Method for detecting a target molecule

Abstract

This method for detecting a surface target molecule and an internal target molecule of a structure comprises steps for: bringing a liquid having a structure dispersed therein into contact with a well array having a plurality of wells so as to introduce the structure into the wells; bringing an encapsulation liquid into contact with the well array so as to cause the structure to be encapsulated within each of the wells; extracting content of the structure within each of the wells; detecting at least one type of surface target molecule present on the surface of the structure within each of the wells; and detecting at least one type of internal target molecule present inside the structure within each of the wells.

Description

Technical Field

[0001] The present invention relates to a method for detecting a target molecule. More specifically, it relates to a method for detecting a surface target molecule present on the surface of a structure and an internal target molecule present inside the structure, a method for evaluating the structure, and a kit. This application claims priority to Japanese Patent Application No. 2019-095187 filed in Japan on May 21, 2019, the content of which is incorporated herein by reference.

Background Art

[0002] By quantitatively detecting a target molecule in a biological sample, early detection of diseases and prediction of the effect of medication are carried out. Conventionally, protein quantification has been performed by enzyme-linked immunosorbent assay (ELISA) or the like, and nucleic acid quantification has been performed by real-time PCR or the like.

[0003] In recent years, for the purpose of detecting diseases earlier, the need to detect target molecules more accurately has been increasing. As a technique for accurately detecting target molecules, for example, Patent Document 1, Patent Document 2, Non-Patent Document 1, etc. describe techniques for performing an enzyme reaction in a large number of microcompartments. These techniques are called digital measurement.

[0004] In digital measurement, a sample solution is divided into an extremely large number of micro solutions. Then, the signals from each micro solution are binarized, and only whether or not a target molecule is present is discriminated to measure the number of target molecules. According to digital measurement, the detection sensitivity and quantification can be significantly improved compared to conventional ELISA, real-time PCR methods, etc.

[0005] In digital PCR, the mixture of the PCR reaction reagent and the nucleic acid is diluted so that the number of nucleic acids serving as templates present in one microdroplet is zero or one. In digital PCR, in order to increase the sensitivity of nucleic acid amplification and to perform nucleic acid amplification simultaneously on a large number of microdroplets, it is preferable that the volume of each microdroplet is small. For example, Patent Document 3 discloses an array-shaped reaction vessel formed such that the volume of each well is 6 nL (nanoliters). Further, Patent Document 1 discloses a method of introducing a sample into each well by flowing the sample through a flow path in which a large number of wells having a depth of 3 μm and a diameter of 5 μm are formed, introducing the sample into each well, and then extruding the excess reagent in the flow path with oil.

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Patent Document 2

Patent Document 3

Non-Patent Documents

[0007]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0008] An object of the present invention is to provide a technique for detecting target molecules present outside and inside a structure.

Means for Solving the Problems

[0009] [1] Contact a liquid in which a structure is dispersed with a well array having a plurality of wells to introduce the structure into the wells; contact a sealing liquid with the well array to encapsulate the structure in the wells; extract the contents of the structure in the wells; detect at least one surface target molecule present on the surface of the structure in the wells; and detect at least one internal target molecule present inside the structure in the wells, Detection of the surface target molecule and detection of the internal target molecule are performed under the same conditions. Extracting the contents of the structure, detecting the surface target molecule, and detecting the internal target molecule are performed after encapsulating the structure in the wells, Detection of the internal target molecule is performed by a signal amplification reaction, the signal amplification reaction is an Invasive Cleavage Assay, the surface target molecule contains a protein, and the internal target molecule contains a nucleic acid. A method for detecting surface target molecules and internal target molecules of the structure. [2] The method according to [1], wherein detecting the surface target molecule and detecting the internal target molecule are performed after extracting the contents of the structure. [3] The method according to any one of [1] or [2], wherein detecting the surface target molecule and detecting the internal target molecule are performed simultaneously. 。 [4 The signal detected in detecting the surface target molecule and the signal detected in detecting the internal target molecule are distinguishable from each other in [1] to 3 The method according to any one of ]. 5 The structure is any one selected from the group consisting of a virus, an exosome, a cell, and an endoplasmic reticulum in [1] to 4 The method according to any one of ]. 6 The structure forms a complex with a capture agent, and the capture agent is a conjugate of a solid phase and a specific binding substance for the structure in [1] to 5 The method according to any one of ]. 7 The specific binding substance is an antibody, 6 The method according to ]. 8 ​​​​Extracting the content of the structure is to heat the structure in a liquid containing a surfactant, [1] to 7 The method according to any one of [1] to 9 When introducing the structure into the well, one or less of the structures are introduced per well, [1] to 8 The method according to any one of [1] to 10 9 Detecting the presence or absence of the surface target molecule and the internal target molecule for each well by the method described in 11 [1] to 9 A kit for performing the method for detecting the surface target molecule and the internal target molecule of the structure according to any one of [1] to [Advantages of the Invention]

[0010] According to the present invention, it is possible to provide a technique for detecting target molecules present outside and inside a structure. [Brief Description of the Drawings]

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7A

Figure 7B

Figure 8A

Figure 8B

Figure 9

Figure 10

Figure 11

[0012] Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings as appropriate. In the drawings, the same or corresponding parts are denoted by the same or corresponding reference numerals, and duplicate explanations are omitted. Note that the dimensional ratios in each figure are exaggerated for the purpose of explanation and do not necessarily match the actual dimensional ratios.

[0013] [Method for Detecting Surface Target Molecules and Internal Target Molecules of a Structure] In one embodiment of the present invention, a liquid in which a structure is dispersed is brought into contact with a well array having a plurality of wells, the structure is introduced into the wells, a sealing liquid is brought into contact with the well array, the structure is encapsulated within the wells, the content of the structure is extracted within the wells, at least one surface target molecule present on the surface of the structure within the wells is detected, and at least one internal target molecule present within the structure within the wells is detected, thereby providing a method for detecting the surface target molecule and the internal target molecule of the structure. Note that introducing the structure may be expressed as an introduction step. Similarly, extracting the content of the structure may be expressed as an extraction step. Detecting the surface target molecule may be expressed as a surface target molecule detection step. Detecting the internal target molecule may be expressed as an internal target molecule detection step.

[0014] As will be described later in the examples, at least one surface target molecule present on the surface of the structure and at least one internal target molecule present within the structure can be detected by the method of this embodiment.

[0015] In this specification, a surface target molecule refers to a molecule that is exposed and present on the surface of a structure and is a molecule to be detected. An internal target molecule refers to a molecule that is encapsulated within the structure and is not exposed on the surface and is a molecule to be detected. In order to detect an internal target molecule, it is necessary to extract the content from the structure to expose the internal target molecule.

[0016] According to the method of this embodiment, it is also easy to detect surface target molecules and internal target molecules at the single structure level.

[0017] (Structure) The structure is not particularly limited as long as it has a surface where surface target molecules are exposed and an internal structure containing internal target molecules, and any structure can be used. Specific examples of the structure include viruses, exosomes, cells, and endoplasmic reticulum. Examples of cells include eukaryotic cells and prokaryotic cells. Examples of eukaryotic cells include animal cells, plant cells, insect cells, yeast cells, and fungal cells. Examples of prokaryotic cells include bacteria. Examples of endoplasmic reticulum include the endoplasmic reticulum as an organelle within the cell and natural or artificial membrane vesicles composed of lipid membranes. The structure may be present in a biological sample. The biological sample is not particularly limited, and examples include serum, plasma, and urine.

