A transgene cassette designed to express the human MECP2 gene

Abstract

The present disclosure provides methods and compositions for treating diseases and genetic disorders associated with loss and / or dysfunction of MeCP2, including Rett syndrome. The methods and compositions of the present disclosure include rAAV vectors and rAAV viral vectors that contain a transgene nucleic acid molecule that includes a nucleic acid sequence encoding an MeCP2 polypeptide.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 944,209, filed December 5, 2019; U.S. Provisional Patent Application No. 62 / 946,696, filed December 11, 2019; U.S. Provisional Patent Application No. 63 / 008,159, filed April 10, 2020; and U.S. Provisional Patent Application No. 63 / 047,596, filed July 2, 2020. The entire content of each of the above - mentioned patent applications is hereby incorporated by reference in its entirety for all purposes.

[0002] Incorporation by Reference of Sequence Listing This application was filed via EFS - Web in ASCII format and includes a sequence listing that is hereby incorporated by reference in its entirety into this specification. The ASCII copy was created on December 4, 2020, named "TAYS - 003_SeqList.txt", and is approximately 18.6 KB in size.

Background Art

[0003] Rett syndrome is caused by mutations in the X - linked MECP2 gene, which encodes a protein (MeCP2) that controls the expression of many genes involved in normal brain function, particularly synapse maintenance. The prevalence of Rett syndrome is 1 in 9000 in girls under 12 years old, while the prevalence in the general population is estimated to be 1 in 30,000. The onset age is about 6 - 18 months. Normal development occurs in the short term, followed by loss of language and intentional hand use, stereotyped hand movements, and gait abnormalities. Further features include deceleration of head growth, seizures, signs of autism, and respiratory abnormalities. Introduction of the MECP2 gene models Rett syndrome (RTT), an X - linked neurodevelopmental disorder - / yIt has been shown to extend the survival of knockout (KO) mice. However, controlling the harmful overexpression of MeCP2 remains an important and unmet obstacle towards a safe and effective gene therapy approach for RTT. There is a need for compositions and methods in the art for the gene therapy treatment of Rett syndrome.

Summary of the Invention

Problems to be Solved by the Invention

[0004] The present disclosure provides an rAAV vector comprising, in the 5' to 3' direction, a) a first AAV ITR sequence, b) a promoter sequence, c) a transgene nucleic acid molecule, d) a control sequence, and e) a second AAV ITR sequence.

Means for Solving the Problems

[0005] The transgene nucleic acid molecule may comprise a nucleic acid sequence encoding a MeCP2-derived polypeptide, wherein the MeCP2-derived polypeptide is a mini-MeCP2 polypeptide. The mini-MeCP2 polypeptide may comprise the amino acid sequence represented by SEQ ID NO: 1. The nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may comprise the nucleic acid sequence represented by SEQ ID NO: 3. The nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may comprise the nucleic acid sequence represented by SEQ ID NO: 28.

[0006] The first AAV ITR sequence may comprise the nucleic acid sequence represented by SEQ ID NO: 18. The second AAV ITR sequence may comprise the nucleic acid sequence represented by SEQ ID NO: 20.

[0007] The promoter sequence may comprise a MeP426 promoter sequence. The MeP426 promoter sequence may comprise the nucleic acid sequence represented by SEQ ID NO: 22.

[0008] The control array may include one or more miRNA binding sites. The miRNA binding sites may include a miR-9-5p miRNA binding site, a miR-26b-5p miRNA binding site, a miR-23a-3p miRNA binding site, a miR-218-5p miRNA binding site, a miR-27a-3p miRNA binding site, a let-7e-5p miRNA binding site, a miR-98-5p miRNA binding site, a let-7d-5p miRNA binding site, a let-7g-5p miRNA binding site, a miR-218-5p miRNA binding site, or any combination thereof.

[0009] The control array may include one or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. The control array may include each of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. The control array may include the nucleic acid sequence represented by SEQ ID NO: 13. The control array may include the nucleic acid sequence represented by SEQ ID NO: 14. The control array may include the nucleic acid sequence represented by SEQ ID NO: 15. The control array may include the nucleic acid sequence represented by SEQ ID NO: 16. The control array may include, in the 5' to 3' direction, i) the nucleic acid sequence represented by SEQ ID NO: 15, ii) the nucleic acid sequence represented by SEQ ID NO: 13, and iii) the nucleic acid sequence represented by SEQ ID NO: 16. The control array may include the nucleic acid sequence represented by SEQ ID NO: 17.

[0010] The present disclosure provides an rAAV vector comprising, in the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) a promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) a transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) a control array comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) a second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20.

[0011] The present disclosure provides an rAAV vector comprising, in the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) a promoter sequence comprising the MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) a transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) a control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) a second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20.

[0012] The present disclosure provides an rAAV viral vector comprising a) any one of the rAAV vectors described herein and b) an AAV capsid protein. The AAV capsid protein may be an AAV1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, or an AAVrh.10 capsid protein. The AAV capsid protein may be an AAV9 capsid protein. The AAV capsid protein may be an AAVPHP.B capsid protein.

[0013] The present disclosure provides a pharmaceutical composition comprising any rAAV viral vector described herein and at least one pharmaceutically acceptable excipient and / or additive.

[0014] The present disclosure provides a method for treating a subject having a disease and / or disorder involving the MECP2 gene, the method comprising administering to the subject at least one therapeutically effective amount of any rAAV viral vector described herein or any pharmaceutical composition described herein. The rAAV viral vector or pharmaceutical composition can be administered to the subject at a dose in the range of about 10 5 to about 10 20 viral vector particles. The rAAV viral vector or pharmaceutical composition can be administered to the subject at a dose in the range of about 10 5 to about 10 15 viral vector particles. The rAAV viral vector or pharmaceutical composition can be administered to the subject intravenously, intrathecally, intracerebrally, intraventricularly, intranasally, intratracheally, intraaurally, intravitreally or periocularly, orally, rectally, transmucosally, by inhalation, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracisternally, intranervally, intrapleurally, locally, intranodally, intracisternally, or intranerve. The rAAV viral vector or pharmaceutical composition can be administered intrathecally. The rAAV viral vector or pharmaceutical composition can be administered intracranially.

[0015] The present disclosure provides any rAAV viral vector described herein or any pharmaceutical composition described herein for use in the treatment of a disease and / or disorder involving the MECP2 gene in a subject in need thereof. The rAAV viral vector or pharmaceutical composition can be for administration to the subject at a dose in the range of about 10 11 to about 10 18 viral vector particles. The rAAV viral vector or pharmaceutical composition can be for administration to the subject at a dose in the range of about 10 5 to about 10 20It may be for administration to a subject in a dosage within the range of viral vector particles. The rAAV viral vector or pharmaceutical composition may be for administration to the subject intravenously, intrathecally, intracerebrally, intraventricularly, intranasally, intratracheally, intraaurally, intravitreally or periocularly, orally, rectally, transmucosally, by inhalation, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracisternally, intraneurally, intrapleurally, locally, intranodally, intracisternally, or intraneurally. The rAAV viral vector or pharmaceutical composition may be for intrathecal administration. The rAAV viral vector or pharmaceutical composition may be for intracranial administration.

[0016] The disease and / or disorder involving the MECP2 gene may be Rett syndrome.

[0017] Any of the above aspects, or any other aspect described herein, can be combined with any other aspect.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this specification, the singular forms include the plural forms unless the context clearly dictates otherwise. For example, the terms "a" and "the" are understood to be singular or plural, and the term "or" is understood to be inclusive. By way of example, "an element" means one or more elements. Throughout the specification, variations such as the terms "comprising", "comprises" or "comprising" mean the described element, integer, or step, or group of elements, integers, or steps, but do not exclude any other element, integer, or step, or group of elements, integers, or steps. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the described value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about".

[0019] Methods and materials similar or equivalent to those described in this specification can be used in the practice or testing of the present disclosure, but the preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this specification are incorporated by reference in their entirety. The references cited in this specification are not admitted to be prior art to the claimed invention. In case of conflict, this specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the present disclosure will become apparent from the following detailed description and claims.

[0020] The above and further features will be more clearly understood from the following detailed description when taken in conjunction with the accompanying drawings.

Brief Description of the Drawings

[0021]

Figure 1A

Figure 1B

Figure 1C

Figure 2A

Figure 2B

Figure 2C

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 3E

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 4E

Figure 5

Figure 6A

Figure 6B

Figure 7A

Figure 7B

Figure 8A

Figure 8B

Figure 8C

Figure 8D

Figure 9

Mode for Carrying Out the Invention

[0022] The present disclosure provides, among other things, isolated polynucleotides comprising transgene nucleic acid molecules comprising nucleic acid sequences encoding MeCP2 and / or MeCP2-derived polypeptides, recombinant adeno-associated virus (rAAV) vectors, and rAAV viral vectors. The present disclosure also provides methods for manufacturing these isolated polynucleotides, rAAV vectors, and rAAV viral vectors, and their use for delivering a transgene for treating or preventing a disease or disorder, including a disease associated with loss and / or dysfunction of the MECP2 gene.

[0023] To minimize the potential for overexpression of transgenes associated with Rett syndrome gene therapy and other dosage-sensitive gene therapies, a risk-driven viral genome design strategy based on high-throughput profiling and genome mining was used to rationally develop a compact synthetic miRNA target panel (miR-responsive self-regulatory element, "miRARE"). Insertion of the miRARE into the mini-MECP2 gene expression cassette greatly improves the safety of the introduction of the mini-MECP2 gene without sacrificing efficiency. Importantly, this built-in control system does not require the application of any additional exogenous drugs, and the miRNA is not expressed from the transgene cassette.

[0024] One strategy to improve the efficiency of AAV9-mediated gene delivery is to pair the AAV9 capsid with a self-complementary (sc) viral genome. Compared to single-stranded AAV (ssAAV), self-complementary AAV (scAAV) has a smaller packaging capacity for viral genomes (about 2.2 kb), but has the ability to bypass rate-limiting second-strand synthesis in host cells, enabling more efficient transduction. Since the approximately 1.5 kb MECP2 gene limits the size of the 5' and 3' control elements included in the viral genome cassette, the reduced packaging capacity of scAAV is important for guiding the design of the MECP2 viral genome. The therapeutic mini-MECP2 gene (about 0.5 kb) liberates additional space within the sc viral genome for inserting novel control elements to improve the therapeutic index of RTT gene therapy.

[0025] AAV9 / MECP2 and mini-MECP2 gene therapies have been shown to extend the survival of KO mice. In KO mice administered neonatally, there are few significant side effects and benefits in survival and behavior are realized. However, when mice were treated at 4 - 5 weeks of age, which is more relevant for translation to humans, the survival benefit was accompanied by significant side effects (including death) and a lack of clear behavioral rescue. Furthermore, this lack of clear behavioral rescue (associated with AAV9-mediated gene delivery) was observed in both KO mice treated in juvenile age and T158M MeCP2-expressing RTT mice. Since high doses of AAV9 / EGFP (not AAV9 / MECP2) in the CSF are well tolerated in WT mice, these dose-dependent side effects are most likely directly due to overexpression of MeCP2. After years of repeated full factor evaluations of candidate MECP2 vectors, this field still struggles with the same dilemmas predicted from studies of MeCP2 overexpression dating back 16 years. High-dose vectors encoding MeCP2 can be harmful, and low doses may be ineffective. Clearly, this persistent dilemma justifies innovative viral genome design strategies that enable efficiency without sacrificing safety.

[0026] In this specification, compositions and methods are provided for preventing toxicity associated with overexpression of a gene by inserting miRNA targets into the 3' untranslated region (UTR) of a viral genome. Endogenous miRNAs can base pair with targets in messenger RNA (mRNA) encoded by the viral genome and ultimately reduce the protein expression level by RNA interference (RNAi). A panel of miRNA targets is provided for conditional control of exogenous genes such as MECP2 in systems such as the CNS. These target panels mitigate the deleterious overexpression of genes and expression cassettes such as mini-MECP2, while allowing sufficient transgene expression to exert a therapeutic effect similar to or greater than that of a control vector such as an MECP2 or mini-MECP2 control vector. To control the expression of genes and expression cassettes (e.g., expression of mini-MeCP2), a risk-driven viral genome design strategy based on high-throughput profiling and genome mining was used to develop a novel panel of miRNA targets (miR-responsive self-regulatory elements, or "miRARE"). A feedback mechanism of negative transgene control involved in overexpression of a gene (e.g., overexpression of MeCP2). The data described herein show that miRARE improves the safety of scAAV9 / mini-MECP2 gene therapy without sacrificing efficiency after intracerebrospinal fluid (CSF) injection in juvenile mice.

[0027] As used herein, the term "adeno-associated virus" or "AAV" refers to a class of viruses that are associated with this name and are members of the genus Dependoparvovirus of the Parvoviridae family. Adeno-associated virus is a single-stranded DNA virus that replicates in cells, and certain functions thereof are provided by a co-infecting helper virus. General information and reviews on AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Volume 1, pages 169-228 and Berns, 1990, Virology, pages 1743-1764, Raven Press (New York). Since it is well known that various serotypes are very closely related both structurally and functionally at the genetic level, it is fully expected that the same principles described in these reviews are applicable to additional AAV serotypes that have been characterized since the date of publication of the reviews (see, for example, Blacklowe, 1988, Parvoviruses and Human Disease, edited by J.R. Pattison, pages 165-174, and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes exhibit very similar replication properties mediated by the homologous rep gene and all have three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by extensive cross-hybridization among serotypes along the length of the genome and by heteroduplex analysis that reveals the presence of similar self-annealing segments at the termini corresponding to the "inverted terminal repeat sequences" (ITRs). Similar infectious patterns also suggest that the replication functions in each serotype are under similar regulatory controls. A number of serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells of various tissue types. At least 11 AAV serotypes numbered consecutively are known in the art.Non-limiting exemplary serotypes useful in the methods disclosed herein include 11 serotypes, such as AAV2, AAV8, AAV9, or variant serotypes, such as either AAV-DJ and AAV PHP.B. The AAV particles contain, consist essentially of, or consist of three major viral proteins, namely VP1, VP2, and VP3. In some embodiments, AAV refers to serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVPHP.B, AAVrh74, or AAVrh.10.

[0028] Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, all serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVPHP.B, AAVrh74, and AAVrh.10). Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, self-complementary AAV (scAAV) and AAV hybrids that contain the genome of one serotype and the capsid of another serotype (e.g., AAV2 / 5, AAV-DJ, and AAV-DJ8). Exemplary adeno-associated viruses and recombinant adeno-associated viruses include, but are not limited to, rAAV-LK03, AAV-KP-1 (described in detail in Kerun et al. JCI Insight, 2019;4(22):e131610) and AAV-NP59 (described in detail in Paulk et al. Molecular Therapy, 2018;26(1):289-303).

[0029] The Structure and Function of AAV AAV is a replication-deficient parvovirus, and its single-stranded DNA genome is about 4.7 kb in length and contains two 145-nucleotide inverted terminal repeats (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided by GenBank accession number NC_002077, the complete genome of AAV-2 is provided by GenBank accession numbers NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is provided by GenBank accession number NC_l829, the complete genome of AAV-4 is provided by GenBank accession number NC_001829, the AAV-5 genome is provided by GenBank accession number AF085716, the complete genome of AAV-6 is provided by GenBank accession number NC_001862, at least a part of the genomes of AAV-7 and AAV-8 are provided by GenBank accession numbers AX753246 and AX753249, respectively, the genome of AAV-9 is provided by Gao et al., J. Virol., 78:6381-6388 (2004), the genome of AAV-10 is provided by Mol. Ther., 13(1):67-76 (2006), and the genome of AAV-11 is provided by Virology, 330(2):375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928. U.S. Patent No. 9,434,928 also provides the sequences of the capsid protein and the self-complementary genome. In one aspect, the AAV genome is a self-complementary genome. The cis-acting sequences that direct viral DNA replication (rep), capsid encapsidation / packaging, and integration into the host cell chromosome are contained within the AAV ITRs. Three AAV promoters (designated p5, p19, and p40 by their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes.Two rep promoters (p5 and p19), integrated with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins ultimately have a variety of enzymatic properties involved in viral genome replication.

