Rapamycin derivative

A novel mTORC1 inhibitor with enhanced bioavailability and stability is developed by modifying the structural formula of rapamycin derivatives, addressing the need for effective and stable mTOR inhibitors for treating various disorders.

JP7699626B2Active Publication Date: 2025-06-27NOVARTIS AG
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023081938
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-09-26
Filing Date
2023-05-18
Publication Date
2025-06-27
Estimated Expiration
2038-09-25

AI Technical Summary

Technical Problem

There is a need for new mTOR inhibitors that effectively inhibit mTORC1, are well absorbed, metabolically stable, and have favorable pharmacokinetic properties, while also being stable, non-hygroscopic, and suitable for various formulations.

Method used

The development of a compound with a specific structural formula (I) that acts as an mTORC1 inhibitor, achieved by reducing the ketone at C32 and replacing the C16 methoxy group with a cyclic N-containing aliphatic ring system, such as a cyclic amine, amide, or sultam, to enhance bioavailability and stability.

Benefits of technology

The compound exhibits a favorable balance of efficacy, stability, and bioavailability, making it a promising candidate for treating a wide range of disorders mediated by the mTOR pathway, including age-related diseases and cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007699626000111
    Figure 0007699626000111
  • Figure 0007699626000112
    Figure 0007699626000112
  • Figure 0007699626000113
    Figure 0007699626000113
Patent Text Reader

Abstract

To provide rapamycin derivatives for treating a disorder or disease mediated by the mTOR pathway such as liver fibrosis.SOLUTION: For example, (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxo-rapamycin of the formula in the figure is presented.SELECTED DRAWING: Figure 2-1
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Priority Claim This application claims priority from U.S. Patent Application No. 62 / 563,312, filed Sep. 26, 2017 and the entire specification of which is incorporated herein by reference.

[0002] The present invention provides 32-deoxo-rapamycin derivatives and methods of using them .

Background Art

[0003] In mammalian cells, the rapamycin target (mTOR) kinase exists in two distinct multiprotein complexes called mTORC1 complex and mTORC2 complex, and both detect the availability of nutrients and energy and integrate inputs from growth factors and stress signaling . mTORC1 integrates signals from growth factors and nutrients and controls cell growth and metabolism. Laplante M.et al.Cell.(2 012)149(2):274-93. mTORC1 is a major regulator of protein translation and autophagy . The mTORC1 complex is sensitive to allosteric mTOR inhibitors such as rapamycin and rapamycin analogs (so-called "rapalogs"). The mode of action of rapamycin and previously produced rapalogs is the formation of intracellular complexes with FK506-binding proteins, F KBP12, FKBP51 or FKBP52 (these three F KBPs will be referred to herein as "FKBP" or "FKBPs"), followed by the binding of FKBP to the FRB (FK506-rapamycin binding) domain of mTOR . These three FKBP proteins will be referred to herein as "FKBP" or "FKBPs". Subsequent to that, FKBP binds to the FRB (FK506-rapamycin binding) domain of mTOR - includes binding of the rapalog complex. Marz A.M. et al. Mol Cell B iol. (2013) 33(7):1357 - 1367. Large FK506 - Bi nding Proteins Shape the Pharmacology of Rapamycin. Such interactions of the FKBP - rapalog complex with TORC1 result in allosteric inhibition by the complex. Rapalogues such as rapamycin and RAD001 (ever olimus; Afinitor®) increase in clinical importance by inhibiting the activity of mTORC1, which is associated with both benign and malignant proliferative diseases. Royce M.E. et al. Breast Cancer(Auck l). (2015) 9:73 - 79; Pleniceanu O. et al. Kidn ey Int Rep. (2018) 3(1):155 - 159.

[0004] Rapamycin is a known macrolide antibiotic produced by Streptomyces h ygoscopius, see, for example McAlpine, J.B., et al., J. Antibiotics(1991) 44:688; Schreiber, S.L.; et al., J. Am. Chem. S oc. (1991) 113:7433; U.S. Patent No. 3,929,992. The following numbering rules for rapamycin and its derivatives as used herein are shown below.

Chemical Structure

[0005] ​​Rapamycin is a potent immunosuppressive drug and has also been shown to have antitumor and antifungal activities. Rapamycin has been shown to be useful for preventing or treating systemic lupus erythematosus, lung inflammation, insulin-dependent diabetes , skin disorders such as psoriasis, smooth muscle cell proliferation and intimal thickening after vascular injury, adult T-cell leukemia / lymphoma, malignant carcinomas, inflammatory diseases of the heart, anemia and increased neurite outgrowth. However, its practical utility as a medicine is limited by its very low and variable bioavailability. Moreover, rapamycin is difficult to formulate and makes it difficult to obtain a stable galenical composition. To overcome these problems, a number of rapalogs have been (semi)synthesized. Water-soluble prodrugs were prepared by derivatizing rapamycin at C28 and 40 to form glycinate, propionate

[0006] and pyrrolidinobutyrate prodrugs (U.S. Patent No. 4,650,803). Other analogs of rapamycin include monoacyl and diacyl analogs (U.S. Patent No. 4,316,885), acetal analogs (U.S. Patent No. 5,151,413), silyl ethers (U.S. Patent No. 5,120,842) , hydroxy esters (U.S. Patent No. 5,362,718) and aryl, alkyl, alkenyl and alkynyl analogs (U.S. Patent No. 5,665,772; U.S. Patent No. 5,258,389; U.S. Patent No. 6,384,046; International Publication No. 97 / 35575 pamphlet). Modifications to rapamycin include demethylation, elimination or replacement of one or more of the methoxy groups; one or more of the hydroxy moieties ; U.S. Patent No. 5,665,772; U.S. Patent No. 5,258,389; U.S. Patent No. 6,384,046; International Publication No. 97 / 35575 pamphlet). Modifications to rapamycin include demethylation, elimination or replacement of one or more of the methoxy groups; one or more of the hydroxy moieties Multiple eliminations, derivatizations, or replacements; One or more reductions, eliminations, or derivatizations of the ketone moiety ; Replacement of the six-membered pipecolate ring with a five-membered prolyl ring; Replacement of the six-membered pipecolate ring with a substituted cyclopentyl ring Alternative substitutions of the cyclohexyl ring are included. Examples of patent literature in this field include rapamycin. US Patent No. 5,523,633 describes various rapalogs aimed at avoiding the immunosuppressive side effects of rapalogs. No. 7,907, WO 96 / 41865 and WO 99 / The specification of U.S. Patent No. 5,985,890 is a 32-D Examples of 32 deoxo-rapamycin analogues, including oxo-rapamycin itself, are disclosed. These compounds have an improved pharmacological profile and better efficacy than rapamycin. It is stated that it has been reported to have stability.

[0007] The rapalogs described in the above publications are useful for treating the same disorders as rapamycin. It was disclosed in U.S. Patent No. 8,906,374 and U.S. Patent No. 9,669 No. 9,358,236 discloses use in cancer. The book discloses uses in neurodegenerative disorders.

[0008] In animal models, rapalogs extend lifespan and delay the onset of age-associated diseases. As with other biological processes, catalysis is mediated by the TOR pathway (in this case, in yeast and C. elegans (Cel The mammalian equivalent [mTOR] is a simple signaling pathways, such as the mTORC1 pathway in mammals and the mTORC2 pathway in mammals. Modulation of TOR and mTORC1 signaling is associated with increased longevity and reduced Delays the onset of age - associated diseases in a wide range of organisms from yeast to mammals. For example, inhibition of the TOR pathway by genetic mutations extends lifespan in yeast, Caenorhabditis elegans, and Drosophila melanogaster, and inhibition of the mTORC1 pathway extends lifespan in mice (Kaeberlein et al., Science (2005) 310:11 93 - 1196; Kapahi et al., Curr Biol (2004) 14: 885 - 890; Selman et al., Science (2009) 326:1 40 - 144; Vellai et al., Nature (2003) 426:620 ). In addition, the mTORC1 inhibitor rapamycin extends the lifespan of mice even when administered in old age (Harrison et al., Nature (2009) 460( 7253):392 - 395). These data increase the likelihood that drugs targeting the mammalian TOR (mTOR) pathway have therapeutic effects in human aging and age - associated diseases. For example, WO 2008 / 022256 describes methods for treating or preventing age - associated diseases and topical formulations containing mTOR inhibitors. Reports of clinical trials using rapamycin in the elderly are described by M. Leslie in Science, 2 013, 342. J. Mannick et al. describe in Sci Transl Med. (2014) 6(268):268ra179 that mTOR inhibition improves immune function in the elderly. However, treating physicians are cautious about using currently available mTOR inhibitors in human aging trials due to their side effects (including immunosuppression, cytopenia, stomatitis, gastrointestinal disorders, and interstitial pneumonia), as described by M. Leslie in Science, 2 013, 342. J. Mannick et al. describe in Sci Transl Med. (2014) 6(268):268ra179 that mTOR inhibition improves immune function in the elderly. However, treating physicians are cautious about using currently available mTOR inhibitors in human aging trials due to their side effects (including immunosuppression, cytopenia, stomatitis, gastrointestinal disorders, and interstitial pneumonia), which make them hesitant to use currently available mTOR inhibitors in human aging trials. ​ existed.

[0009] In animal and human studies of focal cortical dysplasia (FCD) and tuberous sclerosis complex (TSC), the mTOR pathway is involved in mediating cellular and molecular changes that cause cortical malformations and epilepsy expression (Wong et al., Experimental N eurology (2013) 244:22-26). Focal cortical dysplasia (FCD) is a malformation of cortical development, which is the most common cause of intractable epilepsy in the pediatric population and the second / third most common cause of medically intractable seizures in adults (Kabat J, et al., Pol J.Radiology(20 12) 77(2) 35-43). Mutations in tuberous sclerosis complex (TSC), including tuberous sclerosis gene 1 (TSC1) and tuberous sclerosis gene 2 (TSC2), act upstream of the mTOR pathway and cause widespread development of benign tumors, mental retardation, and a high incidence of epilepsy (Manning et al., Identification of the tuberous sclerosis complex-2 tumor suppr essor gene product tuberin as a target o f the phosphoinositide 3-kinase / akt path way, Mol.Cell, (2002) 10:151-162; Inoki et a l., Dysregulation of the TSC-mTOR pathway in human Disease, Nat.Genet, (2005), 37:19 -24; and Holmes and Stafstrom, Tuberous scle rosis, Rapamycin complex and epilepsy: recent developments and future Challenges, Epilepsia,( 2007) 48:617 - 630).

[0010] Abnormal mTOR activation interferes with normal brain development and causes epilepsy. mTOR treatment with rapamycin, which inhibits the C1 pathway, has been shown to attenuate structural abnormalities and reduce seizures in TSC and PTEN mouse models (Ehninger et al., Reversal of learning deficits in a T sc2+ / - mouse model of tuberous sclerosis ; Nat. Med., (2008), 843 - 848; Meikle et al., R esponse of a neuronal model of tuberous sclerosis to mammalian target of rapamyc in, mTOR inhibitors: effects on mTORC1 and Akt signaling lead to improved survival and function; J. Neuroscience., (2008) 28:5 422 - 5432; Zeng et al., Rapamycin prevents epilepsy in a mouse model of tuberous sc lerosis complex; Ann. Neurol., (2008) 63:444 -453; Ljungberg et al., Rapamycin suppress es seizures and neuronal hypertrophy in a mouse model of cortical dysplasia; (200 9) pp.389 - 398; and Zhou et al., Pharmacologic al inhibition of mTORC1 suppresses anato mical, cellular, and behavioral abnormalit ies in neural - specific Pten knock - out mi ce, J.Neurosci., (2009), 29:1773 - 1783). Furthermore, pharmacological inhibition of the mTOR pathway before or immediately after nerve injury can prevent pathological changes in the animal's brain and the occurrence of idiopathic recurrent seizures in a model of acquired epilepsy (Zeng et al., The mammalian target of rapamycin signaling pathway mediates epi leptogenesis in a model of temporal lobe epilepsy; J.Neurosci., (2009) pp.6964 - 6972 ). Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms.

[0011] Mitochondrial myopathy (MM) is the most common manifestation of adult - onset mitochondrial disease and shows a multifaceted tissue - specific stress response: (1) a transcriptional response involving metabolic cytokines FGF 21 and GDF15, (2) remodeling of one - carbon metabolism, and (3) the mito chondrial stress response. Cell Metabolism 26, 419 - 428, A ugust 1, 2017, these processes are part of one integrated mitochondrial stress response. It is part of the integrated stress response (ISRmt), which has been described by Khan et al. as being controlled by mTORC1 in skeletal muscle. mtDNA replication deficiency activates mTORC1, which promotes the integrated mitochondrial stress response through ATF4 activation, induces the synthesis of new nucleotides and serine, the 1C cycle, and the production of FGF21 and GDF15. Inhibition of mTORC1 by rapamycin downregulates all components of ISRmt (integrated mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms. as being controlled by mTORC1 in skeletal muscle. mtDNA replication deficiency activates mTORC1, which promotes the integrated mitochondrial stress response through ATF4 activation, induces the synthesis of new nucleotides and serine, the 1C cycle, and the production of FGF21 and G DF15. Inhibition of mTORC1 by rapamycin downregulates all components of ISRmt (integrated mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms. mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms. mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms. mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms. mitochondrial stress response), improves all MM traits, and even reverses the progression of end-stage MM without inducing mitochondrial biogenesis. Therefore, rapamycin and rapalogs are also considered to have potential value in such symptoms.

SUMMARY OF THE INVENTION

PROBLEMS TO BE SOLVED BY THE INVENTION

[0012] There remains a need to provide new mTOR inhibitors that are suitable drug candidates. In particular, preferred compounds should have at least mTORC1 inhibitory ability, be well absorbed from the gastrointestinal tract, be metabolically sufficiently stable, and have favorable pharmacokinetic properties. Furthermore, ideal drug candidates would be stable, non-hygroscopic, and capable of existing in a physical form suitable for formulations.

MEANS FOR SOLVING THE PROBLEM

[0013] The compound of structural formula (I) is an mTORC1 inhibitor and, therefore, potentially for a wide range of disorders, particularly age-related disorders or diseases currently approved for treatment using and useful for the treatment of disorders. Complete reduction of the ketone of C32 and replacement of the C16 methoxy group with a cyclic N-containing aliphatic ring system such as a cyclic amine, amide or sultam has the aforementioned desired advantages and provides compounds that exhibit a favorable balance of efficacy, stability and bioavailability.

[0014] In one aspect, the present disclosure provides a compound of structural formula (I):

Chemical formula

Chemical formula

Chemical formula

[0015] In one embodiment, the present disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

[0016] In one embodiment, the present disclosure provides a pharmaceutical combination comprising a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof and one or more therapeutically active agents.

[0017] In another aspect, the present disclosure provides a method of treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutical composition or combination thereof. In another aspect, the present disclosure provides a method of treating a disease or disorder in a subject, wherein the target tissue or organ associated with the pathology of the disease or disorder has an FKBP12 level sufficient to inhibit mTORC1, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof. ​​A method is provided that includes administering to a subject in need thereof a salt, pharmaceutical composition, or combination of drugs that is tolerated.

[0018] In one embodiment, the target tissue or organ associated with the pathophysiology of a disease or disorder treated with a compound of structural formula (I) has FKBP12 levels sufficient to inhibit mTORC1, for example, determined empirically using an FKBP12-specific inhibitor and compared to rapamycin or RAD001.

[0019] In another aspect, the present disclosure provides a method for treating a disease or disorder in a subject having or pre-determined to have FKBP12 levels sufficient to inhibit mTORC1, the method comprising administering to the subject in need thereof a therapeutically effective amount of a compound of structural formula (I), a pharmaceutically acceptable salt thereof, a pharmaceutical composition thereof, or a combination of drugs thereof.

[0020] In one embodiment, the subject has or is pre-determined to have FKBP12 levels in a target tissue, organ, or cell sufficient to inhibit mTORC1.

[0021] In another aspect, the present disclosure provides a method for treating an age-related disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of structural formula (I), a pharmaceutically acceptable salt thereof, a pharmaceutical composition thereof, or a combination thereof.

[0022] In one embodiment, the disease or disorder is sarcopenia, dermal atrophy, cherry angioma, seborrheic keratosis, cerebral atrophy - also known as dementia, atherosclerosis, arteriosclerosis ​ , emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis , autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vasculopathy, hearing loss, mobility impairment ( e.g., frailty), cognitive decline, tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic function disorders, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immune aging, Parkinson's disease, Alzheimer's disease, cancer, immune aging that causes cancer due to reduced immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste , loss of smell, arthritis and complications resulting from diabetes such as kidney failure, blindness and neuropathy selected from type II diabetes including

[0023] In another aspect, the present disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof or a pharmaceutical composition or combination thereof, wherein the disorder or disease is - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, smooth muscle cell proliferation and migration causing restenosis, - autoimmune diseases and inflammatory conditions, - treatment and prevention of asthma, - multidrug resistance (MDR), - fungal infections, - inflammation, - infections, - age-related diseases, - neurodegenerative diseases, - proliferative disorders, particularly cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress A method selected from the above is provided.

[0024] In another aspect, the present disclosure provides a method for treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of structural formula (I) or a pharmaceutically acceptable salt thereof or a pharmaceutical composition or combination of pharmaceuticals.

[0025] In one embodiment, the method further comprises a PD-1 / PDL-1 inhibitor.

[0026] In one embodiment, the cancer is selected from renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, uterine membrane cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma and cervical cancer.

[0027] In one embodiment, the disorder is a liver disorder including fibrosis and / or an inflammatory process, such as liver fibrosis, cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH and alcohol-related steatosis occurring in end-stage liver disease.

[0028] In one embodiment, the disorder is a kidney disorder including fibrosis or an inflammatory process in the kidney, such as acute kidney injury causing chronic kidney disease and kidney fibrosis resulting from diabetic nephropathy.

[0029] In one embodiment, the disorder is a cardiac dysfunction, such as myocardial infarction or cardiac hypertrophy. In one embodiment ​​​In this case, the cardiac dysfunction is a systolic and / or diastolic dysfunction. In one embodiment, the cardiac dysfunction is hypertension. In one embodiment, the cardiac dysfunction results in a decrease in ejection fraction.

[0030] In one embodiment, the disorder is immune senescence that causes cancer due to a decrease in immune surveillance.

[0031] In one embodiment, the disorder is cancer including tumors that are treated by immunotherapy and tumors that have been previously treated with rapamycin or ever olimus or any other rapalog. In one embodiment, the cancer includes tumors in which the mTOR pathway is activated, including those with a mutation in the Tsc1 gene or those in which the tumor microenvironment is appropriately treated by a rapalog.

[0032] Details of one or more embodiments of the present disclosure are described herein. Other features objects, and advantages of the present disclosure will become apparent from the figures, detailed description, examples, and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0033]

Figure 1-1

Figure 1-2

Figure 2-1

Figure 2-2

Figure 3

Figure 4-1

Figure 4-2

Figure 4-3

Figure 4-4

Figure 5-1

Figure 5-2

Figure 5-3

Figure 5-4

Figure 6-1

Figure 6-2

Figure 6-3

Mode for Carrying Out the Invention

[0034] In a first aspect, the present disclosure provides a compound of formula (I)

Chemical formula

Chemical formula

Chemical formula

[0035] In one embodiment, the present disclosure relates to formula (I)

Chemical formula

Chemical formula

Chemical formula

[0036] Definition Unless otherwise specified, the term "compound of the present disclosure" refers to the compound of formula (I) and the exemplified compounds and salts thereof, and all stereoisomers (including diastereoisomers and enantiomers), rotamers, tautomers and isotopically labeled compounds (including deuterium substitution) and moieties formed inherently. As used herein, ) and rotamers, tautomers and isotopically labeled compounds (including deuterium substitution) and moieties formed inherently. is referred to.

[0037] As used herein, [Chem.] represents the variable linking moiety to the base molecule and includes both (R)- and (S)-configurations. For example, R is 2 when [Chem.] is the case, [Chem.] represents the moiety of the linkage of R2 to C16 and includes both (R)- and (S)-configurations.

[0038] As used herein, the term "C 1~6 alkyl" consists solely of carbon and hydrogen atoms, contains no unsaturation, has 1 to 6 carbon atoms, and refers to a straight-chain or branched hydrocarbon chain radical attached to the remainder by a single bond. The term "C alkyl" is to be interpreted accordingly. Examples of C 1~4 alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1-meth ylethyl (iso-propyl), n-butyl, n-pentyl, and 1,1-dimethylethyl 1~6 (t-butyl). (t-butyl).

[0039] As used herein, the term "hydroxy C 1~6 alkyl" refers to an alkyl group substituted by one or more -OH groups. Examples of hydroxy C 1~6 alkyl groups include , HO-CH2-, HO-CH2CH2-, and -CH2-CH(OH)-.

[0040] As used herein, the term "C 3~8 cycloalkyl C0~6 Alkyl " consists solely of carbon and hydrogen atoms, has 3 to 8 carbon atoms, and is attached to the rest of the molecule by a single bond or the C defined above 1~6 a stable monocyclic saturated hydrocarbon radical attached to the rest of the molecule by an alkyl radical. C 3~8 Cycloalkyl C 0~6 Examples of alkyl include cyclop ropyl, cyclopropyl-methyl, cyclobutyl, cyclobutyl-ethyl, cyclopent yl, cyclopentyl-propyl, cyclohexyl, cycloheptyl and cyclooctyl including, but not limited to.

[0041] As used herein, the term "phenyl C 0~6 alkyl" is a single bond or is a phenyl ring attached to the rest of the molecule by the C 1~6 alkyl radical defined above. Examples of phenyl C 0~6 alkyl include, but are not limited to, phenyl and benzyl.

[0042] As used herein, "hydroxy" or "hydroxyl" refers to -OH

[0043] Various (enumerated) embodiments of the present disclosure are described herein. The features specified in each embodiment will be recognized as being combinable with other specific features to provide further embodiments of the present disclosure.

[0044] Embodiment 1. A compound of formula (I) as described above or a pharmaceutically acceptable salt thereof.

[0045] Embodiment 2. The compound according to Embodiment 1, or a pharmaceutically acceptable salt thereof, wherein R1 is hydroxy. The salt to be contained.

[0046] Embodiment 3. R2 is

Chemical formula

Chemical formula

[0047] Embodiment 4. R2 is

Chemical formula

Chemical formula

[0048] Embodiment 5. R2 is

Chemical formula

[0049] Embodiment 6. R2 is

Chemical formula

[0050] Embodiment 7. R2 is [Chem.] A compound according to any one of Embodiments 1 to 4 or a pharmaceutically acceptable salt thereof. In one embodiment, R3 is hydrogen, C 1~6 alkyl or hydroxyC 1~6 alkyl. .

