransferase CARDS gene (MPN372) in Mycoplasma bacteria, thereby causing the removal or inactivation of the gene. **Claim 27** The method according to claim 26, wherein the one or more nucleotide deletions, substitutions, and / or insertions are introduced into living Mycoplasma bacteria by a site-specific recombinase, random transposon insertion, and / or site-specific nuclease. **Claim 28** The method according to claim 26 or 27, wherein the method includes preparing a synthetic genome or a part thereof and transferring the synthetic genome (or a part thereof) to a naturally occurring Mycoplasma bacterium. **Claim 29** The method according to claim 28, wherein the method further includes inactivating, degrading, and / or removing the original genome of the living Mycoplasma bacterium. **Claim 30** Use of the attenuated Mycoplasma bacterium according to any one of claims 1 to 20 for the production of at least one exogenous gene product or a fragment thereof. **Claim 31** A pharmaceutical composition comprising at least one of the genetically modified Mycoplasma bacteria according to any one of claims 1 to 20. **Claim 32** The genetically modified Mycoplasma bacterium according to any one of claims 1 to 20, further comprising a deletion, substitution, and / or insertion of one or more nucleotides in at least one gene or operon selected from the group consisting of Table 1.
Citation Information
Patent Citations
Methods and Compositions for Mycoplasma Toxins
US20090104185A1