[0030] The cap gene is expressed from the p40 promoter and encodes three capsid proteins, namely VP1, VP2, and VP3. Alternative splicing and non-consensus translation start sites are involved in the production of these three related capsid proteins. More specifically, after a single mRNA from which each of the VP1, VP2, and VP3 proteins is then translated is transcribed, this mRNA can be spliced in two different ways. Removal of the long intron or the short intron results in the formation of two pools of mRNA, namely mRNA pools of 2.3 kb and 2.6 kb in length. The long intron is often preferred, and thus the 2.3 kb-long mRNA can be termed the major splice variant. This form lacks the first AUG codon from which the synthesis of the VP1 protein then begins, resulting in a decrease in the overall level of VP1 protein synthesis. The first AUG codon remaining in the major splice variant is the start codon of the VP3 protein. However, upstream of that codon in the same open reading frame, there is an ACG sequence (encoding threonine) surrounded by an optimal Kozak (translation initiation) context. This contributes to the low level of synthesis of the VP2 protein.The VP2 protein is, in fact, like the VP1 protein, one with an N-terminal residue added to the VP3 protein, as described in Becerra SP et al., (December 1985). "Direct mapping of adeno-associated virus capsid proteins B and C: a possible ACG initiation codon". Proceedings of the National Academy of Sciences of the United States of America. 82(23):7919-7923; Cassinotti P et al., (November 1988). "Organization of the adeno-associated virus (AAV) capsid gene: mapping of a minor spliced mRNA coding for virus capsid protein 1". Virology. 167(1):176-184; Muralidhar S et al., (January 1994). "Site-directed mutagenesis of adeno-associated virus type 2 structural protein initiation codons: effects on regulation of synthesis and biological activity". Journal of Virology. 68(1):170-176; and Trempe JP, Carter BJ (September 1988). "Alternate mRNA splicing is required for synthesis of adeno-associated virus VP1 capsid protein". Journal of Virology. 62(9):3356-3363, each of which is incorporated herein by reference. A single consensus polyA site is located at map position 95 of the AAV genome. The life cycle and genetic characteristics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0031] Each VP1 protein contains a VP1 portion, a VP2 portion, and a VP3 portion. The VP1 portion is the N-terminal portion of the VP1 protein that is specific to the VP1 protein. The VP2 portion is an amino acid sequence present in the VP1 protein that is also found in the N-terminal portion of the VP2 protein. The VP3 portion and the VP3 protein have the same sequence. The VP3 portion is the C-terminal portion of the VP1 protein that is shared by the VP1 protein and the VP2 protein.

[0032] The VP3 protein can be further divided into discontinuous variable surface regions I to IX (VR-I to IX). Each of the variable surface regions (VRs) can confer a unique infection phenotype (e.g., reduced antigenicity, improved transduction, and / or tissue-specific tropism compared to other AAV serotypes) to a specific serotype, either alone or in combination with specific amino acid sequences of each of the other VRs, as described in DiMatta et al., "Structural Insight into the Unique Properties of Adeno-Associated Virus Serotype 9" J. Virol., Vol. 86(12):6947 - 6958, June 2012, the content of which is incorporated herein by reference.

[0033] AAV has unique features that make it attractive as a vector for delivering foreign DNA into cells, for example, in gene therapy. AAV infection of cells in culture does not cause cytopathic effects, and natural infection in humans and other animals is asymptomatic. Furthermore, AAV can infect many mammalian cells and target many different tissues in vivo. Additionally, AAV can slowly transduce both dividing and non-dividing cells and can persist as a transcriptionally active nuclear episome (extrachromosomal element) for substantially the lifetime of these cells. The AAV proviral genome can be inserted into a plasmid as cloned DNA, enabling the construction of recombinant genomes. Moreover, since signals that direct AAV replication and genomic encapsidation are contained within the ITRs of the AAV genome, part or all of the approximately 4.3 kb portion inside the genome (encoding the replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA to generate an AAV vector. The rep and cap proteins can be provided in trans. Another notable feature of AAV is that it is a very stable and robust virus. It can easily withstand the conditions (56 - 65 °C for several hours) used to inactivate adenovirus, rendering the problem of cryopreservation of AAV unimportant. AAV can even be lyophilized. Finally, cells infected with AAV are not resistant to superinfection.

[0034] Numerous studies have demonstrated long-term (greater than 1.5 years) recombinant AAV-mediated protein expression in muscle. See Clark et al., Hum Gene Ther, 8:659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93:14082-14087 (1996); and Xiao et al., J Virol, 70:8098-8108 (1996). See also Chao et al., Mol Ther, 2:619-623 (2000) and Chao et al., Mol Ther, 4:217-222 (2001). Furthermore, because muscle is highly angiogenic, as described in Herzog et al., Proc Natl Acad Sci USA, 94:5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94:13921-13926 (1997), recombinant AAV transduction resulted in the appearance of transgene products in the systemic circulation after intramuscular injection. Additionally, Lewis et al., J Virol, 76:8769-8775 (2002) demonstrated that skeletal muscle myofibers have the cellular factors necessary for proper glycosylation, folding, and secretion of antibodies, indicating that muscle can stably express secreted protein therapeutics. The recombinant AAV (rAAV) genome of the present invention comprises, consists essentially of, or consists of a nucleic acid molecule encoding a therapeutic protein (e.g., GAT1) and one or more AAV ITRs flanking the nucleic acid molecule. The production of pseudotyped rAAV is disclosed, for example, in WO2001083692. Other types of rAAV variants, such as rAAV having capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0035] Isolated polynucleotide comprising a transgene sequence The present disclosure provides an isolated polynucleotide comprising at least one transgene nucleic acid molecule.

[0036] In some embodiments, the transgene nucleic acid molecule may comprise a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, or at least one fragment thereof. In some embodiments, the transgene nucleic acid molecule may comprise a nucleic acid sequence encoding a biological equivalent of a MeCP2 polypeptide and / or a MeCP2-derived polypeptide. The MeCP2-derived polypeptide may be a polypeptide specifically designed based on the wild-type MeCP2 polypeptide such that it contains only the domains that are absolutely essential for function. Thus, the MeCP2-derived polypeptide can be smaller than the endogenous wild-type MeCP2 polypeptide, and in particular, it results in an increased ability to be efficiently packaged into vectors with in vivo expression and size constraints specific thereto (such as, but not limited to, AAV vectors, etc.).

[0037] In some embodiments, the MeCP2-derived polypeptide may be a mini-MeCP2 polypeptide derived from a human MeCP2 isoform, hereinafter referred to as the "mini-MeCP2" polypeptide.

[0038] In some embodiments, the mini-MeCP2 polypeptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, or a fragment thereof. In some embodiments, the mini-MeCP2 polypeptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to at least a portion of the amino acid sequence represented by SEQ ID NO: 1, or a fragment thereof.

[0039] In some embodiments, the nucleic acid sequence encoding the mini MeCP2 polypeptide comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28. In some embodiments, the nucleic acid sequence encoding the mini MeCP2 polypeptide comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 3. In some embodiments, the nucleic acid sequence encoding the mini MeCP2 polypeptide comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 28.

[0040] In some embodiments, the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may be a codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide. The codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide may comprise, consist essentially of, or consist of a nucleic acid sequence that is not more than 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (or any percentage therebetween) identical to the wild-type human nucleic acid sequence encoding the MeCP2 polypeptide. As used herein, "wild-type human nucleic acid sequence encoding the MeCP2 polypeptide" refers to the nucleic acid sequence encoding the MECP2 polypeptide in the human genome.

[0041] In some embodiments, the codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may not contain a donor splice site. In some embodiments, the codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may contain about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or not more than about 10 donor splice sites. In some embodiments, the codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide contains at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 fewer donor splice sites compared to the wild-type human nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide. Without wishing to be bound by theory, removal of the donor splice site in the codon-optimized nucleic acid sequence can unexpectedly and unpredictably increase the expression of the MeCP2 polypeptide and / or the MeCP2-derived polypeptide in vivo because ambiguous splicing is prevented. Furthermore, ambiguous splicing can vary among different subjects, meaning that the expression levels of the MeCP2 polypeptide and / or the MeCP2-derived polypeptide containing a donor splice site can vary unexpectedly among different subjects.

[0042] In some embodiments, a codon-optimized nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide may have a GC content that is different from the GC content of the wild-type human nucleic acid sequence encoding the MeCP2 polypeptide. In some embodiments, the GC content of the codon-optimized nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide is more uniformly distributed across the nucleic acid sequence as compared to the wild-type human nucleic acid sequence encoding the MeCP2 polypeptide. Without wishing to be bound by theory, by more uniformly distributing the GC content across the nucleic acid sequence, the codon-optimized nucleic acid sequence exhibits a more uniform melting temperature (“Tm”) over the length of the transcript. Since transcription and / or translation of the nucleic acid sequence occurs with less polymerase and / or ribosome stalling, the uniformity of the melting temperature unexpectedly results in increased expression of the codon-optimized nucleic acid in a human subject.

[0043] In some embodiments, a codon-optimized nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased expression in a human subject as compared to the wild-type or non-codon-optimized nucleic acid sequence encoding the MeCP2 polypeptide.

[0044] In some embodiments, the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may further comprise a protein tag. Without wishing to be bound by theory, inclusion of the protein tag enables detection and / or visualization of the exogenous MeCP2 polypeptide. As will be recognized by those of skill in the art, non-limiting examples of protein tags include Myc tag, polyhistidine tag, FLAG tag, HA tag, SBP tag, or any other tag known in the art. In a non-limiting example, the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may further comprise a Myc tag. In some embodiments, the Myc tag comprises, consists essentially of, or consists of an amino acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the amino acid sequence represented by SEQ ID NO: 5.

[0045] Accordingly, in some embodiments, the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide may further comprise a nucleic acid sequence encoding a myc tag. In some embodiments, the nucleic acid sequence encoding a myc tag comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 6.

[0046] Isolated polynucleotide encoding a control sequence The present disclosure provides an isolated polynucleotide comprising at least one control sequence.

[0047] In some embodiments, the control array may comprise, consist essentially of, or consist of at least one miRNA binding site. An "miRNA binding site" is a polynucleotide sequence having complementarity to the sequence of an miRNA sufficient to ensure annealing of the miRNA to the polynucleotide of interest and subsequent downregulation of the transgene.

[0048] In some embodiments, the miRNA binding site comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by any one of SEQ ID NOs: 7, 8, 9, 10, 11, and 12 shown in Table 1.

[0049]

Table 1

[0050] In some embodiments, the control array may comprise, consist essentially of, or consist of at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 miRNA binding sites. In some embodiments, the control array may comprise, consist of, or consist essentially of each of the miRNA binding sites represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. Thus, in some embodiments, the control array may comprise one or more, or any combination thereof, of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. In some embodiments, the control array may comprise each of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.

[0051] In some embodiments, the miRNA binding site may be located adjacent to the flanking sequence. The flanking sequence can occur before (5') the miRNA binding site, after (3') the miRNA binding site, or both before and after the miRNA binding site. The flanking sequence may contain from about 5 to about 35 nucleotides or from about 9 to about 29 nucleotides.

[0052] As used herein, a control sequence referred to as a "Reg2 sequence" or "Reg2 panel" is provided. In some embodiments, the Reg2 sequence may contain six binding sites predicted to bind to let-7-5p miRNA (or miR-98-5p), miR-218-5p, miR-9-5p, miR-26-5p, miR-23-3p, miR-27-3p, or other miRNAs having a seed sequence similar to the miRNAs described herein.

[0053] In some embodiments, the Reg2 sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 13. SEQ ID NO: 13 is shown below, with the miRNA binding sites of SEQ ID NOs: 7-12 underlined. The non-underlined portion of SEQ ID NO: 13 is the flanking sequence. CTGTTCTAGCCC CCAAAGA GTTTTCTGTGCTTGCTTTTGAA ACTTGAA GTCTTGAAAACCAAAGACATAG ATGTGAA AATTTTAGGCAGTGTAAGCTGAT AGCACAA GTTCTGGCGACTCACAATTATG CTGTGAA TTTTACAAAAAGAAGCAGTAAT CTACCTCA GCCGATAAC (SEQ ID NO: 13)

[0054] In some embodiments, the Reg2 array comprises, consists essentially of, or consists of a nucleic acid sequence comprising one or more or any combination of SEQ ID NOs: 7, 8, 9, 10, 11, and 12. In some embodiments, the flanking sequences are not limited to the sequence shown in SEQ ID NO: 8 and may vary widely and are not particularly limited. Thus, in one embodiment, the Reg2 array comprises a polypeptide having one or more of SEQ ID NOs: 7-12 separated by about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or more flank nucleotides (i.e., occurring before (5') and after (3') each binding site) where its sequence is not particularly limited. In some embodiments, the Reg2 array comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to a nucleic acid sequence represented by any one of SEQ ID NOs: 15, 16, 17, 18, 19, and 20. In one embodiment, the Reg2 array comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the flanking sequence shown in SEQ ID NO: 8 (i.e., the polynucleotide not underlined shown above).

[0055] In some embodiments, the control array comprises, consists essentially of, or consists of an RDH1pA element. The RDH1pA element is a synthetic 3’UTR that includes a 110bp highly conserved MECP2 distal polyadenylation signal and an upstream miRNA binding panel that includes sites for three additional miRNA targets predicted or shown to be endogenous to the 3’UTR of MECP2, namely miR-19, miR-22, and miR-132. In some embodiments, the RDH1pA element sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 14.

[0056] In some embodiments, the RDH1pA element of SEQ ID NO: 14 can be separated into two components: a first component, hereinafter referred to as the “RDH1pA miRNA binding site sequence,” and a second component, hereinafter referred to as the “MECP2 downstream polyA (pA) sequence” herein.

[0057] In some embodiments, the RDH1pA miRNA binding site sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 15.

[0058] In some embodiments, the MECP2 downstream polyA (pA) sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 16.

[0059] In some embodiments, the control array can include both the Reg2 array and the RDH1pA element. In some embodiments, the Reg2 array can be located between the first component of the RDH1pA element (the RDH1pA miRNA binding site sequence) and the second component of RDH1pA (the MECP2 downstream polyA (pA) sequence). The Reg2 array can be directly adjacent to one or both of the components of the RDH1pA element, or can be separated from one or both of the components of the RDH1pA element by about 2 to 10 nucleotides.

[0060] Thus, the control array can include, in the 5' to 3' direction, SEQ ID NO: 15, followed by SEQ ID NO: 13, followed by SEQ ID NO: 16. Such a control array can include a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to, consisting essentially of, or consisting of the nucleic acid sequence represented by SEQ ID NO: 17.

[0061] AAV vector In some embodiments, the isolated polynucleotide comprising at least one transgene nucleic acid molecule described herein can be a recombinant AAV (rAAV) vector.

