Composition containing nucleic acid oligomers

Abstract

The purpose of the present invention is to provide a stable composition containing a nucleic acid oligomer that has a phosphorothioate bond, a method for production thereof, and a method for efficiently producing the nucleic acid oligomer from the composition. The present invention provides a composition containing: a nucleic acid oligomer represented by formula (1) (where the symbols are as defined in the specification) and having a phosphorothioate bond; an alkylammonium salt; a water-soluble organic solvent; water; and an additive containing at least one compound disclosed in the specification.

Description

Technical Field

[0001] This patent application claims priority and benefit under the Paris Convention based on Japanese Patent Application No. 2020-072234 (filed on April 14, 2020), and the entire contents described in the above application are incorporated herein by reference.

[0002] The present invention relates to a composition containing a nucleic acid oligomer. More specifically, the present invention relates to a composition containing a nucleic acid oligomer containing phosphorothioate.

Background Art

[0003] In recent years, there has been increasing interest in the application of nucleic acid oligomers in the medical field. For example, nucleic acids that induce RNA interference (RNAi) such as antisense nucleic acids, aptamers, ribozymes, and siRNA are mentioned, and these are called nucleic acid pharmaceuticals.

[0004] Nucleic acid oligomers are known to be synthesized by solid-phase synthesis methods, and nucleic acid oligomers having phosphorothioate bonds are also known as useful compounds synthesized by solid-phase methods (Patent Document 1).

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0006] The stability of nucleic acid oligomers having phosphorothioate bonds may be a problem during their production process. An object of the present invention is to provide a stable composition containing a nucleic acid oligomer having phosphorothioate bonds, a method for producing the same, and an efficient method for producing the nucleic acid oligomer from the composition.

Means for Solving the Problem

[0007] As a result of intensive studies to achieve the above object, the present inventors have found that a nucleic acid oligomer having a phosphorothioate bond, which is generated by the phosphoramidite method in the solid-phase synthesis method, obtained by reverse-phase chromatography treatment, can be stabilized by a composition obtained by mixing an alkylammonium salt, a water-soluble organic solvent, water, and a certain additive. Therefore, the present invention provides the composition, a method for producing the same, and an efficient method for producing a nucleic acid oligomer from the composition.

[0008] The present invention includes, but is not limited to, the following aspects. Item 1. Formula (1): [Chemical formula] (In the formula, B C each independently represents the same or different nucleobases, R each independently represents the same or different, a hydrogen atom, a fluorine atom, or an OQ group, Q each independently represents the same or different, a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4 ’ -position carbon atom of ribose, an ethylene group bonded to the 4 ’ -position carbon atom of ribose, or an ethylidene group bonded to the 4 ’ -position carbon atom of ribose, X each independently represents the same or different, an oxygen atom or a sulfur atom, Y represents a hydrogen atom or a protecting group for a hydroxyl group, G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, n is an integer satisfying formula (2): 15 ≦ n (2).) A composition comprising a nucleic acid oligomer having a phosphorothioate bond represented by, an alkylammonium salt, a water-soluble organic solvent, water, and an additive, wherein the additive comprises at least one compound selected from the group consisting of compounds represented by the following formula (3) or (4). Formula (3): R a (R c )CH-L-CH(R d )R b (3) (In the formula, L represents -S- or -SS-; R a and R b are the same or different and each independently represents a hydrogen atom or a C1-6 alkyl group optionally substituted with at least one group selected from the group consisting of the following Z 1 and Z 2 ; Z 1 : -CH(NHR 1 )COR 2 Z 2 : -COR 2 (In Z 1 and Z 2 , R 1 represents a hydrogen atom, a protecting group for an amino group, or a C(O)-R 11 group; R 11 represents a C1-6 alkyl group optionally substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, or a phenyl group optionally substituted with at least one group selected from the group consisting of an amino group and a carboxyl group; R 2 represents a C1-6 alkylimino group optionally substituted with an optionally protected carboxyl group, or an -OR 20 group (R 20 represents a hydrogen atom or a protecting group for a carboxyl group).), R c and R dis the same as or different from, and each independently represents a hydrogen atom or a C1-6 alkyl group. A compound represented by Formula (4): [Chemical formula] (wherein L has the same meaning as described above, R e and R f are the same as or different from each other and each independently represents a hydrogen atom, a C1-6 alkoxy-carbonyl group, a carboxyl group, or a C1-6 alkyl group which may be substituted with a C1-6 alkoxycarbonyl group or a carboxyl group, X, L and the carbon atom to which they are attached form a 5-membered or 6-membered ring structure, X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (CH3)2CNH, (COOH)CHNH, CH2OCH2, CH2NHCH2, and CH2COCH2. A compound represented by

[0009] Item 2. R 1 represents a hydrogen atom, a protecting group for an amino group, or a C(O)-R 11 group, R 11 represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, and X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (COOH)CHNH, CH2OCH2 and CH2COCH2. The composition according to Item 1 above.

[0010] Item 3. R 1is a hydrogen atom, benzoyl group, 4-methoxybenzoyl group, formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, benzyloxycarbonyl group, 9-fluorenylmethyloxycarbonyl group, or C(O)-R 11 represents a group, R 11 represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, R 2 represents a C1-6 alkylimino group which may be substituted with a carboxyl group which may be protected by a methyl group, benzyl group, allyl group and tert-butyl group, or -OR 20 group (R 20 represents a hydrogen atom, methyl group, benzyl group, allyl group or tert-butyl group.), and X represents any group selected from CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (COOH)CHNH, CH2OCH2, and CH2COCH2, and the composition according to item 1 or 2 above.

[0011] Item 4. R e and R f are the same or different and each independently represents a hydrogen atom, a carboxyl group, or a C1-6 alkyl group, and X represents any group selected from CH2, (CH3)C=N, CH2NH, CH2OCH2, and CH2COCH2, and the composition according to any one of items 1 to 3 above.

[0012] Item 5. R 1 represents a hydrogen atom, benzoyl group, formyl group, acetyl group, benzyloxycarbonyl group and 9-fluorenylmethyloxycarbonyl group, or C(O)-R 11 group, R 11 represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, and R 2 is a C1-6 alkylimino group which may be substituted with a carboxyl group which may be protected with a methyl group, or -OR 20 group (R 20 represents a hydrogen atom or a methyl group.), the composition according to any one of the preceding items 1 to 4.

[0013] Item 6. The additive is alpha-lipoic acid, methionine, N-formyl-methionine, N-acetyl-methionine, N-benzoyl-methionine, N-carbobenzoxy-methionine, N-Fmoc-methionine, methionine methyl hydrochloride, dibutyl sulfide, dihexyl sulfide, thiazolidine-2-carboxylic acid, 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture), 4-oxothiane, 1,4-thioxane, and oxidized glutathione, and is at least one compound selected from the group consisting of, the composition according to any one of the preceding items 1 to 5.