[0051] Embodiment 8. Formula (I)-A: [Chem.] (wherein R1 is hydroxy, [Chem.] selected from the group consisting of) A compound according to any one of Embodiments 1 to 5 or a pharmaceutically acceptable salt thereof. In one embodiment , R1 is hydroxyl. In one embodiment, R2 is as defined in formula (I). In one embodiment, the C16 position has an (R) configuration. In one embodiment, the C16 position has an (S) configuration.

[0052] Embodiment 9. C16-(1,1-dioxidoisothiazolidin-2-yl)-C32- deoxo-rapamycin (Compound 1): [Chem.] A compound according to any one of Embodiments 1 to 8 or a pharmaceutically acceptable salt thereof.

[0053] Embodiment 10. A compound according to any one of Embodiments 1 to 9 or a pharmaceutically acceptable salt thereof, which exists as a single diastereoisomer at C16. In one embodiment, the C16 position is , has an (R) configuration. In one embodiment, the C16 position has an (S) configuration.

[0054] Embodiment 11. A compound according to any one of Embodiments 1 to 9, which is present as a mixture of diastereomers at C16, or a pharmaceutically acceptable salt thereof. or a pharmaceutically acceptable salt thereof.

[0055] Embodiment 12. Formula (I)-B [Chemical formula] (wherein R1 and R2 are as defined for formula (I)) A compound according to any one of Embodiments 1 to 10, or a pharmaceutically acceptable salt thereof. In one embodiment, R2 is [Chemical formula] is.

[0056] Embodiment 13. (S)-C16-(1,1-dioxidoisothiazolidin-2-yl) -C32-deoxo-rapamycin (Example 1): [Chemical formula] A compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0057] Embodiment 14. (R)-C16-(1,1-dioxidoisothiazolidin-2-yl) -C32-deoxo-rapamycin (Example 2): [Chemical formula] A compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0058] Embodiment 15: A compound of formula (I) or a pharmaceutically acceptable salt thereof selected from the following .

[0059] [Table 1]

[0060] [Table 2]

[0061] [Table 3]

[0062] [Table 4]

[0063] [Table 5]

[0064] The definitions of specific functional groups and chemical terms are described in more detail below. Chemical elements are according to the Peri odic Table of the Elements, CAS version, H andbook of Chemistry and Physics, 75 th Ed ., which can be confirmed according to the inside and outside of the cover, and specific functional groups are generally defined as described therein . Moreover, the general principles of organic chemistry as well as specific functional moieties and reactivities are described in Tho mas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March’s Advanced Organic Chemistry , 5th Edition, John Wiley & Sons, Inc., New Yo rk, 2001; Larock, Comprehensive Organic Tra nsformations, VCH Publishers, Inc., New Yor k, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3 rd Edition, Cambridge ge University Press, Cambridge, 1987, as described therein.

[0065] Depending on the choice of starting materials and procedures, the compounds of the present disclosure may exist in one of the possible stereoisomeric forms, or as a mixture thereof with respect to the stereocenters not fixed by formula (I), formula (I)-A, and formula (I)-B, for example, as pure optical isomers or as a mixture of stereoisomers such as racemates and diastereoisomeric mixtures depending on the number of asymmetric carbon atoms. The present disclosure is intended to include all such possible stereoisomers, including racemic mixtures, mixtures of diastereomers, and optically pure forms. The optically active (R)- and (S)-stereoisomers can be prepared using chiral synthons or chiral reagents or can be resolved using conventional techniques. When the compound contains a double bond, the substituents can be in the E configuration or the Z configuration. When the compound contains a disubstituted cycloalkyl, the cycloalkyl substituents can have the cis configuration or the trans configuration. All tautomeric forms are also intended to be included. (R)- and (S)-stereoisomers can be prepared using chiral synthons or chiral reagents or can be resolved using conventional techniques. When the compound contains a double bond, the substituents can be in the E configuration or the Z configuration. When the compound contains a disubstituted cycloalkyl, the cycloalkyl substituents can have the cis configuration or the trans configuration. All tautomeric forms are also intended to be included. forms are also intended to be included.

[0066] The term "tautomer" refers to an interchangeable form of a particular compound structure that changes by the movement of a hydrogen atom and an electron atom. Thus, the two structures can be in equilibrium through the movement of π electrons and atoms (generally H ). For example, enol and ketone are tautomers because they are rapidly interconverted by treatment with either an acid or a base . Another example of tautomerism is the ac i- and nitro-forms of phenylnitromethane, which are likewise formed by treatment with an acid or a base . Tautomeric forms can be relevant to achieving the optimal chemical reactivity and biological activity of a compound of interest.

[0067] As used herein, the term "salt" refers to an acid addition salt or a salt base addition salt of a compound of the present disclosure. "Salt" includes, in particular, "pharmaceutically acceptable salts". The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of a compound of the present disclosure and is usually not biologically undesirable or otherwise undesirable in other respects. In many cases, compounds of the present disclosure can form salts of acids and / or bases due to the presence of amino groups and / or carboxyl groups or groups similar thereto. Pharmaceutically acceptable salts are well known in the art . For example, Berge et al. describe pharmaceutically acceptable salts in detail in J.Phar maceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference . Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids

[0068] . Inorganic acids that can induce salts include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid

[0069] and the like .​

[0070] Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, cyano acid, ethyl ester ... Oxic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, Andric acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicyl Includes acids and the like.

[0071] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.

[0072] Inorganic bases from which salts can be derived include, for example, ammonium salts and salts of the compounds of the I-XI periodic table. In some embodiments, the salts include sodium, potassium, ammonium, calcium, Particularly suitable salts are derived from ammonia, calcium, magnesium, iron, silver, zinc and copper. Includes ammonium, potassium, sodium, calcium and magnesium salts.

[0073] Organic bases from which salts can be derived include, for example, primary, secondary and tertiary amines, aryl ... Substituted amines, including naturally occurring substituted amines, cyclic amines, basic ion exchange resins and the like Specific organic amines include isopropylamine, benzathine, cholinate, etc. , diethanolamine, diethylamine, lysine, meglumine, piperazine and trometa Min included.

[0074] In another aspect, the present disclosure provides an acetate, an ascorbyl salt, an adipate, an aspartate. , benzoate, besylate, bromide / hydrobromide, bicarbonate / carbonate, bisulfate / sulfate Acid salt, camphorsulfonate, caprate, chloride / hydrochloride, chlortheophyllon -ate (chlortheophyllonate), citrate, ethanedisulfonate , fumarate, gluceptate, gluconate, glucuronate, glutamate, glu tarate, glycolate, hippurate, hydroiodide / iodide, isethionate, lactate, lactobionate, lauryl sulfate, malate, maleate, malonate, mandelate, mesylate, methyl sulfate, mucate, naphtoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate , pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, polygalacturonate, propio nate, sebacate, stearate, succinate, sulfosalicylate, sulfate, wine tartrate, tosylate, triphenylacetate, trifluoroacetate or xinafoate forms of the compound are provided.

[0075] Any formula shown herein is also intended to represent both the unlabeled form and the isotopically labeled form of the compound. Isotopically labeled compounds are those in which one or more atoms are replaced with an atom having a selected atomic mass or mass number, except that they have the structure represented by the formula shown herein. Isotopes that can be incorporated into the compounds of the present disclosure include, for example, isotopes of hydrogen such as deuterium (i.e., H or D). Furthermore, the incorporation of certain isotopes, particularly deuterium (i.e.,

[0076] H or D), can result in certain therapeutic advantages, such as increased metabolic stability, e.g., increased half-life in vivo or decreased required dosage or improved therapeutic index or tolerability 2 in vivo. In this regard, deuterium is understood to be considered a substituent of the compounds of the present disclosure. The concentration of deuterium can vary depending on the particular compound and the desired therapeutic effect. Accordingly, deuterium is understood to be considered a substituent of the compounds of the present disclosure. The concentration of deuterium can vary depending on the particular compound and the desired therapeutic effect. can be determined by the isotopic enrichment factor. As used herein, the term "isotopic enrichment factor" means the ratio between the isotopic abundance and the natural abundance for a particular isotope. In the compounds disclosed herein, when a substituent is shown to be deuterium, such a compound has an isotopic enrichment factor of at least 3500 (52.5% incorporation of deuterium for each specified deuterium), at least 40 00 (60% incorporation of deuterium), at least 4500 (67.5% incorporation of deuterium), at least 5000 (75% incorporation of deuterium), at least 5500 (82. 5% incorporation of deuterium), at least 6000 (90% incorporation of deuterium), at least 6333.3 (95% incorporation of deuterium), at least 6466.7 (97% incorporation of deuterium), at least 6600 (99% incorporation of deuterium) or at least 6 633.3 (99.5% incorporation of deuterium) for each specified deuterium. It should be understood that the term "isotopic enrichment factor" can be applied to any isotope in the same way as described for deuterium. Other examples of isotopes that can be incorporated into the compounds of the present disclosure include, respectively H, C, C, C, N,

[0077] O, 3 H, 11 C, 13 C, 14 C, 15 N, 18 F, 31 P, 32 P, 35 S, 36 Cl, 123 I, 12 4 I, 125 I, etc., including isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine. Accordingly, the present disclosure provides, for example,3 H and 14 one or more compounds incorporating any of the foregoing isotopes or 2 H and 13 compounds in which non-radioactive isotopes such as C are present should be understood to be included. Such isotope-labeled compounds are useful in the study of metabolism ( by 14 C), the study of reaction rates (e.g., 2 by 3 H or H), detection techniques or image processing techniques such as positron emission tomography (PET) or single photon emission computed tomography (SPECT), or radiotherapy of patients, including assays of drug or substrate tissue distribution. In particular, F or labeled compounds may be particularly desirable for PET or SPECT 18 studies. The isotope-labeled compounds of the present disclosure can generally be prepared by conventional techniques known to those skilled in the art or by processes similar to those described in the examples and preparations set forth herein, using appropriate isotope-labeled reagents in place of previously used unlabeled reagents. As used herein, the term "pharmaceutical composition" refers to a compound of the present disclosure or a pharmaceutically acceptable salt thereof in a form suitable for oral or parenteral administration, comprising at least one pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to substances useful in the preparation or use of a pharmaceutical composition, such as suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifying agents, absorption agents, etc., known to those skilled in the art.

[0078] As used herein, the term "pharmaceutical composition" refers to a compound of the present disclosure or a pharmaceutically acceptable salt thereof in a form suitable for oral or parenteral administration, comprising at least one pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to substances useful in the preparation or use of a pharmaceutical composition, such as suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifying agents, absorption agents, etc., known to those skilled in the art.

[0079] As used herein, the term "pharmaceutically acceptable carrier" refers to substances useful in the preparation or use of a pharmaceutical composition, such as suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffers, emulsifying agents, absorption agents, etc., known to those skilled in the art. agents, etc., known to those skilled in the art. Delaying agents, salts, pharmaceutical stabilizers, binders, excipients, disintegrants, lubricants, wetting agents, sweeteners, seasonings, colorants, and combinations thereof (see, e.g., Remington The Scien ce and Practice of Pharmacy, 22 nd Ed. Phar maceutical Press, 2013, pp. 1049-1070). ).

[0080] As used herein, the term "therapeutically effective amount" of a compound of the present disclosure refers to an amount of the compound of the present disclosure that induces a biological or medical response in a subject, e.g., reduces or inhibits the activity of an enzyme or protein, or alleviates symptoms, reduces a condition, delays or retards disease progression, or prevents a disease. In one embodiment, the term "therapeutically effective amount" refers to an amount of the compound of the present disclosure that, when administered to a subject, (1) (i) is mediated by the mTOR pathway, or (ii) is related to mTOR activity, or (iii) at least partially reduces, prevents and / or alleviates a condition or disorder or disease characterized by the activity of mTOR (normal or abnormal), or (2) reduces or inhibits the activity of mTOR, or (3) is effective to reduce or inhibit the expression of mTOR. In one embodiment, the term "therapeutically effective amount" refers to an amount of the compound of the present disclosure that, when administered to a cell or tissue or acellular biological substance or medium, is effective to at least partially reduce or inhibit the activity of mTOR, or at least partially reduce or inhibit the expression of mTOR. As used herein, the term "subject" refers to a primate (e.g., a human, male or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development. or female), and includes both human and non-human subjects. In certain embodiments, the subject is a mammal, and in certain embodiments, the subject is a human. The term "subject" also includes animals used in research, testing, and drug development.

[0081] As used herein, the term "subject" refers to a primate (e.g., a human, male or female), dog, cat, rabbit, guinea pig, pig, rat, and mouse. In one embodiment, the subject is a primate. In other embodiments, the subject is a human.

[0082] As used herein, the terms "administer", "administering", or "administration" refer to transplanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing the compound of the invention or its pharmaceutical composition.

[0083] As used herein, the terms "inhibit", "inhibition", or "inhibiting" refer to a significant decrease in the baseline activity of a given condition, symptom, or disorder or disease, or biological activity or process.

[0084] As used herein, for any disease or disorder, the terms "treat", "treating", or "treatment" refer to reducing the disease or disorder, delaying its onset, remitting (i.e., delaying or suppressing the occurrence of at least one manifestation of the disease or its clinical symptoms), or reducing or remitting at least one physical parameter or biomarker associated with the disease or disorder, which may include things that may not be distinguishable to the patient. In some embodiments, "treatment", "treating", and "treatment" require that the signs or symptoms of the disease, disorder, or condition have occurred or been observed. In other embodiments, treatment can be administered in the absence of signs or symptoms of the disease or condition. For example, treatment can be administered to a susceptible individual in light of the causative factors). Treatment can be continued, for example, to delay or prevent recurrence even after symptoms have resolved.

[0085] As used herein, the term "prevent" for any disease or disorder "preventing" or "prevention" refers to prophylactic treatment of a disease or disorder or delaying the onset or progression of a disease or disorder.

[0086] As used herein, "age - associated disease or disorder" refers to any disease or disorder in which the incidence in a population or the severity in an individual correlates with the progression of age. More specifically, an age - associated disease or disorder is a disease or disorder in which the incidence is at least 1.5 times higher among human individuals over 65 years of age compared to human individuals aged 25 - 35 years. Examples of age - associated disorders are sarcopenia, dermatoatrophy, cherry angioma, seborrheic keratosis, brain atrophy - also known as dementia, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke) chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia metabolic dysfunction, renal tubular disease, hearing loss, mobility impairment (e.g., frailty), cognitive decline, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or any cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and including type II diabetes including complications resulting from diabetes such as renal insufficiency, blindness and neuropathy but not limited to these.

[0087] As used herein, a subject "requires" treatment if such subject would benefit biologically, medically or in terms of quality of life from such treatment.

[0088] All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly inconsistent with the context. Any and all examples or exemplary representations provided herein (e.g., "such as") are used merely to clarify the disclosure and, unless otherwise claimed, do not result in a limitation of the scope of the disclosure.

[0089] Any asymmetric atom (e.g., carbon or the like) of a compound of the disclosure can exist in racemic or enantiomerically enriched, e.g., (R)-, (S)- or (R,S)-configuration. In certain embodiments, each asymmetric atom is in the (R)- or (S)-configuration with at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70 % enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess or at least 99% enantiomeric excess. Substituents of atoms having unsaturated double bonds can, where possible, exist in cis-(Z)- or trans-(E)-form.

[0090] Thus, as used herein, compounds of the disclosure encompass possible stereoisomers ​​​​It can exist in one form of a tautomer, a rotational isomer, an atropisomer, a tautomer or a mixture thereof, for example, as a substantially pure geometric (cis or trans) stereoisomer, a diastereomer, an optical isomer (enantiomer), a racemate or a mixture thereof. It can exist, for example, as a substantially pure geometric (cis or trans) stereoisomer, a di astereomer, an optical isomer (enantiomer), a racemate or a mixture thereof. It can.

[0091] Any resulting mixture of stereoisomers can be separated into pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization based on the physicochemical differences of the components. It can be separated by, for example, chromatography and / or fractional crystallization.

[0092] Any resulting racemate of the compounds or intermediates of the present disclosure can be resolved into optical enantiomers by known methods, for example, by separation of the diastereomeric salts obtained with an optically active acid or base and liberation of the optically active acidic or basic compound. In particular, the salt forming moiety can thus be used to resolve the compounds of the present disclosure into their optical enantiomers, for example, by fractional crystallization of the salts formed with an optically active acid, such as tartaric acid, dibenzoyl tartaric acid, di acetyl tartaric acid, di-O,O'-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor-10-sulfonic acid. The racemic compounds or racemic intermediates of the present disclosure can also be resolved by chiral chromatography, for example, by high performance liquid chromatography (HPLC) using a chiral adsorbent. The compounds of the present disclosure can be used to resolve them into their optical enantiomers by fractional crystallization of the salts formed with, for example, optically active acids such as tartaric acid, dibenzoyl tartaric acid, di acetyl tartaric acid, di-O,O'-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor-10-sulfonic acid. The racemic compounds or racemic intermediates of the present disclosure can also be resolved by chiral chromatography, for example, by high performance liquid chromatography (HPLC) using a chiral adsorbent. It can also be resolved by chiral chromatography, for example, by high performance liquid chromatography (HPLC) using a chiral adsorbent.

[0093] Method for preparing the compound of formula (I) In another aspect, the present disclosure provides a process for the production of the compounds of formula (I), formula (I)-A and formula (I)-B. The compounds of formula (I), formula (I)-A and formula (I)-B are shown in the scheme For example, the compounds of formula (I), formula (I)-A and formula (I)-B are shown in the scheme As described in Arms 1, 2, and 3, it can be produced according to the following process. can.

Chemical formula

[0094] A compound of formula (I) in which R2 is as defined under formula (I) is C32-deoxylapa mycin (Intermediate 1) with R2-H as defined under formula (I) and a reagent suitable for the substitution reaction, for example, in the presence of p-toluenesulfonic acid, in a suitable solvent, for example, dichloromethane, and reacting it can be obtained. Suitable conditions are as follows: 1) R2-H, p-toluenesulfonic acid - H2O, dichloromethane, room temperature 2) R2-H, trifluoroacetic acid, -40 °C, dichloromethane (see European Patent No. 121233 1B1 specification) 3) R2-H, 5M LiClO4, Et2O (0.1M), room temperature (see TL, 1995, 4 3,7823) 4) R2-H, Cp2HfCl2 - AgClO4 (Suzuki's catalyst), 4A MS, dichloro methane, room temperature (see TL, 1995, 43,7823) 5) R2-H, BF3-OEt2 or Zn(OTf)2, THF, 0 °C (see TL, 1994 , 37,6835) 6) R2-H, ZnCl2, dichloromethane, 0 °C (see JOC, 1994, 59,6512 ).

[0095] The C32-deoxylapamycin used as the starting material is, for example, described in U.S. Patent Application Publication No. 005985890 or International Publication No. 2007085400 pamphlet. As described hereinbefore, it can be prepared by methods known in the art. It can be done.

Chemical formula

[0096] R1 is

Chemical formula

Chemical formula

[0097] R1 is

Chemical formula

[0098] The reaction can be achieved according to conventional methods, for example, as described in the Examples. This can be done.

[0099] The work-up of the reaction mixture and the purification of the compounds obtained therewith can be carried out according to known procedures. This can be done.

[0100] Acid addition salts can be produced from the free base in a known manner and vice versa.

[0101] The starting materials can be known or can be prepared from known compounds, for example, as described in the Examples, starting from known compounds and following conventional procedures. This can be done.

[0102] In another aspect, the present disclosure provides a pharmaceutical composition comprising a compound of the present disclosure or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. In a further embodiment, the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein. The pharmaceutical composition can be formulated for a particular route of administration, such as oral administration, parenteral administration (e.g., by injection, infusion, transdermal or topical administration), and rectal administration. Topical administration can also relate to inhalation or nasal application. The pharmaceutical compositions of the present disclosure can be made in solid form (including, without limitation, capsules, tablets, pills, granules, powders or suppositories) or in liquid form (including, without limitation, solutions, suspensions or emulsions). Tablets can be film-coated or enteric-coated according to methods known in the art. Usually, the pharmaceutical composition comprises: a) a diluent, such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine; This can be done. This can be done. This can be done. (including, without limitation, capsules, tablets, pills, granules, powders or suppositories) or in liquid form (including, without limitation, solutions, suspensions or emulsions). Tablets can be film-coated or enteric-coated according to methods known in the art. Usually, the pharmaceutical composition comprises: a) a diluent, such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine; This can be done. b) Lubricants, such as silica, talc, stearic acid, its magnesium or calcium salts and / or polyethylene glycol; for tablets, furthermore, c) Binders, such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or poly vinylpyrrolidone; optionally, d) Disintegrants, such as starch, agar, alginic acid or its sodium salt or effervescent mixtures; and e) Absorbents, colorants, flavors and sweeteners in the form of tablets or gelatin capsules containing the active ingredient

[0103] The compounds of the present disclosure or pharmaceutically acceptable salts thereof may also be in the form of a drug eluting stent, i.e., a stent coated with the compounds of the present disclosure or pharmaceutically

[0104] The compounds of the present disclosure in free form or pharmaceutically acceptable salt form show, as shown in tests in vitro and in vivo, as provided in the following sections, beneficial pharmacological properties, such as the property of modulating the mTOR pathway, and are thus

[0105] desirable for use in therapy or as research chemicals, such as tool compounds. Methods for measuring the potency of mTORC1 inhibitors are well known in the art. An mTORC1 inhibitor having an IC50 value within 100-fold of the IC50 of rapamycin in is suitable for use in the present disclosure, and less potent rapalogs still more readily achieve only partial inhibition of mTORC1 activity in certain circumstances and may be desirable for improving the ability to measure molecules in the bloodstream (since higher concentrations are required for less potent molecules) - this would aid in the fine-tuning of the

[0106] blood concentration / efficacy relationship. Suitable assays for measuring the potency of mTOR inhibitors are, for example, as measured by IC50 values in the MLR (mixed lymphocyte reaction ) assay and / or the IL-6 (interleukin 6)-dependent mediated proliferation

[0107] assay, as described, for example, in U.S. Patent No. 5,665,772. The MLR assay is typically performed as follows: Spleen cells (0.5 × 106) from Balb / c mice (female, 8 - 10 weeks) are co-incubated for 5 days with 0.5 × 106 irradiated (2000 rad) or mitomycin C-treated spleen cells from CBA mice (female, 8 - 10 weeks). The irradiated allogeneic cells induce a proliferative response of the Balb / c spleen cells, which can be measured by incorporation of labeled precursors into DNA. The stimulator cells, being irradiated (or mitomycin C-treated), do not respond to Balb / c cells with proliferation but retain their antigenicity. The It can be compared with pamycin and expressed as a relative IC50 (i.e., IC50 test sample / IC50 rapamycin).