[0062] As used herein, the term "vector" refers to a nucleic acid that contains, consists essentially of, or consists of an original replicon, whereby the vector, when introduced into a cell, is replicated, for example, by a process of transfection, infection, or transformation. It is understood in the art that once inside the cell, the vector can replicate as an extrachromosomal (episomal) element or integrate into the host cell's chromosome. Vectors can include nucleic acids derived from retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papovaviruses, or other modified naturally occurring viruses. Exemplary non-viral vectors for delivering nucleic acids include naked DNA, complexes of DNA with cationic lipids alone or in combination with cationic polymers, anionic and cationic liposomes, DNA-protein complexes, and particles that contain, consist essentially of, or consist of DNA condensed with cationic polymers such as heterogeneous polylysine, defined-length oligopeptides, and polyethyleneimine, and in some cases encapsulated in liposomes, as well as the use of ternary complexes that contain, consist essentially of, or consist of viruses and polylysine-DNA.

[0063] Regarding common recombinant techniques, vectors containing both a promoter and a cloning site into which a polynucleotide can be operably linked are well known in the art. Such vectors can transcribe RNA in vitro or in vivo and are commercially available from suppliers such as Agilent Technologies (Santa Clara, Calif) and Promega Biotech (Madison, Wis.). To optimize expression and / or transcription in vitro, it may be necessary to remove, add, or alter the untranslated portions at the 5' and / or 3' of the cloned transgene to eliminate extra and potentially inappropriate alternative translation initiation codons or other sequences that could interfere with or reduce expression at the level of transcription or translation. Alternatively, to enhance expression, a consensus ribosome binding site can be inserted immediately adjacent to the 5' of the initiation codon.

[0064] As used herein, an "rAAV vector" refers to a vector that contains, consists essentially of, or consists of one or more transgene nucleic acid molecules and one or more AAV inverted terminal repeat sequences (ITRs). Such AAV vectors can replicate and package into infectious virus particles that, when present in a host cell, provide the functions of the rep and cap gene products, for example, by transfection of the host cell. In some embodiments, the AAV vector contains a promoter, at least one nucleic acid that can encode at least one protein or RNA, and / or an enhancer and / or terminator in the lateral ITRs packaged into the infectious AAV particles. The nucleic acid portion encapsulated by the capsid can be referred to as the AAV vector genome. A plasmid containing an rAAV vector may contain elements for manufacturing purposes, such as an antibiotic resistance gene, a sequence of an origin of replication, and others, but these are not encapsulated by the capsid and thus do not form part of the AAV particles.

[0065] In some embodiments, the rAAV vector may comprise at least one transgene nucleic acid molecule. In some embodiments, the rAAV vector may comprise at least one control sequence. In some embodiments, the rAAV vector may comprise at least one AAV inverted terminal (ITR) sequence. In some embodiments, the rAAV vector may comprise at least one promoter sequence. In some embodiments, the rAAV vector may comprise at least one enhancer sequence. In some embodiments, the rAAV vector may comprise at least one polyA sequence.

[0066] In some embodiments, the rAAV vector may comprise a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, a control sequence, and a second AAV ITR sequence. In some embodiments, the rAAV vector may comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, a control sequence, and a second AAV ITR sequence.

[0067] In some embodiments, the rAAV vector may comprise two or more transgene nucleic acid molecules. In some embodiments, the rAAV vector may comprise at least two transgene nucleic acid molecules, whereby the rAAV vector comprises a first transgene nucleic acid molecule and at least a second transgene nucleic acid molecule. In some embodiments, the first and at least the second transgene nucleic acid molecules may comprise the same nucleic acid sequence. In some embodiments, the first and at least the second transgene nucleic acid molecules may comprise different nucleic acid sequences. In some embodiments, the first and at least the second transgene nucleic acid sequences may be adjacent to each other.

[0068] In some embodiments, the rAAV vector can include two or more promoter sequences. In some embodiments, the rAAV vector can include at least two promoter sequences, whereby the rAAV vector includes a first promoter sequence and at least a second promoter sequence. In some embodiments, the first and at least the second promoter sequences can include the same sequence. In some embodiments, the first and at least the second promoter sequences can include different sequences. In some embodiments, the first and at least the second promoter sequences can be adjacent to each other. In some embodiments in which the rAAV vector also includes a first transgene nucleic acid molecule and at least a second transgene nucleic acid molecule, the first promoter can be located upstream (5') of the first transgene nucleic acid molecule, and at least the second promoter can be located between the first transgene nucleic acid molecule and the at least second transgene nucleic acid molecule, whereby at least the second promoter is located downstream (3') of the first transgene nucleic acid molecule and upstream (5') of the at least second transgene nucleic acid molecule.

[0069] Any of the preceding rAAV vectors may further comprise at least one enhancer. The at least one enhancer may be located at any location of the rAAV vector. In some embodiments, the at least one enhancer may be located immediately upstream (5’) of the promoter. That is, the rAAV vector may comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, an enhancer, a promoter sequence, a transgene nucleic acid molecule, a control sequence, and a second AAV ITR sequence. In some embodiments, the at least one enhancer may be located immediately downstream (3’) of the promoter. That is, the rAAV vector may comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, an enhancer, a transgene nucleic acid molecule, a control sequence, and a second AAV ITR sequence. In some embodiments, the at least one enhancer may be located immediately downstream of the transgene nucleic acid molecule. That is, the rAAV vector may comprise, in the 5’ to 3’ direction, a first AAV ITR sequence, a promoter sequence, a transgene nucleic acid molecule, an enhancer, a control sequence, and a second AAV ITR sequence.

[0070] AAV ITR sequence In some embodiments, the AAV ITR sequence may comprise any AAV ITR sequence known in the art. In some embodiments, the AAV ITR sequence may be an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV10 ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, an AAVrh74 ITR sequence, or an AAVrh.10 ITR sequence.

[0071] That is, in some embodiments, the AAV ITR sequence may comprise, consist essentially of, or consist of the AAV1 ITR sequence, AAV2 ITR sequence, AAV4 ITR sequence, AAV5 ITR sequence, AAV6 ITR sequence, AAV7 ITR sequence, AAV8 ITR sequence, AAV9 ITR sequence, AAV10 ITR sequence, AAV11 ITR sequence, AAV12 ITR sequence, AAV13 ITR sequence, AAVrh74 ITR sequence, or AAVrh.10 ITR sequence.

[0072] In some embodiments, the AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 18, 19, or 30.

[0073] In some embodiments, the AAV ITR may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to the nucleic acid sequence represented by SEQ ID NO: 20 or 21.

[0074] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 18, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 20.

[0075] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 19, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 21.

[0076] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 18, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 21.

[0077] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 19, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 20.

[0078] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 30, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 20.

[0079] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 30, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 21.

[0080] Promoter sequences and enhancers As used herein, the terms "promoter" and "promoter sequence" mean regulatory sequences that are regions of polynucleotide sequences that control the initiation and rate of transcription of coding sequences such as genes or transgenes. Promoters can be, for example, constitutive, inducible, repressible, or tissue-specific. A promoter can include genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind. Non-limiting exemplary promoters include the Rous sarcoma virus (RSV) LTR promoter (optionally together with the RSV enhancer), the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerate kinase (PGK) promoter, the U6 promoter, the H1 promoter, the ubiquitous chicken β-actin hybrid (CBh) promoter, the small nuclear RNA (U1a or U1b) promoter, the MECP2 promoter, the MeP426 promoter, the human variant of the MeP426 promoter, the minimal MECP2 promoter, the VMD2 promoter, the mRho promoter, or the EF1 promoter.

[0081] Additional non-limiting exemplary promoters provided herein include, but are not limited to, EF1a, Ubc, human β-actin, CAG, TRE, Ac5, polyhedrin, CaMKIIa, Gal1, TEF1, GDS, ADH1, Ubi, and α-1-antitrypsin (hAAT). It is known in the art that the nucleotide sequences of such promoters can be modified to increase or decrease the efficiency of mRNA transcription. See, for example, Gao et al. (2018) Mol. Ther.: Nucleic Acids 12:135-145 (modifying the TATA box of the 7SK, U6, and H1 promoters to ablate RNA polymerase III transcription and stimulate RNA polymerase II-dependent mRNA transcription). Synthetically derived promoters may be used for ubiquitous or tissue-specific expression. Additionally, some of the viral-derived promoters mentioned above, such as those of CMV, HIV, adenovirus, and AAV, may be useful in the methods described herein. In some embodiments, the promoter is used with at least one enhancer to increase transcription efficiency. Non-limiting examples of enhancers include the interstitial retinoid-binding protein (IRBP) enhancer, the RSV enhancer, or the CMV enhancer.

[0082] In some embodiments, the promoter array comprises, consists essentially of, or consists of the Rous sarcoma virus (RSV) LTR promoter array (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter array, the SV40 promoter array, the dihydrofolate reductase promoter array, the β-actin promoter array, the phosphoglycerol kinase (PGK) promoter array, the U6 promoter array, the H1 promoter array, the ubiquitous chicken β-actin hybrid (CBh) promoter array, the small nuclear RNA (U1a or U1b) promoter array, the MECP2 promoter array, the MeP426 promoter array, the minimal MECP2 promoter array, the VMD2 promoter array, the mRho promoter array, the EF1 promoter array, the EF1a promoter array, the Ubc promoter array, the human β-actin promoter array, the CAG promoter array, the TRE promoter array, the Ac5 promoter array, the polyhedrin promoter array, the CaMKIIa promoter array, the Gal1 promoter array, the TEF1 promoter array, the GDS promoter array, the ADH1 promoter array, the Ubi promoter array, the MeP426 promoter, or the α-1-antitrypsin (hAAT) promoter array.

[0083] An enhancer is a control element that increases the expression of a target sequence. A "promoter / enhancer" is a polynucleotide that contains a sequence capable of providing both promoter and enhancer functions. For example, the long terminal repeat of a retrovirus contains both promoter and enhancer functions. An enhancer / promoter can be "endogenous" or "exogenous" or "heterologous". An "endogenous" enhancer / promoter is an enhancer / promoter that is naturally linked to a given gene within the genome. An "exogenous" or "heterologous" enhancer / promoter is an enhancer / promoter that is juxtaposed to a gene by means of genetic manipulation (i.e., molecular biological techniques) or synthetic techniques, whereby the transcription of that gene is directed by the linked enhancer / promoter. Non-limiting examples of linked enhancer / promoters for use in the methods, compositions, and constructs provided herein include the PDE promoter plus the IRBP enhancer, or the CMV enhancer plus the U1a promoter. It is understood in the art that enhancers can act from a distance and regardless of their orientation relative to the position of an endogenous or heterologous promoter. That is, an enhancer that acts away from a promoter is further understood to be "operably linked" to that promoter regardless of its position in the vector or its orientation relative to the position of the promoter.

[0084] As used throughout this disclosure, the term "operably linked" refers to the expression of a gene (i.e., transgene) that is under the control of a spatially linked promoter. The promoter can be located 5' (upstream) or 3' (downstream) of the gene under its control. The promoter can be located 5' (upstream) of the gene under its control. The distance between the promoter and the gene can be approximately the same as the distance between the promoter and the gene that the promoter controls within the gene from which the promoter was derived. Variations in the distance between the promoter and the gene can be accommodated without loss of promoter function.

[0085] In some embodiments, the promoter sequence may comprise, consist essentially of, or consist of the MeP426 promoter sequence. The MeP426 promoter sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 22.

[0086] In some embodiments, the promoter sequence may comprise, consist essentially of, or consist of the JeT promoter sequence. The Jet promoter sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 23.

[0087] In some embodiments, the promoter sequence may comprise, consist essentially of, or consist of the MeP229 promoter sequence. The MeP229 promoter sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 24.

[0088] In some embodiments, the promoter sequence may comprise, consist essentially of, or consist of the CBh promoter sequence. The CBh promoter sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO: 25.

[0089] Transgene nucleic acid molecule The transgene nucleic acid molecule comprises, consists essentially of, or consists of any of the transgene nucleic acid molecules described under the heading "Isolated Polynucleotide Comprising a Transgene Sequence" above.

[0090] In some embodiments, the transgene nucleic acid molecule present in the rAAV vector can be under the transcriptional control of a promoter sequence also present in the same rAAV vector.

[0091] Control sequence The control can comprise, consist essentially of, or consist of any of the sequences described under the heading "Isolated Polynucleotide Encoding a Control Sequence" above.

[0092] PolyA sequence In some embodiments, the polyadenylation (polyA) sequence can include any polyA sequence known in the art. Non-limiting examples of polyA sequences include, but are not limited to, the MECP2 polyA sequence, the retinol dehydrogenase 1 (RDH1) polyA sequence, the bovine growth hormone (BGH) polyA sequence, the SV40 polyA sequence, the SPA49 polyA sequence, the sNRP-TK65 polyA sequence, the sNRP polyA sequence, or the TK65 polyA sequence.

[0093] That is, the polyA sequence can comprise, consist essentially of, or consist of the MeCP2 polyA sequence, the retinol dehydrogenase 1 (RDH1) polyA sequence, the bovine growth hormone (BGH) polyA sequence, the SV40 polyA sequence, the SPA49 polyA sequence, the sNRP-TK65 polyA sequence, the sNRP polyA sequence, or the TK65 polyA sequence.

[0094] In some embodiments, the MECP2 polyA sequence can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to any of the sequences represented by SEQ ID NO: 16.

[0095] In some embodiments, the polyA sequence may comprise, consist essentially of, or consist of the SV40pA sequence. In some embodiments, the SV40pA sequence may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to any of the sequences represented by SEQ ID NO: 26.

[0096] In some embodiments, the rAAV vector of the present disclosure may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to any of the sequences represented by SEQ ID NO: 27 or SEQ ID NO: 29.

[0097] Bacterial plasmid In some embodiments, the rAAV vector of the present disclosure may be included in a bacterial plasmid to enable the growth of the rAAV vector in vitro. That is, the present disclosure provides a bacterial plasmid comprising any of the rAAV vectors described herein. The bacterial plasmid may further comprise a sequence of an origin of replication. The bacterial plasmid may further comprise an antibiotic resistance gene. The bacterial plasmid may further comprise a prokaryotic promoter.

[0098] Sequence of origin of replication In some embodiments, the sequence of the origin of replication may comprise, consist essentially of, or consist of any sequence of an origin of replication known in the art. The sequence of the origin of replication may be a sequence of a bacterial origin of replication, whereby an rAAV vector comprising the sequence of the bacterial origin of replication can be produced, grown, and maintained in bacteria by using standard methods in the art.

[0099] Antibiotic resistance gene In some embodiments, the rAAV vectors and / or rAAV viral vectors of the present disclosure may include an antibiotic resistance gene.

[0100] In some embodiments, the antibiotic resistance gene may comprise, consist essentially of, or consist of any antibiotic resistance gene known in the art. Examples of antibiotic resistance genes known in the art include, but are not limited to, kanamycin resistance gene, spectinomycin resistance gene, streptomycin resistance gene, ampicillin resistance gene, carbenicillin resistance gene, bleomycin resistance gene, erythromycin resistance gene, polymyxin B resistance gene, tetracycline resistance gene, and chloramphenicol resistance gene.

[0101] AAV viral vector A "viral vector" is defined as a recombinantly produced virus or viral particle that contains a polynucleotide to be delivered into a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alphavirus vectors, etc. Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See, for example, Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al., (1999) Nat. Med. 5(7):823-827.