[0014] Item 7. The additive is at least one compound selected from the group consisting of lipoic acid, oxidized glutathione and methionine, the composition according to any one of the preceding items 1 to 6.

[0015] Item 8. The alkylammonium salt is at least one alkylammonium salt selected from the group consisting of a monoalkylammonium salt and a dialkylammonium salt, the composition according to any one of the preceding items 1 to 7.

[0016] Item 9. The composition according to any one of Items 1 to 8 above, wherein the water-soluble organic solvent is a water-soluble organic solvent selected from the group consisting of an alcohol-based water-soluble organic solvent and a nitrile-based water-soluble organic solvent.

[0017] Item 10. The composition according to any one of Items 1 to 9 above, wherein in the formula (1), each R is independently a hydroxy group or a methoxy group.

[0018] Item 11. The composition according to any one of Items 1 to 9 above, wherein in the formula (1), R is a hydroxy group.

[0019] Item 12. A method for producing a nucleic acid oligomer, comprising mixing the composition according to any one of Items 1 to 11 above with a C1-C4 organic solvent having at least one oxygen atom and isolating the precipitated nucleic acid oligomer.

[0020] Item 13. A method for producing the composition according to any one of Items 1 to 12 above, comprising mixing a column eluate containing a nucleic acid oligomer represented by the formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, which is obtained by subjecting a crude product of the nucleic acid oligomer of the formula (1) synthesized by a solid-phase synthesis method to reverse-phase column chromatography treatment, with an additive.

Advantages of the Invention

[0021] According to the present invention, there are provided a stable composition containing a nucleic acid oligomer having a phosphorothioate bond and an efficient method for producing the nucleic acid oligomer using the same.

Brief Description of the Drawings

[0022]

Figure 1

Modes for Carrying Out the Invention

[0023] A composition comprising a nucleic acid oligomer having a phosphorothioate bond represented by the formula (1), an alkylammonium salt, a water-soluble organic solvent, water, and an additive, wherein the additive is at least one compound selected from the group consisting of a compound having a disulfide bond and a compound having a sulfide bond. In the formula (1), B C The nucleobase represented by (hereinafter sometimes referred to as "base") may be a natural or unnatural nucleobase. Examples of such unnatural nucleobases include modified analogs of natural or unnatural nucleobases. Examples of nucleobases typically include purine compounds and pyrimidine compounds. For example, the nucleobases disclosed in U.S. Patent No. 3,687,808, "Concise Encyclopedia Of Polymer Science And Engineering", pages 858-859, edited by Kroschwitz J.I., John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, volume 30, p. 613 are exemplified.

[0024] Specifically, for example, purine bases such as adenine, isoguanine, xanthine, hypoxanthine, and guanine; and pyrimidine bases such as cytosine, uracil, and thymine are exemplified.

[0025] Furthermore, B CExamples of the nucleobase represented by include amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, and 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine, and 6-azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; 8-halogenated, aminoated, thiolated, thioalkylated, hydroxylated, and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 6-azapyrimidine; N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine); dihydrouracil; 3-deaza-5-azacytosine; 7-deazaadenine; N6-methyladenine, N6,N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazole; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, etc.

[0026] When R represents an OQ group, and Q represents a methylene group bonded to the carbon atom at the 4th ’ position of ribose, an ethylene group bonded to the carbon atom at the 4th ’ position of ribose, or an ethylidene group bonded to the carbon atom at the 4th ’ position of ribose, the structure is represented by the structures of LNA-1, LNA-2, and LNA-3 shown in the following formula (3).

[0027] [Chemical formula]

[0028] (In the formula, B c represents the nucleobase as described above.)

[0029] As the protecting group for the hydroxyl group represented by Y, in the amidite method, any group that can function as a protecting group can be used without particular limitation. For example, known protecting groups used for amidite compounds can be widely used. The protecting group for the hydroxyl group represented by Y is preferably the following group.

[0030] [Chemical formula]

[0031] (In the formula, R 1 , R 2 and R 3 each independently represent hydrogen or an alkoxy group, which may be the same or different.) Examples of the alkoxy group include a methoxy group.

[0032] The chain length of the nucleic acid oligomer of formula (1) is n ≥ 15. Examples of the upper limit of the chain length include n ≤ 200. In the nucleic acid oligomer, at least one of the n X's is a sulfur atom, and all X's may be sulfur atoms. For example, when n = 103, the number of sulfur atoms is 6, 12, or 20.

[0033] The nucleic acid oligomer of formula (1) may be, for example, a DNA or RNA oligomer, or one containing non-natural nucleobases in these oligomers. The nucleic acid oligomer is typically a single-stranded DNA or RNA oligomer. In the nucleic acid oligomer of formula (1), the substituent R is preferably, each independently, a hydroxy group or a methoxy group. As the nucleic acid oligomer, RNA which is a nucleic acid oligomer of formula (1) in which the substituent R is, each independently, a hydroxy group or a methoxy group is preferred. More specifically, a nucleic acid oligomer containing both a nucleotide with a hydroxy group as the substituent R and a nucleotide with a methoxy group is preferred.

[0034] The concentration of the nucleic acid oligomer in the composition is usually 0.05 mg / mL to 5 mg / mL, preferably 0.05 mg / mL to 1 mg / mL, and more preferably 0.1 mg / mL to 0.5 mg / mL.

[0035] As the alkylammonium salt, usually, monoalkylammonium salts, dialkylammonium salts and trialkylammonium salts are used, preferably monoalkylammonium salts and dialkylammonium salts, and more preferably dialkylammonium salts are used. The number of carbon atoms of the monoalkylamine forming the monoalkylammonium salt is preferably 3 to 10, more preferably 4 to 6, and still more preferably hexylamine. The number of carbon atoms of the dialkylamine forming the dialkylammonium salt is preferably 4 to 10, more preferably 5 to 9. A preferred dialkylamine is dibutylamine. The trialkylamine forming the trialkylammonium salt preferably has 6 to 12 carbon atoms, more preferably 6 to 9 carbon atoms, and specifically, triethylamine is exemplified.

[0036] Examples of the acid forming the monoalkylammonium salt, dialkylammonium salt and trialkylammonium salt include carbonic acid, acetic acid, formic acid, trifluoroacetic acid and propionic acid.

[0037] The concentration of the ammonium salt is usually 1 to 200 mM, preferably 5 to 150 mM, and more preferably 20 to 100 mM.

[0038] Examples of the water-soluble solvent include alcohol-based organic solvents and nitrile-based organic solvents. The amount of the alcohol-based organic solvent in the composition is usually 0 to 20%, preferably 0 to 15%, and more preferably 0% to 10%. The eluate fraction obtained by reverse-phase column chromatography usually contains water, a water-soluble solvent (for example, an alcohol-based organic solvent, a nitrile-based organic solvent), an alkylammonium salt, and the nucleic acid oligomer of formula (1). The amount of the nitrile-based organic solvent in the eluate is usually 10 to 70%, preferably 20 to 60%, and more preferably 30 to 50% (all the above percentages represent mass percentages).