[0018] (Well) The well array has a plurality of wells. Each well has a size capable of accommodating the above-described structure and the reagents used for extracting the contents of the structure, detecting surface target molecules, and detecting internal target molecules, which will be described later. Its shape and arrangement are not particularly limited.

[0019] Also, the well may be used without treatment, or depending on the purpose, an extraction reagent for extracting the contents of the structure, an antibody, a specific binding substance for the structure, etc. may be immobilized on the inner wall of the well in advance.

[0020] (Fluid device) FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. As shown in FIG. 1, the well array 140 may be arranged adjacent to the flow path 130 of the fluid device 100 including the flow path 130. As shown in FIG. 1, the fluid device 100 includes a substrate 110 and a lid member 120 (which may be simply referred to as the lid 120) arranged to face the substrate 110. The lid member 120 has a convex portion 121. The tip of the convex portion 121 is in contact with the substrate 110. In the fluid device 100, the well array 140 is integrally formed with the substrate 110 on one surface of the substrate 110 and faces the lid member 120. The well array 140 has a plurality of wells 141. The plurality of wells are connected to the flow path 130. The lid member 120 may be welded or adhered to the substrate 110.

[0021] Well 141 has an opening on the surface of substrate 110. The shape, dimensions, and arrangement of well 141 are not particularly limited, but it is preferable that one structure is introduced into one well 141. Well 141 is preferably a micro well with a small volume. For example, the volume of one well 141 may be about 10 fL to 100 pL. In fluid device 100, a plurality of wells 141 of the same shape and size constitute well array 140. The same shape and size means that they only need to have the same shape and the same capacity to the extent required for digital measurement, and variations within the range of manufacturing errors are acceptable.

[0022] The diameter of well 141 may be, for example, about 1 to 10 μm. The depth of well 141 may be, for example, about 1 to 10 μm. Also, the arrangement of wells 141 is not particularly limited, and for example, they may be arranged in a triangular lattice, a square lattice, or randomly.

[0023] In fluid device 100, due to the presence of convex portion 121, a space is formed between well array 140 and lid member 120. This space constitutes flow path 130. Flow path 130 functions as a path for feeding the liquid in which the structures are dispersed and the sealing liquid. The shape, structure, capacity, etc. of flow path 130 are not particularly limited, but the height of flow path 130, that is, the distance between the surface of substrate 110 and the surface of lid member 120 facing substrate 110, may be, for example, 500 μm or less, or may be, for example, 300 μm or less, or may be, for example, 200 μm or less, or may be, for example, 100 μm or less.

[0024] Convex portion 121 may be integrally formed with lid member 120. Lid member 120 can be formed into a plate shape having convex portion 121, for example, by molding a fluid of a thermoplastic resin using a mold. Also, a reagent introduction port 122 and a discharge port 123 may be formed in lid member 120.

[0025] When the lid member 120 has the convex portion 121, the lid member 120 and the substrate 110 are overlapped such that the convex portion 121 contacts the surface of the substrate 110 where the well 141 opens. As a result, the space between the lid member 120 and the substrate 110 becomes a flow path. The lid member 120 and the substrate 110 may be welded by laser welding or the like.

[0026] (Modification Example 1 of Fluid Device) The fluid device used in the method of the present embodiment is not limited to the fluid device 100 described above. FIG. 4 is a schematic cross-sectional view showing an example of a fluid device. As shown in FIG. 4, the fluid device 200 includes a substrate 110 and a wall member 210 (which may be simply referred to as the wall portion 210). In the fluid device 200, the well array 140 is integrally formed with the substrate 110 on one surface of the substrate 110. The well array 140 has a plurality of wells 141.

[0027] The fluid device 200 is mainly different from the fluid device 100 described above in that it does not have a lid member 120. Therefore, the fluid device 200 does not have a flow path.

[0028] (Modification Example 2 of Fluid Device) In the fluid device 100 described above, the lid member 120 and the convex portion 121 are integrally formed. However, the lid member 120 and the convex portion 121 may be formed separately.

[0029] Also, in the fluid device 100 and the fluid device 200 described above, the well array 140 is integrally formed with the substrate 110 on one surface of the substrate 110. However, the well array may not be integrally formed with the substrate 110. For example, a well array 140 formed separately from the fluid device 100 may be disposed on the substrate 110 of the fluid device. Alternatively, a resin layer may be laminated on the surface of the substrate 110, and a well array may be formed in the resin layer by etching or the like.

[0030] (Modification Example 3 of Fluid Device) In the fluid device 100 described above, the well array is formed on the substrate 110. However, the well array may be provided on the lid member 120. As another aspect, a well array molded separately from the fluid device 100 may be disposed on the lid member 120 of the fluid device 100. Alternatively, a resin layer may be laminated on the surface of the lid member 120, and a well array may be formed in the resin layer by etching or the like. Alternatively, a well array may be formed directly on the surface of the lid member 120.

[0031] (Material of the fluid device) The substrate 110 is formed using, for example, a resin. The type of resin is not particularly limited, but a resin resistant to reagents and sealing liquids is preferred. Also, when the signal to be detected is fluorescence it is preferably a resin with low autofluorescence. For example, cycloolefin polymer, cycloolefin copolymer, silicon, polypropylene, polycarbonate, polystyrene, polyethylene, polyvinyl acetate, fluororesin, and amorphous fluororesin, etc. can be mentioned, but are not limited thereto.

[0032] A plurality of wells 141 may be formed on one surface of the substrate 110 in the plate thickness direction. In other words, a plurality of wells 141 having a depth in the plate thickness direction may be formed on one surface of the substrate 110. Examples of the method for forming wells using resin include injection molding, thermal imprinting, and photolithography.

[0033] Alternatively, for example, a fluororesin may be laminated on the substrate 110, and the fluororesin may be processed by etching or the like to form a well array. As the fluororesin, for example, CYTOP (registered trademark) (Asahi Glass) etc. can be used.

[0034] Also, when the fluid device has a lid member 120, the material of the lid member 120 is preferably a resin with low autofluorescence, and may be a thermoplastic resin such as cycloolefin polymer and cycloolefin copolymer, etc.

[0035] Further, the lid member 120 may be formed of a material that does not transmit light having a wavelength near the wavelength detected when observing fluorescence of the signal, or may be formed of a material that does not transmit light at all. For example, the lid member 120 may be formed of a thermoplastic resin added with carbon or metal particles or the like.

[0036] (Conventional method for detecting target molecules) With reference to FIGS. 1 to 3, a conventional method for detecting a target molecule by digital measurement will be described by taking as an example the case where the fluid device 100 is used.

[0037] First, as shown in FIG. 1, a reagent solution L110 is introduced from the introduction port 122 of the fluid device 100 and sent to the flow path 130. The reagent solution L110 contains a target molecule. The concentration of the target molecule contained in the reagent solution L110 is adjusted to a concentration at which the target molecule enters each well in the well 141 at a concentration of 1 molecule or less per well. The reagent solution L110 sent to the flow path 130 is stored inside a plurality of wells 141.