[0102] "AAV virion", "AAV virus particle", "AAV viral vector", "rAAV viral vector", "AAV vector particle", or "AAV particle" refers to a viral particle consisting of at least one AAV capsid protein and a polynucleotide rAAV vector encapsulated by the capsid. That is, the production of an rAAV viral vector necessarily includes the production of an rAAV vector, and thus the vector is included within the rAAV vector.

[0103] As used herein, the terms "viral capsid" or "capsid" refer to the proteinaceous shell or coat of a viral particle. The capsid functions to encapsidate, protect, transport, and release the viral genome into a host cell. The capsid generally consists of oligomeric structural subunits of protein ("capsid protein"). As used herein, the term "encapsidated" means to be encapsulated within a viral capsid. The AAV viral capsid consists of a mixture of three viral capsid proteins, namely VP1, VP2, and VP3. The mixture of VP1, VP2, and VP3 contains 60 monomers arranged in a T = 1 icosahedral symmetry in a ratio of 1:1:10 (VP1:VP2:VP3) or 1:1:20 (VP1:VP2:VP3), as described in Sonntag F et al., (June 2010) "A viral assembly factor promotes AAV2 capsid formation in the nucleolus". Proceedings of the National Academy of Sciences of the United States of America. 107(22):10220-5, and Rabinowitz JE, Samulski RJ (December 2000). "Building a better vector: the manipulation of AAV virions". Virology. 278(2):301-8, each of which is incorporated herein by reference in its entirety.

[0104] The present disclosure provides an rAAV viral vector comprising a) any of the rAAV vectors described herein, and b) an AAV capsid protein.

[0105] The AAV capsid protein may be any AAV capsid protein known in the art. The AAV capsid protein may be an AAV1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, or an AAVrh.10 capsid protein.

[0106] Alternative rAAV vector and rAAV viral vector embodiments 1. In the 5' to 3' direction, a) a first AAV ITR sequence, b) a promoter sequence, c) a transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, d) a control sequence, and e) a second AAV ITR sequence An rAAV vector comprising. 2. The rAAV vector according to embodiment 1, wherein the transgene nucleic acid molecule comprises a nucleic acid sequence encoding a MeCP2-derived polypeptide. 3. The vector according to embodiment 2, wherein the MeCP2-derived polypeptide is a mini-MECP2 polypeptide. 4. The vector according to embodiment 3, wherein the mini-MeCP2 polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. 5. The vector according to embodiment 4, wherein the mini-MeCP2 polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1. 6. The vector according to embodiment 4, wherein the mini MeCP2 polypeptide comprises the amino acid sequence represented by SEQ ID NO: 2. 7. The rAAV vector according to any one of the preceding embodiments, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28. 8. The rAAV vector according to any one of the preceding embodiments, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence represented by SEQ ID NO: 3. 9. The rAAV vector according to any one of the preceding embodiments, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence represented by SEQ ID NO: 4. 10. The rAAV vector according to any one of the preceding embodiments, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence represented by SEQ ID NO: 28. 11. The rAAV vector according to any one of the preceding embodiments, wherein the first AAV ITR sequence comprises the nucleic acid sequence represented by SEQ ID NO: 18. 12. The rAAV vector according to any one of the preceding embodiments, wherein the first AAV ITR sequence comprises the nucleic acid sequence represented by SEQ ID NO: 19. 13. The rAAV vector according to any one of the preceding embodiments, wherein the first AAV ITR sequence comprises the nucleic acid sequence represented by SEQ ID NO: 30. 14. The rAAV vector according to any one of the preceding embodiments, wherein the second AAV ITR sequence comprises the nucleic acid sequence represented by SEQ ID NO: 20. 15. The rAAV vector according to any one of the preceding embodiments, wherein the second AAV ITR sequence comprises the nucleic acid sequence represented by SEQ ID NO: 21. 16. The rAAV vector according to any one of the preceding embodiments, wherein the promoter sequence comprises the MeP426 promoter sequence. 17. The rAAV vector according to embodiment 15, wherein the MeP426 promoter sequence comprises the nucleic acid sequence represented by SEQ ID NO: 22. 18. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises one or more miRNA binding sites. 19. The rAAV vector according to embodiment 17, wherein the one or more miRNA binding sites comprise a miR-9-5p miRNA binding site, a miR-26b-5p miRNA binding site, a miR-23a-3p miRNA binding site, a miR-218-5p miRNA binding site, a miR-27a-3p miRNA binding site, a let-7e-5p miRNA binding site, a miR-98-5p miRNA binding site, a let-7d-5p miRNA binding site, a let-7g-5p miRNA binding site, a miR-218-5p miRNA binding site, or any combination thereof. 20. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises one or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 21. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises two or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 22. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises three or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 23. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises four or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 24. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises five or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 25. The rAAV vector according to any one of the preceding embodiments, wherein the control sequence comprises each of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 26. The rAAV vector according to any one of the preceding embodiments, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 13. 27. The rAAV vector according to any one of the preceding embodiments, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 14. 28. The rAAV vector according to any one of the preceding embodiments, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 15. 29. The rAAV vector according to any one of the preceding embodiments, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 16. 30. The control array, in the 5' to 3' direction, i) the nucleic acid sequence represented by SEQ ID NO: 15, ii) the nucleic acid sequence represented by SEQ ID NO: 13, and iii) the nucleic acid sequence represented by SEQ ID NO: 16 The rAAV vector according to any one of the preceding embodiments. 31. The rAAV vector according to any one of the preceding embodiments, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 17. 32. In the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 30, b) a promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) a transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, d) a control array comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) a second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 or SEQ ID NO: 21 The rAAV vector comprising. 33. In the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising the MeP426 promoter sequence containing the nucleic acid sequence represented by SEQ ID NO: 22 c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 d) A control sequence containing the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence containing the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same 34. In the 5' to 3' direction a) A first AAV ITR sequence containing the nucleic acid sequence represented by SEQ ID NO: 18 b) A promoter sequence comprising the MeP426 promoter sequence containing the nucleic acid sequence represented by SEQ ID NO: 22 c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 d) A control sequence containing the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence containing the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same 35. In the 5' to 3' direction a) A first AAV ITR sequence containing the nucleic acid sequence represented by SEQ ID NO: 19 b) A promoter sequence comprising the MeP426 promoter sequence containing the nucleic acid sequence represented by SEQ ID NO: 22 c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 36. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 37. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 38. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, the transgenic nucleic acid molecule d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 39. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, the transgenic nucleic acid molecule d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 or SEQ ID NO: 21 An rAAV vector comprising the same. 40. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, the transgenic nucleic acid molecule d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 41. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 42. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 43. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a polypeptide derived from MeCP2, wherein the MeCP2 polypeptide and / or the polypeptide derived from MeCP2 comprises the amino acid sequence represented by SEQ ID NO: 1. d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 44. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a polypeptide derived from MeCP2, wherein the MeCP2 polypeptide and / or the polypeptide derived from MeCP2 comprises the amino acid sequence represented by SEQ ID NO: 1. d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 45. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a polypeptide derived from MeCP2, wherein the MeCP2 polypeptide and / or the polypeptide derived from MeCP2 comprises the amino acid sequence represented by SEQ ID NO: 1. d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising In the 5' to 3' direction, a) A first AAV ITR sequence comprising a nucleic acid sequence represented by SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising a nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises a nucleic acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28, d) A control sequence comprising a nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising a nucleic acid sequence represented by SEQ ID NO: 20 or SEQ ID NO: 21 An rAAV vector comprising In the 5' to 3' direction, a) A first AAV ITR sequence comprising a nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising a nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising a nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising a nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising In the 5' to 3' direction, a) A first AAV ITR sequence comprising a nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising a nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 49. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 50. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising 51. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising 52. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising 53. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 or SEQ ID NO: 21 An rAAV vector comprising the same. 54. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 55. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 56. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. 57. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising the same. 58. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, the transgenic nucleic acid molecule, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising. 59. In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 30, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgenic nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the nucleic acid sequence encoding the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the nucleic acid sequence of SEQ ID NO: 3, the transgenic nucleic acid molecule, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising. 60. The rAAV vector according to any one of the preceding embodiments, comprising the nucleic acid sequence of SEQ ID NO: 27. 61. The rAAV vector according to any one of the preceding embodiments, comprising the nucleic acid sequence of SEQ ID NO: 29. 62. a) The rAAV vector according to any one of the preceding embodiments, and b) AAV capsid protein An rAAV viral vector comprising. 63. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, or an AAVrh.10 capsid protein. 64. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV1 capsid protein. 65. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV2 capsid protein. 66. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV3 capsid protein. 67. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV4 capsid protein. 68. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV5 capsid protein. 69. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV6 capsid protein. 70. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV7 capsid protein. 71. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV8 capsid protein. 72. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV9 capsid protein. 73. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV10 capsid protein. 74. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV11 capsid protein. 75. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV12 capsid protein. 76. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAV13 capsid protein. 77. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAVPHP.B capsid protein. 78. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAVrh74 capsid protein. 79. The rAAV viral vector according to embodiment 62, wherein the AAV capsid protein is an AAVrh.10 capsid protein. 80. An rAAV vector comprising a control sequence comprising one or more miRNA binding sites. 81. The rAAV vector according to embodiment 70, wherein the one or more miRNA binding sites comprise a miR-9-5p miRNA binding site, a miR-26b-5p miRNA binding site, a miR-23a-3p miRNA binding site, a miR-218-5p miRNA binding site, a miR-27a-3p miRNA binding site, a let-7e-5p miRNA binding site, a miR-98-5p miRNA binding site, a let-7d-5p miRNA binding site, a let-7g-5p miRNA binding site, a miR-218-5p miRNA binding site, or any combination thereof. 82. The rAAV vector according to embodiment 80 or 81, wherein the control sequence comprises one or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 83. The rAAV vector according to any one of embodiments 80 to 82, wherein the control sequence comprises two or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 84. The rAAV vector according to any one of embodiments 80 to 83, wherein the control array comprises three or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 85. The rAAV vector according to any one of embodiments 80 to 84, wherein the control array comprises four or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 86. The rAAV vector according to any one of embodiments 80 to 85, wherein the control array comprises five or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 87. The rAAV vector according to any one of embodiments 80 to 86, wherein the control array comprises each of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12. 88. The rAAV vector according to any one of embodiments 80 to 87, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 13. 89. The rAAV vector according to any one of embodiments 80 to 88, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 14. 90. The rAAV vector according to any one of embodiments 80 to 89, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 15. 91. The rAAV vector according to any one of embodiments 80 to 90, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 16. 92. The control array is, in the 5' to 3' direction, i) the nucleic acid sequence represented by SEQ ID NO: 15, ii) the nucleic acid sequence represented by SEQ ID NO: 13, and iii) the nucleic acid sequence represented by SEQ ID NO: 16 The rAAV vector according to any one of embodiments 80 to 91, comprising. 93. The rAAV vector according to any one of embodiments 80 to 92, wherein the control array comprises the nucleic acid sequence represented by SEQ ID NO: 17. 94. a) The rAAV vector according to any one of embodiments 80 to 93, and b) an AAV capsid protein An rAAV viral vector comprising.

[0107] Compositions and pharmaceutical compositions The present disclosure provides a composition comprising any one of the isolated polynucleotides, rAAV vectors, and / or rAAV viral vectors described herein. In some embodiments, the composition may be a pharmaceutical composition. Accordingly, the present disclosure provides a pharmaceutical composition comprising any one of the isolated polynucleotides, rAAV vectors, and / or rAAV viral vectors described herein.

[0108] The pharmaceutical composition can be formulated by any method known or developed in the art of pharmacology, as described herein, which includes, but is not limited to, contacting the active ingredient (e.g., viral particles or recombinant vectors) with excipients and / or additives and / or other auxiliary components, and dividing or packaging the product into dosage units. The viral particles of the present disclosure can be formulated to have desirable characteristics such as increased stability, increased cell transfection, sustained or delayed release, biodistribution or tropism, regulated or enhanced translation in vivo of the encoded protein, and in vivo release profile of the encoded protein.

[0109] Accordingly, the pharmaceutical composition may further comprise saline, lipids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics, or combinations thereof. In some embodiments, the pharmaceutical composition is formulated as nanoparticles. In some embodiments, the nanoparticles are self-assembled nucleic acid nanoparticles.

[0110] The pharmaceutical composition according to the present disclosure can be prepared, packaged, and / or sold in bulk as a single unit dose and / or as multiple single unit doses. The amount of the active ingredient is generally equal to the dosage of the active ingredient administered to a subject and / or a convenient proportion of such dosage, such as half or one-third of such dosage. The formulations of the present invention may contain one or more excipients and / or additives, each in an amount that increases the stability of the viral vector, increases the transfection or transduction of cells by the viral vector, increases the expression of the protein encoded by the viral vector, and / or modifies the release profile of the protein encoded by the viral vector. In some embodiments, the pharmaceutical composition contains excipients and / or additives. Non-limiting examples of excipients and / or additives include solvents, dispersion media, diluents, or other liquid vehicles, aids for dispersion or suspension, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, or combinations thereof.

[0111] In some embodiments, the pharmaceutical composition contains a cryoprotectant. The term "cryoprotectant" refers to an agent that can reduce or eliminate damage to a substance during freezing. Non-limiting examples of cryoprotectants include sucrose, trehalose, lactose, glycerol, dextrose, raffinose, and / or mannitol.

[0112] As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline, water, and emulsions, such as oil-in-water or water-in-oil emulsions, as well as various types of wetting agents. The composition may contain stabilizers and preservatives. See Martin (1975) Remington’s Pharm. Sci., 15th ed. (Mack Publ. Co., Easton) for examples of carriers, stabilizers, and adjuvants.

[0113] In some embodiments, the pharmaceutical composition of the present disclosure may comprise phosphate buffered saline (PBS), D-sorbitol, or any combination thereof.

[0114] In some embodiments, the pharmaceutical composition may comprise PBS, which is present at a concentration of about 100 mM to about 500 mM, or about 200 mM to about 400 mM, or about 300 mM to about 400 mM. In some embodiments, sodium chloride may be present at a concentration of about 350 mM.

[0115] In some embodiments, the pharmaceutical composition may comprise D-sorbitol, which is present at a concentration of about 1% to about 10%, or about 2.5% to about 7.5%. In some embodiments, D-sorbitol may be present at a concentration of about 5%.

[0116] That is, the present disclosure provides a pharmaceutical composition comprising the rAAV vector and / or rAAV viral vector of the present disclosure in a 350 mM phosphate buffered saline solution containing D-sorbitol at a concentration of 5%.

[0117] Methods of using the compositions of the present disclosure The present disclosure provides for the use of the disclosed compositions or pharmaceutical compositions, for example, administering or contacting a therapeutically effective amount of the composition or pharmaceutical composition to a cell, tissue, organ, animal, or subject, for the treatment of a disease or disorder in a cell, tissue, organ, animal, or subject known in the art or described herein. In one embodiment, the subject is a mammal. Preferably, the subject is a human. The terms "subject" and "patient" are used interchangeably herein.

[0118] The present disclosure provides a method of preventing or treating a disorder, comprising administering, consisting essentially of, or consisting of, to a subject, a therapeutically effective amount of any one of the rAAV vectors, rAAV viral vectors, compositions, and / or pharmaceutical compositions disclosed herein.

[0119] In some embodiments, the disease can be a genetic disorder involving the MECP2 gene. The genetic disorder involving the MECP2 gene can be MECP2 deficiency.

[0120] The genetic disorder involving the MECP2 gene can be Rett syndrome.