[0108] The IL-6-mediated proliferation assay is usually carried out as follows: The assay uses an interleukin-6 (IL-6)-dependent mouse hybridoma cell line and is performed in a 96-well microtiter plate. 5000 cells / well are cultured in serum-free medium supplemented with 1 ng recombinant IL-6 / ml (as described by M.H. Sch reier and R.Tees in Immunological Methods, I. Lefkovits and B. Pernis, eds., Academic Press 1981. Vol. II, pp. 263-275). After 66 hours of incubation in the absence or presence of the test sample, the cells are further pulse-labeled with 1 μCi (3-H)-thymidine / well for 6 hours, harvested, and counted by liquid scintillation . Incorporation of (3-H)-thymidine into DNA correlates with an increase in cell number and thus serves as a measure of cell proliferation. A dilution series of the test sample allows calculation of the concentration that results in 50% inhibition of cell proliferation (IC50). The inhibitory ability of the test sample can be compared with rapamycin and expressed as a relative IC50 (i.e., IC50 test sample / IC50 rapamycin).

[0109] The efficacy of an mTOR inhibitor can also be determined using a MEF TSC1- / - cell-based assay. MEF TSC1- / - cells are mouse embryonic fibroblasts lacking the tuberous sclerosis protein, TSC1, which negatively regulates mTORC1 signaling. Thus That is, TSC1 deficiency induces constitutive mTORC1 activation, leading to phosphorylation (activation) of downstream proteins in the mTORC1 signaling pathway. This cell-based assay is used to measure the inhibition (dephosphorylation) of the signaling components S6 and 4EBP1 of mTORC1 by rapalog or other mTOR inhibitors. The assay is typically performed as follows: MEF TSC1− / − cells are plated on poly-D -lysine-coated 384-well Greiner clear-bottom plates and incubated overnight at 37 °C, 5% CO2. The next day, the cells are washed 8 times with "Hard star

[0110] ve" solution (1 L DPBS + 1 g D-(+) glucose + 10 ml of 7.5% sodium bicarbonate + 20 ml of 1 M HEPES) and incubated for a further 2 h in the same solution. The cells are then treated with the compound in decreasing concentrations (8 steps with 3.16-fold dilution) and incubated at 37 °C, 5% CO2 for 2 h. The cells are fixed with 4% paraformaldehyde for 30 min, washed 5 times with TBS-EDTA, and then immunostained with fluorescent-tagged antibodies against pS6 and p4EBP1. The nuclei are visualized by Hoechst staining. The cells are imaged using each fluorescence channel, and the potency of the mTOR inhibitor is defined by pS6 IC ve (nM). and incubated for a further 2 h in the same solution. The cells are then treated with the compound in decreasing concentrations (8 steps with 3.16-fold dilution) and incubated at 37 °C, 5% CO2 for 2 h. The cells are fixed with 4% paraformaldehyde for 30 min, washed 5 times with TBS-EDTA, and then immunostained with fluorescent-tagged antibodies against pS6 and p4EBP1. The nuclei are visualized by Hoechst staining. The cells are imaged using each fluorescence channel, and the potency of the mTOR inhibitor is defined by pS6 IC ve (nM). and p4EBP1. The nuclei are visualized by Hoechst staining. The cells are imaged using each fluorescence channel, and the potency of the mTOR inhibitor is defined by pS6 IC ve (nM). ve (nM). ve (nM). 50 (nM).

[0111] Diseases and Disorders The compounds of the present disclosure are - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, proliferation and migration of smooth muscle cells causing restenosis and migration, - Autoimmune diseases and inflammatory conditions, - Treatment and prevention of asthma, - Multidrug resistance (MDR), - Fungal infections, - Inflammation, - Infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, particularly cancer, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, - Situations such as an increase in age-induced cytokines (e.g., IL6), which have been shown to increase the likelihood of age-related diseases, - Treatable conditions, - Disorders including fibrosis and / or inflammatory processes, such as liver and kidney disorders - May be useful for the prevention or treatment of symptoms or prodromal states selected from. As an example, liver fibrosis, cirrhosis, toxic liver failure, non-alcoholic liver - steatosis or NASH and alcoholic steatosis occurring in end-stage liver disease are included. Another example is kidney fibrosis, - which occurs as a result of acute kidney injury and causes chronic kidney disease. Furthermore, diabetic - nephropathy may induce kidney fibrosis and inflammation. In many cases, kidney disease causes heart failure as a result of an increase in blood pressure - which may also be associated with heart fibrosis. Rapalog - is effective at an early stage in treating models of heart dysfunction and is effective in reducing liver fibrosis in patients who have received a liver transplant (Buss, S.J. et al. Ben - eficial effects of Mammalian target of r - apamycin inhibition on left ventricular - remodeling after myocardial infarction. J - apamycin inhibition on left ventricular - remodeling after myocardial infarction. J Am Coll Cardiol.(2009)54(25):2435-46;Bu ss,S.J.et al.Augmentation of autophagy b y mTOR-inhibition in myocardial infarcti on:When size matters.Autophagy.(2010)6(2 ):304-6;Villamil,F.G.et al.Fibrosis prog ression in maintenance liver transplant patients with hepatitis C recurrence:a r andomized study of everolimus vs.calcine urin inhibitors.Liver Int.(2014)34(10):1 513-21).

[0112] The treatment of acute or chronic organ or tissue transplant rejection includes, for example, the treatment of recipients of heart, lung, heart-lung simultaneous, liver, kidney, pancreas, skin or corneal transplants. The compounds of the present disclosure are also shown for the prevention of graft-versus-host disease, such as after bone marrow transplantation.

[0113] Transplant vasculopathy includes atherosclerotic disease.

[0114] Autoimmune diseases and inflammatory conditions include inflammatory conditions caused by etiologies involving autoimmune elements, particularly arthritis (e.g., rheumatoid arthritis, progressive chronic arthritis and osteoarthritis) and rheumatic diseases. Specific autoimmune diseases for which the compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-C can be used are autoimmune blood diseases (e.g., hemolytic anemia, aplastic anemia, Systemic lupus erythematosus (including aplastic anemia, erythroleukemia, and idiopathic thrombocytopenic purpura) , polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis syndrome, psoriasis, Stevens-Johnson syndrome, sprue of unknown cause, autoimmune inflammatory intestinal diseases (including, for example, ulcerative colitis and Crohn's disease), endocrine ophthalmopathy, Graves' disease , sarcoidosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (type I true diabetes mellitus), uveitis (anterior and posterior), keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, glomerulonephritis (including, for example, nephrotic syndrome with and without nephrotic syndrome including idiopathic nephrotic syndrome or minimal change nephrotic syndrome) and juvenile dermatomyositis.

[0115] The treatment of multidrug resistance (MDR) includes enhancing the efficacy of other chemotherapeutic agents in the treatment and control of multidrug-resistant states such as multidrug-resistant cancer or multidrug-resistant AIDS. MDR is a particular problem in cancer patients and AIDS patients who would not respond to conventional chemotherapy because the drug is effluxed from the cell by Pgp.

[0116] Infectious diseases include infections by pathogens having Mip or Mip-like factors.

[0117] Age-related diseases include sarcopenia, cutaneous atrophy, cherry angioma, seborrheic keratosis, brain atrophy - also called dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis , osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubule disease, hearing loss, mobility impairment (e.g., frailty), cognitive​​ low awareness, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and complications resulting from diabetes such as renal failure, blindness and neuropathy, including type II diabetes including.

[0118] Neurodegenerative diseases include Huntington's disease, Parkinson's disease, spinocerebellar ataxia type 3, Alzheimer's disease, motor neuron disease and peripheral neuropathy.

[0119] Proliferative disorders include cancer. Such conditions are those described in U.S. Patent No. 9,669,032, especially renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, uterine body cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma , sarcoma, lymphoma or neck cancer.

[0120] Seizures and seizure disorders include West syndrome, focal cortical dysplasia (FCD), tuberous sclerosis complex (TSC), childhood absence epilepsy, childhood benign focal epilepsy, juvenile myoclonic epilepsy (JME), temporal lobe epilepsy, frontal lobe epilepsy, refractory epilepsy, Lennox-Gastaut syndrome, occipital lobe epilepsy, Proteus syndrome, hemimegalencephaly (HMEG), megalencephaly (MEG), capillary malformation syndrome (MCAP) and megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH). including.

[0121] Mitochondrial myopathy and mitochondrial stress are mitochondrial diseases described in Chinnery, P.F .(2015); EMBO Mol. Med. 7, 1503 - 1512; Koopman , W.J. et al.,(2016); EMBO Mol. Med. 8, 311 - 32 7 and Young, M.J., and Yound and Copeland, W.C .(2016); Curr. Opin. Genet. Dev. 38, 52 - 62. It is a mitochondrial disease described above.

[0122] Treatable conditions that have been shown to make age - associated diseases more future - proof include aging, e.g g., including immunosenescence. This is diagnosed by (i) an increase in circulating cytokines such as IL - 6, but also by (ii) senescent cells found in muscle, kidney, liver, brain, neurons, liver, pancreas or heart, or further by (iii) a decline in the efficiency of DNA repair that can be shown by an increase in the transcription of repetitive elements containing transposon - encoded genes For background, see Baker, D.J. et al, Nature, 2016; 530(7589):184 - 9. doi:10.1038 / nature16932. Epub 2016 Feb 3. See Baker, D.J. et al, Nature, 2016; 530(7589):184 - 9. doi:10.1038 / nature16932. Epub 2016 Feb 3.

[0123] Methods of Treatment and Uses The present disclosure provides for the use of the compounds of the present disclosure for use in therapy. In a further embodiment, the therapy is selected from diseases or disorders or co - morbidities that can be treated by modulation of the mTOR pathway In one embodiment, the disease is selected from the list above, and in one embodiment it is an age - associated disease such as a pathological condition related to respiratory infections in the elderly.

[0124] The present disclosure provides compounds of the present disclosure for use in therapy. Further embodiments provide that the therapy is selected from diseases that can be treated by modulation of the mTOR pathway. In one embodiment the disease is selected from the aforementioned list and in one embodiment is an age-associated disease such as a pathological condition associated with respiratory infections in the elderly

[0125] The present disclosure provides the use of compounds of the present disclosure for the manufacture of a medicament. Further embodiments provide that the medicament is for the prevention or treatment of diseases that can be treated by modulation of the mTOR pathway In one embodiment, the disease is selected from the aforementioned list and in one embodiment is an age-associated disease such as a pathological condition associated with respiratory infections in the elderly

[0126] In one aspect, the present disclosure is a method of treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof or a combination of medicaments comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof In one aspect, the present disclosure is a method of treating a disease or disorder in a subject, wherein the target tissue or organ associated with the pathophysiology of the disease or disorder has an FKBP 12 level sufficient to inhibit mTORC1, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B and formula

[0127] In one aspect, the present disclosure is a method of treating a disease or disorder in a subject, wherein the disease or disorder has a target tissue or organ associated with the pathophysiology of the disease or disorder that has an FKBP 12 level sufficient to inhibit mTORC1, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B and formula ​​​(I)-C or a pharma- ceutically acceptable salt thereof, A pharmaceutical composition comprising a compound of formula (I)-B and a compound of formula (I)-C or a pharma- ceutically acceptable salt thereof. or a compound of formula (I), formula (I)-A, formula (I)-B, or formula (I)-C, or a pharmaceutical composition thereof The present invention includes administering a pharmaceutical combination, including a physiologically acceptable salt thereof, to a subject in need thereof. Well, we provide a method.

[0128] In one aspect, the disclosure provides a method for treating mTORC1-related metabolic syndrome (MDS) comprising administering to a subject a therapeutically effective amount of FKBP12 sufficient to inhibit mTORC1. Treating a disease or disorder in a subject previously determined to have or have A method comprising administering a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B, or formula (I)-C. or a pharma- ceutically acceptable salt thereof, Formula (I), Formula (I)-A, Formula (I)-B, and A pharmaceutical composition comprising a compound of formula (I)-C or a pharma- ceutically acceptable salt thereof or a compound of formula (I) Compounds of formula (I)-A, formula (I)-B and formula (I)-C or pharma- ceutically acceptable salts thereof The method includes administering to a subject in need thereof a pharmaceutical combination comprising a salt thereof. do.

[0129] In one embodiment, the disease or disorder is sarcopenia, atrophy of the skin, cherry angioma, Seborrheic keratosis, cerebral atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, deformity Arthropathy, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke (medium), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, intrauterine Membrane hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy and / or cardiac dysfunction, such as systolic and / or diastolic dysfunction, and / or hypertension damage, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease , cancer, immunosenescence leading to cancer due to decreased immune surveillance, infectious diseases due to weakened immune function, Chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and kidney failure, blindness and type II diabetes including complications resulting from diabetes such as neuropathy.

[0130] In one embodiment, the disorder is liver fibrosis.

[0131] In one aspect, the present disclosure provides a method for treating a disease or disorder in a subject in need thereof. The method comprises administering to a patient a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B, or formula (I)-C. or a pharma- ceutically acceptable salt thereof, A pharmaceutical composition comprising a compound of formula (I)-C or a pharma- ceutical acceptable salt thereof, Compounds of formula (I)-A, formula (I)-B and formula (I)-C or pharma- ceutically acceptable salts thereof administering to a subject a pharmaceutical combination comprising a salt thereof, - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - Proliferation of smooth muscle cells that causes intimal hyperplasia, vascular occlusion, coronary arteriosclerosis and restenosis and migration, - autoimmune diseases and inflammatory conditions, - Treatment and prevention of asthma, - Multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders, and - Mitochondrial myopathy and mitochondrial stress Provided is a method selected from

[0132] In one embodiment, the disorder is a disorder including a fibrosis and / or inflammation process.

[0133] In one embodiment, the disorder is selected from liver disorders and kidney disorders.

[0134] In one embodiment, the liver disorder occurs in end-stage liver disease and is selected from hepatic fibrosis, cirrhosis, liver failure due to toxicity, non-alcoholic hepatic steatosis or NASH, and alcoholic hepatic steatosis.

[0135] In one embodiment, the kidney disorder is renal fibrosis.

[0136] In one embodiment, the renal fibrosis results from acute kidney injury.

[0137] In one embodiment, the kidney disorder is chronic kidney disorder.

[0138] In one embodiment, the kidney disorder is diabetic nephropathy.

[0139] In one aspect, the present disclosure provides a method for treating an age-related disorder or age-associated disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, or a combination of medicaments comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy, atherosclerosis ​​​​​​arteriosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract , macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease , liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vasculopathy , hearing loss, mobility impairment, cognitive decline, tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction , immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence that causes cancer due to reduced immune surveillance , infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity , ageusia, anosmia, arthritis and complications resulting from diabetes such as renal failure, blindness and neuropathy Provided is a method selected from type II diabetes including complications resulting from diabetes.

[0140] In one aspect, the present disclosure is a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I ), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof or a combination of pharmaceuticals comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof. administering to the subject.

[0141] In one embodiment, the method further comprises a PD-1 / PDL-1 inhibitor.

[0142] In one embodiment, the cancer is renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, uterine body cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple ​Multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and cervical cancer.

[0143] In one aspect, the present disclosure provides a compound of formula (I), formula (I)-A, formula (I )-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), formula (I )-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, or a combination of medicaments comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof for use as a medicament.

[0144] In one aspect, the present disclosure provides a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof, or a combination of medicaments comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof for use in the prevention or treatment of a disorder or disease mediated by the mTOR pathway. (I)-C or a pharmaceutically acceptable salt thereof, or a combination of medicaments comprising a compound of formula (I), formula (I)-A, formula (I)-B, and formula (I)-C or a pharmaceutically acceptable salt thereof.

[0145] In one aspect, the present disclosure provides - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, proliferation and migration of smooth muscle cells causing restenosis, - autoimmune diseases and inflammatory conditions, - treatment and prevention of asthma, - multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - Age-related diseases, - neurodegenerative diseases, - proliferative disorders, particularly cancer, - seizures and seizure disorders, - mitochondrial myopathy and mitochondrial stress, and - situations with an increase in aging-induced cytokines, etc., increasing the likelihood of age-related diseases are shown to be treatable conditions for use in the prevention or treatment of disorders or diseases selected from compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or pharmaceutically acceptable salts thereof, formula (I), formula (I)-A, formula (I)-B and formula (I)-C or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)- C or pharmaceutically acceptable salts thereof, or combinations of medicaments comprising compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-

[0146] In one aspect, the present disclosure provides compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)- C or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)- C or pharmaceutically acceptable salts thereof, or combinations of medicaments comprising compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or pharmaceutically acceptable salts thereof for use in the prevention or treatment of disorders or diseases including a process of fibrosis and / or inflammation. In one embodiment, the disorder is selected from liver disorders and kidney disorders. In one embodiment, the liver disorder is liver fibrosis, cirrhosis, liver failure caused by toxicity, non-alcohol-related hepatic steatosis or NASH, and alcohol-related lipidosis

[0147] occurring in end-stage liver diseases.

[0148] ​​selected from adiposis.

[0149] In one embodiment, the kidney disorder is renal fibrosis resulting from acute kidney injury.

[0150] In one embodiment, the kidney disorder is chronic kidney disease.

[0151] In one embodiment, the kidney disorder is diabetic nephropathy.

[0152] In one aspect, the present disclosure relates to sarcopenia, dermal atrophy, cherry angioma, seborrheic keratosis, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubular disease, hearing loss, mobility impairment (e.g., frailty), cognitive decline, tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to decreased immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, ageusia, anosmia, arthritis, and complications resulting from diabetes such as renal failure, blindness and neuropathy, for use in the prevention or treatment of age-related disorders or age-associated diseases selected from type II diabetes, compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or pharmaceutically acceptable salts thereof, pharmaceutical compositions comprising compounds of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or pharmaceutically acceptable salts thereof, or formula (I), A medicament comprising a compound of formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof is provided.

[0153] In one aspect, the present disclosure provides a compound of formula (I), formula (I )-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof, a formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of cancer, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)- C or a pharmaceutically acceptable salt thereof, or a combination of medicaments

[0154] In one aspect, the present disclosure provides a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof, a formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a pharmaceutically acceptable salt thereof for use in the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma,

[0155] sarcoma, lymphoma or cervical cancer, a pharmaceutical composition comprising a compound of formula (I), formula (I)-A, formula (I)-B and formula (I)-C or a

Chemical formula

[0156] In one embodiment, the disorder or disease is - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, smooth muscle cell proliferation and migration that cause restenosis, - autoimmune diseases and inflammatory conditions, - treatment and prevention of asthma, - multi-drug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - age-related diseases, - neurodegenerative diseases, - proliferative disorders, particularly cancer, - seizures and seizure disorders, - mitochondrial myopathy and mitochondrial stress, and - situations with an increase in age-induced cytokines (e.g., IL6), such as treatable conditions shown to have a high likelihood of age-related diseases selected from.

[0157] In one embodiment, the disorder or disease is sarcopenia, dermatoatrophy, cherry angioma, seborrheic keratosis, brain atrophy - also called dementia, atherosclerosis, arteriosclerosis emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, Stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis , autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vasculopathy, hearing loss, mobility impairment ( e.g., frailty), cognitive decline, tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic function impairment, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune senescence causing cancer due to decreased immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and complications resulting from diabetes such as renal failure, blindness and neuropathy, is an

[0158] aging-related disorder or age-associated disease selected from type II diabetes including complications. In one embodiment, the disorder or disease is a liver disorder and / or an inflammatory process including fibrosis, e.g., liver impairment and kidney impairment. In one embodiment, the disorder is kidney impairment. In one embodiment, the disorder is liver impairment. Examples include liver fibrosis, cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH and alcohol-related steatosis occurring in end-stage liver disease. Another example is kidney fibrosis, which results from acute kidney injury and causes chronic kidney disease. Further, diabetic nephropathy may induce kidney fibrosis and inflammation. In many cases, kidney disease causes heart failure as a result of increased blood pressure, which may also be associated with

[0159] cardiac fibrosis. Rapalog is effective at an early stage in treating models of cardiac dysfunction and depends on the individual's condition, the disorder or disease being treated, or its severity. Normal skills A physician, clinician, or veterinarian having ordinary skill can readily determine the respective effective amounts of the active ingredients necessary to prevent, treat, or inhibit the progression of a disorder or disease.

[0160] The properties for the dosages listed above can be conveniently demonstrated in in vitro and in vivo tests using mammals such as mice, rats, dogs, monkeys, or excised organs, tissues, and their preparations. The compounds of the present disclosure can be administered in vitro in the form of solutions, for example aqueous solutions, and in vivo enterally, parenterally, preferably intravenously, for example as a suspension or in an aqueous solution. The dosage can range from about 10 -3 molar to 10 -9 molar concentration in vitro. The therapeutically effective amount in vivo can range from about 0.1 to 500 mg / kg or about 0.1 to 500 mg per subject, depending on the administration route and can range within the bounds of about 0.1 to 500 mg / kg or about 0.1 to 500 mg per subject.

[0161] The compounds of the present disclosure can be administered simultaneously with, before, or after one or more other therapeutic agents. The compounds of the present disclosure can be administered separately, by the same or different administration routes as the other agents or together in the same pharmaceutical composition. The therapeutic agents can be, for example, chemical compounds, peptides, antibodies, antibody fragments, or nucleic acids, which are either therapeutically active or enhance the therapeutic activity when administered to a patient in combination with the compounds of the present disclosure . In one embodiment, the present disclosure provides a preparation comprising a compound of the present disclosure and at least one other therapeutic agent, as a combined preparation for use simultaneously, separately, or sequentially in therapy .

[0162] ​ to provide a product. In one embodiment, the therapy is through partial or complete inhibition of mTOR for the treatment of a disease or condition. The product provided as a combined preparation is a composition containing both the compound of the present disclosure and another therapeutic agent in the same pharmaceutical composition or separate forms, such as kits containing the compound of the present disclosure and another therapeutic agent in the form of a kit.

[0163] In one embodiment, the present disclosure provides a pharmaceutical composition containing the compound of the present disclosure and another therapeutic agent. Optionally, the pharmaceutical composition may contain a pharmaceutically acceptable carrier as described above.

[0164] In one embodiment, the present disclosure provides a kit containing two or more separate pharmaceutical compositions, at least one of which contains the compound of the present disclosure. In one embodiment, the kit includes means for separately holding the compositions, such as a container, a vial, a foil package for a small portion, etc. An example of such a kit is a blister pack commonly used for packaging tablets, capsules, and the like.

[0165] The kits of the present disclosure can be used, for example, to administer different dosage forms, oral and parenteral, to administer separate compositions at different dosing intervals, or to titrate separate compositions with respect to each other. To facilitate compliance, the kits of the present disclosure typically include instructions for administration.