[0038] Subsequently, as shown in FIG. 2, a sealing liquid L120 is sent from the introduction port 122 of the lid member 120 to the flow path 130 between the substrate 110 and the lid member 120 to individually seal a plurality of wells 141. As the sealing liquid, for example, an oily oil can be used. The sealing liquid L120 flushes out and replaces the reagent solution L110 that is not stored in the well 141 among the reagent solutions L110 sent to the flow path 130. Thereby, the sealing liquid L120 individually seals a plurality of wells 141 containing the reagent solution L110 containing the target molecule, and the wells 141 become independent reaction spaces, that is, micro compartments 142.

[0039] Subsequently, as shown in FIG. 3, a predetermined reaction is performed in the well 141, and the generated signal is observed. The well 142R is a well in which a signal is detected, and the well 142 is a well in which a signal is not detected.

[0040] In the conventional detection method, when detecting target molecules such as nucleic acids and proteins contained in structures such as cells and viruses, the target molecules are extracted from the structure in advance, mixed with the reagent solution L110, and then fed. Therefore, the target molecules may be lost and decreased in the stage of extracting the target molecules from the structure and in the feeding process. In addition, the target molecules may not be contained in the well 141, remain inside the flow path 130, be washed away by the sealing liquid L120, and no signal amplification reaction may be observed in the reaction process, resulting in the non-detection of their presence. As a result, the target molecules contained in the structure may not be accurately detected. Also, even when the target molecules can be detected, the structure and the detected target molecules cannot be associated with each other.

[0041] Subsequently, with reference to FIGS. 4 to 6, a conventional method for detecting target molecules by digital measurement will be described by taking the case of using the fluid device 200 as an example. In this case, the method disclosed in International Publication No. 2016 / 006208 can be used for detection.

[0042] First, as shown in FIG. 4, the reagent solution L110 is introduced into the fluid device 200. The reagent solution L110 contains target molecules. The concentration of the target molecules contained in the reagent solution L110 is adjusted to a concentration such that the number of target molecules per well in the well 141 is 1 molecule or less. The reagent solution L110 is contained inside a plurality of wells 141.

[0043] Subsequently, as shown in FIG. 5, the sealing liquid L120 is introduced into the fluid device 200. The specific gravity of the sealing liquid L120 is greater than that of the reagent solution L110. Therefore, the sealing liquid L120 sinks below the reagent solution L110 that is not contained in the well 141 and contacts the well array 140. Then, the sealing liquid L120 individually seals each of the plurality of wells 141 containing the reagent solution L110 containing the target molecules, and the well 141 becomes an independent reaction space, that is, a micro-compartment 142.

[0044] Subsequently, as shown in FIG. 6, a predetermined reaction is performed in well 141, and the generated signal is observed. Well 142R is the well in which the signal was detected, and well 142 is the well in which the signal was not detected.

[0045] (Detection method of this embodiment) Subsequently, with reference to FIGS. 1 to 3 as appropriate, the method of this embodiment will be described by taking the case of using the fluid device 100 as an example. The method of this embodiment is a method for detecting surface target molecules and internal target molecules of a structure. A liquid in which the structure is dispersed is brought into contact with a well array having a plurality of wells to introduce the structure into the wells, a sealing liquid is brought into contact with the well array to enclose the structure in the wells, the content of the structure is extracted in the wells, at least one type of surface target molecule present on the surface of the structure in the wells is detected, and at least one type of internal target molecule present inside the structure in the wells is detected.

[0046] According to the method of this embodiment, the structure, the surface target molecule, and the internal target molecule can be detected in association with each other. That is, the surface target molecule and the internal target molecule can be detected at the level of one structure. When the surface target molecule and the internal target molecule are detected by the method of this embodiment, it can be said that the surface target molecule and the internal target molecule were present on the surface and inside of one structure.

[0047] According to the method of this embodiment, two or more types of target molecules including surface target molecules and internal target molecules can be detected. Also, a plurality of types of surface target molecules can be detected. Further, a plurality of types of internal target molecules can be detected.

[0048] 《Introduction of the structure into the well》 In this project, as shown in FIG. 1, the reagent solution L110 is introduced from the introduction port 122 of the fluid device 100 and sent to the flow path 130. The reagent solution L110 is a liquid in which structures are dispersed. The reagent solution L110 also includes reagents for detecting surface target molecules and internal target molecules. At the time when the reagent solution L110 is sent to the flow path 130, the reagent for detecting the surface target molecules may or may not be bound to the surface target molecules.

[0049] In the conventional method, the reagent solution L110 contains target molecules extracted from the structure in advance. On the other hand, in the method of this embodiment, the reagent solution L110 is different from the prior art in that it contains the structure itself. That is, the reagent solution L110 contains the structure.

[0050] The reagent solution L110 sent to the flow path 130 contacts the well array 140. Then, the reagent solution L110 is accommodated inside the well 141. As a result, the structure is introduced into the well 141.

[0051] The number of structures introduced into one well in the introduction step is not particularly limited, but preferably, one or less, that is, 0 or 1 structure is introduced into one well. Thereby, the detection of the structure can be performed in units of one, that is, digital measurement is possible. Also, it is not necessary for all the wells of the well array to be introduced with structures.

[0052] The means for introducing the structure into the well is not particularly limited, and an appropriate means can be selected according to the selected structure. For example, a method of sedimenting the structure in the fluid device (in the flow path) by its own weight and distributing it to the well can be mentioned. Alternatively, a substance (capture substance) for capturing the structure by the method described later may be used, and the capture substance may be bound to the structure that is difficult to sediment by its own weight to form a complex and then sent. Also, by previously immobilizing the capture substance in the well and capturing the sent structure to form a complex, the introduction efficiency of the structure into the well can be improved.

[0053] A capture object having a specific gravity smaller than that of the reagent solution L110 may be bound to the structure, and the reagent solution L110 may be fed to introduce the structure into the well. In this case, the structure can be introduced into the well by feeding the reagent solution L110 in a state where the fluid device 100 is turned upside down so that the substrate 110 is on the upper side and the lid member 120 is on the lower side. Further, when using the fluid device described in the third modification of the fluid device, the structure can be introduced into the well formed in the lid member 120. In addition, when the specific gravity of the structure is smaller than that of the reagent solution L110, the structure can be introduced into the well by the same method.

[0054] The step of binding the capture object to the structure can be performed at any point in the method of the present embodiment. For example, this step may be performed by bringing the structure and the capture object into contact with each other in the sample tube before introducing the structure into the well. The contact between the structure and the capture object may be performed by adding the capture object to the reagent solution L110 containing the structure. Further, the structure and the capture object may be brought into contact with each other and then mixed with a solution containing a reagent for detecting the surface target molecule and the internal target molecule. Alternatively, after introducing the capture object into the well, the structure may be introduced into the well, and the capture object and the structure may be brought into contact with each other in the well to form a complex.

[0055] The capture object is a substance that can capture the structure. The capture object may be, for example, a conjugate of a solid phase and a specific binding substance for the structure. The specific binding substance may be an antibody.

[0056] Examples of the solid phase include particles, membranes, and substrates. The specific binding substance for the structure may be at least one type. For example, it may be three types, four types, or five or more types.