[0121] In some embodiments, the disease can be a disease characterized by loss of function of at least one copy of the MECP2 gene in the subject's genome. In some embodiments, the disease can be a disease characterized by reduced function of at least one copy of the MECP2 gene in the subject's genome. In some embodiments, the disease can be a disease characterized by at least one mutation in at least one mutation in at least one copy of the MECP2 gene in the subject's genome.

[0122] The mutation in the MECP2 gene can be any type of mutation known in the art. Non-limiting examples of mutations include somatic mutations, single nucleotide variants (SNVs), nonsense mutations, insertions, deletions, duplications, frameshift mutations, repeat expansions, short insertions and deletions (INDELs), long INDELs, alternative splicing, products of alternative splicing, altered translation initiation, products of altered translation initiation, proteolytic cleavage, products of proteolytic cleavage.

[0123] In some embodiments, the disease can be a disease characterized by reduced expression of the MECP2 gene in the subject as compared to a control subject without the disease. In some embodiments, the reduction in expression can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0124] In some embodiments, the disease can be a disease characterized by a decrease in the amount of MeCP2 in a subject as compared to a control subject without the disease. In some embodiments, the decrease in the amount of MeCP2 can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0125] In some embodiments, the disease can be a disease characterized by a decrease in the activity of MeCP2 in a subject as compared to a control subject without the disease. In some embodiments, the decrease in the activity of MeCP2 can be at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 99%, or at least about 100%.

[0126] The method of treatment can alleviate one or more symptoms of Rett syndrome. In one embodiment, if administered to a subject having a mutation in the MECP2 gene prior to the symptoms becoming detectable by delivery of the compositions described herein, the progression of detectable symptoms can be prevented or delayed. Thus, the treatment can be therapeutic or prophylactic. Treatment refers to the inhibition or reversal of an established symptom or phenotype. Treatment can also mean the delay in the onset of a symptom or phenotype. Prevention means preventing or precluding the progression of symptoms in a subject who does not already exhibit overt symptoms. A subject who does not exhibit overt symptoms can be identified in youth as having a loss-of-function mutation in the MECP2 gene by appropriate genetic testing performed at 18 months, 12 months, or 6 months of age or earlier.

[0127] The symptoms of Rett syndrome include, for example, delays in brain growth (microcephaly) and growth of other parts of the body, loss of normal movement and coordination, loss of communication ability, abnormal hand movements, unusual eye movements, breathing difficulties (such as apnea, abnormally rapid breathing (hyperventilation), forcible expulsion of air or saliva, and air swallowing), excitability and crying, cognitive impairment, seizures, scoliosis, arrhythmia, sleep disorders, weight loss, Fracture fragile bones that are prone to breakage, usually cold and small hands and feet, difficulties in chewing and swallowing, bowel function disorders, as well as teeth grinding.

[0128] The stages of Rett syndrome include, for example, the following. Stage I is the initial onset (usually starting at 6 - 18 months of age and may last for several months or a year). Stage II is the rapid deterioration (starting at about 1 - 4 years of age). Stage III is the plateau (usually starting at 2 - 10 years of age and may last for several years). Stage IV is the late motor deterioration (usually starting after 10 years of age and may last for several years or decades). Delays in the growth of the head or other parts of the body of the child. The compositions and methods described herein can be used to treat patients at any stage of Rett syndrome.

[0129] The subject to be treated using the methods, compositions, pharmaceutical compositions, rAAV vectors, or rAAV viral vectors of the present disclosure can have any of the diseases and / or symptoms described herein.

[0130] In some embodiments, the subject may be less than 0.5 years old, or less than 1 year old, or less than 1.5 years old, or less than 2 years old, or less than 2.5 years old, or less than 3 years old, or less than 3.5 years old, or less than 3.5 years old, or less than 4 years old, or less than 4.5 years old, or less than 5 years old, or less than 5.5 years old, or less than 6 years old, or less than 6.5 years old, or less than 7 years old, or less than 7.5 years old, or less than 8 years old, or less than 8.5 years old, or less than 9 years old, or less than 9.5 years old, or less than 10 years old. In some embodiments, the subject may be less than 11 years old, less than 12 years old, less than 13 years old, less than 14 years old, less than 15 years old, less than 20 years old, less than 30 years old, less than 40 years old, less than 50 years old, less than 60 years old, less than 70 years old, less than 80 years old, less than 90 years old, less than 100 years old, less than 110 years old, or less than 120 years old. In some embodiments, the subject may be less than 0.5 years old. In some embodiments, the subject may be less than 4 years old. In some embodiments, the subject may be less than 10 years old.

[0131] The methods of treatment and prevention disclosed herein may be combined with appropriate diagnostic techniques for identifying and selecting patients for treatment or prevention.

[0132] The present disclosure provides a method of increasing the level of a protein in a host cell, comprising contacting the host cell with any one of the rAAV viral vectors disclosed herein, wherein the rAAV viral vector comprises any one of the rAAV vectors disclosed herein comprising a transgene nucleic acid molecule encoding the protein. In some embodiments, the protein is a therapeutic protein. In some embodiments, the host cell is in vitro, in vivo, or ex vivo. In some embodiments, the host cell is derived from a subject. In some embodiments, the subject suffers from a disorder that results in a decreased level and / or function of the protein as compared to the level and / or function of the protein in a normal subject.

[0133] In some embodiments, the level of the protein is about 1×10 in the host cell-7 ng, approximately 3×10 -7 ng, approximately 5×10 -7 ng, approximately 7×10 -7 ng, approximately 9×10 -7 ng, approximately 1×10 -6 ng, approximately 2×10 -6 ng, approximately 3×10 -6 ng, approximately 4×10 -6 ng, approximately 6×10 -6 ng, approximately 7×10 -6 ng, approximately 8×10 -6 ng, approximately 9×10 -6 ng, approximately 10×10 -6 ng, approximately 12×10 -6 ng, approximately 14×10 -6 ng, approximately 16×10 -6 ng, approximately 18×10 -6 ng, approximately 20×10 -6 ng, approximately 25×10 -6 ng, approximately 30×10 -6 ng, approximately 35×10 -6 ng, approximately 40×10 -6 ng, approximately 45×10 -6 ng, approximately 50×10 -6 ng, approximately 55×10 -6 ng, approximately 60×10 -6 ng, approximately 65×10 -6 ng, approximately 70×10 -6 ng, approximately 75×10 -6 ng, approximately 80×10 -6 ng, approximately 85×10 -6 ng, approximately 90×10 -6 ng, approximately 95×10 -6 ng, approximately 10×10 -5 ng, approximately 20×10 -5 ng, approximately 30×10 -5 ng, approximately 40×10 -5 ng, approximately 50×10 -5 ng, approximately 60×10 -5 ng, approximately 70×10 -5 ng, approximately 80×10 -5 ng, or approximately 90×10 -5 ng level is increasing.

[0134] The present disclosure provides a method of introducing a gene of interest into a cell in a subject, comprising contacting the cell with an effective amount of any one of the rAAV viral vectors disclosed herein, wherein the rAAV viral vector comprises any one of the rAAV vectors disclosed herein that contains the gene of interest.

[0135] In some aspects of the methods of the present disclosure, in addition to administering the rAAV vector or rAAV viral vector of the present disclosure, a prophylactic immunosuppressive treatment regimen can also be administered to the subject. In some aspects, the immunosuppressive treatment regimen includes administering at least one immunosuppressive therapeutic agent. Non-limiting examples of immunosuppressive therapeutic agents include, but are not limited to, sirolimus (rapamycin), acetaminophen, diphenhydramine, IV methylprednisolone, prednisone, or any combination thereof. The immunosuppressive therapeutic agent can be administered prior to the day of administration of the rAAV vector and / or rAAV viral vector, on the same day as the administration of the rAAV vector and / or rAAV viral vector, or on any day after the administration of the rAAV vector and / or rAAV viral vector.

[0136] A "subject" for diagnosis or treatment is a cell, an animal such as a mammal, or a human. The subject is not limited to a particular species and includes non-human animals that are subjects for diagnosis or treatment, including, without limitation, primates, mice, rats, dogs, or rabbit species, and those that are subjects for infection or animal models, as well as other livestock, sport animals, or pets. In some aspects, the subject is a human.

[0137] As used herein, "treating" or "treatment" of a disease in a subject refers to (1) preventing the disease or arresting its progression, or (2) ameliorating the disease or its symptoms or causing regression thereof. As understood in the art, "treatment" is an approach to obtain beneficial or desirable results, including clinical outcomes. For the purposes of the present technology, beneficial or desirable results can include, whether detectable or not, one or more, but not limited to, alleviation or amelioration of one or more symptoms, diminution in the degree of a condition (including a disease), stabilization of the condition (including a disease) (i.e., not getting worse), delay or retardation of a condition (including a disease), progression, amelioration, or remission of a condition (including a disease), situation, and remission (partial or complete).

[0138] As used herein, "preventing" or "prevention" of a disease refers to preventing a symptom or disease from occurring in a subject who is susceptible to the disease or in whom symptoms of the disease have not yet manifested.

[0139] As used herein, the term "effective amount" is intended to mean an amount sufficient to achieve a desired effect. For therapeutic or prophylactic uses, the effective amount will depend on the type and severity of the condition in question, as well as the characteristics of the individual subject, such as general health, age, sex, weight, and tolerance to the pharmaceutical composition. For gene therapy, the effective amount may be an amount sufficient to effect partial or complete restoration of the function of a gene that is deficient in the subject. In some embodiments, the effective amount of the rAAV viral vector is an amount sufficient to effect gene expression in a subject such that MeCP2 polypeptide or a MeCP2-derived polypeptide is produced. In some embodiments, the effective amount is an amount necessary to increase the metabolism of galactose in a subject in need thereof. One of ordinary skill in the art will be able to determine an appropriate amount depending on these and other factors.

[0140] In some embodiments, the effective amount will depend on the size and nature of the problem's application. This will also depend on the nature and sensitivity of the target and the method of use. One of ordinary skill in the art would be able to determine the effective amount based on these and other considerations. The effective amount may include, consist essentially of, or consist of one or more administrations of the composition according to the embodiment.

[0141] As used herein, the term "administer" or "administration" is intended to mean the delivery of a substance to a subject such as a human or an animal. Administration can be achieved in one dose, continuously, or intermittently, throughout the course of treatment. Methods for determining the most effective means of administration and dosage amount are known to those of ordinary skill in the art and will vary depending on the composition used for treatment, the purpose of the treatment, and the age, health, or gender of the subject being treated. Single or multiple administrations may be carried out at dosage levels and patterns selected by the treating clinician or, in the case of pets and other animals, the treating veterinarian.

[0142] Methods for determining the most effective means of administration and dosage amount are known to those of ordinary skill in the art and will vary depending on the composition used for treatment, the purpose of the treatment, and the subject being treated. Single or multiple administrations may be carried out at dosage levels and patterns selected by the treating clinician. It is noted that the dosage amount can be affected by the route of administration. Suitable dosage regimens and methods of administering the medicament are known in the art. Non-limiting examples of such suitable dosage amounts are from a low amount of vector genome of 10 9 to a high amount of vector genome of 10 17 .

[0143] In some embodiments of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject is in the range of about 10 9 to about 10 17 . In some embodiments, about 10 10 to about 10 12 , about 10 11 to about 10 13, about 10 11 ~ about 10 12 , about 10 11 ~ about 10 14 , about 10 12 ~ about 10 16 , about 10 13 ~ about 10 16 , about 10 14 ~ about 10 15 , about 5×10 11 ~ about 5×10 12 , or about 10 12 ~ about 10 13 viral particles are administered to the subject.

[0144] In some aspects of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject can be at least about 10 10 , or at least about 10 11 , or at least about 10 12 , or at least about 10 13 , or at least about 10 14 , or at least about 10 15 , or at least about 10 16 , or at least about 10 17 viral particles.

[0145] In some aspects of the methods described herein, the number of viral particles (e.g., rAAV viral vectors) administered to the subject can depend on the age of the subject. By way of non-limiting example, about 10×10 14 viral particles may be administered to a subject 7 years of age or older, about 10×10 14 viral particles may be administered to a subject between about 4 and about 7 years of age, about 9×10 14 viral particles may be administered to a subject between about 3 and about 4 years of age, about 8.2×10 14 viral particles may be administered to a subject between about 2 and about 3 years of age, about 7.3×10 14 viral particles may be administered to a subject between about 1 and about 2 years of age, about 4×10 14It is acceptable to administer individual viral particles, and for subjects less than about 0.5 years of age, 3×10 14 individual viral particles may be administered.

[0146] In some embodiments, the amount of viral particles in the composition, pharmaceutical composition, or the amount of viral particles administered to a patient can be calculated based on the percentage of viral particles predicted to contain the viral genome.

[0147] In some embodiments, the rAAV viral vectors of the present disclosure may be introduced into a subject intravenously, intrathecally, intracerebrally, intraventricularly, intranasally, intratracheally, intraaurally, intravitreally or periocularly, orally, rectally, transmucosally, by inhalation, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracisternally, intraneurally, intrapleurally, locally, intralymphatically, intracisternally. Such introduction may be intraarterially, intracardially, subventricularly, epidurally, intracerebrally, intraventricularly, subretinally, intravitreally, intraarticularly, intraperitoneally, intrauterinely, intraneurally, or any combination thereof. In some embodiments, the viral particles are delivered to a desired target tissue, for example, but not limited to, the lung, eye, or CNS. In some embodiments, the delivery of the viral particles is systemic. The intracisternal route of administration includes direct administration of the drug into the cerebrospinal fluid of the ventricle. This can be accomplished by direct injection into the cistern or by a permanently positioned tube. In some embodiments, the rAAV viral vectors of the present disclosure are administered intrathecally.

[0148] In some embodiments, the rAAV viral vectors of the present disclosure repair gene deficiencies in a subject. In some embodiments, the ratio of the repaired target polynucleotide or polypeptide to the unrepaired target polynucleotide or polypeptide in successfully treated cells, tissues, organs, or subjects is at least about 1.5:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 20:1, about 50:1, about 100:1, about 1000:1, about 10,000:1, about 100,000:1, or about 1,000,000:1. The amount or ratio of the repaired target polynucleotide or polypeptide can be determined by any method known in the art including, but not limited to, Western blot, Northern blot, Southern blot, PCR, sequencing, mass spectrometry, flow cytometry, immunohistochemistry, immunofluorescence, fluorescence in situ hybridization, next generation sequencing, immunoblot, and ELISA.

[0149] Administration of the rAAV vectors, rAAV viral vectors, compositions, or pharmaceutical compositions of the present disclosure can be achieved in one dose, continuously, or intermittently throughout the course of treatment. In some embodiments, the rAAV vectors, rAAV viral vectors, compositions, or pharmaceutical compositions of the present disclosure are administered parenterally by injection, infusion, or transplantation.

[0150] In some embodiments, the rAAV viral vectors of the present disclosure exhibit enhanced tropism for the brain and cervical spine. In some embodiments, the rAAV viral vectors of the present disclosure can cross the blood-brain barrier (BBB).

[0151] Manufacturing method Various approaches can be used to produce the rAAV viral vectors of the present disclosure. In some embodiments, packaging is achieved by using a helper virus or helper plasmid and a cell line. The helper virus or helper plasmid contains elements and sequences that facilitate the production of the viral vector. In another embodiment, the helper plasmid is stably integrated into the genome of the packaging cell line, such that the packaging cell line does not require further transfection with the helper plasmid.