[0039] The amount of water may be an amount that balances so as to satisfy the concentration ranges of the above components, and is usually 90% to 30%, preferably 80% to 40%, and more preferably 70% to 40%.

[0040] The additive represented by the formula (3) will be described below. Z 1 In, R 1 The protecting group of the amino group represented by is not particularly limited, and known protecting groups can be used. Specific examples of the protecting group include, for example, benzoyl group, 4-methoxybenzoyl group, formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, benzyloxycarbonyl group, and 9-fluorenylmethyloxycarbonyl group (Fmoc group). Preferred protecting groups include benzoyl group, formyl group, benzyloxycarbonyl group, and 9-fluorenylmethyloxycarbonyl group. R 11Examples of the C1-6 alkyl group optionally substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, represented by , include, for example, the (CH2)2CH(NH2)(COOH) group. Examples of the phenyl group optionally substituted with at least one group selected from the group consisting of an amino group and a carboxyl group include a phenyl group, an aminophenyl group, and a carboxyphenyl group, etc. Preferred R 11 is exemplified by a C1-6 alkyl group (e.g., the (CH2)2CH(NH2)(COOH) group) optionally substituted with at least one group selected from the group consisting of an amino group and a carboxyl group. Z 1 and Z 2 In, COR 2 groups include a COOH group and a COOR 20 group. The protecting group for the carboxyl group represented by R 20 is not particularly limited, and known protecting groups can be used. Examples of such protecting groups include a methyl group, a benzyl group, an allyl group, and a tert-butyl group, etc. R 2 Examples of the C1-6 alkylimino group optionally substituted with a carboxyl group which may be protected, represented by , include a methylimino group, an ethylimino group, a propylimino group, a butylimino group, a pentylimino group, and a hexylimino group, or a group substituted with a carboxyl group which may be protected with a methyl group, a benzyl group, an allyl group, or a tert-butyl group. A C1-6 alkylimino group optionally substituted with a carboxyl group which may be protected with a methyl group is preferred, and for example, the NHCH2CO2H group is exemplified as a preferred group. Specific examples of the additive represented by formula (3) include methionine, oxidized glutathione, N-formylmethionine, N-acetyl-DL-methionine, N-benzoyl-DL-methionine, N-carbobenzoxy-DL-methionine, N-Fmoc-L-methionine, L-methionine methyl hydrochloride, dibutyl sulfide, and dihexyl sulfide.

[0041] Next, the definition of the compound represented by formula (4) will be described. First, in the groups represented by R e and R f as the C1-6 alkyl group or alkyl moiety constituting the C1-6 alkoxycarbonyl group and the C1-6 alkyl group, examples of the C1-6 alkyl group include a methyl group, an ethyl group, a propyl group, an isobutyl group, an n-butyl group, a pentyl group, and a hexyl group. R e and R f as the group represented by, a hydrogen atom, a carboxyl group, or a C1-6 alkyl group is preferable. R e or R f specific examples of the group represented by include a carboxyl group, an isobutyl group, (CH2)4CO2H, and CO2C2H5. As X, in formula (4) as described above, the groups described are exemplified, and preferable X is CH2, CH2CH2, (CH3)CHCH2, (CH3CH2)CHCH2, CH2CH2CH2, (CH3)CHCH2CH2, CH2(CH3)CHCH2, CH=N, (CH3)C=N, CH2NH, (CH3)CHNH, (COOH)CHNH, CH2OCH2, and CH2COCH2. More preferably, they are CH2, (CH3)C=N, CH2NH, CH2OCH2, and CH2COCH2. Specific examples of the compound represented by formula (4) include α-lipoic acid, thiazolidine-2-carboxylic acid, 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture), and the like.

[0042] These additives are usually used as an aqueous solution or a solution in a water-soluble organic solvent.

[0043] The concentration of the additive is usually 0.1 μM to 100 mM, preferably 1 mM to 10 mM.

[0044] In addition to purchasing, the additive can be obtained, for example, by the methods disclosed in Japanese Patent No. 4,476,386, Japanese Patent No. 5,317,836, and "Fundamentals of modern peptide synthesis", pages 3 to 24, edited by John Howl, Muriel Amblard, Jean-Alain Fehrentz, Jean Martinez, Methods in Molecular Biology (trademark) book series, volume 298, 2005.

[0045] The composition of the present invention is usually obtained by adding the above additive to the column eluate obtained by subjecting the crude product of the nucleic acid oligomer of formula (1) synthesized by the solid-phase synthesis method to reverse-phase column chromatography using a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water. Alternatively, the composition of the present invention may be prepared as an elution fraction of reverse-phase column chromatography by using a mobile phase containing the additive in advance.

[0046] The elution fraction obtained by reverse-phase column chromatography is generally analyzed and selected by UV absorption at a wavelength of 260 nm under the conditions of chromatography generally used for the separation and analysis of nucleic acids. A predetermined amount of the nucleic acid oligomer having phosphorothioate bonds, which is the target product purified from the collected fractions, is obtained. As the above analysis method, for example, the method described in the non-patent literature (Handbook of Analysis of Oligonucleotides and Related Products, CRC Press) can be used.

[0047] Examples of the packing material for the reverse-phase column chromatography include silica or polymer serving as a hydrophobic stationary phase, for example, silica or polymer having one or more selected from a phenyl group, an alkyl group having 1 to 20 carbon atoms, and a cyanopropyl group immobilized thereon. As such silica or polymer as the packing material, for example, those having a particle size of 2 μm or more, or 5 μm or more are used.

[0048] As the mobile phase for reverse-phase column chromatography, for example, a mobile phase containing an aqueous solution of an ammonium salt having the above-described concentration and pH and the above-described water-soluble organic solvent, and a mobile phase used with a gradient in which the concentration thereof is sequentially increased are used. The temperature of the reverse-phase column chromatography is usually 20 to 100°C, preferably 30 to 80°C, and more preferably 40 to 70°C. The composition of the present invention is typically obtained as an eluate fraction of the reverse-phase column chromatography as described above.

[0049] The composition of the present invention may be subjected to one or more steps selected from post-treatment steps such as a reprecipitation step, a liquid separation step, an ultrafiltration step, a deprotection step, and a lyophilization step for isolating a nucleic acid oligomer, for example, after the storage step. In the storage step, the atmosphere in the storage container may be replaced by using an inert gas. Examples of the inert gas include nitrogen gas, argon gas, and helium gas.

[0050] In the reprecipitation step, the stabilized solution can be brought into contact with a poor solvent to precipitate and isolate the nucleic acid oligomer. If necessary, from the solid-liquid separated state, the liquid part may be removed, and then the precipitated nucleic acid oligomer may be collected and isolated by filtration or the like. Examples of the poor solvent for the reprecipitation step include C1-C4 organic solvents having at least one oxygen atom (for example, C1-C4 alcohols, tetrahydrofuran, dioxane). As such a solvent, ethanol or isopropanol is preferred.