[0057] The particles are not particularly limited, and examples include polymer particles, magnetic particles, and glass particles. The particles are preferably particles that have been surface-treated to avoid non-specific adsorption. Also, particles having a functional group such as a carboxyl group on the surface are preferred for immobilizing the specific binding substance. More specifically, products such as the product name "Magnosphere LC300" manufactured by JSR can be used.

[0058] Alternatively, for example, when using a virus as a structure, cells to which the virus can adhere (i.e., cells having a virus receptor) may be used as the capture.

[0059] Examples of the specific binding substance include antibodies, antibody fragments, aptamers, and lectins. Examples of antibody fragments include Fab, F(ab’)2, Fab’, single-chain antibody (scFv), disulfide-stabilized antibody (dsFv), dimerized V-region fragment (Diabody), and peptides containing CDR. The antibody may be a monoclonal antibody or a polyclonal antibody. Also, a commercially available antibody may be used.

[0060] The method for immobilizing the specific binding substance on the particle surface is not particularly limited, and examples include a method by physical adsorption, a method by chemical bonding, a method using the avidin-biotin binding, and a method using the binding between protein G or protein A and an antibody. Examples of the method by physical adsorption include a method of immobilizing the specific binding substance on the particle surface by hydrophobic interaction or electrostatic interaction. Examples of the method by chemical bonding include a method using a crosslinking agent. For example, when the surface of the particle has a hydroxyl group, after reacting the crosslinking agent with the carboxyl group of the specific binding substance to perform active esterification, the hydroxyl group and this ester group are reacted to immobilize the specific binding substance on the particle surface. Also, it is preferable to provide a spacer between the specific binding substance and the particle surface so as not to inhibit the ability of the specific binding substance to recognize the target molecule.

[0061] As described above, the introduction of the structure into the wells may be performed using a capture agent. For example, a complex of the capture agent and the structure may be fed into a flow path and introduced into the wells.

[0062] Here, it is preferable to form a complex of the capture agent and the structure under the condition that 0 or 1 structure is captured by 1 capture agent. Further, it is preferable that each well is configured such that 0 or 1 capture agent is introduced therein. This enables digital measurement. That is, in the present embodiment, the detection of the structure may be performed on a per-unit basis. In that case, the surface target molecule and the internal target molecule are detected at the level of 1 structure.

[0063] 《Enclosure of the Structure in the Wells》 In this step, as shown in FIG. 2, the sealing liquid L120 is fed from the introduction port 122 of the lid member 120 into the flow path 130 between the substrate 110 and the lid member 120. The sealing liquid L120 fed into the flow path 130 contacts the well array 140. Then, the sealing liquid L120 flushes and replaces the reagent liquid L110 that is not contained in the well 141 among the reagent liquids L110 fed into the flow path 130. As a result, the sealing liquid L120 individually seals a plurality of wells 141 containing the reagent liquid L110 containing the structure, and the wells 141 become independent reaction spaces, that is, micro compartments 142.

[0064] The sealing liquid is a liquid that can individually seal the liquids introduced into the plurality of wells so as not to mix with each other to form droplets, that is, micro droplets, and is preferably an oily solution, more preferably an oil. As the oil, a fluorine-based oil, a silicone-based oil, a hydrocarbon-based oil, or a mixture thereof can be used. More specifically, a product name “FC-40” manufactured by Sigma Corporation can be used. FC-40 (CAS number: 86508-42-1) is a fluorinated aliphatic compound and has a specific gravity of 1.85 g / mL at 25°C.

[0065] 《Extraction of the Contents of the Structure》 In this step, the content of the structure is extracted within well 141. In this step, the content containing the internal target molecule is extracted from the structure. In the extraction of the content, all the target molecules may be extracted from the structure, or only a part of the target molecules contained in the structure may be extracted.

[0066] The method for extracting the target molecule from the structure is not particularly limited, and known methods can be used. For example, physical methods using heat, ultrasonic waves, light, magnetic force, or electromagnetic waves, chemical methods using extractants such as surfactants, antibiotics, osmotic pressure inducing agents, or necrosis / apoptosis inducing agents, and combinations of these methods can be mentioned.

[0067] As the surfactant, those that destabilize the structure are desirable. Specific surfactants include, for example, Triton-X100 (also called polyethylene glycol mono-4-octylphenyl ether (n = about 10)), sodium dodecyl sulfate, Nonidet P-40 (also called octylphenoxypoly(ethyleneoxy)ethanol), and Tween20 (also called polyoxyethylene sorbitan monolaurate). Further, as the extractant, a reagent containing a surfactant may be used. Examples of the reagent containing a surfactant include BugBuster (manufactured by Merck Millipore).

[0068] More specifically, when heat is used as the extraction method, the structure may be heated to a temperature sufficient to destabilize the structure. The fluid device is preferably heated at 70 °C or higher and 90 °C or lower, more preferably 75 °C or higher and 85 °C or lower, for example, about 80 °C, for at least 5 minutes, preferably at least 10 minutes, for example, about 15 minutes or about 30 minutes, whereby the target molecule can be extracted from the structure.

[0069] When heat is used as the extraction method, the content of the structure may be extracted by heating the structure in a liquid containing a surfactant.

[0070] When using an extractant, the structure and the extractant can be brought into contact at any point in the method of this embodiment. For example, the structure and the extractant may be mixed before the introduction step, and then the mixed liquid may be fed and introduced into the well. Subsequently, an encapsulation step is performed.

[0071] In this case, for example, the extraction conditions may be designed so that the target molecule is extracted from the structure in the well after the well is sealed, by a method such as adjusting the mixing ratio of the structure and the extractant. Alternatively, after introducing the extractant into the well, the liquid in which the structure is dispersed may be fed and brought into contact in the well. Subsequently, an encapsulation step is performed.

[0072] After the well is sealed, the extractant acts in the well, the structure collapses, and the internal target molecule is extracted.

[0073] The extraction step is performed in the well after the well is sealed. Thereby, loss of the target molecule can be suppressed. As a result, compared with the conventional method of distributing the target molecule to each well of the microarray using a flow path after extracting the target molecule from the structure, the target molecule can be detected accurately.

[0074] FIG. 7A is a schematic diagram showing a state in which a structure 700 containing a surface target molecule 710 and an internal target molecule 720 is accommodated in a micro compartment 142 formed by a well 141 and a sealing liquid L120.

[0075] FIG. 7B is a schematic diagram showing a state after performing an extraction step on the structure in the state of FIG. 7A. As shown in FIG. 7B, after the extraction step, the internal target molecule 720 has been extracted from the structure 700'.

[0076] FIG. 8A is a schematic diagram showing a state in which a structure 700 containing a surface target molecule 710 and an internal target molecule 720 is introduced and encapsulated into a well using a capture agent 800 and is accommodated in a micro compartment 142 formed by a well 141 and a sealing liquid L120. A specific binding substance 810 to the structure 700 is bound to the capture agent 800.

[0077] Figure 8B is a schematic diagram showing the state of the structure in the state of Figure 8A after performing the extraction step. As shown in Figure 8B, after the extraction step, the internal target molecule 720 has been extracted from the structure 700'.

[0078] 《Surface Target Molecule Detection Step》 In this step, at least one type of surface target molecule present on the surface of the structure in the well 141 is detected.