[0152] In some embodiments, the cell is a packaging cell line or a helper cell line. In some embodiments, the helper cell line is a eukaryotic cell, such as a HEK293 cell or a 293T cell. In some embodiments, the helper cell is a yeast cell or an insect cell.

[0153] In some embodiments, the cell contains a nucleic acid encoding a tetracycline activator protein and a promoter that controls the expression of the tetracycline activator protein. In some embodiments, the promoter that controls the expression of the tetracycline activator protein is a constitutive promoter. In some embodiments, the promoter is a phosphoglycerate kinase promoter (PGK) or a CMV promoter.

[0154] The helper plasmid can contain, for example, at least one viral helper DNA sequence derived from a non-replicating viral genome that does not produce replication-competent AAV and encodes trans-orbiviron proteins necessary for packaging replication-incompetent AAV and producing high titers of virion proteins capable of packaging replication-incompetent AAV.

[0155] Helper plasmids for packaging AAVs are known in the art; see, e.g., U.S. Patent Application Publication No. 2004 / 0235174A1, which is incorporated herein by reference. As described therein, an AAV helper plasmid can include, as helper virus, DNA sequences, such as Ad5 genes E2A, E4, and VA, controlled by their respective native promoters or heterologous promoters. An AAV helper plasmid may further include an expression cassette for the expression of a marker protein, such as a fluorescent protein, to enable simple detection of transfection of the desired target cells.

[0156] The present disclosure provides a method for producing an rAAV viral vector, including transfecting a packaging cell line with any one of the AAV helper plasmids disclosed herein and any one of the rAAV vectors disclosed herein. In some embodiments, the AAV helper plasmid and the rAAV vector are co-transfected into the packaging cell line. In some embodiments, the cell line is a mammalian cell line, such as a human embryonic kidney (HEK) 293 cell line. The present disclosure provides a cell comprising any one of the rAAV vectors and / or rAAV viral vectors disclosed herein.

[0157] As used herein, the term "helper" in relation to a virus or plasmid refers to a virus or plasmid used to provide additional components necessary for the replication and packaging of any one of the rAAV vectors described herein. Components encoded by the helper virus may include any genes necessary for virion assembly, capsid encapsidation, genome replication, and / or packaging. For example, the helper virus or plasmid may encode the necessary enzymes for replication of the viral genome. Non-limiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus), or herpesvirus (virus). In some embodiments, the pHELP plasmid may be the pHELPK plasmid, in which case the ampicillin expression cassette is replaced with a kanamycin expression cassette.

[0158] As used herein, a packaging cell (or helper cell) is a cell used to produce a viral vector. Production of a recombinant AAV viral vector requires the Rep and Cap proteins provided in trans, as well as an adenovirus-derived genetic sequence that aids in AAV replication. In some embodiments, the packaging / helper cell contains a plasmid that is stably integrated into the genome of the cell. In other embodiments, the packaging cell may be transiently transfected. Typically, the packaging cell is a eukaryotic cell, such as a mammalian cell or an insect cell.

[0159] Kit The isolated polynucleotides, rAAV vectors, rAAV viral vectors, compositions, and / or pharmaceutical compositions described herein may be assembled into kits for pharmaceutical, diagnostic, or research use to facilitate their use in therapeutic, diagnostic, or research applications. In some embodiments, the kits of the disclosure include any one of the isolated polynucleotides, rAAV vectors, rAAV viral vectors, compositions, pharmaceutical compositions, host cells, and isolated tissues as described herein.

[0160] In some embodiments, the kit further includes instructions for use. Specifically, such kits may include one or more of the agents described herein, together with instructions that describe the intended use and correct use of these agents. In some embodiments, the kit may include instructions for mixing one or more components of the kit and / or isolating and mixing a sample for application to a subject. In some embodiments, the agents in the kit are in a pharmaceutical formulation and are in dosages appropriate for a particular use and method of administration of the agent. Kits for research purposes may contain components in concentrations or amounts appropriate for performing various experiments.

[0161] The kits are designed to facilitate the use of the methods described herein and can take many forms. Each of the components of the kit can be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), where applicable. In certain examples, some of the compositions may be reconstituted or otherwise processed (e.g., into an active form) with a suitable solvent or other species (e.g., water or cell culture medium), which may or may not be provided with the kit. In some embodiments, the compositions may be provided in a storage solution (e.g., a cryopreservation solution). Non-limiting examples of storage solutions include DMSO, paraformaldehyde, and CryoStor® (Stem Cell Technologies, Vancouver, Canada). In some embodiments, the storage solution contains an amount of a metalloprotease inhibitor.

[0162] In some embodiments, the kit contains any one or more of the components described herein in one or more containers. That is, in some embodiments, the kit may include a container that houses the agent described herein. The agent may be in the form of a liquid, gel, or solid (powder). The agent may be prepared aseptically, packaged in a syringe, and shipped refrigerated. Alternatively, the agent may be housed in a vial or other container for storage. The second container may have another agent prepared aseptically. Alternatively, the kit may include an active agent that has been pre-mixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the parts necessary to administer the agent to a subject, such as a syringe, topical application device, or an IV needle tube and bag.

[0163] Further Definitions Unless otherwise indicated by context, it is specifically intended that the various features of the invention described herein can be used in any combination. Further, the disclosure is intended in some embodiments to exclude or disclaim any feature or combination of features described herein. For illustration, if the specification states that a complex contains components A, B, and C, it is specifically intended that any one of A, B, or C, or combinations thereof, may be removed or disclaimed, either singly or in any combination.

[0164] Unless otherwise expressly indicated, all specified embodiments, forms, features, and terms are intended to include both the recited embodiment, form, feature, or term and its biological equivalents.

[0165] Unless otherwise indicated, the practice of the present technology will employ conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology, and recombinant DNA within the skill of the art. See, for example, Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Edition (1989); Current Protocols In Molecular Biology (F.M. Ausubel et al. eds., (1987)); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane eds., (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (R.I. Freshney ed., (1987)).

[0166] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements but do not exclude others. As used herein, the transitional phrase "consisting essentially of" (and grammatical variations) should be interpreted to include the recited materials or steps and those that do not materially affect the basic and novel characteristics of the recited embodiments. That is, the term "consisting essentially of" as used herein should not be interpreted as equivalent to "comprising". "Consisting of" means excluding other components and elements in excess of trace amounts of substantial method steps for administering the compositions disclosed herein. The aspects defined by each of these transitional phrases are within the scope of the present disclosure. In each example herein, any of the terms "comprising", "consisting essentially of", and "consisting of" can be replaced by the other two phrases while retaining their original meaning. Any single term, single element, single phrase, group of terms, or group of elements described herein can be specifically excluded from the claims, respectively.

[0167] All numerical designations, including, for example, pH, temperature, time, concentration, and molecular weight, which include ranges, are approximations that vary, as appropriate, in increments of 1.0 or 0.1, or with a variation of ±15%, 10%, 5%, or 2%, (+) or (-). Although not always explicitly stated, it should be understood that the term "about" precedes all numerical designations. Although not always explicitly stated, it should also be understood that the reagents described herein are merely exemplary, and that equivalents thereof are known in the art. As used herein, the term "about" when referring to an amount or concentration or other measurable value means that it encompasses variations of even up to 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0168] The terms "acceptable," "effective," or "sufficient," when used to describe any component, range, dosage form, or other selection disclosed herein, are intended to mean that the said component, range, dosage form, etc. are suitable for the disclosed purpose.

[0169] Also, as used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the absence of combinations when explained in terms of alternatives ("or").

[0170] Unless specifically cited otherwise, the term "host cell" includes eukaryotic host cells, including, for example, fungal cells, yeast cells, higher plant cells, insect cells, and mammalian cells. Non-limiting examples of eukaryotic host cells include primates, cows, pigs, mice, rats, birds, reptiles, and humans, such as HEK293 cells and 293T cells.

[0171] As used herein, the term "isolated" refers to a molecule or biologic or cell material that is substantially free of other materials.

[0172] As used herein, the terms "nucleic acid sequence" and "polynucleotide" are used interchangeably and refer to a polymer of nucleotides of any length that is either ribonucleotide or deoxyribonucleotide. That is, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers that contain, consist essentially of, or consist of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0173] "Gene" refers to a polynucleotide that includes at least one open reading frame (ORF) that can encode a specific polypeptide or protein. "Gene product" or "gene expression product" refers to the amino acid sequence (e.g., peptide or polypeptide) produced when a gene is transcribed and translated.

[0174] As used herein, "expression" refers to the two-step process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. When the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA within a eukaryotic cell.

[0175] "Under the control of transcription" is a term well understood in the art and indicates that the transcription of a polynucleotide sequence, usually a DNA sequence, depends on being operably linked to an element that contributes to or promotes the initiation of transcription. "Operably linked" is intended to mean arranged in such a way as to enable the polynucleotide to function in a cell. In one aspect, a promoter may be operably linked to a downstream sequence.

[0176] The term "encoding", when applied to a polynucleotide and / or nucleic acid sequence, refers to a polynucleotide and / or nucleic acid sequence that, in its native state or when manipulated by methods known to those of skill in the art, can be transcribed to produce mRNA for a polypeptide and / or a fragment thereof, and if so, is said to "encode" the polypeptide. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom.

[0177] The terms "protein", "peptide", and "polypeptide" are used interchangeably and refer to a compound of two or more subunits of amino acids, amino acid analogs, or peptidomimetics in their broadest sense. The subunits may be linked by peptide bonds. In another aspect, the subunits may be linked by other bonds such as esters, ethers, or the like. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise, consist essentially of, or consist of the sequence of the protein or peptide. As used herein, the term "amino acid" refers to natural and / or non-natural, or synthetic amino acids, including glycine and both D and L optical isomers, amino acid analogs, and peptidomimetics.

[0178] As used herein, the term "signal peptide" or "signal polypeptide" is intended to refer to an amino acid sequence that is typically present at the N-terminus of a newly synthesized secretory or membrane polypeptide or protein. This functions to direct the polypeptide to a specific cellular location, such as across the cell membrane, into the cell membrane, or into the nucleus. In some aspects, the signal peptide is removed after localization. Examples of signal peptides are well known in the art. Non-limiting examples include those described in U.S. Patent Nos. 8,853,381, 5,958,736, and 8,795,965. In some aspects, the signal peptide may be an IDUA signal peptide.

[0179] The terms "equivalent" or "biologically equivalent", when referring to a particular molecule, biological material, or cell material, are used interchangeably and are intended to refer to a particular molecule, biological material, or cell material that has a minimal level of homology while still maintaining the desired structure or functionality. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% identity to a reference polypeptide (e.g., a wild-type polypeptide), or polypeptides encoded by polynucleotides having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to a reference polynucleotide (e.g., a wild-type polynucleotide).

[0180] "Identity" or "sameness" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. The percent identity can be determined by comparing positions in each of the sequences aligned for purposes of comparison. If a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences is a function of the number of matching positions shared by the sequences. "Unrelated" or "non-identical" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present disclosure. Alignment and percent sequence identity can be determined for the nucleic acid or amino acid sequences provided herein by importing the nucleic acid or amino acid sequences into ClustalW (available at https: / / genome.jp / tools-bin / clustalw / ) and using it. For example, the ClustalW parameters used to perform the protein sequence alignments found herein were generated using the Gonnet (for proteins) weight matrix. In some embodiments, the ClustalW parameters used to perform nucleic acid sequence alignments using the nucleic acid sequences found herein are generated using the ClustalW (for DNA) weight matrix.

[0181] As used herein, an amino acid modification may be an amino acid substitution, an amino acid deletion, or an amino acid insertion. The amino acid substitution may be a conservative amino acid substitution or a non-conservative amino acid substitution. A conservative replacement (also called a conservative mutation, conservative substitution, or conservative variation) is an amino acid substitution in a protein that changes a given amino acid to a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, or size). As used herein, "conservative variation" refers to the replacement of an amino acid residue with another biologically similar residue. Examples of conservative variations include the substitution of one hydrophobic residue, such as isoleucine, valine, leucine, or methionine, with another, or the substitution of one charged or polar residue with another, such as the substitution of arginine with lysine, glutamic acid with aspartic acid, glutamine with asparagine, and others. Other illustrative examples of conservative substitutions include the change from alanine to serine, asparagine to glutamine or histidine, aspartic acid to glutamic acid, cysteine to serine, glycine to proline, histidine to asparagine or glutamine, lysine to arginine, glutamine, or glutamic acid, phenylalanine to tyrosine, serine to threonine, threonine to serine, tryptophan to tyrosine, tyrosine to tryptophan or phenylalanine, and other changes.

[0182] The polynucleotides disclosed herein can be delivered to cells or tissues using gene delivery vehicles. As used herein, "gene delivery", "gene transfer", "transduction", etc. refer to the introduction of an exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, regardless of the method used for introduction. Such methods include various well-known techniques, such as vector-mediated gene transfer (e.g., viral infection / transfection, or by other various protein-based or lipid-based gene delivery complexes), as well as techniques that facilitate the delivery of "naked" polynucleotides (e.g., electroporation, "gene gun" delivery, and other various techniques used for the introduction of polynucleotides). The introduced polynucleotide can be maintained stably or transiently in the host cell. Stable maintenance typically requires that the introduced polynucleotide contains an origin of replication compatible with the host cell, or is integrated into a replicon of the host cell, such as an episomal replicon (e.g., a plasmid), or the nuclear or mitochondrial chromosome. As is known in the art and described herein, some vectors are known to be able to mediate the introduction of genes into mammalian cells.

[0183] A "plasmid" is typically a DNA molecule that is separate from chromosomal DNA and can replicate independently thereof. In many cases, this is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microorganisms and typically provide a selective advantage under a given environmental situation. Plasmids carry genes that confer resistance to naturally produced antibiotics in a competitive environmental niche, or the proteins produced can act as toxins under similar circumstances. While plasmid vectors often exist as extrachromosomal circular DNA molecules, plasmid vectors are also designed to integrate stably into the host chromosome randomly or in a targeted manner, and it is known in the art that such integration can be achieved using circular plasmids or plasmids linearized prior to introduction into the host cell.

[0184] The "plasmid" used in genetic engineering is called a "plasmid vector". Many plasmids are commercially available for such use. The gene to be replicated is inserted into a copy of a plasmid containing a gene that makes the cell resistant to a specific antibiotic, and into a multiple cloning site (MCS or polylinker), which is a short region containing several commonly used restriction sites and facilitating the insertion of a DNA fragment at this position. Another major use of plasmids is to produce large amounts of protein. In this case, bacteria or eukaryotic cells containing the plasmid with the gene of interest are grown by the researcher, and they can be induced to produce large amounts of protein from the inserted gene.

[0185] In the mode where gene transfer is mediated by a DNA virus vector such as adenovirus (Ad) or adeno-associated virus (AAV), the vector construct refers to a polynucleotide that contains, consists essentially of, or consists of a viral genome or a portion thereof and a transgene.