[0051] In the liquid separation step, at least one of an acidic aqueous solution such as an aqueous acetic acid solution, water, and brine is mixed with the stabilized solution, and an organic solvent immiscible with water is further added to separate the solution into an aqueous layer and an organic layer, and an aqueous layer containing the desired nucleic acid oligomer can be obtained.

[0052] In the ultrafiltration step, the nucleic acid oligomer present in the solution after the storage step can be separated from low molecular weight components having a desired molecular weight or less using an ultrafiltration membrane.

[0053] When there is a protecting group at the 5 ’ terminal site of the nucleic acid oligomer, in order to deprotect this, an acidic aqueous solution such as an aqueous acetic acid solution or a solution in which an acidic substance such as acetic acid is dissolved in an organic solvent is mixed with the solution after the storage step, whereby the protecting group of the nucleic acid oligomer can be deprotected.

[0054] In the freeze-drying step, water can be sublimated by reducing the pressure of the frozen aqueous solution of the nucleic acid oligomer, and the nucleic acid oligomer and water can be separated.

[0055] The synthesis of nucleic acid oligomers by the phosphoramidite method can perform a nucleic acid elongation reaction according to a known method (for example, the method described in Patent No. 5157168 or Patent No. 5554881 mentioned above). Regarding the production of nucleic acid oligomers by the phosphoramidite method, taking the synthesis of RNA in the scheme shown in FIG. 1 as an example, the production method of nucleic acid oligomers will be described with reference to the following reaction routes (condensation reaction, oxidation, deprotection).

[0056] In the chemical formula showing the reaction route, B a is an optionally protected nucleobase; Tr is a protecting group; X is as defined above, and SP represents the part other than the nucleoside structure of the inorganic porous carrier, respectively.

[0057] The nucleobases constituting the inorganic porous carrier (Sp-Nu) having a nucleoside structure and the nucleoside of the amidite monomer (Am-1) are the nucleobases as described above or the nucleobases protected with a protecting group.

[0058] Examples of suitable amidite monomers (Am-1) include the following chemical formula (Am-1 ’In the compound represented by [[ID=]], when R represents a protected hydroxyl group, specific protecting groups include a tert-butyldimethylsilyl (TBDMS) group, a bis(2-acetoxy)methyl (ACE) group, a (triisopropylsilyloxy)methyl (TOM) group, a (2-cyanoethoxy)ethyl (CEE) group, a (2-cyanoethoxy)methyl (CEM) group, a para-toluenesulfonylethoxymethyl (TEM) group, a (2-cyanoethoxy)methoxymethyl (EMM) group, etc. Examples include TBDMS amidites (TBDMS RNA Amidites, trade name, ChemGenes Corporation), ACE amidites, TOM amidites, CEE amidites, CEM amidites, TEM amidites (review by Chakhmakhcheva: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21.), EMM amidites (described in International Publication No. 2013 / 027843), etc.

[0059] [Chemical formula]

[0060] (In the formula, R represents the group as described above, and B a represents a nucleic acid base which may be protected.)

[0061] [Solid-phase synthesis of RNA] Deprotect the Tr group of the inorganic porous carrier (Sp-Nu) to obtain a solid-phase carrier (Am-2). Thereafter, condense the amidite monomer (Am-1) and the solid-phase carrier (Am-2) to obtain a reaction product (Am-3). Thereafter, oxidize the reaction product (Am-3) to obtain a product (Am-4). Thereafter, deprotect the product (Am-4) (-Tr) to obtain a product (Am-5). Next, further condense the amidite monomer (Am-1) and the product (Am-5) to extend the phosphodiester bond. Thus, the hydroxyl group at the 5 ’ position of the extended oligonucleotide chain end is repeated as many times as necessary in a series of deprotection, condensation reaction, and oxidation cycles so as to have a desired sequence, and then cut out from the solid-phase carrier, whereby a nucleic acid molecule having a desired sequence can be produced. Such synthesis may be carried out using a nucleic acid automatic synthesizer or the like that employs the phosphoramidite method. Here, RNA is taken as an example for explanation, but it is also applicable to nucleic acid compounds containing nucleotides other than ribonucleotides.

[0062] In the step of deprotecting the Tr group, deprotect the protecting group of the hydroxyl group at the 5 ’ ’ position of the RNA chain end supported on the solid-phase carrier. As the protecting group, a trityl-based protecting group (typically, a DMTr group) is used. Deprotection can be carried out using an acid. Examples of the acid for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0063] In the condensation step, a nucleoside phosphoramidite is bonded to the hydroxyl group at the 5 position of the RNA chain end deprotected by the above-described deprotection step to generate a phosphite. As the nucleoside phosphoramidite, one in which the hydroxyl group at the 5 ’ position is protected by a protecting group (for example, a DMTr group) is used.

[0064] Also, the condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator-42), etc.

[0065] After the condensation step, the unreacted 5 ’ -position hydroxyl group may be capped as appropriate. Capping can be carried out using a known capping solution such as acetic anhydride-tetrahydrofuran solution, phenoxyacetic anhydride / N-methylimidazole solution, etc.

[0066] The oxidation step is a step of oxidizing the phosphite formed by the condensation step. The oxidation step can be carried out using an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butyl hydroperoxide, 2-butanone peroxide, bis(trimethylsilyl) peroxide, 1,1-dihydroperoxycyclododecane, and hydrogen peroxide, etc.

[0067] When converting a triester group of phosphorous acid to a triester group of thiophosphoric acid, as the "oxidizing agent", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used. The oxidizing agent can be diluted with an appropriate solvent so as to have a concentration of 0.001 to 2M and used. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, and examples include dichloromethane, acetonitrile, pyridine, or a mixed solvent of these in any ratio.

[0068] The oxidation step may be carried out after the capping operation, or conversely, the capping operation may be carried out after the oxidation step, and this order is not limited.

[0069] After the oxidation step, return to the deprotection step, and according to the nucleotide sequence of the nucleic acid oligomer to be synthesized, repeat the series of steps of the above condensation reaction, oxidation, and deprotection to synthesize RNA having a desired sequence.

[0070] After the synthesis of the nucleic acid oligomer having a desired sequence is completed, the RNA strand is cleaved from the solid phase carrier and recovered using ammonia or an amine compound.

[0071] Examples of the amine compound here include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and triethylamine.

[0072] The chain length of the nucleic acid oligomer thus obtained is exemplified by, for example, those where n≧60, n≧80 or n≧100, and n≦200. Preferably, n≧60. Specifically, for example, n = 67, 100 or 120.

[0073] After the synthesis of the nucleic acid having the desired sequence is completed, an amine compound is allowed to act to deprotect the phosphate protecting group in the phosphate moiety in the step of deprotecting the phosphate protecting group. Examples of the amine compound include diethylamine described above.