[0079] Examples of the surface target molecule include at least one molecule selected from the group consisting of nucleic acids, proteins, sugars, glycoproteins, lipids, or complexes thereof. Examples of nucleic acids include DNA, RNA, miRNA, and mRNA. Examples of proteins include structural proteins, membrane proteins, and enzymes.

[0080] The structure contains the target molecule. In the present specification, the structure "containing" the target molecule may refer to the structure enclosing the target molecule, or a part or all of the target molecule being present on the surface of the structure.

[0081] As the method for detecting the surface target molecule, any known detection method can be used according to the characteristics of the target molecule to be detected. For example, first, a reaction (signal amplification reaction) for amplifying the signal derived from the target molecule to a detectable level is performed as necessary, and then the amplified signal is detected using appropriate means. In the present embodiment, the step of detecting the surface target molecule may be performed by a nucleic acid detection method.

[0082] Examples of signals that can be used in the detection method according to the present embodiment include fluorescence, chemiluminescence, color development, potential change, and pH change.

[0083] The signal amplification reaction may be, for example, a biochemical reaction, more specifically an enzymatic reaction. As an example, in the signal amplification reaction, in a state where a reagent solution containing an enzyme for signal amplification is contained in a well, the fluid device is maintained at a constant temperature condition where a desired enzyme activity can be obtained, for example, a constant temperature of 60°C or higher and 75°C or lower, preferably about 66°C, for a predetermined time, for example, at least 10 minutes, preferably about 15 minutes, in an isothermal reaction.

[0084] As examples of the signal amplification reaction, specifically, when using a nucleic acid detection method, the Invasive Cleavage Assay (ICA) method, the Loop-mediated Isothermal Amplification (LAMP) method (registered trademark), the 5'→3' nuclease method (TaqMan (registered trademark) method), the fluorescent probe method, etc. can be mentioned. It is particularly preferable to use the ICA reaction.

[0085] The ICA reaction is related to the principle that signal amplification proceeds by a cycle of two reactions: (1) complementary binding of nucleic acids and (2) recognition and cleavage of a triple-stranded structure by an enzyme.

[0086] In the ICA reaction, the influence of inhibition of the reaction cycle by contaminants other than the target molecule is small. Therefore, even when various components other than the target molecule present in the structure are released into the microcompartment during the extraction of the content from the structure, the target molecule can be accurately detected by using the ICA reaction. For example, when using the ICA reaction for the signal amplification reaction, the reagent solution L110 (the liquid for dispersing the structure) contains the reaction reagents and the template nucleic acid necessary for the ICA reaction.

[0087] When using the ICA reaction, specifically, the reagent solution L110 may contain ICA reaction reagents such as allele probes, ICA oligos, flap endonuclease-1 (FEN-1), and fluorescent substrates.

[0088] As the reagent solution L110, a general liquid used in biochemical analysis performed using a fluid device can be used, and it is preferably an aqueous solution. Further, by including a surfactant or the like in the reagent solution L110, it may be easier to enclose the liquid in the well. Further, the reagent solution L110 may contain an extractant used for extracting the contents of the structure. However, since the extractant may deactivate the enzyme that performs the biochemical reaction, it is not easy to contain the extractant in the reagent solution L110.

[0089] When the biochemical reaction in the detection of the surface target molecule is an ICA reaction, if the target molecule is present in the well, the fluorescent substance is released from the quenching substance by the enzyme reaction due to the isothermal reaction, and a predetermined fluorescence signal is emitted corresponding to the excitation light.

[0090] Alternatively, the detection of the surface target molecule can also be performed by binding a specific binding substance to the surface target molecule and detecting the bound specific binding substance.

[0091] For example, when the surface target molecule is a protein, it can be detected using the ELISA method. More specifically, for example, it may be performed by sandwich ELISA using the principle of fluorescence resonance energy transfer (FRET).

[0092] When performing the sandwich method using the principle of FRET, first, a first specific binding substance (for example, an antibody) labeled with a first fluorescent substance (donor) and a second fluorescent substance having an absorption wavelength overlapping the fluorescence wavelength of the first fluorescent substance (acceptor) are prepared. Subsequently, the surface target molecule (for example, an antigen) is brought into contact with both the first specific binding substance and the second specific binding substance to form a complex. When the complex is formed, the distance between the donor and the acceptor approaches, and the fluorescence wavelength of the acceptor can be detected by irradiating the excitation wavelength of the donor.

[0093] Alternatively, a specific binding substance may be labeled with a nucleic acid fragment, and the nucleic acid fragment may be detected by an ICA reaction. As the specific binding substance, for example, an antibody, an antibody fragment, an aptamer, or the like can be used. To detect the specific binding substance bound to the target molecule, the specific binding substance may be labeled directly or indirectly with an enzyme such as horseradish peroxidase (HRP). When using two or more specific binding substances, each specific binding molecule can be labeled so as to be distinguishable from each other.

[0094] The method for observing the signal can be selected from known appropriate methods according to the type of signal to be observed. For example, when performing bright-field observation, white light is irradiated in a direction perpendicular to the substrate provided with the well array. When observing a fluorescence signal, excitation light corresponding to the fluorescent substance is irradiated into the well, and the fluorescence emitted by the fluorescent substance is observed.

[0095] 《Detection of internal target molecules》 In this step, at least one type of internal target molecule present inside the structure in well 141 is detected.

[0096] The internal target molecule is the same as the surface target molecule, and examples include at least one type of molecule selected from the group consisting of nucleic acids, proteins, sugars, glycoproteins, lipids, or complexes thereof. For example, the surface target molecule may contain a protein, and the internal target molecule may contain a nucleic acid.

[0097] The detection of the internal target molecule can be performed in the same manner as the above-described surface target molecule. Among them, it is preferable that the detection of the internal target molecule is performed by a nucleic acid detection method. As the nucleic acid detection method, the ICA method is preferable.

[0098] For example, the surface target molecule can be detected using a nucleic acid-labeled antibody, and the nucleic acid labeled on the nucleic acid-labeled antibody can be detected by the ICA method. Further, when the internal target molecule is a nucleic acid, the nucleic acid can be detected by the ICA method.

[0099] Even if the surface target molecule and the internal target molecule are different molecules, they can be detected by the same principle by labeling. In the above case, both the surface target molecule and the internal target molecule can be detected by the ICA method. Therefore, the surface target molecule and the internal target molecule can be detected simultaneously under the same conditions.

[0100] In the method of this embodiment, extraction of the content of the structure, detection of the surface target molecule, and detection of the internal target molecule are preferably performed after encapsulation of the structure in the well. Thereby, the surface target molecule and the internal target molecule derived from one structure can be detected. And the structure, the surface target molecule, and the internal target molecule can be detected in association with each other.

[0101] The surface target molecule and the internal target molecule may be detected in any order. Also, when there are multiple types of surface target molecules, each surface target molecule may be detected in any order. Also, when there are multiple types of internal target molecules, each internal target molecule may be detected in any order. Also, the detection of the surface target molecule and the detection of the internal target molecule may be performed simultaneously or independently and separately.

[0102] Also, the detection of the surface target molecule and the detection of the internal target molecule may be performed under the same conditions. By simultaneously performing the detection of the surface target molecule and the detection of the internal target molecule under the same conditions, the method of this embodiment can be easily implemented.