[0166] In the combination therapy of the present disclosure, the compound of the present disclosure and another therapeutic agent can be manufactured and / or formulated by the same or different manufacturers. Moreover, the compound of the present disclosure and other therapeutic agents (i) before the release of the formulation to physicians (e.g., in a kit containing the compound of the present disclosure and another therapeutic agent) ​ in the case of (ii) immediately before administration by the physician himself (or under the guidance of the physician), (iii) for example, it can be incorporated into combination therapy by the patient himself during the continuous administration of the compounds of the present disclosure and other therapeutic agents. can be.

[0167] Accordingly, the present disclosure provides the use of the compounds of the present disclosure for preventing or treating a disease or condition via partial or complete inhibition of mTOR, and the medicament is prepared for administration together with another therapeutic agent. The present disclosure also provides the use of another therapeutic agent for preventing or treating a disease or condition mediated by mTOR inhibition, and the medicament is administered together with the compounds of the present disclosure. Accordingly, the present disclosure provides the use of the compounds of the present disclosure for preventing or treating a disease or condition via partial or complete inhibition of mTOR, and the medicament is prepared for administration together with another therapeutic agent. The present disclosure also provides the use of another therapeutic agent for preventing or treating a disease or condition mediated by mTOR inhibition, and the medicament is administered together with the compounds of the present disclosure. Accordingly, the present disclosure provides the use of the compounds of the present disclosure for preventing or treating a disease or condition via partial or complete inhibition of mTOR, and the medicament is prepared for administration together with another therapeutic agent. The present disclosure also provides the use of another therapeutic agent for preventing or treating a disease or condition mediated by mTOR inhibition, and the medicament is administered together with the compounds of the present disclosure. Accordingly, the present disclosure provides the use of the compounds of the present disclosure for preventing or treating a disease or condition via partial or complete inhibition of mTOR, and the medicament is prepared for administration together with another therapeutic agent. The present disclosure also provides the use of another therapeutic agent for preventing or treating a disease or condition mediated by mTOR inhibition, and the medicament is administered together with the compounds of the present disclosure. is.

[0168] The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides compounds of formula (I), formula (I)-A and (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds of the present disclosure are prepared for administration together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is prepared for administration together with a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof. The present disclosure also provides compounds of formula (I), formula (I)-A and formula (I)-B or pharmaceutically acceptable salts thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the compounds are administered together with another therapeutic agent. The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B The present disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, and the other therapeutic agent is a compound of formula (I), formula (I)-A and formula (I)-B administered together with or as its pharmaceutically acceptable salt.

[0169] The present disclosure also provides for the use of a compound of formula ( I), formula (I)-A and formula (I)-B or its pharmaceutically acceptable salt for preventing or treating a disease or condition mediated by mTOR, where the patient has been previously (e.g., within 24 hours) treated with another therapeutic agent. The present disclosure also provides for the use of another therapeutic agent for preventing or treating a disease or condition mediated by mTOR, where the patient has been previously (e.g., within 24 hours) treated with a compound of formula (I), formula (I)-A and formula (I)-B or its pharmaceutically acceptable salt.

[0170] In another aspect, the present disclosure provides for the use of a compound of formula (I), formula (I)-A and formula (I)-B or its pharmaceutically acceptable salt for the manufacture of a medicament.

[0171] In another aspect, the present disclosure provides for the use of a compound of formula (I), formula (I)-A and formula (I)-B or its pharmaceutically acceptable salt for the manufacture of a medicament for the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

[0172] In another aspect, the present disclosure provides for - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, proliferation and migration of smooth muscle cells causing restenosis, - autoimmune diseases and inflammatory conditions, - treatment and prevention of asthma, - multi-drug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - age-related diseases, ​​​​​​​​- Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, and - Situations with an increase in aging-induced cytokines, etc., increasing the likelihood of age-related diseases for the manufacture of a medicament for the prevention or treatment of a treatable condition selected from the disorders or diseases, for the use of a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof is provided.

[0173] In another aspect, the present disclosure provides for the manufacture of a medicament for the prevention or treatment of a disorder or disease including a process of fibrosis or inflammation, for the use of a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof.

[0174] In one embodiment, the disorder is selected from liver disorders and kidney disorders.

[0175] In one embodiment, the liver disorder is hepatic fibrosis, cirrhosis, liver failure caused by toxicity, non-alcohol-related hepatic steatosis or NASH, and alcohol-related steatosis occurring in end-stage liver diseases. selected from.

[0176] In one embodiment, the kidney disorder is renal fibrosis resulting from acute kidney injury.

[0177] In one embodiment, the kidney disorder is chronic kidney disease.

[0178] In one embodiment, the kidney disorder is diabetic nephropathy.

[0179] In another aspect, the present disclosure provides for sarcopenia, dermatoatrophy, cherry angioma, seborrheic keratosis, brain atrophy - also called dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema ​ 、osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis, auto- immune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vasculopathy, hearing loss, mobility impairment, cognitive decline 、tendon stiffness, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or hypertension such as cardiac dysfunction, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infections due to reduced immune function decline, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis and renal failure, blindness and neuropathy and other complications resulting from diabetes, including type II diabetes for the manufacture of a medicament for the prevention or treatment of an age-related disorder or age-associated disease selected from the manufacture of a medicament for the manufacture of a medicament for the prevention or treatment of an age-related disorder or age-associated disease selected from the use of a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof.

[0180] In another aspect, the present disclosure provides for the manufacture of a medicament for the manufacture of a medicament for the prevention or treatment of cancer for the manufacture of a medicament for the manufacture of a medicament for the prevention or treatment of cancer the use of a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof.

[0181] In another aspect, the present disclosure provides for the manufacture of a medicament for the manufacture of a medicament for the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, uterine body cancer, uterine endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma 、sarcoma, lymphoma or cervical cancer, the use of a compound of formula (I), formula (I)-A and formula (I)-B or a pharmaceutically acceptable salt thereof is provided.

[0182] Particular individual combinations that can provide the benefits of a particular treatment are combinations that include a compound

Chemical formula

[0183] In one embodiment, the present disclosure provides a product, as a combined preparation for use simultaneously, separately, or sequentially in therapy, that includes a compound

Chemical formula

[0184] In one embodiment, the present disclosure provides a compound [Chemical] or a pharmaceutically acceptable salt thereof and a catalytic mTOR inhibitor, particularly those as described above and provide a pharmaceutical composition comprising a pharmaceutically acceptable carrier. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32- deoxo-rapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl) -C32-deoxo-rapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0185] In one embodiment, the other therapeutic agent is selected from a humanized anti-CD4 antibody, such as an anti-CD4 antibody such as zanilimab or an antigen-binding fragment thereof, or a CD4 lymphocyte depleting agent. Such therapeutic agents can be used particularly for the treatment of growth disorders, particularly cancer. For such combination therapies reference is made to U.S. Patent No. 8,906,374 and U.S. Patent No. 9,427,463 See.

[0186] Specific individual combinations that can provide the benefits of a particular treatment are the compound [Chemical] or a pharmaceutically acceptable salt thereof and a CD4 lymphocyte depleting agent, particularly those as described above In one embodiment, the compound is (S)-C16-(1,1-dioxide isothiazolidin-2-yl)-C32-deoxo-rapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-(1,1- (S)-C16-(1,1-dioxideisothiazolidin-2-yl)-C32-deoxo-rapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0187] In one embodiment, the present disclosure is for use simultaneously, separately or sequentially in therapy a combined preparation of the compound [Chemical formula] or a pharmaceutically acceptable salt thereof and a CD4 lymphocyte depleting agent, particularly as described above and provides a product comprising the same. In one embodiment, the compound is (S)-C16-(1,1-di oxideisothiazolidin-2-yl)-C32-deoxo-rapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-( 1,1-dioxideisothiazolidin-2-yl)-C32-deoxo-rapamycin( Example 2) or a pharmaceutically acceptable salt thereof.

[0188] In one embodiment, the present disclosure provides a pharmaceutical composition comprising the compound [Chemical formula] or a pharmaceutically acceptable salt thereof, a CD4 lymphocyte depleting agent, particularly as described above, and a pharmaceutically acceptable carrier. In one embodiment, the compound is (S)-C16-(1,1-dioxideisothiazolidin-2-yl)-C32- deoxo-rapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment the compound is (R)-C16-(1,1-dioxideisothiazolidin-2-yl) -C32-deoxo-rapamycin (Example 2) or a pharmaceutically acceptable salt thereof. ​

[0189] In one embodiment, the other therapeutic agent is selected from agents that modulate the activity of immune inhibitory proteins such as anti-PD-1 antibodies or anti-PDL-1 antibodies, such as PD-1 / PDL-1. Anti-PD-1 antibodies useful as such therapeutic agents are as disclosed in U.S. Patent No. 9,683,048 As described. Such therapeutic agents can be used in the treatment of cancer, particularly in cancer immunotherapy .

[0190] Specific individual combinations that can provide the benefits of a particular treatment include a compound

Chemical formula

[0191] In one embodiment, the present disclosure provides a product as a combined preparation for use simultaneously, separately, or sequentially in therapy comprising a compound

Chemical formula

[0192] In one embodiment, the present disclosure

Chemical Structure

Examples

[0193] The present disclosure provides the following examples. The synthetic and biological examples described in this application are presented to illustrate the compounds, pharmaceutical compositions and methods provided herein and should in no way be construed as limiting their scope.

[0194] The compounds provided herein will be well known to those skilled in the art and are described below ​Prepared from readily available starting materials using an improved method of a specific synthetic protocol is possible. When given typical or preferred process conditions (i.e., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.), other process conditions can also be used, unless otherwise specified It will be understood. The optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art by routine optimization procedures Moreover, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing unwanted reactions The selection of a protecting group suitable for a particular functional group and the conditions suitable for protection and deprotection are well known in the art. For example, numerous protecting groups and their introduction and removal are described in Greene et al., Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991 and the references cited therein

[0195] In addition, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing unwanted reactions The selection of a protecting group suitable for a particular functional group and the conditions suitable for protection and deprotection are well known in the art. For example, numerous protecting groups and their introduction and removal are described in Greene et al., Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991 and the references cited therein Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991 and the references cited therein Groups in Organic Synthesis, Second Edit ion, Wiley, New York, 1991 and the references cited therein are described.

[0196] Rapamycin and its derivatives, such as the compounds of formula (I), formula (I)-A and formula (I)-B, exist in a solvent- and pH-dependent equilibrium state in the hemi-ketal forms of 6-membered and 7-membered rings shown below as E and F (Schemes 4 and 5). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142 Rapamycin and its derivatives exist in a solvent- and pH-dependent equilibrium state in the hemi-ketal forms of 6-membered and 7-membered rings shown below as E and F (Schemes 4 and 5). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142 See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142 See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142 See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-90 and Tetrahedron Letters (1992) 33(33):4139-4142 Rapamycin and its derivatives exist in a cis form shown below as E, H, J and K Also present is a mixture of the s- and trans-amides (Schemes 4 and 5). [Mierk e, D.F., Schmieder, P., Karuso, P. and Kessler , H. (1991), Conformational Analysis of the cis- and trans-Isomers of FK506 by NMR and Molecular Dynamics. Helvetica Chimica Acta, 74:1027-1047]. The NMR characterization data shown in the examples corresponds only to the form of the main equilibrium state observed under the deuterated solvent conditions reported.

Chem.

Chem.

Chem.

[0197] In one embodiment, R1 is hydroxy.

[0198] In one embodiment, R2 is

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0199] In one embodiment, R2 is [Chemical formula] and n is 1, 2 or 3. In one embodiment, R2 is [ka] It is.

[0200] In one embodiment, the compounds of Formula (I), Formula (I)-A and Formula (I)-B are selected from the group consisting of E-1 and F- Solvent- and pH-dependent equilibrium behavior of the 6- and 7-membered hemiketal forms, shown below as -1. In one embodiment, the compound represented by formula (I), formula (I)-A and formula (I)- Compound B exists as a mixture of cis- and trans-amides E-1 and H-1. [ka]

[0201] Preparation of compounds The compounds of the present disclosure can be prepared as described in the Examples below.

[0202] Abbreviation: 4-EP 4-Ethylpyridine AcOH Acetic acid ACN Acetonitrile Aq aqueous solution C Celsius d double line dd double double line DCM Dichloromethane DIPEA N,N-Diisopropylethylamine DMSO Dimethyl sulfoxide EDTA Ethylenediaminetetraacetic acid ESIMS Electrospray Ionization Mass Spectrometry EtOAc Ethyl acetate EtOH Ethanol FA Formic Acid g grams h time HPLC High Performance Liquid Chromatography HRMS High Resolution Mass Spectrometry iPrOH 2-Propanol or Isopropanol L Liter LC Liquid Chromatography LCMS Liquid Chromatography Mass Spectrometry MeOH Methanol MS Mass Spectrometry M Mole m Multiplet min Minute mL Milliliter μM Micromole m / z Mass-to-Charge Ratio N2 Nitrogen Gas nM Nanomole NMR Nuclear Magnetic Resonance 1 HNMR: Proton Nuclear Magnetic Resonance Spectroscopy PEI Polyethyleneimine PPU Propyl-Pyridyl-Urea pTsOH p-Toluenesulfonic Acid prep Preparative rac Racemic rpm Revolutions Per Minute r.t. Room Temperature s Singlet sat. Saturated SFC Supercritical Fluid Chromatography t Triplet TCEP Tris(2-Carboxyethyl)Phosphine TFA Trifluoroacetic Acid THF Tetrahydrofuran TLC Thin Layer Chromatography vol. Volume

[0203] The method used in the purification of the examples The purification of the intermediates and final products was carried out via either normal-phase or reverse-phase chromatography Performed

[0204] Normal-phase chromatography was performed using a prepacked SiO2 cartridge (e.g., Teledy Using the RediSep® Rf column of Isco, Inc., appropriate solvent systems (e.g., hexane and ethyl acetate; DCM and MeOH; i.e., unless otherwise indicated) were eluted with a gradient and run.

[0205] SFC was run using the method described below: Method 1: Princeton PPU 5μm (100A) column (30×250mm) ; CO2 / MeOH Method 2: Princeton 4-EP 5μm (60A) column (30×250mm) ; CO2 / MeOH Method 3: Reprospher PEI 5μm (100A) column (30×250mm ); CO2 / MeOH The gradient was selected based on the analytical separation.

[0206] Reverse-phase preparative HPLC was run using the method described below: Method 1 (Agilent): Phenomenex Luna C18; 5μm column ( 30×250mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. The gradient was selected based on the analytical separation. Method 2: (EZprep) YMC Actus Triart C18; 5μm column ( 20×150mm); acetonitrile / water. The gradient was selected based on the analytical separation.

[0207] Chiral preparative HPLC was run using the method described below: Method 1: Chiralpak IC; 5μm column (20×250mm); n-heptane / DCM / EtOH Method 2: Chiralpak ID; 5μm column (20×250mm); n-heptane / DCM / iPrOH The gradient was selected based on analytical separation.

[0208] LC / MS method: Column: Acquity UPLC BEH C18, 130 Å, 1. 7 μm, 2.1 mm × 50 mm Temperature: 50 °C Injection: 1 μL Solvent A: Water + 5 mM ammonium hydroxide Solvent B: Acetonitrile + 5 mM ammonium hydroxide Gradient:

[0209]

Table 6

[0210] 1 H NMR instrument: Bruker UltraShield™ A dvance III HD 400 MHz equipped with a cryo-DCI probe. The data was processed with MestReNova 11. 0 software.

[0211] Preparation of Intermediates 1 - 7 Intermediate 1: C32 - deoxo - rapamycin

Chemical Structure

[0212] Intermediate 2: RAD001 (everolimus; Afinitor®) ​ [Chemical formula] Intermediate 2 was prepared according to procedures known in the literature, including those disclosed in International Publication No. WO 2012 / 103959, which is hereby incorporated by reference in its entirety. 2012103959 Pamphlet, and are known to those skilled in the art. It was prepared according to known procedures.

[0213] Intermediate 3: [Chemical formula] Intermediate 3 was prepared in two steps through Intermediate A as shown below. [Chemical formula] Step 1. Synthesis of Intermediate A 2-((tert-Butyldimethylsilyl)oxy)ethanol (0.471 g, 2.67 mmol) was dissolved in anhydrous toluene (0.95 mL) in a reaction vial. The vial was capped and then purged with nitrogen under vacuum. N,N-Diisopropylethylamine (DIPEA) (0.490 mL, 2.81 mmol) was added via syringe. The mixture was cooled to 0 °C in an ice bath. Trifluoromethanesulfonic anhydride (Tf2O) (0.438 mL, 2.59 mmol) was added dropwise at 0 °C over about 2 minutes. The reaction mixture was stirred at 0 °C for 30 minutes. The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added rapidly all at once. The vial was quickly recapped and the mixture was purged with nitrogen. The reaction mixture was stirred at 0 °C for 30 minutes. The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added rapidly all at once. The vial was quickly recapped and the mixture was purged with nitrogen. The reaction mixture was stirred at 0 °C for 30 minutes.

[0214] The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added rapidly all at once. The vial was quickly recapped and the mixture was purged with nitrogen. The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added rapidly all at once. The vial was quickly recapped and the mixture was purged with nitrogen. The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added via syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was added rapidly all at once. The vial was quickly recapped and the mixture was purged with nitrogen. It was purged with air and vacuum. Toluene (0.5 mL) was added.

[0215] The reactants were stirred at 40 °C under nitrogen overnight. The reactants were diluted with saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2 SO4, vacuum filtered through celite, concentrated, and a waxy white solid crude product was obtained. The crude product was purified by silica gel flash column chromatography (0 - 3

[0216] 5% acetone - heptane, gradient elution, 40 g silica column, visualized by TLC and UV under 35% acetone - heptane), and the desired intermediate A (0.245 g, 0.2 31 mmol, 34.7% yield) was obtained as a glass and used "as is" immediately in the following step. Intermediate A: ESIMS [M+NH4] 1076.1, ESIMS [M - H] 1056. 0. Intermediate A: ESIMS [M+NH4] 1076.1, ESIMS [M - H] 1056. 0.

[0217] Step 2. Synthesis of Intermediate 3 Intermediate A (0.135 g, 0.128 mmol) was dissolved in anhydrous T HF (1.2 mL). The vial was capped and the mixture was evacuated with nitrogen twice. The mixture was cooled to 0 °C in an ice - water bath. HF - pyridine (0.12 mL, 1. 332 mmol) was added dropwise via syringe over 30 seconds. The reaction was stirred at 0 °C for 60 minutes. The reaction mixture was added dropwise to saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through celite, concentrated, and a white solid crude product was obtained.

[0218] The reaction mixture was added dropwise to saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through celite, concentrated, and a white solid crude product was obtained. The reaction mixture was added dropwise to saturated aqueous NaHCO3. The quenched mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through celite, concentrated, and a white solid crude product was obtained.

[0219] The crude product was purified by silica gel flash column chromatography (eluted with a 0 - 50% acetone - heptane gradient, 40 g silica column, visualized by TLC and UV under 50% acetone - heptane), and intermediate 3 (0.087 g, 0.092 mmol, 72.2% yield) was obtained as a white solid. 0% acetone - heptane gradient elution, 40 g silica column, visualized by TLC and UV under 50% acetone - heptane ), and intermediate 3 (0.087 g, 0.092 mmol, 72.2% yield) was obtained as a white solid. mol, 72.2% yield) was obtained as a white solid.

[0220] Intermediate 3: ESIMS [M + NH4] 962.0, ESIMS [M - H] 943.0 1 H NMR (400 MHz, chloroform - d) δ 6.46 - 6.25 (m, 2H) , 6.19 - 6.09 (m, 1H), 5.91 (m, 1H), 5.55 (m, 1H), 5 .34 - 5.26 (m, 1H), 5.26 - 5.15 (m, 1H), 4.88 - 4.64 (m, 2H), 4.11 (m, 1H), 3.94 - 3.82 (m, 1H), 3.79 (m , 1H), 3.73 - 3.63 (m, 3H), 3.63 - 3.47 (m, 4H), 3.4 5 (m, 4H), 3.33 (m, 3H), 3.28 - 3.15 (m, 2H), 3.13 ( s, 3H), 3.08 (m, 1H), 2.80 (m, 1H), 2.32 (m, 3H), 2 .14 (m, 2H), 2.07 - 1.94 (m, 2H), 1.94 - 1.72 (m, 5H ), 1.72 - 1.56 (m, 8H), 1.56 - 1.40 (m, 3H), 1.39 - 1 .21 (m, 7H), 1.21 - 1.09 (m, 1H), 1.08 - 0.99 (m, 8H ), 0.98 - 0.83 (m, 9H), 0.73 (q, J = 12.0 Hz, 1H).

[0221] Intermediate 4:

Chemical Structure

[0222] The reaction was diluted with saturated aqueous NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, concentrated, and a colorless tarry crude product (0.768 g) was obtained. The crude product was purified by silica gel flash column chromatography (elution with a 0 - 80% acetone - heptane gradient, 24 g silica column, visualized by TLC, UV at 80% EtOAc - heptane). The product - containing fractions were pooled, concentrated, and Intermediate 4 (0.087 g, 0.089 mmol, 34.4% yield) was obtained as a white solid. Intermediate 4: ESIMS [M + NH4] 993.7, ESIMS [M - H] 974.7.

[0223] HRMS: Calculated: 999.5812 (as sodium adduct). Measured: 999.5807. H NMR (600 MHz, chloroform - d) δ 6.47 - 6.26 (m, 2H) , 6.22 - 6.08 (m, 1H), 6.02 - 5.83 (m, 1H), 5.54 (m, 1H), 5.35 - 5.26 (m, 1H), 5.21 (m, 1H), 4.85 - 4.76 (m, 1H)

[0224] 1 1 H NMR (600 MHz, chloroform - d) δ 6.47 - 6.26 (m, 2H) , 6.22 - 6.08 (m, 1H), 6.02 - 5.83 (m, 1H), 5.54 (m, 1H), 5.35 - 5.26 (m, 1H), 5.21 (m, 1H), 4.85 - 4.76 (m, 1H) 1H), 5.35 - 5.26 (m, 1H), 5.21 (m, 1H), 4.85 - 4.76 (m, 1H) (m, 1H), 4.12 (m, 2H), 3.93 - 3.81 (m, 1H), 3.67 (t , J = 7.7 Hz, 1H), 3.62 (d, J = 6.7 Hz, 1H), 3.60 - 3.5 3 (m, 1H), 3.53 - 3.44 (m, 1H), 3.42 - 3.36 (m, 3H), 3.32 (m, 3H), 3.28 - 3.18 (m, 1H), 3.13 (m, 3H), 3. 05 (m, 1H), 2.82 (m, 1H), 2.42 - 2.21 (m, 3H), 2.16 - 2.08 (m, 3H), 1.99 (m, 1H), 1.95 - 1.83 (m, 1H), 1 .83 - 1.72 (m, 4H), 1.71 - 1.57 (m, 9H), 1.57 - 1.43 (m, 12H), 1.39 (m, 1H), 1.34 - 1.20 (m, 4H), 1.20 - 1.10 (m, 1H), 1.05 (m, 4H), 1.00 (d, J = 6.5 Hz, 3H) , 0.95 (dd, J = 6.6, 2.1 Hz, 3H), 0.92 (d, J = 6.6 Hz, 3H), 0.91 - 0.84 (m, 4H), 0.77 (q, J = 12.1 Hz, 1H).