[0074] When there is a protecting group for the hydroxyl group at the 2'- or 3'-position of ribose, it can be removed according to the method described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571.

Example

[0075] Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples.

[0076] Measurement method Each measurement method used in the following tests is shown below. (Measurement method 1: Method for measuring the purity of RNA) The purity of RNA in the solution after fractionation was measured by HPLC. The fractionated RNA was separated into each component by HPLC (wavelength 260 nm, column DNAPacTM PA200, 4.0 mm × 250 mm, 8.0 μm), and the purity of RNA was calculated from the area value of the peak of the main product in the total area value of the peaks of the obtained chromatogram. The HPLC measurement conditions are shown in Table 1 below.

[0077]

Table 1

[0078] [Reference Example 1] Solid-phase synthesis of RNA by the amidite method RNA having the nucleic acid sequence of I shown below was synthesized. The chain is 103 bases long.

[0079] Lock I: A*U*A*ACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGU UAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*U*U*U (5'-3') (SEQ ID NO: 1) In the notation of the above sequence, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The RNA was synthesized from the 3 ’ side to the 5 ’ side using a nucleic acid synthesizer (AKTA oligopilot plus100 GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 63 μmol scale. Also, for the synthesis, as RNA amidites, uridine EMM amidite (described in Example 2 of International Publication No. 2013 / 027843), cytidine EMM amidite (described in Example 3 thereof), adenosine EMM amidite (described in Example 4 thereof), and guanosine EMM amidite (described in Example 5 thereof) of the following formulas were used respectively. Porous glass was used as the solid phase support, a toluene solution of dichloroacetic acid was used as the deblocking solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as the sulfurizing agent, and an anhydrous phenoxyacetic acid solution and an N-methylimidazole solution were used as the capping solution. After completion of nucleic acid elongation, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by treating the nucleic acid on the support with a diethylamine solution. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0080]

Chemical formula

[0081] Cleavage from the solid support and deprotection after solid-phase synthesis were carried out according to the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol were added, and after standing for a while, the solid support was filtered and the solvent was distilled off. Then, deprotection of the hydroxyl group was carried out using tetrabutylammonium fluoride. The obtained RNA was dissolved in distilled water for injection to a desired concentration.

[0082] Fractionation and purification of RNA Column chromatography purification was carried out under the conditions shown in Table 2 below. However, before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The fraction was collected from 94.2 minutes to 95.8 minutes of retention time, and the obtained solution was analyzed by HPLC. The purity was calculated by the method described in the above Measurement Method 1. As a result, the purity was 94.2%. Experiments in the following Examples and Comparative Examples were carried out using this fractionated and purified RNA solution.

[0083]

Table 2

[0084] [Example 1] 99 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and 1 μL of an acetonitrile solution of lipoic acid was mixed as an additive solution to prepare a sample at a predetermined concentration. The vial containing the mixed solution was placed in an incubator (Kenis) thermostatically controlled at 60°C and allowed to stand for 8 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in the above Measurement Method 1. The results are shown in Table 3.

[0085] The composition prepared with the concentration of lipoic acid adjusted to 3 mM (0.07%) has the following composition according to calculation: water: 63.79%, acetonitrile: 34.89%, dibutylamine 0.84%, acetic acid: 0.39% (1.23% as dibutylammonium acetate), nucleic acid concentration: 0.21 mg / mL (0.02%).

[0086] [Example 2] In the experiment of Example 1, except that in place of the lipoic acid acetonitrile solution, an aqueous methionine solution was used to prepare a solution with a methionine concentration of 3 mM (0.05%), the experiment was conducted under the same conditions, and the purity of the RNA after the experiment was measured. The results are shown in Table 3.

[0087] [Example 3] In the experiment of Example 1, except that in place of the lipoic acid acetonitrile solution, an aqueous solution of oxidized glutathione was added to prepare a solution with an oxidized glutathione concentration of 0.15 mM (0.01%), the experiment was conducted under the same conditions, and the purity of the RNA after the experiment was measured. The results are shown in Table 3.

[0088] [Comparative Example 1] 100 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 1 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and the vial containing the solution was placed in an incubator (Kenis) thermostatically controlled at 60 °C and allowed to stand for 8 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in Measurement Method 1 above. The results are shown in Table 3.

[0089] [Comparative Example 2] In the experiment of Example 1, except that in place of the lipoic acid acetonitrile solution, an aqueous cysteine solution, an acetonitrile solution of N-acetylcysteine, an aqueous solution of reduced glutathione, an aqueous solution of dithiothreitol, an aqueous solution of L-ascorbic acid, or an aqueous solution of sodium bisulfite was used at a predetermined concentration, respectively, the experiment was conducted under the same conditions. The results are shown in Table 3.

[0090]

Table 3

[0091] [Example 4] (Recovery of RNA from fractionated and purified RNA solution) In Example 1, a solution was mixed so that the concentration of lipoic acid was 3 mM and allowed to stand at 60°C for 8 hours, and the following treatment was performed using this solution. 80 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning), 40 μL of an aqueous sodium acetate solution (3 M, pH = 5.2) and 240 μL of ethanol were added. The resulting slurry solution was centrifuged at 3000 g at 25°C for 10 minutes, and the supernatant was removed. Subsequently, 200 μL of a 70% aqueous ethanol solution was added, and the operation of centrifuging at 3000 g at 25°C for 10 minutes and removing the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 80 μL of water, and when the purity of the RNA was calculated by the method described in Measurement Method 1 above, the purity was 85.8%.

[0092] [Comparative Example 3] In Comparative Example 1, the following treatment was performed using a solution allowed to stand at 60°C for 8 hours. 80 μL of the solution was placed in a 15 mL polypropylene conical tube (Corning), 40 μL of an aqueous sodium acetate solution (3 M, pH = 5.2) and 240 μL of ethanol were added. The resulting slurry solution was centrifuged at 3000 g at 25°C for 10 minutes, and the supernatant was removed. Subsequently, 200 μL of a 70% aqueous ethanol solution was added, and the operation of centrifuging at 3000 g at 25°C for 10 minutes and removing the supernatant was repeated twice to obtain RNA. The obtained RNA was dissolved in 80 μL of water, and when the purity of the RNA in the fraction was calculated by the method described in Measurement Method 1 above, the purity was 70.9%.

[0093] [Reference Example 2] Solid-phase synthesis of RNA by the amidite method RNA having the nucleic acid sequence of II shown below was synthesized. The strand consists of 67 bases in length.