[0103] In the detection of the surface target molecule and the detection of the internal target molecule, when two or more types of target molecules are detected simultaneously, or when the target molecules are sequentially detected in a situation where they coexist in a detectable state even if not simultaneously, etc., it is necessary to design the reaction system so that the signals indicating the presence of each target molecule do not get confused. In such a case, it is preferable that the signal detected in the detection of the surface target molecule and the signal detected in the detection of the internal target molecule are distinguishable from each other.

[0104] Furthermore, when there are multiple types of surface target molecules, it is preferable that the signals indicating the presence of each surface target molecule are distinguishable from each other. Similarly, when there are multiple types of internal target molecules, it is preferable that the signals indicating the presence of each internal target molecule are distinguishable from each other.

[0105] For example, when detection is performed by fluorescence signals, the signals can be made distinguishable from each other by setting the excitation light and the fluorescence wavelengths to different bands. Alternatively, for example, by using different signals such as fluorescence signals and magnetic signals, the signals can also be made distinguishable from each other.

[0106] The method of this embodiment may be carried out in the order of encapsulating the structure in a well, detecting the surface target molecule, extracting the content of the structure, and detecting the internal target molecule. That is, after encapsulating the structure in a well, the surface target molecule present on the surface of the structure is detected. Thereafter, the content of the structure is extracted. As a result, the internal target molecule is exposed inside the well. Thereafter, the detection of the internal target molecule may be carried out. In this case, even when the signal for detecting the surface target molecule and the signal for detecting the internal target molecule are the same, the surface target molecule and the internal target molecule can be distinguished by the timing of detection.

[0107] When the detection of the surface target molecule is performed before the extraction of the content of the structure, the detection of the surface target molecule is carried out under conditions where no extraction of the internal target molecule occurs. For example, the detection of the surface target molecule may be carried out at a temperature lower than the temperature at the time of extracting the content of the structure, more specifically, at a temperature in the range from room temperature to about 60°C.

[0108] Alternatively, the detection of the surface target molecule and the detection of the internal target molecule may be carried out after the extraction of the content of the structure.

[0109] Alternatively, the steps of encapsulating the structure into the well, extracting the content of the structure, detecting the surface target molecule, and detecting the internal target molecule may be performed in a different order, or any two of the steps may be performed simultaneously. For example, after introducing the structure into the well, the extraction step may be performed before the step of encapsulating the structure into the well, and in that case, the introduction step and the extraction step may be performed simultaneously. Also, as described above, a part of the surface target molecule detection step or the internal target molecule detection step may be performed before the extraction step is performed.

[0110] (Detection of the structure) The method of this embodiment may further include a step of detecting the structure. The detection of the structure can be performed at any point in the method of the above embodiment. For example, it may be performed after introducing the structure into the well and before extracting the content of the structure. Alternatively, the structure may be detected after extracting the content of the structure.

[0111] Alternatively, the detection of the surface target molecule or the internal target molecule and the detection of the structure may be performed simultaneously. When the detection of the surface target molecule, the internal target molecule, and the structure are performed simultaneously, the configuration of the reaction system so that the detection signals do not interfere with each other is the same as in the above-described case.

[0112] The structure may be directly detected by a method such as bright-field observation. Alternatively, the structure may be indirectly detected by a method such as detecting the molecule contained in the structure by the same operation as the surface target molecule or the internal target molecule. Examples of the latter include detecting the structure using a fluorescent dye that stains the cell membrane, an antibody that recognizes the virus coat protein, and the like.

[0113] [Method for evaluating the structure] One embodiment of the present invention is to bring a liquid in which a structure is dispersed into a well array having a plurality of wells, introduce one or fewer of the structures per well into the wells, bring a sealing liquid into contact with the well array, encapsulate the structures in the wells, extract the contents of the structures in the wells, detect at least one surface target molecule present on the surface of the structures in the wells, detect at least one internal target molecule present inside the structures in the wells, and evaluate the structures based on the detection results of the surface target molecules and the detection results of the internal target molecules, and provides a method for evaluating structures.

[0114] In the method of this embodiment, the presence or absence of the surface target molecules and the internal target molecules is detected for each well. As a result, the structures, the surface target molecules, and the internal target molecules can be detected in association with each other. That is, the surface target molecules and the internal target molecules can be detected at the level of one structure. "Evaluating the structures" thus refers to detecting the structures, the surface target molecules, and the internal target molecules in association with each other. Also, by evaluating the structures, the origin or state of the structures may be analyzed.

[0115] [Kit] One embodiment of the present invention provides a kit for detecting the surface target molecules and the internal target molecules of the structure, including a well array having a plurality of wells, a reagent for extracting the contents from the structure, a reagent for detecting at least one surface target molecule present on the surface of the structure, and a reagent for detecting at least one internal target molecule present inside the structure.

[0116] The well array may constitute the fluid device described above. The reagent for extracting the contents from the structure (i.e., the extractant), the reagent for detecting the surface target molecules, and the reagent for detecting the internal target molecules are the same as those described above.

[0117] With the kit of the present embodiment, the detection of surface target molecules and internal target molecules of a structure can be preferably carried out.

Example

[0118] Hereinafter, the present invention will be described in more detail based on examples. The present invention is not limited to these examples at all.

[0119] [Example 1] (Detection of viral surface protein and nucleic acid inside virus) The surface target molecules and internal target molecules of the structure were detected. As the structure, f1 phage, a kind of virus (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010), was used. Also, as the surface target molecule, the coat protein, which is the surface protein of f1 phage (having the base sequence of 5’-ACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAAT-3’ (SEQ ID NO: 1) as the encapsulated DNA), was detected. Further, as the internal target molecule, the base sequence (5'-GTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGC-3', SEQ ID NO: 2) on the genomic DNA of f1 phage was detected. Also, for the introduction of the structure into the well, magnetic beads having an antibody as a specific binding substance were used as the capture.

[0120] 《Preparation of nucleic acid detection reagent》 An ICA reaction solution having the composition shown in Table 1 below was prepared. This reaction solution is for detecting nucleic acids by the ICA reaction. In Table 1, Alexa488 and Redmond RED (denoted as RED in Table 1) are fluorescent dyes, and BHQ-1 (denoted as BHQ in Table 1) and Eclipse are quenching substances.

[0121]

Table 1

[0122] Subsequently, a solution (Solution A) was prepared by mixing the ICA reaction solution and BugBuster (manufactured by Merck Millipore), a protein extraction reagent, at a volume ratio of 1:1.

[0123] 《Preparation of the Capture Agent》 A capture agent for capturing f1 phage was prepared. Specifically, magnetic beads immobilized with an anti-f1 phage antibody were prepared as the capture agent.

[0124] First, an anti-f1 phage antibody (type "Anti-M-13 Phage Coat Protein", manufactured by Funakoshi) was added to a solution of carboxyl group-modified magnetic beads (Magnosphere, LC300, manufactured by JSR), and the mixture was reacted on a rotator for 30 minutes. Subsequently, EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide), a condensing agent, was added and the mixture was reacted for 3 hours to immobilize the anti-f1 phage antibody on the carboxyl group-modified magnetic beads.