[0225] Intermediate 5:

Chemical Structure

[0226] ​​It was vacuum purged twice. The mixture was cooled to -30 °C in an acetonitrile / dry ice bath. and.

[0227] Trifluoromethanesulfonic anhydride (1.209 mL, 7.16 mmol) was added dropwise via syringe over 4 minutes. The reaction mixture was stirred at -30 °C for 30 minutes. The reaction mixture was transferred to an ice bath at 0 °C and stirred at 0 °C for 20 minutes.

[0228] The reaction mixture was placed on a rotary evaporator and concentrated without heating. Isopropyl acetate (22 mL) was added. Tetrazole (1.170 g, 16.71 mmol) was added in one portion. The flask was quickly capped and vacuum purged twice with nitrogen. N,N-Di isopropylethylamine (4.18 mL, 23.94 mmol) was added via syringe over 1 minute. The reaction mixture was stirred at room temperature overnight.

[0229] The reaction mixture was concentrated on a rotary evaporator. The concentrate was purified by normal phase silica gel flash column chromatography (0 - 40% acetone - heptane gradient elution, 80 g silica column, TLC at 40% acetone - heptane, visualization under UV ).

[0230] The second elution peak fractions (determined by UV absorbance at 279 nm) were pooled, concentrated, and Intermediate 5 (2.194 g, 2.304 mmol, 47.4% yield) was obtained as a white solid.

[0231] Intermediate 5: ESIMS [M + NH4] 969.8, ESIMS [M - H] 950.8. 1 H NMR (400 MHz, DMSO - d6) δ 9.33 (d, J = 6.4 Hz, 1 H), 6.58 - 6.41 (m, 2H), 6.35 - 6.14 (m, 2H), 6.09 - 5.98 (m, 1H), 5.55 - 5.43 (m, 1H), 5.19 (m, 1H), 5. 05 (m, 1H), 5.00 - 4.93 (m, 1H), 4.87 - 4.79 (m, 1H) , 4.67 - 4.56 (m, 1H), 3.98 - 3.87 (m, 1H), 3.87 (d, J = 6.9 Hz, 1H), 3.61 (m, 2H), 3.55 (dd, J = 11.8, 1. 9 Hz, 1H), 3.49 - 3.38 (m, 1H), 3.31 - 3.17 (m, 4H), 3.10 (m, 4H), 3.04 (s, 3H), 2.88 - 2.75 (m, 1H), 2. 29 - 2.09 (m, 3H), 2.07 - 1.86 (m, 3H), 1.88 - 1.60( m, 9H), 1.59 - 1.44 (m, 7H), 1.43 - 1.01 (m, 11H), 0 .96 (t, J = 7.1 Hz, 5H), 0.95 - 0.77 (m, 7H), 0.72 (m , 4H).

[0232] Intermediate 6:

Chemical Structure

[0233] Trifluoromethanesulfonic anhydride (0.901 ml, 5.33 mmol) was added dropwise via syringe over 2 minutes. The reaction was stirred at 0 °C for 15 minutes. The cold bath was removed ​ Removed, and the reactants were equilibrated to room temperature for 15 minutes.

[0234] N,N-Diisopropylethylamine (1.067 mL, 6.11 mmol) was added dropwise over 30 seconds via syringe. Intermediate 1 (1.00 g, 1.111 mmol ) was added all at once.

[0235] The reaction mixture was quickly capped and purged with nitrogen under vacuum. Anhydrous toluene (2.0 mL) and anhydrous dioxane (0.22 mL) were added via syringe. The reaction mixture was stirred at 55 °C for 24 hours.

[0236] The reaction mixture was diluted with brine and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, concentrated, and a colorless tarry crude product (4.25 g) was obtained .

[0237] The crude product was purified by silica gel flash column chromatography (0 - 50% acetone - heptane gradient elution, 80 g silica column, visualized by TLC, UV at 40% acetone - heptane ). The product - containing fractions were pooled, concentrated, and Intermediate 6 (0.443 g, 0.456 mmol, 41.0% yield) was obtained as a colorless glass.

[0238] Intermediate 6: ESIMS [M - H] 970.9. HRMS: Calculated - 989.6678 (as ammonium adduct); Measured - 989.6655 Calculated - 994.6232 (as sodium adduct); Measured - 994.62 15.

[0239] Intermediate 7:

Chemical Structure

Chemical formula

[0240] The reaction mixture was filtered through a syringe filter. The filter was rinsed with THF (2 mL) . The filtrates were combined and concentrated on a rotary evaporator, leaving a colorless tar.

[0241] Toluene (7.6 mL) was added to the concentrate. Intermediate 1 (1.447 g, 1.607 m mol) was added all at once, followed by 4-dimethylaminopyridine (0.281 g, 2.2 96 mmol). The reaction mixture was stirred at room temperature overnight.

[0242] The mixture was diluted with water and extracted 4 times with EtOAc. The organic extracts were combined, dried over Na2S O4, decanted, concentrated, and a crude yellow tar product (2.15 g) was obtained.

[0243] ​The crude product was purified by silica gel flash column chromatography (0 - eluted with a 40% acetone - heptane gradient, 40 g silica column, visualized by TLC and UV under UV). The product - containing fractions were pooled, concentrated, and white foam was obtained as Intermediate B (0.438 g, 0.415 mmol, 18.1% yield).

[0244] Intermediate B: ESIMS [M + NH4] 1074.0, ESIMS [M - H] 1055. 1.

[0245] Step 2. Synthesis of Intermediate 7 Intermediate B (0.431 g, 0.408 mmol) was dissolved in THF (4 mL). H Cl (1 M, aq.) (2.0 ml, 2.00 mmol) was added via syringe . The reaction mixture was stirred at room temperature for 36 h.

[0246] The reaction mixture was diluted with water and extracted 4 times with EtOAc. The organic extracts were combined, dried over Na 2SO4, decanted, concentrated, and a pale yellow tar was obtained. The tar was dissolved in dichloro methane and diluted with heptane. The mixture was concentrated and dried under high vacuum to give Intermediate 7 as a white solid (0.407 g, 0.400 mmol, 98% yield).

[0247] Intermediate 7: ESIMS [M + NH4] 1034.0, ESIMS [M - H] 1015. 0. HRMS calculated - 1033.6576 (as ammonium adduct); found - 1033.6588 calculated - 1038.6130 (as sodium adduct); found - 1038. 6138.

[0248] Example 1: (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C3 2-deoxy-rapamycin Example 2: (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C3 2-deoxy-rapamycin

Chemical formula

[0249] The diastereomer mixture was separated by normal-phase chromatography on silica (gradient elution with 10 0% dichloromethane to 40% acetonitrile-dichloromethane).

[0250] The first eluted diastereomer (Rf approximately 0.23 on silica TLC developed in 30% acetonitrile-dichloromethane) gave Example 1 (S)-diastereomer as a white solid .

[0251] Example 1: ESIMS [M+NH4] 1006.7, ESIMS [M-H] 987.8 . 11H NMR (600 MHz, chloroform-d) δ 6.43 (dd, J = 14.9, 10.4 Hz, 1H), 6.35 (dd, J = 14.9, 10.7 Hz, 1H), 6.1 6 (dd, J = 15.1, 10.2 Hz, 1H), 6.06 - 6.01 (m, 1H), 5 .67 (dd, J = 15.2, 8.6 Hz, 1H), 5.35 (dd, J = 6.4, 1. 8 Hz, 1H), 5.26 (d, J = 9.6 Hz, 1H), 4.83 (td, J = 6.6 , 4.7 Hz, 1H), 4.12 (d, J = 7.4 Hz, 1H), 3.88 (dd, J = 11.1, 5.1 Hz, 1H), 3.84 - 3.77 (m, 1H), 3.63 - 3.60 (m, 2H), 3.51 (d, J = 7.5 Hz, 1H), 3.46 (s, 3H), 3.4 5 - 3.42 (m, 3H), 3.35 (s, 3H), 3.29 - 3.14 (m, 3H), 3.06 - 2.96 (m, 2H), 2.93 (ddd, J = 10.4, 6.4, 1.5 H z, 1H), 2.44 (tt, J = 8.6, 6.2 Hz, 1H), 2.37 - 2.23 ( m, 4H), 2.22 - 2.14 (m, 2H), 2.03 (dt, J = 12.3, 3.8 Hz, 1H), 1.96 (pd, J = 6.4, 5.7, 3.5 Hz, 2H), 1.92 - 1.82 (m, 3H), 1.80 - 1.76 (m, 2H), 1.75 (d, J = 1.2 H z, 4H), 1.72 (d, J = 3.1 Hz, 1H), 1.68 (d, J = 1.3 Hz, 3H), 1.65 - 1.53 (m, 4H), 1.48 - 1.17 (m, 9H), 1.07 (d, J = 6.5 Hz, 1H), 1.06 (s, 3H), 1.04 (d, J = 7.3 Hz , 3H), 1.01 (d, J = 6.6 Hz, 3H), 0.99 (dd, J = 6.7, 2. 3 Hz, 3H), 0.95 (d, J = 6.8 Hz, 3H), 0.74 (q, J = 11.9 Hz, 1H).

[0252] The second eluted diastereomer (Rf approximately 0.16 on silica TLC developed in 30% acetonitrile - dichloromethane) was carried out as Example 2 (R)-diastereomer and obtained as a white solid

[0253] Example 2: ESIMS [M + NH4] 1006.9, ESIMS [M - H] 988.1 . 1 1H NMR (chloroform - d) δ 6.48 (dd, J = 14.7, 10.9 Hz, 1H), 6.24 (dd, J = 14.6, 10.6 Hz, 1H), 6.16 (dd, J = 14.9, 10.6 Hz, 1H), 6.01 (d, J = 11.0 Hz, 1H), 5.38 (dd, J = 14.9, 9.8 Hz, 1H), 5.23 (dd, J = 6.2, 2.0 Hz , 1H), 5.12 (d, J = 9.9 Hz, 1H), 4.73 (dd, J = 12.1, 2 .9 Hz, 1H), 4.65 (dt, J = 8.3, 3.9 Hz, 1H), 4.14 (d, J = 6.7 Hz, 1H), 3.97 (m, 1H), 3.74 (d, J = 6.7 Hz, 1H ), 3.62 (qd, J = 13.9, 12.7, 5.5 Hz, 2H), 3.42 (s, 3 H), 3.39 (m, 1H), 3.31 (s, 3H), 3.24 (ddd, J = 12.2 , 7.5, 4.6 Hz, 1H), 3.10 (td, J = 8.2, 3.8 Hz, 1H), 3 .08 (s, 1H), 3.02 - 2.97 (m, 1H), 2.97 - 2.92 (m, 1H ), 2.83 - 2.71 (m, 1H), 2.42 (ddt, J = 13.1, 9.5, 6. 4 Hz, 1H), 2.34 (d, J = 4.3 Hz, 1H), 2.31 (s, 1H), 2. ​​28 - 2.23 (m, 1H), 2.22 - 2.19 (m, 1H), 2.19 (s, 2H) , 2.12 - 2.08 (m, 2H), 2.03 - 1.99 (m, 1H), 1.90 (s, 3H), 1.88 (s, 1H), 1.79 (s, 1H), 1.77 (s, 1H), 1.7 6 (s, 1H), 1.72 - 1.68 (m, 1H), 1.48 (s, 1H), 1.46 ( s, 1H), 1.40 (d, J = 3.0 Hz, 1H), 1.38 (s, 1H), 1.66 (d, J = 3.0 Hz, 2H), 1.64 (d, J = 2.9 Hz, 1H), 1.62 (s , 2H), 1.62 (s, 2H), 1.58 - 1.53 (m, 1H), 1.37 (s, 1 H), 1.36 (d, J = 2.3 Hz, 1H), 1.33 (d, J = 2.9 Hz, 1H) , 1.30 (dd, J = 6.7, 1.8 Hz, 1H), 1.28 (s, 2H), 1.28 (s, 2H), 1.24 (s, 1H), 1.09 (s, 1H), 1.07 (d, J = 6. 6 Hz, 3H), 1.05 (d, J = 6.6 Hz, 3H), 1.01 (d, J = 3.2 H z, 1H), 0.95 (d, J = 6.8 Hz, 3H), 0.92 (s, 1H), 0.92 - 0.90 (m, 3H), 0.88 (d, J = 6.8 Hz, 2H), 0.66 (q, J = 12.0 Hz, 1H)

[0254] The absolute configuration of the C16 substituent in Example 1 and Example 2 was determined by X - ray crystallographic analysis of the co - crystallization with FKBP12 [Stuart L. Schrieber and J on Clardy, et al., Atomic Structure of the Rapamycin Humano Immunophilin FKBP - 12 C omplex, J. Am. Chem. Soc., 1991, 113, 7433 - 7434 ​See []. The crystal structures are shown in FIGS. 1A and 1B and FIGS. 2A and 2B.

[0255] The pure FKBP12(1-108) protein was concentrated to 9 mg / mL in 50 mM Tris pH 8.0, 1 50 mM NaCl, 1 mM EDTA, 1 mM TCEP. The complex for co-crystallization was prepared by mixing 3 mM of the compound (from a 50 mM stock prepared in 90% dDMSO, 10% D2O) with the protein. The complex was incubated at 4 °C for 2 hours and then centrifuged at 10000 rpm for 2 minutes to remove any possible precipitate before crystallization. The co-crystals were obtained at 20 °C by the sitting-drop vapor diffusion method using microseed matrix screening. The complex was incubated at 4 °C for 2 hours and then centrifuged at 10000 rpm for 2 minutes to remove any possible precipitate before crystallization. The co-crystals were obtained at 20 °C by the sitting-drop vapor diffusion method using microseed matrix screening. The co-crystals were obtained at 20 °C by the sitting-drop vapor diffusion method using microseed matrix screening. [Allan D’Arcy et al.,An automated micros eed matrix-screening method for protein crystallization,Acta Cryst.,(2007)D63,55 0-554]. The droplets were composed of 200 nL of the protein solution, 160 nL of the well solution and 40 nL of the seed stock. The crystals appeared within a few days under the A1 condition of the commercially available “ammonium sulfate” screening from Qiagen. The reservoir solution consisted of 2.2 M ammonium sulfate. The crystals were cryoprotected in the reservoir solution supplemented with 20% ethylene glycol, flash-frozen and placed in liquid nitrogen. The data were collected at beamline X10SA at the Swiss Light Source Facility (SLS, Villigen, Switzerland). The crystals were cryoprotected in the reservoir solution supplemented with 20% ethylene glycol, flash-frozen and placed in liquid nitrogen. The data were collected at beamline X10SA at the Swiss Light Source Facility (SLS, Villigen, Switzerland). The data were collected at beamline X10SA at the Swiss Light Source Facility (SLS, Villigen, Switzerland).

[0256] The data were processed with XDS (Kabsch, W. (2010), XDS. Acta Cryst. D, 66:125-132). The structure was determined by molecular replacement (Collaborative Computational Project, Number 4 (1994). Acta Cryst. D50, 760-763) using the previous X-ray structure of KBP12 as a search model. The programs REFMAC (Murshudov GN, Skubak P, Lebedev AA, et al., REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallographica Section D: Biological Crystallography. 2011;67(Pt 4):355-367) and COOT (Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot, Acta Crystallographica Section D: Biological Crystallography. 2010;66(Pt 4):486-501) were used for structure refinement and model (re)building. In the following examples, the absolute configuration of the C16 substituent was not determined by X-ray co-crystallization and is therefore unknown. In some examples, the major diastereomeric products derived from the reaction were isolated and characterized. In other examples, each diastereomer was isolated and characterized, but the absolute configuration could not be assigned.

[0257]

[0258] ​​​​​​​​​​​​​​​​​Example 3: C16-(4-oxoazetidin-2-yl)-C32-deoxo-rapamycin Sin

Chemical Structure

[0259] Example 3: ESIMS [M - H] 938.0 Exact mass: 938.59 1 H NMR (400 MHz, DMSO-d6) δ 6.45 (dd, J = 14.0, 1 1.0 Hz, 1H), 6.28 - 6.11 (m, 2H), 5.98 (d, J = 10.9 H z, 1H), 5.95 - 5.85 (m, 1H), 5.50 (dd, J = 14.2, 9.5 Hz, 1H), 5.06 (d, J = 4.7 Hz, 1H), 5.02 - 4.97 (m, 1H ), 4.94 (d, J = 9.8 Hz, 1H), 4.63 - 4.53 (m, 2H), 4.3 4 - 4.22 (m, 1H), 3.99 - 3.92 (m, 1H), 3.84 - 3.74 (m , 1H), 3.61 - 3.53 (m, 1H), 3.49 (d, J = 7.3 Hz, 1H), , 1H), 3.61 - 3.53 (m, 1H), 3.49 (d, J = 7.3 Hz, 1H), 3.46 - 3.39 (m, 1H), 3.37 - 3.25 (m, 3H), 3.22 - 3.1 2(m,4H), 3.10 - 3.04(m,1H), 3.04 - 2.95(m,1H), 2.92 - 2.65(m,4H), 2.27 - 2.11(m,2H), 2.10 - 1.9 9(m,2H), 1.96 - 1.87(m,1H), 1.84 - 1.70(m,5H), 1.69 - 1.37(m,15H), 1.37 - 1.05(m,8H), 1.03 - 0. 93(m,4H), 0.90(d, J = 6.4Hz,3H), 0.88 - 0.83(m, 5H), 0.79(d, J = 6.7Hz,3H), 0.75(d, J = 6.7Hz,3H ), 0.59(q, J = 11.8Hz,1H).

[0260] Example 4: C16-(3-Methylimidazolidin-2-one-1-yl)-C32-de oxo-rapamycin

Chemical Structure

[0261] Example 4: ESIMS [M - H] 966.5 Exact mass: 967.61 1 H NMR (600 MHz, DMSO-d6) δ 0.59(q, J = 11.9Hz, 1H), 0.74 (d, J = 6.7 Hz, 3H), 0.79 (d, J = 6.7 Hz, 3H ), 0.80 - 0.90 (m, 8H), 0.92 - 1.00 (m, 4H), 1.04 - 1 .10 (m, 1H), 1.12 - 1.34 (m, 7H), 1.34 - 1.67 (m, 14 H), 1.69 (s, 3H), 1.71 - 1.78 (m, 2H), 1.88 - 1.94 ( m, 1H), 1.96 - 2.08 (m, 3H), 2.10 - 2.25 (m, 2H), 2. 60 - 2.69 (m, 4H), 2.80 - 2.94 (m, 2H), 3.07 - 3.20 ( m, 5H), 3.21 - 3.26 (m, 2H), 3.33 (s, 3H), 3.41 - 3. 48 (m, 1H), 3.56 - 3.66 (m, 3H), 3.99 (dd, J = 6.5, 3 .5 Hz, 1H), 4.53 - 4.63 (m, 3H), 4.95 - 5.00 (m, 2H) , 5.07 (d, J = 4.8 Hz, 1H), 5.35 (s, 1H), 5.45 (dd, J = 14.9, 9.8 Hz, 1H), 5.98 (d, J = 11.0 Hz, 1H), 6.15 (dd, J = 14.8, 10.7 Hz, 1H), 6.23 (dd, J = 14.6, 10. 7 Hz, 1H), 6.44 (dd, J = 14.6, 11.0 Hz, 1H).

[0262] Example 5: C16-(2-Hydroxyethyl)-2-oxoimidazolidin-1-yl) -C32-Deoxo-rapamycin

Chemical Structure

[0263] Example 5: ESIMS [M+H] 998.5 Exact mass: 997.62 1 H NMR (400 MHz, DMSO-d6) δ 6.45 (dd, J = 14.3, 1 1.0 Hz, 1H), 6.23 (dd, J = 14.3, 10.6 Hz, 1H), 6.14 (dd, J = 14.6, 10.6 Hz, 1H), 5.98 (d, J = 10.9 Hz, 1H ), 5.44 (dd, J = 14.5, 9.8 Hz, 1H), 5.28 (s, 1H), 5. 07 (d, J = 4.7 Hz, 1H), 5.02 - 4.96 (m, 2H), 4.67 (t, J = 5.3 Hz, 1H), 4.64 - 4.53 (m, 3H), 4.03 - 3.96 (m, 1H), 3.71 - 3.57 (m, 3H), 3.52 - 3.42 (m, 2H), 3.42 - 3.29 (m, 6H), 3.22 - 3.07 (m, 7H), 2.95 - 2.79 (m, 2H), 2.71 - 2.56 (m, 1H), 2.27 - 1.87 (m, 6H), 1.80 - 1.36 (m, 20H), 1.36 - 1.12 (m, 6H), 1.11 - 1.02 (m , 1H), 1.00 - 0.91 (m, 4H), 0.91 - 0.76 (m, 11H), 0. 74 (d, J = 6.7 Hz, 3H), 0.59 (q, J = 11.9 Hz, 1H).

[0264] ​ Example 6: C16-(1,1-Dioxide-1,2-thiazetidin-2-yl)-C32 -Deoxo-rapamycin (diastereomer 1) Example 7: C16-(1,1-Dioxide-1,2-thiazetidin-2-yl)-C32 -Deoxo-rapamycin (diastereomer 2)

Chem.

[0265] Final purification of the first eluting diastereomer by preparative HPLC (Method 2) gave Example 6 as a white solid (18 mg, 10.7% yield). Example 6: ESIMS [M+NH4] 992.6, [M+FA-H] 1019.6.