[0094] Lock II: Am*Gm*Cm*AmUmAmGmCAAGUUAmAAAUAAGGmC*U*AmG*U*C*CmGUUAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGCACmCmGmAGUCGGmUmGmCm*Um*Um*U (5'-3')(SEQ ID NO: 2) In the notation of the above sequence, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The alphabets Am, Um, Cm, Gm represent nucleotides in which the hydroxyl group is replaced by a methoxy group. The RNA was synthesized from the 3' side to the 5' side using a nucleic acid synthesizer (AKTA oligopilot plus 100, GE Healthcare) based on the phosphoramidite method. The synthesis was carried out on a 53 μmol scale. In the synthesis, as RNA amidites, uridine EMM amidite (described in Example 2 of WO 2013 / 027843), cytidine EMM amidite (described in Example 3 thereof), adenosine EMM amidite (described in Example 4 thereof), and guanosine EMM amidite (described in Example 5 thereof), and uridine 2'-OMe amidite, cytidine 2'-OMe amidite, adenosine 2'-OMe amidite, and guanosine 2'-OMe amidite of the following formulas were used respectively. Porous glass was used as the solid phase carrier, a toluene solution of dichloroacetic acid was used as the deblocking solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as the sulfurizing agent, and an anhydrous phenoxyacetic acid solution and an N-methylimidazole solution were used as the capping solution. After completion of nucleic acid elongation, a diethylamine solution was allowed to act on the nucleic acid on the carrier to selectively deprotect the cyanoethyl protecting group of the phosphate moiety. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group. ’ In the notation of the above sequence, the symbol * between nucleotides indicates that the phosphate bond connecting the nucleotides is phosphorothioate. The alphabets Am, Um, Cm, Gm represent nucleotides in which the hydroxyl group is replaced by a methoxy group. The RNA was synthesized from the 3' side to the 5' side using a nucleic acid synthesizer (AKTA oligopilot plus 100, GE Healthcare) based on the phosphoramidite method. ’ from the 3' side to the 5' side ’ In the synthesis, as RNA amidites, uridine EMM amidite (described in Example 2 of WO 2013 / 027843), cytidine EMM amidite (described in Example 3 thereof), adenosine EMM amidite (described in Example 4 thereof), and guanosine EMM amidite (described in Example 5 thereof), and uridine 2'-OMe amidite, cytidine 2'-OMe amidite, adenosine 2'-OMe amidite, and guanosine 2'-OMe amidite of the following formulas were used respectively. ’ 2'-OMe amidite ’ 2'-OMe amidite ’ 2'-OMe amidite ’ 2'-OMe amidite were used, porous glass was used as the solid phase carrier, a toluene solution of dichloroacetic acid was used as the deblocking solution, 5-benzylthio-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, 3-amino-1,2,4-dithiazole-5-thione was used as the sulfurizing agent, and an anhydrous phenoxyacetic acid solution and an N-methylimidazole solution were used as the capping solution. After completion of nucleic acid elongation, a diethylamine solution was allowed to act on the nucleic acid on the carrier to selectively deprotect the cyanoethyl protecting group of the phosphate moiety. Here, EMM is an abbreviation for (2-cyanoethoxy)methoxymethyl group.

[0095]

Chemical formula

[0096] The cleavage and deprotection from the solid-phase support after solid-phase synthesis were carried out according to the method described in International Publication No. 2013 / 027843. That is, an aqueous ammonia solution and ethanol were added, and after standing for a while, the solid-phase support was filtered and the solvent was distilled off. Then, deprotection of the hydroxyl group was carried out using tetrabutylammonium fluoride. The obtained RNA was dissolved to a desired concentration using distilled water for injection.

[0097] Fractionation and purification of RNA Column chromatography purification was carried out under the conditions shown in Table 4 below. However, before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The fraction was collected from the retention time of 66.7 minutes to 70.9 minutes, and the obtained solution was analyzed by HPLC. The purity was calculated by the method described in the above Measurement Method 1. As a result, the purity was 94.2%. Experiments in the following Examples and Comparative Examples were carried out using this fractionated and purified RNA solution.

[0098]

Table 4

[0099] [Example 5] 99 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and 1 μL of an aqueous solution of L-methionine was mixed as an additive solution to prepare a sample with an L-methionine concentration of 1.5 mM. The vial containing the mixed solution was placed in an incubator (Kenis) thermostatically controlled at 60°C and allowed to stand for 8 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in the above Measurement Method 1. The results are shown in Table 5.

[0100] The composition prepared with the concentration of L-methionine at 1.5 mM (0.02%) has, according to calculations, the following composition: water: 62.95%, acetonitrile: 32.21%, methanol: 3.59%, dibutylamine 0.82%, acetic acid: 0.38% (1.20% as dibutylammonium acetate), nucleic acid concentration: 0.31 mg / mL (0.03%).

[0101] [Example 6] In the experiment of Example 5, an experiment was conducted under the same conditions except that, as the additive solution, instead of the aqueous solution of L-methionine, a methanol solution of N-formyl-L-methionine was used to prepare a solution with a concentration of N-formyl-L-methionine of 3 mM (0.06%), and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0102] [Example 7] In the experiment of Example 5, an experiment was conducted under the same conditions except that, as the additive solution, instead of the aqueous solution of L-methionine, a methanol solution of N-acetyl-DL-methionine was used to prepare a solution with a concentration of N-acetyl-DL-methionine of 3 mM (0.06%), and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0103] [Example 8] In the experiment of Example 5, an experiment was conducted under the same conditions except that, as the additive solution, instead of the aqueous solution of L-methionine, a methanol solution of N-benzoyl-DL-methionine was used to prepare a solution with a concentration of N-benzoyl-DL-methionine of 3 mM (0.08%), and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0104] [Example 9] In the experiment of Example 5, an experiment was conducted under the same conditions except that, as the additive solution, instead of the aqueous solution of L-methionine, a methanol solution of N-carbobenzoxy-DL-methionine was used to prepare a solution with a concentration of N-carbobenzoxy-DL-methionine of 3 mM (0.12%), and the purity of the RNA after the experiment was measured. The results are shown in Table 5.

[0105] [Example 10] In the experiment of Example 5, as the additive solution, instead of the aqueous solution of L-methionine, a solution prepared by dissolving N-Fmoc-L-methionine in a mixed solvent of methanol and acetonitrile (mixing ratio 50:50 (v / v)) was used, and the experiment was carried out under the same conditions except that the concentration of N-Fmoc-L-methionine was adjusted to a solution of 3 mM (0.10%). After the experiment, the purity of RNA was measured. The results are shown in Table 5.

[0106] [Example 11] In the experiment of Example 5, as the additive solution, instead of the aqueous solution of L-methionine, an aqueous solution of L-methionine methyl hydrochloride was used, and the experiment was carried out under the same conditions except that the concentration of L-methionine methyl hydrochloride was adjusted to a solution of 3 mM (0.07%). After the experiment, the purity of RNA was measured. The results are shown in Table 5.

[0107] [Example 12] In the experiment of Example 5, as the additive solution, instead of the aqueous solution of L-methionine, an acetonitrile solution of dibutyl sulfide was used, and the experiment was carried out under the same conditions except that the concentration of dibutyl sulfide was adjusted to a solution of 3 mM (0.05%). After the experiment, the purity of RNA was measured. The results are shown in Table 5.