[0125] Subsequently, to remove unreacted antibodies and reagents, the antibody-immobilized magnetic beads were magnetically collected using a magnetic stand. Subsequently, washing with PBS-T (PBS (Phosphate-buffered saline) containing 0.1% Tween 20) was repeated three times to prepare antibody-immobilized magnetic beads. Thereby, a capture agent for capturing f1 phage was prepared.

[0126] 《Preparation of Nucleic Acid-Labeled Anti-f1 Phage Antibody》 An anti-f1 phage antibody (type "Anti-M-13 Phage Coat Protein", Funakoshi Co., Ltd.) was conjugated with a DNA fragment (5'-TTTGTCACTGTTCCTCCTTTTGTTTTCCTTTCTGTGAGCAATCTCACCCAAATTGGAACCATGCTGTATACAGTT-3', SEQ ID NO: 9) to prepare a nucleic acid-labeled anti-f1 phage antibody. For the conjugation of the DNA fragment, a commercially available kit (product name "Protein-Oligo Conjugation Kit", Solulink Inc.) was used.

[0127] 《Reaction of f1 phage and antibody-immobilized beads》 The concentration of f1 phage is expressed as the dilution ratio when the concentration of the commercially available f1 phage suspension is taken as 100%. f1 phage (final concentration 0% or final concentration 1%), 100 μg / mL of the above-described antibody-immobilized magnetic beads, and 10 ng / mL of the above-described nucleic acid-modified anti-f1 phage antibody were mixed so that the total volume was 100 μL, and reacted on a rotator at room temperature for 1 hour. Here, when f1 phage was present, the anti-f1 phage antibody recognized and bound to the coat protein on the surface of f1 phage, thereby forming a complex with the antibody-immobilized magnetic beads.

[0128] Subsequently, the magnetic beads were magnetically collected using a magnetic stand, and the operations of removing the supernatant and adding PBS-T were repeated three times for washing, and finally the supernatant was removed.

[0129] 《Introduction step》 Subsequently, 20 μL of the antibody-immobilized magnetic beads suspended in the above-described solution A (a mixture of the ICA reaction solution and BugBuster (manufactured by Merck Millipore)) was fed into the fluid device having the structure shown in FIG. 1 and brought into contact with the well array. As a result, the antibody-immobilized magnetic beads were introduced into the wells.

[0130] The diameter of the wells of the fluid device used in this example was 5 μm, and the depth of the wells was 3 μm. Also, the height of the flow path was 100 μm.

[0131] 《Enclosure step》 Subsequently, 150 μL of FC-40 (Sigma) was dispensed as the sealing liquid and brought into contact with the well array. As a result, each well was individually sealed, encapsulating the antibody-immobilized magnetic beads. Through the above operations, when the antibody-immobilized magnetic beads had formed a complex with the f1 phage, 1 or fewer f1 phages were sealed within each well.

[0132] 《Extraction Step》 Subsequently, the above fluid device was set on a hot plate and reacted at 66 °C for 15 minutes. Thereby, within the sealed wells, the capsid structure of the f1 phage was broken down, and the genomic DNA, which is the content of the f1 phage, was extracted.

[0133] 《Surface Target Molecule Detection Step and Internal Target Molecule Detection Step》 Subsequently, the above fluid device after the extraction step was set on a hot plate and reacted at 66 °C for 15 minutes. Thereby, the surface target molecule and the internal target molecule were detected simultaneously.

[0134] More specifically, the allele probe 1 and ICA oligo 1 hybridized to the base sequences (SEQ ID NO: 2) on the genomic DNA respectively, forming a flap structure. Subsequently, FEN-1 recognized the flap structure and cleaved the allele probe 1.

[0135] Subsequently, the released fragment of the allele probe 1 hybridized to RED-Eclipse, forming a flap structure. Subsequently, FEN-1 recognized the flap structure and cleaved RED-Eclipse. As a result, the fluorescent substance and the quenching substance were separated, generating a fluorescent signal of Redmond RED.

[0136] Similarly, the allele probe 2 and ICA oligo 2 hybridized to the DNA fragments modified with the nucleic acid-labeled anti-f1 phage antibody respectively, forming a flap structure. Subsequently, FEN-1 recognized the flap structure and cleaved the allele probe 2.

[0137] Subsequently, the fragments of the released allerprobe 2 hybridized to Alexa488-BHQ to form a flap structure. Subsequently, FEN-1 recognized the flap structure and cleaved Alexa488-BHQ. As a result, the fluorescent substance and the quenching substance were separated, and a fluorescent signal of Alexa488 was generated.

[0138] 《Fluorescence Observation of Wells》 After the surface target molecule detection step and the internal target molecule detection step, the fluorescence signals of each well of the fluid device were photographed using a fluorescence microscope BZ-710 (KEYENCE). A 10x objective lens was used.

[0139] The exposure time was set to 3000 msec using a GFP fluorescence filter for the fluorescence observation of Alexa488, and 2000 msec using a Texas Red fluorescence filter for the fluorescence observation of Redmond RED.

[0140] Figure 9 is a photograph showing the results of fluorescence observation. In Figure 9, "without phage" indicates the result of f1 phage with a virus concentration of 0%, and "with phage" indicates the result of f1 phage with a virus concentration of 1%.

[0141] Also, "Alexa488" indicates the result of detecting the fluorescence of Alexa488, "RED" indicates the result of detecting the fluorescence of Redmond RED, and "Overlay" indicates the result of overlapping the detection result of the fluorescence of Alexa488 and the detection result of the fluorescence of Redmond RED. Table 2 below shows the number of wells in which fluorescence was detected.

[0142]

Table 2

[0143] As a result, it was revealed that the nucleic acid fragment of SEQ ID NO: 2 was detected in 23 out of 32 wells where the phage coat protein was presented. That is, the phage genomic DNA could be detected in about 72% of the wells where the phage coat protein was presented. This result indicates that the surface target molecule and the internal target molecule of the structure can be detected in association with high precision.

[0144] [Example 2] (Examination of the Concentration of the Extraction Reagent) In the extraction step, the concentration of the reagent (extraction reagent) for extracting the content from the structure was examined. As the structure, f1 phage, which is a kind of virus (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010), was used. Also, as the internal target molecule, the base sequence (SEQ ID NO: 2) on the genomic DNA of f1 phage was detected.

[0145] 《Preparation of Nucleic Acid Detection Reagent》 An ICA reaction solution having the composition shown in Table 3 below was prepared. In Table 3, Alexa488 is a fluorescent dye, and BHQ-1 (denoted as BHQ in Table 3) is a quenching substance.

[0146]

Table 3

[0147] Subsequently, solutions were prepared by mixing the ICA reaction solution and BugBuster, which is a protein extraction reagent (manufactured by Merck Millipore), at volume ratios of ICA reaction solution:BugBuster = 9:1, 1:1, and 1:9, respectively. Also, a sample not containing f1 phage was prepared as a negative control.

[0148] Subsequently, each sample was set in a real-time PCR device (model "LightCycler480", Roche), reacted at 65°C for 60 minutes, and the fluorescence signal of Alexa488 was measured over time.