[0186] The term "tissue" is used herein to refer to a tissue of a living or dead organism or any tissue derived from or designed to mimic a living or dead organism. The tissue may be healthy, diseased, and / or have a genetic mutation. A biological tissue can include any single tissue (e.g., a collection of cells that may be interconnected) or a group of tissues that make up an organ or part or region of the body of an organism. The tissue may contain, consist essentially of, or consist of homogeneous cell material, or may be a composite structure such as found in a body region including the chest, which may contain, for example, lung tissue, skeletal tissue, and / or muscle tissue. Exemplary tissues include, but are not limited to, those derived from the liver, lung, thyroid, skin, pancreas, blood vessels, bladder, kidney, brain, biliary system, duodenum, abdominal aorta, iliac vein, heart, and intestine, and any combination thereof may be included. Examples

[0187] Materials and methods for Examples 1-5 Animals: Mice were allowed free access to food and water and were housed under a 12-hour light-dark cycle. Animal studies were conducted according to protocols approved by the Institutional Animal Care and Use Committee at the University of North Carolina (UNC) at Chapel Hill (Figures 1A-1C) and the University of Texas Southwestern (UTSW) Medical Center (all other figures). All mice were weaned at P28 (Sinnett, S.E. et al., Mol Ther Methods Clin Dev, 2017. 5:106-115). Mice were housed and evaluated in barrier facilities, except for the following exceptions. The mice in Figure 4D were housed, maintained, and evaluated in a conventional facility.

[0188] Vector a) AAV9 / CBH-EGFP: A viral vector containing an rAAV vector that includes an AAV9 capsid protein and a nucleic acid encoding a chicken β-actin hybrid (CBh) promoter followed by an eGFP polypeptide. b) AAV9 / MeP426-hMECP2-myc-RDH1pA (hereinafter referred to as "AAV9 / MECP2"): A viral vector containing an rAAV vector that includes an AAV9 capsid protein and, in the 5' to 3' direction, a MeP426 promoter sequence, a nucleic acid sequence encoding human MeCP2, a nucleic acid sequence encoding a myc tag, and a control sequence including the nucleic acid sequence represented by SEQ ID NO: 14. c) AAV9-MeP426-miniMECP2-myc-RDH1pA (hereinafter referred to as "AAV9 / miniMECP2"): A viral vector containing an rAAV vector that includes an AAV9 capsid protein and, in the 5' to 3' direction, a MeP426 promoter sequence, a nucleic acid sequence encoding a mini MeCP2 polypeptide containing the amino acid sequence of SEQ ID NO: 1, a nucleic acid sequence encoding a myc tag, and a control sequence including the nucleic acid sequence represented by SEQ ID NO: 14. d) AAV9-MeP426-miniMECP2-myc-miRARE-RDH1pA (hereinafter referred to as "AAV9 / miniMECP2-miRARE"): A viral vector comprising an rAAV vector containing an AAV9 capsid protein and, in the 5' to 3' direction, a MeP426 promoter sequence, a nucleic acid sequence encoding a mini MeCP2 polypeptide containing the amino acid sequence of SEQ ID NO: 1, a nucleic acid sequence encoding a myc tag, and a control sequence containing the nucleic acid sequence represented by SEQ ID NO: 17. e) PHP.B / miniMECP2-myc: A viral vector comprising an rAAV vector containing a PHP.B capsid protein and, in the 5' to 3' direction, a MeP426 promoter sequence, a nucleic acid sequence encoding a mini MECP2-myc polypeptide containing the amino acid sequence of SEQ ID NO: 1, a nucleic acid sequence encoding a myc tag, and a control sequence containing the nucleic acid sequence represented by SEQ ID NO: 14. f) PHP.B / miniMECP2-myc-miRARE: A viral vector comprising an rAAV vector containing a PHP.B capsid protein and, in the 5' to 3' direction, a MeP426 promoter sequence, a nucleic acid sequence encoding a mini MECP2-myc polypeptide containing the amino acid sequence of SEQ ID NO: 1, a nucleic acid sequence encoding a myc tag, and a control sequence containing the nucleic acid sequence represented by SEQ ID NO: 17. g) PHP.B / CBH-EGFP vector: A viral vector comprising an rAAV vector containing a PHP.B capsid protein and a chicken β-actin hybrid (CBh) promoter followed by a nucleic acid encoding an eGFP polypeptide.

[0189] All vectors were produced by the UNC Vector Core (Clement, N. and J. C. Grieger. Mol Ther Methods Clin Dev, 2016. 3: p. 16002).

[0190] All of the above vectors have self-complementary genomes and were all prepared in a formulation buffer of 350 mM PBS containing 5% D-sorbitol.

[0191] A 6-target miRARE panel was inserted between two sub-components of RDH1pA. These two sub-components are a 3-target panel for miR-19, miR-22, and miR-132 and a 110-bp fragment of the conserved polyadenylation signal at the terminus.

Chem.

[0192] The underlined sequences indicate seed matches for miR-9-5p, miR-26-5p, miR-23-3p, miR-218-5p, miR-27-3p, and let-7-5p, respectively. The non-underlined parts represent flanking sequences. These target and flanking sequences meet several criteria: (1) The bold mutations were introduced to create a T1A anchor (Schirle, N.T. et al., Science, 2014. 346(6209):608 - 13); (2) The spacer between each underlined sequence is within the desired range for co-suppression (Grimson, A. et al., Mol Cell, 2007. 27(1):91 - 105; Saetrom, P. et al., Nucleic Acids Res, 2007. 35(7):2333 - 42); (3) Most of the targets tolerate T9A or T9U (Lewis, B.P. et al., Cell, 2005. 120(1):15 - 20).

[0193] Treatment: For 4 - 5-week-old mice, surgical intracerebroventricular or percutaneous IT injection (10 μL) was performed. Except for the following exceptions, injection methods known to those skilled in the art were used. Carprofen (5 mg / kg) and lidocaine (5 μL, 2% solution) were administered subcutaneously prior to inhalation anesthesia with isoflurane (instead of intraperitoneal administration of avertin) (Sinnett, S.E. et al., Mol Ther Methods Clin Dev, 2017. 5:106 - 115; Gray, S.J. et al., Curr Protoc Neurosci, 2011. Chapter 4: Unit 4 17). IT injections were performed by personnel unaware of the treatment.

[0194] Purification of RNA: Three mice per group were treated with saline, 1×10 12 vg of AAV9 / MECP2, or 1×10 12 vg of AAV9 / EGFP. Two to three weeks after injection, the mice were euthanized with a lethal dose of intraperitoneal avertin and the necks were severed. The cervical spinal cord, cerebellum, and medulla oblongata were quickly excised, frozen on dry ice, and immediately transferred to -80°C. After thawing, total RNA was purified from the lysed tissue using the Qiagen miRNeasy Mini Kit. The RNA samples were stored at -80 until shipment on dry ice for screening.

[0195] miRNA profiling: Mouse miRNAs profiled by LC Sciences from blinded RNA samples (microarray part number MRA-1002, miRBase version 21, n = 3 mice per group per tissue type, screening replicate 2 times) were statistically analyzed. Signals less than 500 in intensity were defined as normalized signals. The significantly increased miRNA expression levels described herein are limited to those with an average signal intensity exceeding 500.

[0196] Bioinformatics: The endogenous targets discussed herein are based on the annotations listed on targetscan.org, where the Excel files of 21 3’UTRs were downloaded (Release 7.2, March 2018) (Agarwal, V. et al., Elife, 2015.4). When two 3’UTR sequences were available for a single gene, the most dominant transcript was selected for analysis. For example, for MECP2, the 8 kb transcript from which a part of RDH1pA was derived was used for analysis. The targets obtained from the downloaded files were merged into a single master file used to create a frequency table. Since these scores do not account for the context of the viral genome, all uniquely annotated targets were considered regardless of their context++ percentile scores. (Agarwal, V. et al., Elife, 2015.4). Targets that appeared more than twice within a single transcript were counted only once per 3’UTR. Six targets from miRARE match the endogenous human 3’UTR for MECP2 (miR-9-5, miR-26b-5p, miR23a-3p, miR-218-5p, miR-27a-3p, and let-7-5p / 98-5p). Five targets from miRARE match the endogenous mouse 3’UTR for MECP2 (miR-26b-5p, miR-23a-3p, miR-218-5p, miR-27a-3p, and let-7-5p / 98-5p).

[0197] Weekly body weight measurement and total behavioral scoring: Behavior in treated mice was evaluated using the Total Phenotypic Severity Scale, which is based on a previously published scale (Guy, J. et al., Science, 2007. 315(5815):1143-1147). This total scale includes six subscales for abnormal movements, abnormal gait, hindlimb clasping, tremors, abnormal respiration, and abnormal general findings. Hindlimb clasping was evaluated by suspending the mouse by the tail so that the hindlimbs were floating. Scores were blinded to treatment and genotype, although it would be possible to infer genotype by visual assessment. Mice had their body weights measured and were scored before injection and then weekly thereafter.

[0198] Rotarod: Mice were tested by a Columbus Instruments Rotamax-5. The rotarod accelerated from 4 to 40 rpm over 5 minutes. Mice were tested 4 times per day at 15-minute intervals for 2 days. The recorded latency was either the time the mouse fell off the rotarod or the time the mouse made one full rotation around the rod without falling (the mouse was then removed from the rotarod). These evaluations were performed by a scorer blinded to treatment and genotype.

[0199] Survival: The recorded date of death for each mouse was the natural date of death, except for the following exceptions. Mice that lost at least 20% of their peak body weight were euthanized according to a previously published method (Gadalla, K.K.E. et al., Mol Ther Methods Clin Dev, 2017. 5:180-190) or according to the advice of the veterinary staff at the UT Southwestern Animal Resource Center. Early euthanasia due to severe health problems (dropout due to complications, tail lesions resulting in necrosis or following self-injury) was indicated in the survival curves prior to review.

[0200] Immunofluorescence and confocal analysis: The immunofluorescence analysis technique was performed according to a previously published method, except for the following exceptions (Sinnett, S.E. et al., Mol Ther Methods Clin Dev, 2017.5: pp. 106 - 115). Antigen activation was not performed. Antigen activation is required before blocking and incubation with the anti-MeCP2 primary antibody, but not before blocking and incubation with the anti-myc antibody. Immunolabeled sections were imaged at the Live Cell Imaging Facility of UT Southwestern using Zen software with a Zeiss 880 confocal microscope.

[0201] Statistical analysis: The alpha level used to determine significance was p < 0.05. Statistical analysis of the converted signal intensities from the miRNA microarray was performed according to the method described in the technical document. Analysis between groups (e.g., group A vs. group B) was performed. Due to the limitations of the screening method, the p-values were carefully analyzed, and the results of screening and bioinformatics were combined to justify the miRNA targets selected for miRARE. The Gehan-Breslow-Wilcoxon test was used to calculate the statistical significance between pairs of groups in the Kaplan-Meier plots generated by GraphPad Prism. Unless otherwise noted, two-way ANOVA followed by Tukey's post hoc test was performed on the body weight and behavioral data using GraphPad.

Example

[0202] The mini-MECP2 vector can cause side reactions in WT mice. AAV9 / MeP426-hMECP2-myc-RDH1pA (hereinafter referred to as AAV9 / MECP2) can cause dose-dependent side effects (such as weight loss and abnormal limb clasping) after intracerebroventricular (ICV) administration to juvenile mice. In contrast, little is known about the safety of AAV9 / minMECP2. To evaluate the toxicity of minMECP2 gene transfer, WT juvenile mice were injected with 1×10 12 vg of AAV9 / or PHP.B / minMECP2 (ICV), and the behavior was scored weekly. These doses are extremely high, but the goal is to develop a treatment that allows widespread MeCP2 protein expression in the CNS without causing side effects, and thus high doses are required. AAV9 / minMECP2 increased the average clasping score within 2 weeks after injection (p<0.05, Figure 1A). PHP.B / minMECP2 resulted in bilateral clasping early at 3 days after injection (Figure 1B). Both AAV9 / and PHP.B / minMECP2 increased the total phenotypic severity score within 2 weeks after injection (p<0.05, Figure 1C). Transgenic mice expressing endogenous minMeCP2-EGFP exhibited mild clasping, but the rapid progression to severe phenotypes was observed, consistent with overexpression toxicity, and thus further optimization of the minMECP2 viral genome was justified.

Example

[0203] MicroRNA (miRNA) expression analysis for designing miRARE sequences To identify miRNAs upregulated by toxic MECP2 gene therapy, WT and KO mice were injected at 4 - 5 weeks of age with saline, AAV9 / EGFP, or AAV9 / MECP2 (1×10 12vg / mouse, ICM). Two to three weeks after injection, three tissues found near the injection site were excised. The tissue types were cervical cord (CC), cerebellum, and medulla. Total RNA was purified from these samples. Next, the expression of 1900 mouse miRNAs was quantified by microarray. This approach enabled the identification of relevant MeCP2-responsive miRNAs in the CNS while withholding the possibility of identifying more granular, cell type-specific miRNAs. miRNAs whose expression levels significantly increased at the tissue level in correlation with MeCP2 were identified. In view of these changes being too small in scale (at most less than 1.5-fold) for secondary confirmation by qRT-PCR, an alternative secondary approach was used to justify the selection of miRNA targets for a new control panel.

[0204] In view of the need for a secondary approach, the microarray data was combined with a novel bioinformatics approach. The 3’UTRs of dosage-sensitive CNS genes that are related in phenotype and co-occur in development to mediate neurodevelopmental disorders may commonly have several miRNA targets (Tables 2 - 3). If so, a small, multi-purpose target panel can be designed that is primarily intended for let gene therapy but may also be relevant to other diseases. The number of times the annotated miRNA targets appeared among the 11 3’UTRs was quantified for a selected list of genes that mediate intellectual disability (Tables 2 - 3, Figures 2A - 2B). To address the concern that the apparent conservation of targets across our selected list of 3’UTRs may be an artifact of very long mRNA sequences, the same analysis was performed on a random selection of human genes. (1) The 3’UTRs of randomly selected genes had few common miRNA targets (Figure 5), and (2) the number of shared targets per 100bp length of 3’UTR sequence was found to be less for the set of randomly selected genes than for the set of genes we selected (Figures 6A - 6B and 7A - 7B).

[0205] [Table 2]

[0206] Inactivating mutations in the genes listed in Table 2 have been shown to mediate neurodevelopmental disorders characterized by intellectual disability and other phenotypes, such as seizures, stereotypies, abnormal speech, and / or abnormal head size. The exact age of onset varies across loss-of-function syndromes, but many of these syndromes become apparent by 2 years of age. Reciprocal (associated with overexpression) disorders may be mediated, in whole or in part, by the same genes. The contribution of specific genes to specific phenotypes associated with human chromosomal duplications is not always known. To elucidate, patients with more than necessary protein expression typically have duplications across larger chromosomal regions that include, but are not limited to, the genes shown in this table. Therefore, Table 3 includes single-gene duplication mouse models that underestimate the possible dosage sensitivity of these genes. Clinical profiles describing duplications within genes (which can result in protein truncation) are not considered in this table. 3’UTR sequences are accessible at targetscan.org. The Ensembl transcript numbers listed here were used in the analysis (Agarwal, V. et al., Elife, 2015.4).

[0207]

Table 3

[0208] After identifying miRNA targets that occur in the majority (6 or more) of 11 3’UTRs (in the mouse and human data sets), microarray data were used (Figs. 2A–2B) to prioritize miRNA targets expressed in tissues near the intracerebrospinal fluid (CSF) injection site. The list of candidate targets was then narrowed to include targets for miRNAs whose expression levels appeared to increase in correlation with MeCP2. Finally, the DNA sequence length was minimized while maximizing the regulatory potential by including let-7-5p binding sites predicted to base pair with a number of possible MeCP2-sensitive let-7-5p miRNAs. Ultimately, an approach from these two aspects yielded a 175-base pair 6-target panel (miRARE), which was inserted into the miniMECP2 viral genome (Fig. 2C). The self-complementary AAV9 / MeP426-miniMECP2-myc-miRARE-RDH1pA viral genome will hereafter be referred to as AAV9 / miniMECP2-miRARE. Importantly, each of these miRARE targets is predicted to bind to miRNAs shown to be expressed in human brain tissues from infancy through adolescence. Furthermore, the relative expression levels of six female human cerebellar miRNAs (miR-9-5p, miR-26b-5p, miR-23a-3p, miR-218-5p, miR-27a-3p, and let-7e-5p) generally reflect the relative expression levels in the miRNA profile, with miR-9-5p and miR-23a-3p expressed at high and low levels, respectively.