[0108] [Example 13] In the experiment of Example 5, as the additive solution, instead of the aqueous solution of L-methionine, an acetonitrile solution of dihexyl sulfide was used, and the experiment was carried out under the same conditions except that the concentration of dibutyl sulfide was adjusted to a solution of 3 mM (0.07%). After the experiment, the purity of RNA was measured. The results are shown in Table 5.

[0109] [Example 14] In the experiment of Example 5, as the additive solution, instead of the aqueous solution of L-methionine, an aqueous solution of thiazolidine-2-carboxylic acid was used, and the experiment was carried out under the same conditions except that the concentration of thiazolidine-2-carboxylic acid was adjusted to a solution of 3 mM (0.04%). After the experiment, the purity of RNA was measured. The results are shown in Table 5.

[0110] [Example 15] In the experiment of Example 5, an acetonitrile solution of 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture) was used as the additive solution instead of the aqueous solution of L-methionine, and the concentration of 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture) was adjusted to 3 mM (0.06%) solution. The experiment was carried out under the same conditions except for this, and the purity of RNA after the experiment was measured. The results are shown in Table 5.

[0111] [Example 16] In the experiment of Example 5, an acetonitrile solution of 4-oxothiane was used as the additive solution instead of the aqueous solution of L-methionine, and the concentration of 4-oxothiane was adjusted to 3 mM (0.04%) solution. The experiment was carried out under the same conditions except for this, and the purity of RNA after the experiment was measured. The results are shown in Table 5.

[0112] [Example 17] In the experiment of Example 5, an acetonitrile solution of 1,4-thioxane was used as the additive solution instead of the aqueous solution of L-methionine, and the concentration of 1,4-thioxane was adjusted to 3 mM (0.03%) solution. The experiment was carried out under the same conditions except for this, and the purity of RNA after the experiment was measured. The results are shown in Table 5.

[0113] [Comparative Example 4] 100 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 2 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and the vial containing the solution was placed in an incubator (Kenis) thermostatically controlled at 60 °C and allowed to stand for 8 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in the above Measurement Method 1. The results are shown in Table 5.

Table 5

[0114] [Reference Example 3] Fractionation and purification of RNA For the RNA subjected to deprotection of hydroxyl groups using tetrabutylammonium fluoride obtained in Reference Example 2, column chromatography purification was performed under the conditions shown in Table 6 below. However, before purification, mobile phase A was passed through the column at a flow rate of 4.7 mL / min for 12.5 minutes, and then the sample was added. The fraction was collected from 91.7 minutes to 94.2 minutes of retention time, and the obtained solution was analyzed by HPLC. In addition, the purity was calculated by the method described in the above Measurement Method 1. As a result, the purity was 95.1%. Using this fractionated and purified RNA solution, the experiments of the following Examples and Comparative Examples were conducted.

[0115] [Table 6]

[0116] [Example 18] 99 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene vial (Thermo Fisher Scientific), and 1 μL of an acetonitrile solution of α-lipoic acid was mixed as an additive solution to prepare a sample with a concentration of α-lipoic acid of 3 mM. The vial containing the mixed solution was placed in an incubator (Kenis) thermostatically controlled at 60°C and allowed to stand for 14 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in the above Measurement Method 1. The results are shown in Table 7.

[0117] The composition prepared with a concentration of α-lipoic acid of 3.0 mM (0.07%) has the following composition according to calculation: water: 59.69%, acetonitrile: 35.38%, methanol: 3.84%, hexylamine 0.61%, acetic acid: 0.36%, (as hexylammonium acetate 0.97%), nucleic acid concentration: 0.35 mg / mL (0.04%).

[0118] [Example 19] In the experiment of Example 18, an experiment was conducted under the same conditions except that an aqueous solution of L-methionine was used as the additive solution instead of the acetonitrile solution of α-lipoic acid, and the concentration of L-methionine was adjusted to a solution of 3 mM (0.05%), and the purity of RNA after the experiment was measured. The results are shown in Table 7.

[0119] [Example 20] In the experiment of Example 18, an experiment was conducted under the same conditions except that an aqueous solution of DL-methionine was used as the additive solution instead of the acetonitrile solution of α-lipoic acid, and the concentration of DL-methionine was adjusted to a solution of 3 mM (0.05%), and the purity of RNA after the experiment was measured. The results are shown in Table 7.

[0120] [Example 21] In the experiment of Example 18, an experiment was conducted under the same conditions except that an aqueous solution of oxidized glutathione was used as the additive solution instead of the acetonitrile solution of α-lipoic acid, and the concentration of oxidized glutathione was adjusted to a solution of 3 mM (0.01%), and the purity of RNA after the experiment was measured. The results are shown in Table 7.

[0121] [Comparative Example 5] 100 μL of the RNA solution fractionated and purified by reverse-phase column chromatography in Reference Example 3 was placed in a 300 mL polypropylene vial (Thermo Fisher), and the vial containing the solution was placed in an incubator (Kenis) thermostatically controlled at 60 °C and allowed to stand for 14 hours. After standing, the polypropylene vial taken out from the incubator was cooled to room temperature, and the purity was calculated by the method described in the above Measuring Method 1. The results are shown in Table 7.

[0122] [Comparative Example 6] In the experiment of Example 18, an experiment was conducted under the same conditions except that an acetonitrile solution of isobutylene sulfide or an acetonitrile solution of 4-tert-butyldiphenyl sulfide was used at a predetermined concentration as the additive solution instead of the acetonitrile solution of lipoic acid. The results are shown in Table 7.

Table 7

Industrial Applicability

[0123] According to the present invention, a composition in which a nucleic acid oligomer having a phosphorothioate bond is stabilized can be obtained, and thus the composition can be efficiently produced.