[0149] Figure 10 is a graph showing the results of measuring the change over time of the fluorescence signal. In Figure 10, "9:1NC" indicates the result of a sample obtained by mixing an ICA reaction solution not containing f1 phage and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 9:1. "9:1phage" indicates the result of a sample obtained by mixing an ICA reaction solution (containing f1 phage) and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 9:1. "1:1NC" indicates the result of a sample obtained by mixing an ICA reaction solution not containing f1 phage and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 1:1. "1:1phage" indicates the result of a sample obtained by mixing an ICA reaction solution (containing f1 phage) and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 1:1. "1:9NC" indicates the result of a sample obtained by mixing an ICA reaction solution not containing f1 phage and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 1:9. "1:9phage" indicates the result of a sample obtained by mixing an ICA reaction solution (containing f1 phage) and BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 1:9.

[0150] As a result, it became clear that when the volume ratio of Bugbuster was too high, the ICA reaction was inhibited.

[0151] [Example 3] (Examination of the extraction process) In this example, the conditions for extracting the contents from the structure were examined. As the structure, f1 phage, a type of virus (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010), was used. Also, the base sequence (SEQ ID NO: 2) on the genomic DNA of f1 phage was detected as an internal target molecule.

[0152] 《Preparation of nucleic acid detection reagent》 The ICA reaction solution with the composition shown in Table 4 below was prepared. This reaction solution is for detecting nucleic acids by the ICA reaction. In Table 4, Alexa488 is a fluorescent dye, and BHQ-1 (denoted as BHQ in Table 4) is a quenching substance. In Table 4, "MOPS" represents 3-morpholinopropanesulfonic acid.

[0153]

Table 4

[0154] Subsequently, attempts were made to extract the contents of the phage under various conditions, and the following Samples 1 to 4 were prepared. · Sample 1: The phage (10%) was sonicated for 1 minute using a probe-type ultrasonic generator. · Sample 2: BugBuster (manufactured by Merck Millipore) was added to the phage (10%) at a volume ratio of 50%, and the mixture was stirred at 37°C for 30 minutes. · Sample 3: The phage (10%) was heated at 70°C for 30 minutes. · Sample 4: BugBuster (manufactured by Merck Millipore) was added to the phage (10%) at a volume ratio of 50%, and the mixture was stirred at 70°C for 30 minutes.

[0155] Subsequently, in a sample tube, the above-described ICA reaction solution was mixed with Samples 1 to 4 respectively to prepare a solution with a final phage concentration of 1% and a volume of 10 μL.

[0156] Also, as negative controls, only the ICA reaction solution (Sample 5) and a mixed solution of the ICA reaction solution and the phage (Sample 6) were prepared. Also, as a positive control, a solution (Sample 7) was prepared by adding a nucleic acid fragment having the base sequence (SEQ ID NO: 2) present on the genomic DNA of the f1 phage to the ICA reaction solution to a final concentration of 30 pM.

[0157] Subsequently, these samples were set in a real-time PCR device (model "LightCycler480", Roche), reacted at 66°C for 60 minutes, and the fluorescence signal of Alexa488 was measured over time.

[0158] Figure 11 is a graph showing the results of measuring the change over time of the fluorescence signal. In Figure 11, the horizontal axis represents the reaction time (seconds), and the vertical axis represents the fluorescence intensity (relative value). In Figure 11, "ICA" indicates an ICA solution, "phage" indicates a phage, and "bug" indicates BugBuster (manufactured by Merck Millipore).

[0159] As a result, in sample 1 where the phage was sonicated, sample 2 where BugBuster (manufactured by Merck Millipore) was added to the phage, sample 3 where the phage was heat-treated at 70°C, sample 4 where BugBuster (manufactured by Merck Millipore) was added to the phage and heat-treated at 70°C for 30 minutes, and sample 7 which was a positive control, an increase in fluorescence intensity was detected in all of them.

[0160] Also, in sample 1 where the phage was sonicated and sample 4 where BugBuster (manufactured by Merck Millipore) was added to the phage and heat-treated at 70°C for 30 minutes, the increase in fluorescence intensity was remarkable. On the other hand, in the ICA reaction solution alone (sample 5) which was a negative control, almost no increase in fluorescence intensity was observed. Also, in the mixed solution of the ICA reaction solution and the phage (sample 6), an increase in fluorescence intensity was observed over time, but the degree of increase was gentle compared to samples 1 to 4.

Industrial Applicability

[0161] According to the present invention, it is possible to provide a technique for detecting target molecules present outside and inside a structure.

Explanation of Signs

[0162] 100, 200... fluid device, 110... substrate, 120... lid member, 121... convex portion, 122... introduction port, 123... discharge port, 130... flow path, 140... well array, 141... well, 142... micro compartment, L110... reagent solution, L120... sealing liquid, 142R... well where signal is detected, 210... wall member, 700, 700’... structure, 710... surface target molecule, 720... internal target molecule, 800... capturer, 810... specific binding substance.

Claims

1. Contacting a liquid in which a structure is dispersed with a well array having a plurality of wells, and introducing the structure into the wells; Contacting a sealing liquid with the well array and encapsulating the structure in the wells; Extracting the content of the structure in the wells; Detecting at least one surface target molecule present on the surface of the structure in the wells; Detecting at least one internal target molecule present inside the structure in the wells; including Detecting the surface target molecule and detecting the internal target molecule are performed under the same conditions, Extracting the content of the structure, detecting the surface target molecule, and detecting the internal target molecule are performed after encapsulating the structure in the wells, Detecting the internal target molecule is performed by a signal amplification reaction, The signal amplification reaction is Invasive Cleavage Assay, The surface target molecule includes a protein, A method for detecting the surface target molecule and the internal target molecule of the structure, wherein the internal target molecule includes a nucleic acid.

2. The method according to claim 1, wherein detecting the surface target molecule and detecting the internal target molecule are performed after extracting the content of the structure.

3. The method according to claim 1 or 2, wherein detecting the surface target molecule and detecting the internal target molecule are performed simultaneously.

4. The method according to any one of claims 1 to 3, wherein the signal detected in detecting the surface target molecule and the signal detected in detecting the internal target molecule are distinguishable from each other.

5. The method according to any one of claims 1 to 4, wherein the structure is any one selected from the group consisting of a virus, an exosome, a cell, and an endoplasmic reticulum.

6. The method according to any one of claims 1 to 5, wherein the structure forms a complex with a capture substance, and the capture substance is a conjugate of a solid phase and a specific binding substance for the structure.

7. The method according to claim 6, wherein the specific binding substance is an antibody.

8. The method according to any one of claims 1 to 7, wherein extracting the content of the structure is heating the structure in a liquid containing a surfactant.

9. The method according to any one of claims 1 to 8, wherein when introducing the structure into the well, one or fewer of the structures are introduced per well.

10. A step of detecting the presence or absence of the surface target molecule and the internal target molecule for each well by the method according to claim 9, And a step of evaluating the structure based on the detection result of the surface target molecule and the detection result of the internal target molecule, a method for evaluating a structure.

11. A kit for performing the method of detecting the surface target molecule and the internal target molecule of the structure according to any one of claims 1 to 9, A well array having a plurality of wells, A sealing liquid for individually sealing the plurality of wells, A reagent for extracting the content from the structure, A reagent for detecting at least one kind of surface target molecule present on the surface of the structure, and A reagent for detecting at least one kind of internal target molecule present inside the structure, A kit comprising.

Images