Example

[0209] miRARE improves the safety of miniMECP2 gene transfer in treated WT mice. The safety of controlled miniMECP2 gene transfer was analyzed in two treatment paradigms for juvenile mice, namely (1) ICM PHP.B-mediated gene transfer (see Fig. 8) and (2) intrathecal (IT) AAV9-mediated gene transfer.

[0210] The ICM experiments using PHP.B provided data on highly efficient gene transfer, linking the miRARE data to Figure 1, which compared ICM administration of unregulated AAV9 / and PHP.B / minMECP2 vectors. Summarize the set of PHP.B data. miRARE provided robust control of mini-MeCP2-myc protein expression in the WT brain (miRARE decreased the expression of mini-MeCP2-myc protein in the brain), prevented weight loss in virus-treated WT mice (p < 0.05 versus unregulated vectors and saline, Figure 8A), normalized the total phenotypic score in virus-treated WT mice (p < 0.05 versus unregulated vectors, Figure 8B), delayed the onset of severe gait (p < 0.05 versus unregulated vectors, Figure 8C), and almost completely eliminated the occurrence of severe hindlimb clasping in virus-treated WT mice (p < 0.05 versus unregulated vectors, Figure 8D).

[0211] Next, to combine the evaluation of miRARE with methods relevant to translation to humans, miRARE was evaluated in the context of intrathecal administration of AAV9. miRARE provided several safety benefits. Specifically, miRARE prevented acute mini-MeCP2-mediated weight loss at the highest dose tested in WT mice (1×10 12 vg / mouse, Figure 3A). AAV9 / mini-MeCP2-treated WT mice had significantly lower body weights starting at 15 weeks of age than saline-treated WT mice (p < 0.05). No significant difference was observed between saline-treated and AAV9 / mini-MeCP2-miRARE-treated WT mice (1×10 12 vg / mouse).

[0212] miRARE attenuated mini-MECP2-mediated worsening in the WT total phenotypic severity score (Figure 3B). WT mice treated with AAV9 / MECP2 and AAV9 / mini-MECP2 had significantly higher mean total behavioral severity scores compared to the scores observed in saline-treated mice (p < 0.05 at 6 - 30 weeks of age and 7 - 27 weeks of age, respectively). WT mice treated with AAV9 / mini-MECP2-miRARE had significantly lower mean total severity scores compared to mice treated with AAV9 / MECP2 and AAV9 / mini-MECP2 at most time points between 11 - 19 weeks of age and 9 - 20 weeks of age, respectively. No significant difference was observed between saline and WT mice treated with AAV9 / mini-MECP2-miRARE (1×10 12 vg / mouse). miRARE attenuated mini-MeCP2-mediated worsening in the total severity score by reducing the frequency of mini-MeCP2-mediated severe hindlimb clasping and preventing mini-MeCP2-mediated severe abnormal gait (Figures 3C - 3D). In contrast, at least half of the WT mice treated with AAV9 / MECP2 or AAV9 / mini-MECP2 developed severe abnormal gait or severe hindlimb abnormalities.

[0213] No early death was observed among WT mice treated with AAV9 / mini-MECP2-miRARE. Early euthanasia due to veterinary request among WT mice treated with AAV9 / mini-MECP2 was due to complications from dropout (Figure 3E). Finally, no tail lesions were observed among AAV9 / mini-MECP2-miRARE-treated WT mice (0% among 21 mice). In contrast, lesions were observed in 8 - 17% of untreated AAV9 / mini-MECP2-treated WT mice (1 out of 12 mice treated with 1×10 11 vg, 2 out of 12 mice treated with 1×10 12 vg). Tail lesions were observed in 1 out of 12 WT mice treated with 1×10 11 vg of AAV9 / MECP2. These results demonstrate that the miRARE sequence can effectively prevent the harmful side effects of AAV-mediated delivery of MECP2.

Example

[0214] AAV9 / minMECP2-miRARE extends the survival of MECP2 KO mice. In the context of IT administration of AAV9 vectors in juvenile mice, uncontrolled minMECP2 gene transfer was unable to extend the survival of MECP2 KO at any of the doses tested. However, controlled minMECP2 gene transfer extended KO survival by 56% (1×10 12 vg / mouse, FIGS. 4A-4E and 9). There was a trend towards an extension of survival in KO mice treated with AAV9 / MECP2, but this extension was not significant (p = 0.1). There was a strong trend towards an extension of survival with AAV9 / MECP2, but studies in WT mice indicated unacceptable toxicity for this vector design at this dose (FIGS. 3A-3E). Treatment did not affect the body weight of the KO. These results demonstrate that the miRARE sequence can effectively prevent the harmful side effects of AAV-mediated delivery of MECP2, while providing therapeutic benefits and extending the survival of KO mice.

Example

[0215] AAV9 / minMECP2-miRARE delays the age of onset of severe abnormal gait. Using weekly behavioral data, the approximate age of onset of severe gait abnormalities (score 2 on a 0-2 scale) in KO mice was tabulated. AAV9 / minMECP2-miRARE delayed the approximate age of onset of severe gait abnormalities by 4-5 weeks (p < 0.05 compared to all other groups, one-way ANOVA followed by Tukey's post hoc test), and the frequency of occurrence was similar or lower (compared to all other KO groups, FIGS. 4A-4E).

[0216] In the accelerating rotarod test, AAV9 / minMECP2-miRARE (1×10 12vg / mouse) produced a trend of initial motor neurons in KO mice that was improved by 150% compared to the motor neurons of saline-treated mice (p > 0.05), but kinematic learning over the test did not improve. The rotarod test was performed on another cohort of mice located in a second animal facility.

[0217] Adverse events were noted in some AAV-treated KO mice.

[0218] Tail lesions were observed across all treatment groups, including saline-treated KO mice (Figure 4E). The frequency of lesions among KO mice treated with saline was 11% (2 / 18). 1×10 11 The frequencies of lesions among mice treated with 1×10 vg of AAV9 / MECP2, AAV9 / minMECP2, and AAV9 / minMECP2-miRARE were 25% (3 / 12), 42% (5 / 12), and 17% (2 / 12), respectively. 1×10 12 The frequencies of lesions among KO mice treated with 1×10 vg of AAV9 / MECP2, AAV9 / minMECP2, and AAV9 / minMECP2-miRARE were 33% (4 / 12), 25% (3 / 12), and 17% (2 / 12), respectively. Due to the small group sizes, it is not possible to confidently determine whether miRARE reduces the risk of lesions. The inverse correlation between the frequency of lesions and dose for AAV9 / minMECP2-treated KO mice may be due to small group sizes or perhaps an artificial effect due to early death. 1×10 11 or 1×10 12 The median survival for each of the KO mice treated with 1×10 vg of AAV9 / minMECP2 was 10.4 weeks and 9.6 weeks, respectively (Figure 4A and Figure 9).

[0219] Summary of Examples 1 - 5 The results presented in Examples 1-5 are the first to quantify the dose-dependent side effects of uncontrolled AAV9 / minMECP2 in WT mice. These side effects recapitulate those previously observed for AAV9 / MECP2, thus justifying further improvements to the viral genome.

[0220] To design a controlled minMECP2 viral genome featuring the "miRARE" miRNA target panel, a novel target panel design strategy was created. While not bound by theory, the goal was to utilize endogenous MeCP2-responsive miRNAs to downregulate the minMECP2 transgene in the event of MeCP2 overexpression, in order to create a safety valve that prevents transgene overexpression in any transduced cell. miRARE meets the following criteria: (1) Most of the targets are predicted to bind to the putative MeCP2-responsive miRNAs. (2) Each target appears in 7-11 endogenous human 3'UTRs from a selected list of dosage-sensitive genes that mediate intellectual disability (thus also useful for other dosage-sensitive CNS gene therapy applications). (3) The targets are predicted to bind to miRNAs expressed in human CNS tissue over the course of development. Ultimately, this strategy led to the design of a controlled viral genome with improved safety, without sacrificing efficacy in two different treatment models (relative to the efficacy of the uncontrolled control vector).

[0221] The miRARE design strategy seeks to address the limitations of conventional approaches to controlling transgene expression within the context of CNS gene therapy. Previous approaches to controlling expression have included strategies to confer cell-type specificity (e.g., a neuronal promoter), eliminate peripheral expression (e.g., a miR-122 target panel to constitutively inhibit expression in the liver), destabilize mRNA (in a manner that does not respond to total MeCP2 levels), and destabilize exogenous proteins (e.g., a fused degron domain) (Luoni, M. et al., Elife, 2020.9; Qiao, C. et al., Gene Ther, 2011.18(4):403-410; Geisler, A. et al., Gene Ther, 2011.18(2):199-209; Gray, S.J. et al., Hum Gene Ther, 2011.22(9):1143-1153; Quintino, L. et al., Mol Ther Methods Clin Dev, 2018.11:29-39). However, these prior approaches were not intended to limit the level of exogenous protein expression in CNS cells that receive hundreds of vector genome copies relative to the level of exogenous protein expression in CNS cells that receive only a few genomic copies. Furthermore, conventional control approaches were not intended to control expression in response to the mosaicism of MeCP2 where transduced cells express either WT endogenous MeCP2 or mutant MeCP2. This variability in vector copy number across transduced cells and in the expression of endogenous WT MeCP2 creates the need for a control that enables true feedback of MeCP2. At the organismal level, such a feedback loop should improve safety while maintaining efficacy. Ultimately, miRARE attenuates the side effects associated with overexpression in WT mice without sacrificing efficacy in KO mice.

[0222] miRARE improves both the safety and efficacy of intrathecal mini-MECP2 gene transfer (in WT and KO mice, respectively) without the need for secondary intervention (Figures 4A-4E). Since the miRARE vector was well tolerated in WT mice, this vector is expected to be well tolerated in the allelic-specific RTT model. Overall, miRARE significantly attenuated these WT behavioral side effects while improving KO survival in our lumbar intrathecal treatment model (Figures 4A-4E).

[0223] The results presented in Examples 1-5 also demonstrate that miRARE may have practical applications beyond Rett syndrome. The miRARE sequence was designed using a combination of experimental data collected from studies of MeCP2 overexpression and also integrated knowledge obtained from the analysis of several developmentally regulated dosage-sensitive genes. That is, miRARE can be used to provide feedback control of other dosage-sensitive genes in the context of gene transfer involving genes beyond those analyzed in the creation of MiRARE. Since the target panel design strategy described herein is built on molecular data from intentional overexpression, the miRARE design strategy has additional significance. A field of gene therapy is provided that has the unique advantage that dose-dependent transgene-related side effects can be resolved among therapeutic products encoded by virus genome modifications driven by risk,

Claims

1. In the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 19; b) a promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22; c) a transgene comprising the nucleic acid sequence represented by SEQ ID NO: 3; d) a control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13; and e) a second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 21 An rAAV vector comprising.

2. The rAAV vector according to claim 1, wherein the control sequence comprises one or more miRNA binding sites.

3. The rAAV vector according to claim 2, wherein the one or more miRNA binding sites comprise an miR-9-5p miRNA binding site, an miR-26b-5p miRNA binding site, an miR-23a-3p miRNA binding site, an miR-218-5p miRNA binding site, an miR-27a-3p miRNA binding site, a let-7e-5p miRNA binding site, an miR-98-5p miRNA binding site, a let-7d-5p miRNA binding site, a let-7g-5p miRNA binding site, or any combination thereof.

4. The rAAV vector according to any one of claims 1 to 3, wherein the control sequence further comprises one or more of the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12.

5. The rAAV vector according to any one of claims 1 to 4, wherein the control sequence further comprises the nucleic acid sequences represented by SEQ ID NOs: 7, 8, 9, 10, 11, and 12.

6. The control sequence, in the 5' to 3' direction, i) the nucleic acid sequence represented by SEQ ID NO: 15; ii) the nucleic acid sequence represented by SEQ ID NO: 13; and iii) the nucleic acid sequence represented by SEQ ID NO: 16 The rAAV vector according to any one of claims 1 to 5, comprising.

7. In the 5' to 3' direction, a) a first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18; b) a promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22; c) a transgene nucleic acid molecule comprising a nucleic acid sequence encoding an MeCP2 polypeptide and / or an MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1 d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 13, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. **Claim 8** In the 5' to 3' direction, a) A first AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 18, b) A promoter sequence comprising a MeP426 promoter sequence comprising the nucleic acid sequence represented by SEQ ID NO: 22, c) A transgene nucleic acid molecule comprising a nucleic acid sequence encoding a MeCP2 polypeptide and / or a MeCP2-derived polypeptide, wherein the MeCP2 polypeptide and / or the MeCP2-derived polypeptide comprises the amino acid sequence represented by SEQ ID NO: 1, a transgene nucleic acid molecule, d) A control sequence comprising the nucleic acid sequence represented by SEQ ID NO: 17, and e) A second AAV ITR sequence comprising the nucleic acid sequence represented by SEQ ID NO: 20 An rAAV vector comprising the same. **Claim 9** a) The rAAV vector according to any one of claims 1 to 8, and b) An AAV capsid protein An rAAV viral vector comprising the same. **Claim 10** The rAAV viral vector according to claim 9, wherein the AAV capsid protein is an AAV1 capsid protein, an AAV2 capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, or an AAVrh.10 capsid protein. **Claim 11** The rAAV viral vector according to claim 10, wherein the AAV capsid protein is an AAV9 capsid protein. **Claim 12** The rAAV viral vector according to claim 10, wherein the AAV capsid protein is an AAVPHP.B capsid protein. **Claim 13** a) The rAAV viral vector according to any one of claims 9 to 12, as well as b) At least one pharmaceutically acceptable excipient and / or additive A pharmaceutical composition comprising the same. **Claim 14** A pharmaceutical composition for treating a disease and / or disorder involving the MECP2 gene, comprising a therapeutically effective amount of the rAAV viral vector according to any one of claims 9 to 12 or the pharmaceutical composition according to claim 13.

15. The pharmaceutical composition according to claim 14, wherein the disease and / or disorder involving the MECP2 gene is Rett syndrome.

16. The rAAV viral vector or the pharmaceutical composition is administered at a dose in the range of 10 ５ to 10 ２０ viral vector particles. The pharmaceutical composition according to claim 14 or 15.

17. The rAAV viral vector or the pharmaceutical composition is administered at a dose in the range of 10 ５ to 10 １５ viral vector particles, the pharmaceutical composition according to claim 16.

18. The pharmaceutical composition according to any one of claims 14 to 17, wherein the rAAV viral vector or the pharmaceutical composition is administered intravenously, intrathecally, intracerebrally, intraventricularly, intranasally, intratracheally, intratympanically, intraocularly or periorbitally, orally, rectally, transmucosally, by inhalation, transdermally, parenterally, subcutaneously, intradermally, intramuscularly, intracisternally, intraneurally, intrapleurally, locally, intranodally, intracisternally, or intraneurally.

19. The pharmaceutical composition according to claim 18, wherein the rAAV viral vector or the pharmaceutical composition is administered intrathecally.

20. The pharmaceutical composition according to claim 19, wherein the rAAV viral vector or the pharmaceutical composition is administered intracranially.

Images