[0266] Example 6: ESIMS [M+NH4] 992.6, [M+FA-H] 1019.6. Exact mass: 974.55 1 H NMR (400 MHz, chloroform-d) δ 6.39 (dd, J = 14.8, 9.8 Hz, 1H), 6.34 (dd, J = 14.8, 10.3 Hz, 1H), 6.18 - 6.10 (m, 1H), 6.02 (d, J = 10.3, 1.5 Hz, 1H), 5.66 (dd, J = 15.1, 8.6 Hz, 1H), 5.38 (s, 1H), 5.32 (dd, J = 6.4, 1.8 Hz, 1H), 5.23 (d, J = 9.6 Hz, 1H), 4.87 - 4.76 (m, 1H), 4.12 - 4.06 (m, 1H), 3.99 (ddd, J = 12 .0, 8.2, 6.2 Hz, 1H), 3.92 - 3.86 (m, 1H), 3.84 (dd , J = 10.7, 4.4 Hz, 1H), 3.81 - 3.74 (m, 1H), 3.63 - 3 .59 (m, 2H), 3.59 (d, J = 3.6 Hz, 1H), 3.46 (d, J = 7. 6 Hz, 1H), 3.43 (s, 3H), 3.40 - 3.37 (m, 1H), 3.32 ( s, 3H), 3.04 (ddd, J = 8.2, 5.8, 3.8 Hz, 1H), 3.00 - 2.94 (m, 1H), 2.94 - 2.89 (m, 1H), 2.88 - 2.84 (m, 1 H), 2.64 (d, J = 6.7 Hz, 1H), 2.47 - 2.38 (m, 1H), 2. 36 - 2.27 (m, 2H), 2.21 - 2.12 (m, 1H), 2.03 - 1.97 ( m, 1H), 1.95 - 1.77 (m, 7H), 1.76 - 1.67 (m, 5H), 1. 65 (s, 3H), 1.60 - 1.50 (m, 6H), 1.47 - 1.39 (m, 2H) , 1.38 - 1.27 (m, 4H), 1.25 - 1.10 (m, 3H), 1.08 - 1. 04 (m, 1H), 1.03 - 1.01 (m, 3H), 1.00 (d, J = 1.4 Hz, 3H), 0.99 - 0.97 (m, 3H), 0.97 (d, J = 6.6 Hz, 3H), 0 .93 (d, J = 6.8 Hz, 3H), 0.75 - 0.66 (m, 1H).

[0267] Final purification of the second eluted diastereomer using SFC chromatography (Method 2) By production, Example 7 was obtained as a white solid (15.8 mg, 9.2% yield).

[0268] Example 7: ESIMS [M+NH4] 992.7, [M+FA-H] 1019.6 Exact mass: 974.55 1 1H NMR (400 MHz, chloroform-d) δ 6.46 (dd, J = 14.2, 10.9 Hz, 1H), 6.22 (dd, J = 14.2, 10.6 Hz, 1H), 6.1 4 (dd, J = 14.5, 10.6 Hz, 1H), 6.00 (d, J = 10.9 Hz, 1 H), 5.38 (dd, J = 14.5, 9.6 Hz, 1H), 5.27 - 5.19 (m, 1H), 5.12 - 5.05 (m, 1H), 4.66 - 4.59 (m, 1H), 4.59 - 4.53 (m, 1H), 4.25 (d, J = 1.8 Hz, 1H), 4.17 - 4.06 (m, 3H), 4.02 (ddd, J = 11.8, 8.0, 3.5 Hz, 1H), 3.6 6 (d, J = 7.0 Hz, 1H), 3.60 - 3.52 (m, 2H), 3.43 - 3.3 4 (m, 4H), 3.28 (s, 3H), 3.17 - 3.07 (m, 1H), 3.03 - 2.95 (m, 1H), 2.95 - 2.89 (m, 1H), 2.84 - 2.73 (m, 1 H), 2.65 - 2.62 (m, 1H), 2.35 - 2.26 (m, 1H), 2.27 - 2.21 (m, 1H), 2.21 - 2.12 (m, 3H), 2.12 - 2.05 (m, 1 H), 2.02 - 1.98 (m, 1H), 1.97 - 1.95 (m, 3H), 1.91 - 1.83 (m, 1H), 1.82 - 1.70 (m, 3H), 1.70 - 1.51 (m, 1 0H), 1.50 - 1.17 (m, 10H), 1.11 - 1.06 (m, 1H), 1.0 6 - 1.02 (m, 6H), 1.01 - 0.96 (m, 1H), 0.93 (d, J = 6. 8 Hz, 4H), 0.89 (d, J = 6.6 Hz, 3H), 0.86 (d, J = 6.8 H z, 3H), 0.64 (q, J = 11.9 Hz, 1H).

[0269] Example 8: C16-(1,1-dioxide-1,2-thiazolidin-2-yl)-C32 -deoxy-C40-(2-hydroxyethoxy)-rapamycin (diastereomer 1 ) Example 9: C16-(1,1-dioxide-1,2-thiazolidin-2-yl)-C32 -deoxy-C40-(2-hydroxyethoxy)-rapamycin (diastereomer 2 )

Chemical Structure

[0270] Final purification of the first eluting diastereomer using preparative HPLC (method 2) gave Example 8 (3.1 mg, 5.5% yield) as a white solid.

[0271] Example 8: ESIMS [M+NH4] 1037.0, [M+FA-H] 1064.1 Exact mass: 1018.58 1 1H NMR (400 MHz, DMSO-d6) δ: 6.53 - 6.44 (m, 1H), 6.41 (dd, J = 11.0, 5.6 Hz, 1H), 6.29 - 6.14 (m, 2H) , 6.07 (dd, J = 11.0, 1.5 Hz, 1H), 5.54 (dd, J = 14.6 , 9.1 Hz, 1H), 5.06 (d, J = 8.9 Hz, 1H), 4.99 - 4.93 ( m, 1H), 4.92 - 4.83 (m, 1H), 4.70 - 4.60 (m, 1H), 4. 49 - 4.42 (m, 1H), 4.13 - 4.02 (m, 3H), 3.92 - 3.86 ( m, 1H), 3.69 - 3.64 (m, 1H), 3.59 - 3.54 (m, 1H), 3. 52 - 3.42 (m, 5H), 3.33 (s, 3H), 3.30 - 3.27 (m, 1H) , 3.13 (s, 3H), 3.10 - 3.02 (m, 2H), 3.02 - 2.94 (m, 2H), 2.90 - 2.80 (m, 1H), 2.30 - 2.21 (m, 1H), 2.21 - 2.10 (m, 1H), 2.10 - 2.00 (m, 2H), 2.00 - 1.87 (m, 3H), 1.82 (s, 3H), 1.81 - 1.62 (m, 6H), 1.58 - 1.54 (m, 1H), 1.53 - 1.47 (m, 5H), 1.47 - 1.35 (m, 5H), 1 . 36 - 1.23 (m, 2H), 1.23 - 1.09 (m, 4H), 1.06 - 1.01 (m, 1H), 1.01 - 0.95 (m, 6H), 0.90 - 0.87 (m, 1H), 0 . 87 - 0.83 (m, 3H), 0.81 (d, J = 6.7 Hz, 3H), 0.76 - 0 . 70 (m, 4H), 0.68 - 0.60 (m, 1H).

[0272] By the final purification of the second eluted diastereomer using preparative HPLC (Method 2), white Example 9 was obtained as a colored solid (2.8 mg, 4.9% yield).

[0273] Example 9: ESIMS [M+NH4] 1037.2, [M+FA-H] 1064.3 Exact mass: 1018.58 1 H NMR (400 MHz, DMSO-d6) δ: 6.48 - 6.40 (m, 1H), 6.27 - 6.19 (m, 1H), 6.19 - 6.13 (m, 1H), 6.10 - 6.0 5 (m, 1H), 5.52 (dd, J = 14.2, 9.3 Hz, 1H), 5.13 - 5. 00 (m, 2H), 4.96 (d, J = 9.4 Hz, 1H), 4.67 - 4.57 (m, 1H), 4.48 - 4.40 (m, 1H), 4.17 - 4.10 (m, 2H), 4.10 - 4.02 (m, 2H), 3.98 - 3.90 (m, 1H), 3.56 - 3.49 (m, 2H), 3.50 - 3.43 (m, 4H), 3.37 (d, J = 11.2 Hz, 1H), 3.33 (s, 3H), 3.23 - 3.15 (m, 1H), 3.15 - 3.10 (m, 4 H), 3.07 - 2.95 (m, 2H), 2.75 - 2.64 (m, 1H), 2.27 - 2.14 (m, 2H), 2.11 - 2.00 (m, 2H), 2.00 - 1.89 (m, 3 H), 1.82 (s, 3H), 1.76 - 1.65 (m, 2H), 1.65 - 1.56( m, 3H), 1.56 - 1.49 (m, 7H), 1.48 - 1.36 (m, 3H), 1. 34 - 1.23 (m, 3H), 1.23 - 1.04 (m, 5H), 1.01 - 0.94( m, 4H), 0.90 (d, J = 6.4 Hz, 3H), 0.88 - 0.83 (m, 5H) , 0.80 (d, J = 6.7 Hz, 3H), 0.75 (d, J = 6.7 Hz, 3H), 0 .62 (q, J = 11.8 Hz, 1H).

[0274] Example 10: C16-(1,1-dioxide-1,2-thiazetidin-2-yl)-C3 2-Deoxy-C40-dimethylphosphinyl-rapamycin (diastereomer 1) Example 11: C16-(1,1-dioxide-1,2-thiazetidin-2-yl)-C3 2-Deoxy-C40-dimethylphosphinyl-rapamycin (diastereomer 2)

Chemical Structure

[0275] Final purification of the first eluting diastereomer using preparative HPLC (Method 2) gave Example 10 (20.7 mg, 18.8% yield) as a white solid.

[0276] Example 10: ESIMS [M+H] 1051.9, [M+FA-H] 1096.0 Exact Mass: 1050.56 1 H NMR (400 MHz, DMSO-d6) δ 6.49 - 6.39 (m, 2H), 6.30 - 6.14 (m, 2H), 6.11 - 6.01 (m, 1H), 5.60 - 5.5 0 (m, 1H), 5.06 - 5.00 (m, 1H), 4.98 - 4.93 (m, 1H), 4.87 (d, J = 9.7 Hz, 1H), 4.67 - 4.58 (m, 1H), 4.17 - 4.01 (m, 3H), 4.01 - 3.92 (m, 1H), 3.92 - 3.85 (m, 1 H), 3.73 - 3.64 (m, 1H), 3.60 - 3.52 (m, 1H), 3.50 - 3.42 (m, 1H), 3.35 - 3.26 (m, 4H), 3.15 - 3.12 (m, 3 H), 3.11 - 3.01 (m, 2H), 3.01 - 2.95 (m, 1H), 2.88 - 2.79 (m, 1H), 2.29 - 2.20 (m, 1H), 2.20 - 2.12 (m, 1 H), 2.10 - 1.99 (m, 2H), 1.99 - 1.87 (m, 3H), 1.82 ( s, 3H), 1.80 - 1.71 (m, 1H), 1.71 - 1.62 (m, 4H), 1. 58 - 1.54 (m, 1H), 1.52 - 1.48 (m, 5H), 1.47 - 1.31 ( m, 13H), 1.28 - 1.11 (m, 4H), 1.07 - 1.02 (m, 1H), 1 .01 - 0.95 (m, 8H), 0.87 - 0.84 (m, 3H), 0.82 (d, J = 6.7 Hz, 3H), 0.79 - 0.76 (m, 1H), 0.74 (d, J = 6.7 Hz , 3H), 0.72 - 0.66 (m, 1H).

[0277] By the final purification of the second eluted diastereomer using preparative HPLC (Method 2), Example 11 (13.4 mg, 12.2% yield) was obtained as a white solid.

[0278] Example 11: ESIMS [M + H] 1051.8, [M + FA - H] 1095.8 Exact mass: 1050.56 1 H NMR (400 MHz, DMSO - d6) δ 6.51 - 6.39 (m, 1H), 6.28 - 6.13 (m, 2H), 6.08 (d, J = 11.1 Hz, 1H), 6.04 -5.88 (m, 1H), 5.57 - 5.46 (m, 1H), 5.05 (s, 1H), 5 .03 (d, J = 5.7Hz, 1H), 4.96 (d, J = 9.9Hz, 1H), 4.6 7 - 4.56 (m, 1H), 4.18 - 4.11 (m, 2H), 4.09 - 4.02 (m , 2H), 3.99 - 3.89 (m, 2H), 3.60 - 3.49 (m, 2H), 3.3 7 (d, J = 13.3Hz, 1H), 3.30 (s, 3H), 3.18 (dt, J = 7. 7, 5.1Hz, 1H), 3.15 - 3.11 (m, 4H), 3.07 - 3.00 (m, 1H), 2.73 - 2.63 (m, 1H), 2.28 - 2.13 (m, 2H), 2.13 - 2.05 (m, 2H), 2.05 - 1.97 (m, 2H), 1.97 - 1.88 (m, 1H), 1.83 (s, 3H), 1.80 - 1.69 (m, 1H), 1.68 - 1.58 (m, 4H), 1.58 - 1.48 (m, 7H), 1.48 - 1.43 (m, 1H), 1 .42 - 1.34 (m, 10H), 1.34 - 1.28 (m, 1H), 1.28 - 1.2 2 (m, 2H), 1.22 - 1.13 (m, 2H), 1.13 - 1.03 (m, 1H), 1.03 - 0.94 (m, 5H), 0.94 - 0.88 (m, 4H), 0.86 (d, J = 6.5Hz, 3H), 0.81 (d, J = 6.7Hz, 3H), 0.75 (d, J = 6 .6Hz, 3H), 0.66 (q, J = 12.0Hz, 1H).

[0279] Example 12: C16-(1,1-dioxide-1,2-thiazolidin-2-yl)-C3 2-deoxy-C40-(S)-(1H-tetrazol-1-yl)-rapamycin (di astereomer 1) Example 13: C16-(1,1-dioxide-1,2-thiazolidin-2-yl)-C3 2-Deoxy-C40-(S)-(1H-tetrazol-1-yl)-rapamycin (di astereomer 2)

Chem.

[0280] Final purification of the first eluting diastereomer using preparative HPLC (Method 2) gave Example 12 (14.8 mg, 11.3% yield) as a white solid.

[0281] Example 12: ESIMS [M+NH4] 1050.0, [M+FA-H] 1072.1 Exact mass: 1026.57 1 H NMR (400 MHz, DMSO-d6) δ 9.32 (s, 1H), 6.52 ( s, 1H), 6.45 - 6.37 (m, 1H), 6.31 - 6.14 (m, 2H), 6. 10 - 6.04 (m, 1H), 5.60 - 5.49 (m, 1H), 5.23 - 5.12 ( m, 1H), 5.07 - 5.01 (m, 1H), 4.99 - 4.93 (m, 1H), 4. 87 (d, J = 9.7 Hz, 1H), 4.69 - 4.59 (m, 1H), 4.15 - 4. 02 (m, 3H), 3.94 - 3.84 (m, 1H), 3.72 - 3.54 (m, 3H) , 3.51 - 3.42 (m, 1H), 3.27 (s, 4H), 3.11 (s, 3H), 3 .07 (dd, J = 7.3, 5.1 Hz, 1H), 3.01 - 2.91 (m, 1H), 2 .85 (td, J = 10.6, 9.5, 4.7 Hz, 1H), 2.28 - 2.13 (m, 3H), 2.10 - 2.00 (m, 2H), 1.98 - 1.88 (m, 3H), 1.82 (s, 3H), 1.80 - 1.75 (m, 1H), 1.73 - 1.67 (m, 4H), 1 .59 - 1.53 (m, 4H), 1.53 - 1.45 (m, 6H), 1.45 - 1.34 (m, 3H), 1.33 - 1.20 (m, 3H), 1.20 - 1.07 (m, 3H), 1 .05 - 1.01 (m, 1H), 1.00 - 0.94 (m, 6H), 0.88 - 0.82 (m, 6H), 0.80 - 0.75 (m, 1H), 0.73 (d, J = 6.7 Hz, 3H ).

[0282] By the final purification of the second eluted diastereomer using preparative HPLC (Method 2), Example 13 (12.3 mg, 9.4% yield) was obtained as a white solid.

[0283] Example 13: ESIMS [M + H] 1027.7, [M - H] 1025.6, [M + F A - H] 1071.6 Accurate mass: 1026.57 1 1H NMR (400 MHz, DMSO - d6 δ 9.30 (s, 1H), 6.52 - 6.38 (m, 1H), 6.28 - 6.14 (m, 2H), 6.08 (d, J = 11.1 Hz, 1H), 5.58 - 5.42 (m, 1H), 5.21 - 5.14 (m, 1H), 5 .10 - 5.00 (m, 2H), 5.00 - 4.92 (m, 1H), 4.69 - 4.57 (m, 1H), 4.16 - 4.10 (m, 3H), 4.08 - 4.01 (m, 1H), 3 .97 - 3.91 (m, 1H), 3.61 (dt, J = 10.6, 4.1 Hz, 1H), 3.57 - 3.51 (m, 1H), 3.51 - 3.46 (m, 1H), 3.46 - 3.3 6 (m, 1H), 3.27 (s, 3H), 3.19 - 3.15 (m, 1H), 3.12 ( s, 3H), 3.11 - 3.08 (m, 1H), 2.80 - 2.68 (m, 1H), 2. 25 - 2.15 (m, 3H), 2.10 - 2.01 (m, 2H), 2.01 - 1.89 ( m, 2H), 1.83 (s, 3H), 1.79 - 1.65 (m, 4H), 1.64 - 1. 58 (m, 2H), 1.57 - 1.54 (m, 2H), 1.54 - 1.47 (m, 7H) , 1.46 - 1.35 (m, 3H), 1.32 - 1.18 (m, 5H), 1.14 - 1. 04 (m, 3H), 0.98 (d, J = 6.6 Hz, 3H), 0.91 - 0.85 (m, 7H), 0.83 (d, J = 6.7 Hz, 3H), 0.72 (d, J = 6.6 Hz, 3H ).

[0284] Example 14: C16-(1,1-Dioxidoisothiazolidin-2-yl)-C32-de oxo-C40-dimethylphosphinyl-rapamycin (diastereomer 1) Example 15: C16-(1,1-Dioxidoisothiazolidin-2-yl)-C32-de oxo-C40-dimethylphosphinyl-rapamycin (diastereomer 2)

Chem.

[0285] Saturated NaHCO3 water was added. The mixture was extracted several times with ethyl acetate. The organic extracts were combined. Combine, dry over NaSO, decant, and concentrate to give a colorless tar crude product.

[0286] The crude product was dissolved in MeOH (2.5 mL) and purified by preparative scale reverse phase chromatography. The eluate was purified in one injection via ~90% acetonitrile-water with 0.1% TFA modifier).

[0287] Pool the first elution peak fractions and reduce to approximately 1 / 3 volume on a rotary evaporator. The remaining solution was made basic with saturated aqueous NaHCO4 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to give a white solid. As a result, Example 14 (0.055 g, 0.044 mmol, 29.3% yield) was obtained as a compound.

[0288] Example 14: ESIMS [M+NH4] 1082.8, [MH] 1063.7. HRMS: Calculated for C55H89N2O14PSNa as the sodium adduct - 1087.5670.Measurement - 1087.5725. 1 H NMR (400MHz, chloroform-d) δ 6.45 (dd, J=14.4, 10.9Hz,1H),6.22(dd,J=14.5,10.6Hz,1H),6.1 3(dd,J=14.6,10.5Hz,1H),5.98(d,J=10.8Hz,1 H), 5.35 (dd, J = 14.7, 9.8 Hz, 1H), 5.23 - 5.17 (m, 1H), 5.10 (d, J = 9.8 Hz, 1H), 4.67 (m, 2H), 4.47 (d , J = 1.8 Hz, 1H), 4.18 - 4.04 (m, 2H), 4.03 - 3.91 (m , 1H), 3.72 (d, J = 6.5 Hz, 1H), 3.68 - 3.48 (m, 2H), 3.38 (m, 4H), 3.28 (s, 3H), 3.26 - 3.12 (m, 2H), 3. 12 - 2.91 (m, 4H), 2.74 (m, 1H), 2.48 - 2.26 (m, 3H) , 2.26 - 2.12 (m, 3H), 2.12 - 2.04 (m, 2H), 1.87 (s, 3H), 1.85 - 1.72 (m, 4H), 1.72 - 1.54 (m, 12H), 1.5 4 - 1.43 (m, 6H), 1.43 - 1.33 (m, 3H), 1.33 - 1.21 (m , 2H), 1.21 - 1.09 (m, 2H), 1.03 (m, 7H), 1.00 - 0.7 8 (m, 9H), 0.72 (q, J = 11.9 Hz, 1H).

[0289] The second elution peak fraction was pooled and reduced to about 1 / 3 volume on a rotary evaporator. The remaining solution was made basic with saturated aqueous NaHCO3. The mixture was extracted several times with ethyl acetate. The organic extracts were combined, dried over Na2SO4, decanted, concentrated, and Example 15 was obtained as a white solid (0.010 g, 7.51 μmol, 5.02% yield). to give.

[0290] Example 15: ESIMS [M + NH4] 1082.8, [M - H] 1063.8. 1 H NMR (400 MHz, chloroform - d) δ 6.36 (dd, J = 19.2, 10.3 Hz, 1H), 6.13 (m, 1H), 6.04 - 5.84 (m, 1H), 5. 65 (m, 1H), 5.32 (m, 1H), 6.21 (m, 1H), 5.11 (m, 1H ), 4.81 (dd, J = 13.7, 7.5 Hz, 1H), 4.21 - 4.03 (m, 1 H), 3.83 (dd, J = 15.2, 5.1 Hz, 2H), 3.74 (d, J = 13. 2 Hz, 1H), 3.59 (dq, J = 10.9, 6.8, 5.6 Hz, 2H), 3.5 2 (d, J = 7.1 Hz, 1H), 3.46 - 3.33 (m, 7H), 3.30 (m, 3 H), 3.18 (m, 3H), 3.10 - 2.82 (m, 3H), 2.39 (t, J = 4 .1 Hz, 1H), 2.28 (m, 3H), 2.14 (m, 3H), 1.90 - 1.77 (m, 4H), 1.74 (m, 4H), 1.66 (d, J = 10.4 Hz, 3H), 1. 61 - 1.41 (m, 12H), 1.34 - 1.19 (m, 5H), 1.18 - 1.11 (m, 1H), 1.11 - 0.79 (m, 19H), 0.78 - 0.68 (m, 1H).

[0291] Example 16: (R)-C16-(1,1-dioxideisothiazolidin-2-yl)-C 32-deoxy-C40-(2-hydroxyethoxy)-rapamycin

Chemical formula

[0292] Example 16 was prepared from 2-((tert-butyldimethylsilyl)oxy)ethanol and Example 2 in a two-step procedure.

Chemical formula

[0293] N,N - Diisopropylethylamine (0.147 ml, 0.843 mmol), toluene (0.5 mL) and Example 2 (0.198 g, 0.200 mmol) were added. The ice bath was removed and the reaction was stirred at 40 °C overnight and then at 55 °C for 1 hour.