Sequence Listing Free-Text

[0124] SEQ ID NOs: 1 and 2 in the sequence listing represent the nucleotide sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (1): 【Chemical 1】 (wherein B Ｃ each independently represents the same or a different nucleobase, R, each independently, is the same or different and represents a hydrogen atom, a fluorine atom or an OQ group, Q is, independently of each other and identically or differently, a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4-carbon atom of ribose, an ethylene group bonded to the 4-carbon atom of ribose, or an ethylidene group bonded to the 4-carbon atom of ribose, and ’ the methylene group bonded to the 4-carbon atom of ribose, an ethylene group bonded to the 4-carbon atom of ribose, or an ethylidene group bonded to the 4-carbon atom of ribose, and ’ the ethylene group bonded to the 4-carbon atom of ribose, or an ethylidene group bonded to the 4-carbon atom of ribose, and ’ the ethylidene group bonded to the 4-carbon atom of ribose represents X, each independently, is the same or different and represents an oxygen atom or a sulfur atom, Y represents a hydrogen atom or a protecting group for a hydroxyl group, G represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion or a hydroxyalkylammonium ion, n is of formula (2): an integer satisfying 15 ≦ n (2). ) A composition comprising a column eluate obtained by subjecting a product before purification of a nucleic acid oligomer having a phosphorothioate bond represented by the formula to reverse-phase column chromatography using a mobile phase containing an alkylammonium salt, a water-soluble organic solvent, and water, and an additive, wherein the additive is an additive containing at least one compound selected from the group consisting of compounds represented by the following formula (3) or (4). Formula (3): R ａ (R ｃ )CH−L−CH(R ｄ )R ｂ (3) (wherein L represents -S- or -SS-, R ａ and R ｂ are the same or different and each independently represents a hydrogen atom or a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of the following Z １ and Z ２ and may be substituted with at least one group selected from the group consisting of: Z １ : -CH(NHR １ )COR ２ Z ２ : -COR ２ (Z １ and Z ２ in R １ represents a hydrogen atom, a protecting group for an amino group, or a C(O)-R １１ group, and R １１ represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, or a phenyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, R ２ is a C1-6 alkylimino group which may be substituted with a carboxyl group which may be protected, or an -OR ２０ group (R ２０ represents a hydrogen atom or a protecting group for a carboxyl group.), and R ｃ and R ｄ are the same or different and each independently represents a hydrogen atom or a C1-6 alkyl group.), a compound represented by Formula (4): 【Chemical 2】 (wherein L has the same meaning as described above, R ｅ and R ｆ are the same or different and each independently represents a hydrogen atom, a C1-6 alkoxy-carbonyl group, a carboxyl group, or a C1-6 alkyl group which may be substituted with a C1-6 alkoxycarbonyl group or a carboxyl group, X, L and the carbon atom to which they are attached form a 5- or 6-membered ring structure, and X represents any group selected from CH ２ , CH ２ CH ２ , (CH ３ )CHCH ２ , (CH ３ CH ２ )CHCH ２ , CH ２ CH ２ CH ２ , (CH ３ )CHCH ２ CH ２ , CH ２ (CH ３ )CHCH ２ , CH=N, (CH ３ )C=N, CH ２ NH, (CH ３ )CHNH, (CH ３ ) ２ CNH, (COOH)CHNH, CH ２ OCH ２ , CH ２ NHCH ２ , and CH ２ COCH ２ .) A compound represented by

2. R １ represents a hydrogen atom, a protecting group for an amino group, or a C(O)-R １１ group, and R １１ represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, and X is CH ２ CH ２ CH ２ CH ３ CHCH ２ CH ３ CH ２ CHCH ２ CH ２ CH ２ CH ２ CH ３ CHCH ２ CH ２ CH ２ CH ３ CHCH ２ CH=N, CH ３ C=N, CH ２ NH, CH ３ CHNH, (COOH)CHNH, CH ２ OCH ２ and CH ２ COCH ２ The composition according to claim 1, wherein X represents any group selected from

3. R １ represents a hydrogen atom, benzoyl group, 4-methoxybenzoyl group, formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, benzyloxycarbonyl group, 9-fluorenylmethyloxycarbonyl group, or C(O)-R １１ group, and R １１ represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, R ２ is a C1-6 alkylimino group optionally substituted with a carboxyl group optionally protected with a methyl group, benzyl group, allyl group or tert-butyl group, or an -OR ２０ group (R ２０ represents a hydrogen atom, methyl group, benzyl group, allyl group or tert-butyl group.), and X is CH ２ 、CH ２ CH ２ 、(CH ３ )CHCH ２ 、(CH ３ CH ２ )CHCH ２ 、CH ２ CH ２ CH ２ 、(CH ３ )CHCH ２ CH ２ 、CH ２ (CH ３ )CHCH ２ 、CH = N、(CH ３ )C = N、CH ２ NH、(COOH)CHNH、CH ２ OCH ２ 、およびCH ２ COCH ２ The composition according to claim 1 or 2, wherein X represents any group selected from

4. R ｅ and R ｆ are the same or different and each independently represents a hydrogen atom, a carboxyl group, or a C1-6 alkyl group, and X is CH ２ , (CH ３ )C=N, CH ２ NH, CH ２ OCH ２ , and CH ２ COCH ２ The composition according to any one of claims 1 to 3, which represents any group selected from

5. R １ is a hydrogen atom, benzoyl group, formyl group, acetyl group, benzyloxycarbonyl group and 9-fluorenylmethyloxycarbonyl group, or a C(O)-R １１ group, and R １１ represents a C1-6 alkyl group which may be substituted with at least one group selected from the group consisting of an amino group and a carboxyl group, and R ２ is a C1-6 alkylimino group which may be substituted with a carboxyl group which may be protected with a methyl group, or an -OR ２０ group (R ２０ represents a hydrogen atom or a methyl group.), the composition according to any one of claims 1 to 4.

6. The additive is α-lipoic acid, methionine, N-formyl-methionine, N-acetyl-methionine, N-benzoyl-methionine, N-carbobenzoxy-methionine, N-Fmoc-methionine, methionine methyl hydrochloride, dibutyl sulfide, dihexyl sulfide, thiazolidine-2-carboxylic acid, 2-isobutyl-4,5-dimethyl-3-thiazoline (isomer mixture), 4-oxothiane, 1,4-thioxane, and oxidized glutathione, and is at least one compound selected from the group consisting of, the composition according to any one of claims 1 to 5.

7. The composition according to any one of claims 1 to 6, wherein the additive is at least one compound selected from the group consisting of lipoic acid, oxidized glutathione and methionine.

8. The composition according to any one of claims 1 to 7, wherein the alkylammonium salt is at least one alkylammonium salt selected from the group consisting of a monoalkylammonium salt and a dialkylammonium salt.

9. The composition according to any one of claims 1 to 8, wherein the water-soluble organic solvent is a water-soluble organic solvent selected from the group consisting of an alcohol-based water-soluble organic solvent and a nitrile-based water-soluble organic solvent.

10. The composition according to any one of claims 1 to 9, wherein in the formula (1), each R is independently a hydroxy group or a methoxy group.

11. The composition according to any one of claims 1 to 9, wherein in the formula (1), R is a hydroxy group.

12. A method for producing a nucleic acid oligomer, comprising mixing the composition according to any one of claims 1 to 11 with a C1-C4 organic solvent having at least one oxygen atom and isolating the precipitated nucleic acid oligomer.

13. A method for producing the composition according to any one of claims 1 to 11, comprising mixing a column eluate containing a nucleic acid oligomer represented by the formula (1), an alkylammonium salt, a water-soluble organic solvent, and water, which is obtained by subjecting a product before purification of a nucleic acid oligomer having a phosphorothioate bond represented by the formula (1) synthesized by a solid-phase synthesis method to reverse-phase column chromatography treatment, with an additive.

Images