[0294] The reaction was diluted with saturated NaHCO3 aqueous solution and extracted 4 times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through celite, concentrated, and a colorless oil of the crude product was obtained. The crude product was purified by silica gel flash column chromatography (0 - 4 0% acetone - heptane, gradient elution, 12 g silica column, visualized by TLC, UV at 30% acetone - heptane), and Intermediate C (0.077 g, 0.067

[0295] mmol, 33.5% yield) was obtained as a white solid. 0% acetone - heptane, gradient elution, 12 g silica column, visualized by TLC, UV at 30% acetone - heptane), and Intermediate C (0.077 g, 0.067 mmol, 33.5% yield) was obtained as a white solid. mmol, 33.5% yield) was obtained as a white solid.

[0296] Intermediate C: ESIMS [M + NH4] 1164.7, [M - H] 1147.0.

[0297] Step 2. Preparation of Example 16 Intermediate C (0.077 g, 0.067 mmol) was combined with pyridine (5.43 μl, 0.067 mmol) in anhydrous THF (0.7 mL). The mixture was evacuated twice with nitrogen and then cooled to 0 °C in an ice-water bath. HF-pyridine (0.086 ml, 0.671 mmol) was added dropwise via syringe over 15 seconds. The reaction was stirred at 0 °C for 70 minutes.

[0298] The reaction was quenched with saturated aqueous NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, vacuum filtered through celite, concentrated, and a white solid crude product was obtained.

[0299] The crude product was purified by silica gel flash column chromatography (0 - 40% acetone - heptane, gradient elution, 12 g silica column, visualized by TLC, UV at 40% EtOAc - heptane), and Example 16 (0.049 g, 0.046 mmol, 69.0% yield) was obtained as a white solid.

[0300] Example 16: ESIMS [M + NH4] 1050.9, [M - H] 1031.9. 1 1H NMR (600 MHz, chloroform - d) δ 6.45 (dd, J = 14.6, 10.9 Hz, 1H), 6.22 (dd, J = 14.7, 10.6 Hz, 1H), 6.13 (dd, J = 14.9, 10.6 Hz, 1H), 5.98 (d, J = 10.9 Hz, 1H), 5.35 (dd, J = 14.9, 9.8 Hz, 1H), 5.20 (d, J = 5.9 Hz, 1H), 5.09 (d, J = 9.9 Hz, 1H), 4.71 (d, J = 12.3 H ​​​​​​​​​​​​z, 1H), 4.62 (m, 1H), 4.46 (s, 1H), 4.11 (d, J = 6.8 Hz, 1H), 3.96 (t, J = 11.3Hz, 1H), 3.78 (m, 1H), 3. 70 (m, 3H), 3.63 - 3.55 (m, 3H), 3.43 (s, 3H), 3.28 (s, 3H), 3.24 - 3.15 (m, 2H), 3.12 - 3.04 (m, 2H), 3 .07 - 2.98 (m, 1H), 2.97 (q, J = 7.9Hz, 1H), 2.75 (m , 1H), 2.44 - 2.33 (m, 1H), 2.30 (M, 2H), 2.23 (m, 1 H), 2.16 (m, 2H), 2.09 (d, J = 13.1Hz, 1H), 2.01 (m , 1H), 1.88 (s, 3H), 1.84 (d, J = 13.1Hz, 1H), 1.78 - 1.70 (m, 3H), 1.70 - 1.62 (m, 4H), 1.52 (dd, J = 11 .8, 7.7Hz, 1H), 1.50 - 1.41 (m, 2H), 1.43 - 1.32 (m , 1H), 1.34 - 1.27 (m, 1H), 1.30 - 1.17 (m, 8H), 1.0 4 (dd, J = 9.5, 6.6Hz, 7H), 1.02 - 0.85 (m, 10H), 0. 85 (d, J = 6.8Hz, 3H), 0.69 (q, J = 12.0Hz, 1H).

[0301] Example 17: C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-de oxo-C40-(S)-(1H-tetrazol-1-yl)-rapamycin [Chemical formula] Intermediate 5 (0.109 g, 0.114 mmol) was combined with isothiazolidine 1,1-dioxide (0.139 g, 1.145 mmol) in anhydrous acetonitrile (1.1 mL) and Combined. Para-toluenesulfonic acid monohydrate (0.0022 g, 0.011 mmol) was added. The reaction mixture was stirred at room temperature for 2 hours.

[0302] The reaction mixture was diluted with saturated aqueous NaHCO3. The mixture was extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, concentrated to give a yellow tarry crude product .

[0303] The crude product was purified by silica gel flash column chromatography (0 - 4 0% acetone - heptane, gradient elution, 24 g silica column, visualized by TLC, UV at 40% acetone - heptane to give Example 17 as a white solid (0.053 g, 0.04 6 mmol, 40.0% yield).

[0304] Example 17: ESIMS [M + H] 1041.8, [M - H] 1039.8. HRMS: Calculated for C54H84N6O12SNa - 1063.5765. Found - 1063.5759. 1 1H NMR (600 MHz, chloroform - d) δ 8.86 (s, 1H), 6.39 (dd, J = 14.7, 11.0 Hz, 1H), 6.22 (dd, J = 14.7, 10. 7 Hz, 1H), 6.11 (dd, J = 15.0, 10.5 Hz, 1H), 5.99 (d , J = 10.9 Hz, 1H), 5.34 (dd, J = 14.9, 9.8 Hz, 1H), 5 .18 (d, J = 5.7 Hz, 1H), 5.10 (d, J = 9.8 Hz, 1H), 4.8 7 (m, 1H), 4.67 (m, 1H), 4.63 (d, J = 12.2 Hz, 1H), 4 .50 (s, 1H), 4.13 (d, J = 6.1 Hz, 1H), 3.97 (t, J = 11 .4 Hz, 1H), 3.78 (d, J = 6.2 Hz, 1H), 3.69 - 3.62 (m, 1H), 3.55 (dt, J = 11.2, 4.0 Hz, 1H), 3.50 - 3.39 (m , 1H), 3.39 (s, 3H), 3.38 - 3.30 (m, 1H), 3.27 (s, 3 H), 3.25 - 3.13 (m, 1H), 3.07 (td, J = 8.4, 3.8 Hz, 1 H), 3.01 (m, 1H), 2.96 (q, J = 7.9 Hz, 1H), 2.70 - 2. 63 (m, 2H), 2.39 (m, 1H), 2.35 - 2.21 (m, 3H), 2.18 (d, J = 13.7 Hz, 1H), 2.16 - 2.09 (m, 1H), 1.95 - 1.8 1 (m, 3H), 1.82 (s, 3H), 1.75 (m, 3H), 1.65 (s, 3H) , 1.60 (m, 6H), 1.58 - 1.50 (m, 1H), 1.53 - 1.34 (m, 2H), 1.32 (m, 1H), 1.29 (m, 1H), 1.25 (m, 6H), 1.1 2 (m, 1H), 1.05 (d, J = 6.6 Hz, 3H), 1.05 - 0.78 (m, 1 2H).

[0305] Example 18: C16-(1,1-Dioxidoisothiazolidin-2-yl)-C32-de oxo-C40-(2-ethoxyethoxy)-rapamycin

Chem.

[0306] ​ All reaction mixtures were purified by silica gel flash column chromatography (0 ~40% acetone-heptane, gradient elution, 24g silica column, 40% acetone-heptane (Visualized under TLC and UV in Fig. 2) Example 18 and remaining unreacted isothiazolidinediamine A mixture of lysine 1,1-dioxides was obtained.

[0307] The mixture was purified once more by silica gel flash column chromatography. (0-50% acetonitrile-dichloromethane, gradient elution, 24g column, 30% acetonitrile nitrile-dichloromethane (TLC, visualized under UV), Example 1 as a white solid 8 (0.021 g, 0.019 mmol, 20.4% yield) was obtained.

[0308] Example 18: ESIMS [M+NH4] 1078.9, [MH] 1059.9. HRMS: Calculated for C57H92N2O14SNa sodium adduct - 10 83.6167. Measurement 1083.6151. 1 H NMR (600MHz, chloroform-d) δ 6.45 (dd, J=14.5, 11.0Hz,1H),6.21(dd,J=14.6,10.7Hz,1H),6.1 4(dd,J=14.8,10.8Hz,1H),5.98(d,J=10.9Hz,1 H),5.35(dd,J=14.8,9.8Hz,1H),5.20(d,J=5.8 Hz,1H),5.09(d,J=9.8Hz,1H),4.72(d,J=12.1H z,1H),4.61(m,1H),4.46(s,1H),4.10(d,J=6.9 Hz,1H),3.96(t,J=11.4Hz,1H),**3.73(t,J=5. 5 Hz, 2H), 3.68 (d, J = 6.9 Hz, 1H), 3.59 (m, 4H), 3. 53 (m, 2H), 3.46 (s, 3H), 3.28 (s, 3H), 3.21 (m, 1H ), 3.13 (m, 1H), 3.07 (m, 2H), 3.05 - 2.99 (m, 1H), 2.97 (q, J = 8.0 Hz, 1H), 2.78 (dq, J = 14.4, 7.1 Hz, 1H), 2.44 - 2.33 (m, 1H), 2.31 (m, 2H), 2.27 - 2.19 (m, 1H), 2.19 - 2.12 (m, 2H), 2.07 - 1.94 (m, 2H), 1 .88 (s, 3H), 1.83 (d, J = 12.9 Hz, 1H), 1.74 (m, 3H) , 1.66 (m, 7H), 1.56 - 1.44 (m, 1H), 1.43 (m, 2H), 1 .41 - 1.15 (m, 12H), 1.04 (m, 7H), 0.91 (m, 8H), 0. 84 (d, J = 6.7 Hz, 3H), 0.70 (q, J = 12.0 Hz, 1H).

[0309] Example 19: C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-de oxo-C40-((3-hydroxy-2-(hydroxymethyl)-2-methylpropan yl)oxy)-rapamycin

Chemical Structure

[0310] ​The total reaction mixture was purified by normal-phase flash column chromatography (0 - 60% acetonitrile-dichloromethane, gradient elution, 12 g silica column, TLC in 30% acetonitrile-dichloromethane) to afford Example 19 (0.020 g, 0.017 mmol, 19.9% yield) as a white solid. Example 19: ESIMS [M+NH4] 1123.0, [M-H] 1104.0. HRMS: Calculated for ammonium adduct C58H92N2O16SNH4 - 1122.6511; Measured 1122.652. 1

[0311] H NMR (600 MHz, chloroform-d) δ 6.45 (dd, J = 14.7, 10.9 Hz, 1H), 6.22 (dd, J = 14.7, 10.7 Hz, 1H), 6.13 (dd, J = 14.9, 10.6 Hz, 1H), 5.99 (d, J = 10.9 Hz, 1H), 5.35 (dd, J = 14.9, 9.8 Hz, 1H), 5.21 (d, J = 5.8 Hz, 1H), 5.10 (d, J = 9.9 Hz, 1H), 4.73 (ddd, J = 11.0, 9.2, 4.7 Hz, 1H), 4.69 (d, J = 12.4 Hz, 1H), 4.64 (m, 1H), 4.49 (s, 1H), 4.13 (d, J = 6.5 Hz, 1H), 3.97 (t, J = 11.3 Hz, 1H), 3.84 (dd, J = 18.5, 11.4 Hz, 2H), 3.78 - 3.69 (m, 2H), 3.64 (m, 2H), 3.56 (td, J = 13.5, 3.0 Hz, 1H), 3.43 - 3.31 (m, 4H), 3.28 (m, 3H), 3.26 - 3.17 (m, 2H), 3.12 - 2.92 (m, 3H), 2.76 - 2.68 (m, 1H), 2.45 - 2.34 (m, 1H), 2.31 - 2.21 (m, 3H) ​​​​​​​​​​​​​​​ ), 2.20 - 2.10 (m, 3H), 2.06 (m, 1H), 1.87 (m, 4H), 1.75 (m, 3H), 1.71 - 1.59 (m, 3H), 1.60 (s, 3H), 1. 60 - 1.50 (m, 1H), 1.48 - 1.39 (m, 1H), 1.42 - 1.31 ( m, 2H), 1.33 - 1.20 (m, 8H), 1.11 (s, 3H), 1.11 - 1. 05 (m, 2H), 1.03 (dd, J = 18.2, 6.6 Hz, 6H), 0.99 - 0 .82 (m, 10H), 0.79 (q, J = 12.0 Hz, 1H).

[0312] Example 20: Bioassay and Data The activity of the compounds according to the present disclosure was evaluated by the following in vitro and in vivo methods. It was evaluated as follows.

[0313] Pharmacological Characteristics Materials and Methods Cell-based assay for rapalog potency determination. The potency of rapalog was determined using a MEF TSC 1 - / - cell-based assay. MEF TSC1 - / - cells are mouse embryonic fibroblasts lacking the tuberous sclerosis protein - TSC1 that negatively regulates m TORC1 signaling, and thus exhibit constitutive mTORC1 activation, resulting in phosphorylation (activation) of downstream targets. This cell-based assay is used to measure the inhibition (dephosphorylation) of S6 and 4EBP1 by rapalog or other m TOR inhibitors. TOR inhibitors. TOR inhibitors. .

[0314] MEF TSC1 - / - cells were plated on poly-D-lysine-coated 384-well Grien er clear-bottom plates and incubated overnight at 37 °C, 5% CO2. Done. The next day, the cells were washed 8 times with "Hard starve" solution (1L DPBS + 1g D-(+) glucose + 10ml of 7.5% sodium bicarbonate + 20ml of 1M HEPES), and incubated for an additional 2 hours with the same solution. The cells were then treated with the compound while reducing the concentration (8 steps with 3.16-fold dilution) and incubated at 37 °C, 5% CO2 for 2 hours . The cells were fixed with 4% paraformaldehyde for 30 minutes, washed 5 times with TBS- EDTA, and then immunostained with fluorescently tagged antibodies against pS6 (Ser240 / 244) (Cell Sign aling #9468) and p4EBP1 (Thr37 / 46) (Cell Signa ling #5123). The nuclei were visualized by Hoechst ( ThermoFisher Scientific #H3570) staining . The cells were imaged using each fluorescence channel (InCell 600), and the potency of the m TOR inhibitor was defined by pS6 IC (nM). Housing of animals, treatment with compounds, and tissue collection. All procedures involving animals were approved by the Inst 50 itutional Animal Care and Use Committee of the Novartis Institutes for Biomedica

[0315] l Research, Cambridge, MA, USA. Adult Sprague Dawley (SD) male rats were purchased from Envigo (Indianapol is, USA) or Charles River (USA). Upon arrival, the rats were housed with controlled temperature and lighting (22 °C, 12h light / 12h dark cycle: 06 :00 to 18:00), and allowed to acclimatize for at least 1 week before the experiment . ​​​Light on at 00h / light off at 1800h), specific pathogen-free facility where rats can freely ingest feed and water and reared. The rats were acclimated for at least 3 days before the experiment began.

[0316] Example 2 and RAD001 were formulated for oral administration. The blank formulation (Example 2 or without RAD001) served as a vehicle control. The rats received a single dose of Example 2, RAD001, or their respective vehicles p.o. After treatment at a predetermined time, the rats were anesthetized with 3.5% isoflurane and euthanized. Various organs were collected and frozen in liquid nitrogen. Blood was collected via the tail vein or cardiac puncture (fatal) and frozen for further pharmacokinetic analysis. All tissues were stored at -80 °C until analysis.

[0317] Determination of the concentrations of Example 2 and RAD001 in blood and tissues. The concentrations were determined using HPLC / mass spectrometry .

[0318] Protein extraction and immunoblotting. For protein extraction, snap-frozen tissues were lysed in MSD lysis buffer (MSD, Rockville, Maryland) supplemented with a complete EDTA-free protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche, Mannheim, Germany) and centrifuged at 13,000 g for 20 minutes at 4 °C. The resulting supernatant was used for immunoblotting. Proteins were quantified by the BCA protein assay (Thermo Scientific, MA). Samples were run on 4 - 20% Criterion™ TGX (com ​​Separated on a Precast Midi Protein gel (Bio-Rad, CA) and transferred onto a nitrocellulose membrane (Bio-Rad, CA) using a Trans Turbo Blot system (Bio-Rad, CA). Immunoblotting was performed with antibodies against p-S6 and t-S6 from Cell Signaling Technologies (both 1:1000 in TBS-T with 5% BSA). The "p" and "t" designations indicate "phosphorylated" and "total" forms, respectively. The HRP-conjugated secondary antibody against rabbit (#7074) was from Cell Signaling Technologies (MA). Chemiluminescent signals were generated using SuperSignal (trademark) West Femto Enhanced Chemiluminescent Substrate (#34095, Thermo Scientific, MA) or Western Lightning (registered trademark) Plus-ECL Enhanced Chemiluminescence Substrate (NEL103001EA, Perkin Elmer, MA) and captured using a ChemiDoc MP Imaging System (Bio-Rad). The resulting digital images were converted to TIFF format and quantified using ImageJ software (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. A CRISPR / CAS9 vector containing a gRNA sequence targeting the FKBP12 C-terminus (GCTTCTAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours

[0319] Generation of FKBP12 knockdown cells. An FKBP12 C-terminus (GCTTCTAAACTGGAATGAC)-targeting gRNA sequence-containing CRISPR / CAS9 vector was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. An FKBP12 C-terminus (GCTTCTAAACTGGAATGAC)-targeting gRNA sequence-containing CRISPR / CAS9 vector was transfected into 293T cells. Selection was performed with puromycin for 48 hours (MA). Generation of FKBP12 knockdown cells. An FKBP12 C-terminus (GCTTCTAAACTGGAATGAC)-targeting gRNA sequence-containing CRISPR / CAS9 vector was transfected into 293T cells. Selection was performed with puromycin for 48 hours Performed by, the cells were plated for colony formation. FKBP12 knockdown Clones were screened by immunoblotting with an anti-FKBP12 antibody (Thermo Scientific, Pierce #PA1-026A). FKB Clones with significantly reduced FKBP12 (approximately 80% reduction compared to the level in unmanipulated 293T cells ) were selected.

[0320] Generation of FKPB12 knockout cells. The CRISPR / Cas9 system was used to deliver a ribonucleoprotein complex containing a guide RNA (gRNA) sequence targeting FKBP12 (GCCACTACTCACCGTCTCCT) into 293T cells using the Amaxa (registered trademark) 4D-Nucleofector (trademark) X Kit (Lonza, V4XC- 2032). Cell clones were screened by immunoblotting with an anti-FKBP12 antibody (Novus, N B300-508), and a single clone showing complete FK BP12 knockout (no detectable FKBP12) was selected. B300-508) and a single clone showing complete FK BP12 knockout (no detectable FKBP12) was selected. clone was selected.

[0321] Treatment of wild-type (WT), FKBP12 knockdown, and FK BP12 knockout 293T cells with RAD001 and Example 2. WT, FKBP12 knockdown, and FKB P12 knockout 293T cells were plated at a density of 30,000 cells per well in a poly-D-lysine-coated 96-well plate ( Corning, #354461) in Dulbecco's Modified Eagle's Medium (ThermoFish er, #11995-065) supplemented with 10% fetal bovine serum (ThermoFisher, #16140-071). Cells were cultured in plates and incubated at 37 °C with 5% CO2 for 48 hours until they reached approximately 80% confluence. Cells were then treated with RAD001 and Example 2 using a 12-step dose range from 1000 nM to 0.003 nM for 2 hours at 37 °C. Media supplemented with blank dimethyl sulfoxide (DMSO) was used as a control for both compounds. The amount of phosphorylation of S6K1 (Thr389) was detected using a sandwich ELISA kit (Cell signaling, #7063C) according to the manufacturer's protocol.

[0322] SPR assay to determine the binding affinity for FK506 binding protein (FKBP). N-terminal avi-his6-tagged FKBP fusions for FKBP12, FKBP51 and FKBP52 were expressed in Escherichia coli (E. coli) and purified using standard chromatography. Each protein was subsequently immobilized on a streptavidin chip of a Biacore 8K SPR instrument (GE Healthcare). Using single cycle kinetics, titration compounds were flowed over each surface at 45 μL / min in a buffer containing 50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween20 / 1 mM DTT / 2% DMSO with a 2-minute association phase and a 30-minute dissociation phase. Data was fit using low molecular weight (LMW) single cycle kinetics. The equilibrium dissociation constant (Kd) was reported. D

[0323] The specific pharmacology of the rapalogs is 1) the relative presence of FKBP homologs in these cells / tissues Depending on the amount and 2) the specificity of binding to these various FKBP homologs, various cell types or tissue types can be achieved (Mol. Cell Biol. (2013) 3 3:1357-1367).

[0324] Results The in vitro potency of the mTOR inhibitor was determined by p S6 IC 50 (nM) in MEF TSC1- / - cells.

[0325] [Table 7]

[0326] The IC50 value is calculated as the average from multiple assays.

[0327] [Table 8]

[0328] Pharmacokinetic profile of Example 2 in rats. Four-month-old rats were treated with a single p.o. dose of Example 2 at 3 mg / kg, and blood was collected at 0.25, 0.5, 1, 2, 4, and 7 h after dosing. In this experiment, Example 2 was formulated in 15% polyethylene glycol (PEG) 300, 7.5% Solutol HS15, 7.5% Cre mophore EL in MilliQ water. The concentration of Example 2 was measured by HPLC-MS (Figure 3). in MilliQ water. The concentration of Example 2 was measured by HPLC-MS (Figure 3).

[0329] Relative blood and brain concentrations of Example 2 and RAD001 in rats. Four-month-old rats were treated with Example 2 (15% P in MilliQ water) at 3, 10, and 30 mg / kg EG300, 7.5% Solutol HS15, 7.5% Cremophore EL in the formulation) and treated p.o. In another experiment, 8-week-old rats were treated p.o. with RAD001 formulated as a 2% (w / w) microemulsion at 3, 10, and 30 mg / kg and diluted to the final concentration in MilliQ water). Blood and brain tissues were collected 3 hours (h) and 24 h after treatment to determine the concentration of the compound. At the same doses (3, 10, and 30 mg / kg), the blood concentration and brain concentration for Example 2 were higher compared to the concentration for RAD001 (Figure 4A and 4B).

[0330] To compare the bioavailability of Example 2 vs. RAD001 in rats, the compound was formulated as a solution formulation. Example 1 was formulated in 15% PEG300, 7.5 % Solutol HS15, 7.5% Cremophore EL in PBS, and R AD001 was formulated in 10% PEG300, 10% Solutol HS15, 10% Cremophore EL in PBS. The compound was administered p.o. at 3 mg / kg and i.v. at 1 mg / kg to 7- to 9-week-old rats (N = 3 per group) ( Figure 4C and 4D). For Example 2 and RAD001, respectively, the bioavailability was 18% and 19%, the i.v. terminal phase half-life was 9.9 h and 9.5 h, the clearance was 9 mL / min / kg and 32 mL / min / kg, and the Vdss (volume of distribution at steady state) was 4.4 L / kg and 18.8 L / kg.

[0331] Example 2 inhibits the mTORC1 pathway in rat liver. That Example 2 is in vivo The ability to inhibit the mTORC1 pathway was determined in 4-month-old rats (Figure 5A-5 D). Single doses of 3, 10, and 30 mg / kg of Example 2 resulted in significant dephosphorylation (inactivation) of S6 in the rat liver 3 hours after dosing (compared to vehicle control )(Figure 5A and 5B). S6 remained inactivated 24 h after dosing with 10 (trend p = 0.06) and 30 mg / k g (Figure 5C and 5D).

[0332] FKBP12 is required for the inhibitory effect of Example 2 but not RAD001. The amount of phosphorylation of S6K1 (Thr389) was measured in WT, FK BP12 knockdown and FKBP12 knockout 293T cells treated with RAD001 or Example 2. S 6K1 is a target downstream of mTORC1, and phosphorylation of its rapalog-sensitive Thr389 site is used as a function of the measured value of mTORC1 activity. Lee, C.H., In oki, K. and Guan, K.L. (2007). mTOR pathway a s a target in tissue hypertrophy. Annu. Re v. Pharmacol. Toxicol. 47, 443-467. In WT 293T cells both RAD001 and Example 2 were effective in inhibiting S6K1(Thr389) up to about 80% (Figure 6A). In FKBP12 knockdown cells, Example 2 did not inhibit S6K1(Thr389) phosphorylation to the same level as R AD001. The maximum inhibition of S6K1(Thr389) by RA D001 was about 70%, while the inhibition achieved by Example 2 was about 40% (Figure 6B). In FKBP12 knockout cells, Example 2 did not inhibit S6K1(Thr389) phosphorylation (Figure 6C). In cells, Example 2 did not inhibit S6K1(Thr389) phosphorylation, but >60 % inhibition was still achieved by RAD001 (Figure 6C). These results indicate that the pharmacological effect of Example 2 is restricted to FKBP12. Such specificity of Example 2 for FKBP12 avoids side effects in tissues with low FKBP12 expression ( while minimizing or minimizing) and facilitates targeting cells and tissues with relatively high levels of FKBP12 expression.

[0333] Equivalents and ranges In the claims, articles such as "a", "an", and "the" mean one or more than one unless the contrary is indicated or is not apparent from the context. A claim or description that includes "or" between one or more members of a group is, unless the contrary is indicated or is not apparent from the context, one, two or more, or all group members are considered to meet the conditions if present in, used in, or otherwise related to a given product or process. The present disclosure includes embodiments in which exactly one member of a group is present in, used in, or otherwise related to a given product or process. The present disclosure also includes embodiments in which two or more or all group members are present in, used in, or otherwise related to a given product or process.

[0334] Furthermore, the present disclosure includes all variations, combinations, and rearrangements in which one or more limitations, elements, clauses, and descriptive terms of one or more of the recited claims are introduced into another claim. For example, any claim that depends on another claim is also any other claim that depends on the same underlying claim ​​​​​​​It can be modified to include one or more limitations found in the claims. Element When, for example, the is provided as a list in a Markush format, each subgroup of the elements is also disclosed, and any element can be excluded from the group. Generally, when the present disclosure or an aspect of the present disclosure is referred to as including a particular element and / or feature, it should be understood that certain embodiments of the present disclosure or an aspect of the present disclosure consist of or consist essentially of such element and / or feature. It should be noted that the terms "comprising" and "containing" are intended to be open and allow the incorporation of additional elements or steps. When ranges are given, the endpoints are included. Further, unless otherwise indicated or otherwise apparent from the context and the understanding of one of ordinary skill in the art, values expressed as ranges are, within the context of the disclosure, any specific value or subrange within a certain range in various embodiments of the present disclosure can be assumed to be to one tenth of the unit of the lower limit of the range, unless clearly indicated otherwise in the context.

[0335] This application references various issued patents, published patent applications, journal articles, and other publications, all of which are hereby incorporated by reference into this specification. If there is any conflict between any of the incorporated references and the specification of the present invention, the specification shall prevail. In addition, any specific embodiment of the present disclosure that is within the scope of the prior art can be explicitly excluded from any one or more claims. Since such embodiments are considered to be known to one of ordinary skill in the art, they can be excluded even if not explicitly described herein with respect to the exclusion. Any specific embodiment of the present disclosure can be excluded from any claim for any reason, regardless of whether it relates to the existence of the prior art. ​

[0336] One of ordinary skill in the art will recognize or be able to ascertain many equivalents to the specific embodiments described herein using only routine experimentation. The scope of the embodiments of the invention described herein is not intended to be limited to the above description, but rather is as set forth in the appended claims. One of ordinary skill in the art will understand that various changes and modifications to this specification may be made without departing from the spirit or scope of the disclosure as defined in the following claims. It may include the following aspects. [1] Formula (I)

Chemical Formula

Chemical Formula

Chemical Formula

Chem.

Chem.

Chem.

Chem.

Table 9-1

Table 9-2

Table 9-3

Table 9-4

Table 9-5

Chem.

Chem.

Chem.

[10] A pharmaceutical composition comprising a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [9] above and one or more pharmaceutically acceptable carriers.

[11] A pharmaceutical combination comprising a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [9] above and one or more therapeutically active agents.

[12] A method for treating a disorder or disease mediated by the mTOR pathway in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [9] above, or the pharmaceutical composition according to

[10] above, or the pharmaceutical combination according to

[11] above.

[13] A method for treating a disease or disorder in a subject, wherein the target tissue, cell or organ associated with the pathology of the disease or disorder has an FKBP12 level sufficient to inhibit mTORC1, the method comprising administering to the subject in need thereof a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [9] above, or the pharmaceutical composition according to

[10] above, or the pharmaceutical combination according to

[11] above.

[14] A method for treating a disease or disorder in a subject determined in advance to have or be assumed to have sufficient FKBP12 levels to inhibit mTORC1, the method comprising administering to the subject in need thereof a therapeutically effective amount of a compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to

[10] above, or a combination of pharmaceuticals according to

[11] above.

[15] The disease or disorder is sarcopenia, dermal atrophy, cherry angioma, seborrheic keratosis, brain atrophy, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubule disease, hearing loss, mobility impairment, cognitive decline, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune senescence causing cancer due to reduced immune surveillance, infectious diseases due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, ageusia, anosmia, arthritis, and complications resulting from type II diabetes including renal failure, blindness, and neuropathy, selected from any one of

[12] to

[14] above.

[16] The disorder is liver fibrosis, according to any one of

[12] to

[14] above.

[17] A method for treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to

[10] above, or a combination of pharmaceuticals according to

[11] above, wherein the disorder or disease is - acute or chronic organ or tissue transplant rejection, - transplant vasculopathy, - intimal hyperplasia, vascular occlusion, obstructive coronary atherosclerosis, proliferation and migration of smooth muscle cells causing restenosis, - autoimmune diseases and inflammatory conditions, - treatment and prevention of asthma, - multidrug resistance (MDR), - fungal infections, - inflammation, - infectious diseases, - age-related diseases, - neurodegenerative diseases, - proliferative disorders, particularly cancer, - seizures and seizure disorders, and - A method selected from mitochondrial myopathy and mitochondrial stress The method selected from the above.

[18] The method according to

[17] above, wherein the disorder is a disorder including a fibrosis and / or an inflammation process.

[19] The method according to

[18] above, wherein the disorder is selected from liver disorders and kidney disorders.

[20] The method according to

[19] above, wherein the liver disorder is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH, and alcohol-related steatosis occurring in end-stage liver diseases.

[21] The method according to

[19] above, wherein the kidney disorder is kidney fibrosis.

[22] The method according to

[21] above, wherein the kidney fibrosis results from acute kidney injury.

[23] The method according to

[19] above, wherein the kidney disorder is chronic kidney disease.

[24] The method according to

[19] above, wherein the kidney disorder is diabetic nephropathy.

[25] A method for treating an age-related disorder or an age-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [9] above, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, wherein the disorder or disease is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubular disease, hearing loss, mobility impairment, cognitive decline, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in a decrease in ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune senescence causing cancer due to a decrease in immune surveillance, infectious diseases due to a decrease in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and complications resulting from diabetes such as kidney failure, blindness, and neuropathy, and type II diabetes.

[26] A method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of the compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or a combination of the medicaments according to

[11] above.

[27] The method according to

[26] above, further comprising a PD-1 / PDL-1 inhibitor.

[28] The cancer is selected from renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma and cervical cancer, the method according to

[26] or

[27] above.

[29] The compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or a combination of the medicaments according to

[11] above for use as a medicament.

[30] The compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or a combination of the medicaments according to

[11] above for use in the prevention or treatment of disorders or diseases mediated by the mTOR pathway.

[31] - Acute or chronic organ or tissue transplant rejection, - Transplant vasculopathy, - Intimal hyperplasia, vascular occlusion, obstructive coronary atherosclerosis, proliferation and migration of smooth muscle cells causing restenosis, - Autoimmune diseases and inflammatory conditions, - Treatment and prevention of asthma, - Multidrug resistance (MDR), - Fungal infections, - Inflammation, - Infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, and - A treatable condition shown to increase the likelihood of age-related diseases, such as a situation with an increase in age-induced cytokines The compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or a combination of the medicaments according to

[11] above for use in the prevention or treatment of disorders or diseases selected from.

[32] The compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for use in the prevention or treatment of a disorder or disease involving a fibrotic or inflammatory process.

[33] The compound for use according to

[32] above, wherein the disorder is selected from liver disorders and kidney disorders.

[34] The compound for use according to

[33] above, wherein the liver disorder is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcoholic hepatic steatosis or NASH, and alcoholic steatosis occurring in end-stage liver diseases.

[35] The compound for use according to

[33] above, wherein the kidney disorder is kidney fibrosis resulting from acute kidney injury.

[36] The compound for use according to

[33] above, wherein the kidney disorder is chronic kidney disease.

[37] The compound for use according to

[33] above, wherein the kidney disorder is diabetic nephropathy.

[38] The compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for use in the prevention or treatment of age-related disorders or age-associated diseases selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy - also known as dementia, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubule disease, hearing loss, mobility impairment, cognitive decline, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, ageusia, anosmia, arthritis, and complications resulting from diabetes such as kidney failure, blindness, and neuropathy, including type II diabetes.

[39] The compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for use in the prevention or treatment of cancer.

[40] The compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for use in the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, corpus cancer of the uterus, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal carcinoma, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or cervical cancer.

[41] Use of the compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for the manufacture of a medicament.

[42] Use of the compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for the manufacture of a medicament for the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

[43] - Acute or chronic organ or tissue transplant rejection, - Transplant vasculopathy, - Intimal hyperplasia, vascular occlusion, obstructive coronary atherosclerosis, proliferation and migration of smooth muscle cells causing restenosis, - Autoimmune diseases and inflammatory conditions, - Treatment and prevention of asthma, - Multidrug resistance (MDR), - Fungal infections, - Inflammation, - Infectious diseases, - Age-related diseases, - Neurodegenerative diseases, - Proliferative disorders, especially cancer, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, and - A treatable condition shown to increase the likelihood of age-related diseases, such as a situation with an increase in age-induced cytokines Use of the compound according to any one of [1] to [9] above, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for the manufacture of a medicament for the prevention or treatment of a disorder or disease selected from the above.

[44] Use of a compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to

[10] above, or a combination of pharmaceuticals according to

[11] above, for the manufacture of a medicament for the prevention or treatment of a disorder or disease involving a process of fibrosis or inflammation.

[45] Use according to

[44] above, wherein the disorder is selected from liver disorders and kidney disorders.

[46] Use according to

[45] above, wherein the liver disorder is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcoholic fatty liver disease or NASH, and alcohol-related steatosis occurring in end-stage liver diseases.

[47] Use according to

[45] above, wherein the kidney disorder is kidney fibrosis resulting from acute kidney injury.

[48] Use according to

[45] above, wherein the kidney disorder is chronic kidney disease.

[49] Use according to

[45] above, wherein the kidney disorder is diabetic nephropathy.

[50] Use of a compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to

[10] above, or a combination of pharmaceuticals according to

[11] above, for the manufacture of a medicament for the prevention or treatment of age-related disorders or age-associated diseases selected from sarcopenia, cutaneous atrophy, cherry angioma, seborrheic keratosis, brain atrophy - also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease (stroke), chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal vascular disease, hearing loss, mobility impairment, cognitive decline, tendon rigidity, cardiac hypertrophy, and / or systolic and / or diastolic dysfunction, and / or cardiac dysfunction such as hypertension, cardiac dysfunction resulting in reduced ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence causing cancer due to reduced immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, ageusia, anosmia, arthritis, and complications arising from diabetes such as kidney failure, blindness, and neuropathy, including type II diabetes.

[51] Use of the compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for the manufacture of a medicament for the prevention or treatment of cancer.

[52] Use of the compound according to any one of [1] to [9] above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to

[10] above, or the combination of medicaments according to

[11] above, for the manufacture of a medicament for the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, endometrial carcinoma, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or cervical cancer.

Claims

1. Formula (I) 【Chemical 1】 wherein R 1 is hydroxy, [Chemical Formula 2] is selected from the group consisting of, and R 2 is [Chemical Formula 3] is selected from the group consisting of, where m is 0, 1, 2 or 3; n is 1, 2 or 3; o is 1, 2, 3, 4, 5 or 6; p is 1, 2, 3, 4 or 5; q is 1, 2, 3, 4 or 5, and the sum of p and q is 2, 3, 4, 5 or 6; R 3 is hydrogen, C 1~6 alkyl, hydroxy C 1~6 alkyl, C 3~8 cycloalkyl C 0~6 alkyl or phenyl C 0~6 alkyl, and R 4 is hydrogen, and R 5 is hydrogen, hydroxy or cyano, or R 4 and R 5 together form =O) a compound of or a pharmaceutically acceptable salt thereof.

2. R 2 is 【Chemical Formula 4】 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein is

3. R 3 is hydrogen, C 1~6 alkyl, or hydroxy C 1~6 alkyl, the compound according to claim 2 or a pharmaceutically acceptable salt thereof.

4. R 2 is 【Chemical Formula 5】 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein is

5. R 2 is 【Chemical Formula 6】 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein is

6. R 2 is 【Chemical Formula 7】 The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein is

7. R 5 is hydrogen, the compound according to claim 6 or a pharmaceutically acceptable salt thereof.

8. The compound according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is selected from 【Table 1】 【Table 2】

9. As follows: A compound selected from or a pharmaceutically acceptable salt thereof. [Chemical Formula 8] 【Chemical Formula 9】

10. A pharmaceutical composition comprising a therapeutically effective amount of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

11. A pharmaceutical composition comprising a therapeutically effective amount of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof, which is used in combination with one or more therapeutically active agents.

12. A pharmaceutical composition comprising the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for use as a medicament.

13. A pharmaceutical composition comprising the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for use in the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

14. - Acute or chronic rejection in organ or tissue transplantation, - Transplant vasculopathy, - Intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, proliferation and migration of smooth muscle cells causing restenosis, - Autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR) state, - Fungal infections, - Inflammation, - Infectious diseases, - Age-related diseases or disorders, - Neurodegenerative diseases, - Proliferative disorders, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, and - Treatable conditions shown to increase the likelihood of age-related diseases ​ A pharmaceutical composition for use in the prevention or treatment of a disorder or disease selected from the group consisting of the compounds or pharmaceutically acceptable salts thereof according to any one of claims 1 to 9.

15. The pharmaceutical composition according to claim 14, wherein the treatable condition shown to increase the likelihood of age-related diseases is a situation with an increase in aging-induced cytokines.

16. The pharmaceutical composition according to claim 14, wherein the disorder or disease is an age-related disease.

17. The pharmaceutical composition according to claim 14, wherein the disorder or disease is a proliferative disorder.

18. The pharmaceutical composition according to claim 14, wherein the disorder or disease is an autoimmune disease or an inflammatory condition.

19. A pharmaceutical composition for use in the prevention or treatment of a disorder or disease including a process of fibrosis or inflammation, comprising the compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 9.

20. The pharmaceutical composition according to claim 19, wherein the disorder is selected from liver disorders and kidney disorders.

21. The pharmaceutical composition according to claim 20, wherein the liver disorder is selected from hepatic fibrosis, cirrhosis, toxic liver failure, non-alcohol-related hepatic steatosis or NASH, and alcohol-related steatosis occurring in end-stage liver diseases.

22. The pharmaceutical composition according to claim 20, wherein the kidney disorder is renal fibrosis resulting from acute kidney injury.

23. The pharmaceutical composition according to claim 20, wherein the kidney disorder is chronic kidney disease.

24. The pharmaceutical composition according to claim 20, wherein the kidney disorder is diabetic nephropathy.

25. The disorder or disease is selected from sarcopenia, cutaneous atrophy, cherry angioma, seborrheic keratosis, brain atrophy or dementia, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease or stroke, chronic kidney disease, diabetic kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubular disease, hearing impairment, mobility impairment, cognitive decline, tendon stiffness, cardiac dysfunction, cardiac dysfunction resulting in decreased ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune senescence causing cancer due to decreased immune surveillance, infections due to decreased immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and complications resulting from diabetes including type II diabetes, the pharmaceutical composition according to any one of claims 13 to 16.

26. The pharmaceutical composition according to claim 25, wherein the cardiac dysfunction is at least one selected from the group consisting of cardiac hypertrophy, systolic and / or diastolic dysfunction, and hypertension.

27. The pharmaceutical composition according to claim 25, wherein the complication resulting from diabetes is selected from renal failure, blindness, and neuropathy.

28. The disorder or disease is rheumatoid arthritis, the pharmaceutical composition according to any one of claims 13 to 16.

29. The disorder or disease is heart failure, the pharmaceutical composition according to any one of claims 13 to 16.

30. The disorder or disease is cardiac dysfunction, the pharmaceutical composition according to any one of claims 13 to 16.

31. The disorder or disease is cardiac dysfunction resulting in decreased ejection fraction, the pharmaceutical composition according to any one of claims 13 to 16.

32. The disorder or disease is an infection due to decreased immune function, the pharmaceutical composition according to any one of claims 13 to 16.

33. The disorder or disease is immune senescence, the pharmaceutical composition according to any one of claims 13 to 16.

34. A pharmaceutical composition comprising the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for use in the prevention or treatment of cancer.

35. The cancer is renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, endometrial carcinoma, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or cervical cancer, the pharmaceutical composition according to claim 34.

36. Use of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament.

37. Use of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

38. - Acute or chronic rejection in organ or tissue transplantation, - Transplant vasculopathy, - Intimal hyperplasia, vascular occlusion, atherosclerotic coronary artery disease, proliferation and migration of smooth muscle cells causing restenosis, - Autoimmune diseases and inflammatory conditions, - Asthma, - Multidrug resistance (MDR) state, - Fungal infections, - Inflammation, - Infectious diseases, - Age-related diseases or disorders, - Neurodegenerative diseases, - Proliferative disorders, - Seizures and seizure disorders, - Mitochondrial myopathy and mitochondrial stress, and - Treatable conditions shown to increase the likelihood of age-related diseases Use of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a disorder or disease selected from.

39. The use according to claim 38, wherein the treatable condition shown to increase the likelihood of age-related diseases is a situation with an increase in aging-induced cytokines.

40. The use according to claim 39, wherein the disorder or disease is an age-related disease.

41. The use according to claim 39, wherein the disorder or disease is a proliferative disorder.

42. The use according to claim 39, wherein the disorder or disease is an autoimmune disease or an inflammatory condition.

43. Use of the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a disorder or disease including a process of fibrosis or inflammation.

44. The use according to claim 43, wherein the disorder is selected from liver disorders and kidney disorders.

45. The liver disorder is selected from liver fibrosis, cirrhosis, toxic liver failure, non-alcoholic fatty liver disease or NASH, and alcoholic steatosis, which occur in end-stage liver diseases, the use according to claim 44.

46. The kidney disorder is kidney fibrosis resulting from acute kidney injury, the use according to claim 44.

47. The kidney disorder is chronic kidney disease, the use according to claim 44.

48. The kidney disorder is diabetic nephropathy, the use according to claim 44.

49. The disorder or disease is selected from sarcopenia, skin atrophy, cherry angioma, seborrheic keratosis, brain atrophy or dementia, atherosclerosis, arteriosclerosis, emphysema, osteoporosis, osteoarthritis, hypertension, erectile dysfunction, cataract, macular degeneration, glaucoma, stroke, cerebrovascular disease or stroke, chronic kidney disease, diabetes-related kidney disease, liver dysfunction, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renal tubular disease, hearing loss, mobility impairment, cognitive decline, tendon rigidity, cardiac dysfunction, cardiac dysfunction resulting in reduced ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune senescence causing cancer due to reduced immune surveillance, infections due to reduced immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes including complications resulting from diabetes, the use according to any one of claims 37 to 40.

50. The cardiac dysfunction is at least one selected from the group consisting of cardiac hypertrophy, systolic and / or diastolic dysfunction, and hypertension, the use according to claim 49.

51. The complications resulting from diabetes are selected from renal failure, blindness, and neuropathy, the use according to claim 49.

52. The disorder or disease is rheumatoid arthritis, the use according to any one of claims 37 to 40.

53. The disorder or disease is heart failure, the use according to any one of claims 37 to 40.

54. The disorder or disease is cardiac dysfunction, the use according to any one of claims 37 to 40.

55. The disorder or disease is cardiac dysfunction resulting in reduced ejection fraction, the use according to any one of claims 37 to 40.

56. The disorder or disease is an infection due to reduced immune function, the use according to any one of claims 37 to 40.

57. Use according to any one of claims 37 to 40, wherein the disorder or disease is immune senescence.

58. Use of a compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of cancer.

59. Use of a compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial cancer, uterine corpus cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or cervical cancer.

60. The pharmaceutical composition according to claim 14, wherein the disorder or disease is an autoimmune blood disease.

61. The pharmaceutical composition according to claim 60, wherein the autoimmune blood disease is selected from the group consisting of hemolytic anemia, aplastic anemia, erythroleukemia and idiopathic thrombocytopenic purpura.

62. Use according to claim 38, wherein the disorder or disease is an autoimmune blood disease.

63. Use according to claim 62, wherein the autoimmune blood disease is selected from the group consisting of hemolytic anemia, aplastic anemia, erythroleukemia and idiopathic thrombocytopenic purpura.

Citation Information

Patent Citations

  • Rapamycin derivative

    JP2000510815A

  • Rapamycin derivatives for treating neuroblastoma

    JP2009527520A

  • Rapamycin analogs and uses thereof

    WO2017044720A1