Modification of 5' untranslated region and method for producing target substance using the same

Abstract

To improve productivity in production of a target substance by a microorganism.SOLUTION: Provided is a DNA molecule containing a modified promoter. The modified promoter contains modified 5'UTR containing a heterologous polynucleotide. The heterologous polynucleotide is a polynucleotide containing the nucleotide sequence of SEQ ID NO: 70 or containing a nucleotide sequence having at least 80% identity with the sequence.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a DNA molecule containing a modified 5' untranslated region or a promoter containing the same, and a method for producing a target substance using the same.

Background Art

[0002] In the industrial production of substances by microorganisms, improvement of productivity is an important issue. Many studies have been conducted on the modification of expression control regions such as promoters to improve the expression of target genes.

[0003] Patent Document 1 describes that a modified promoter obtained from the catabolite responsive element (cre)-like sequence of the alkaline cellulase gene of Bacillus sp. KSM-S237 strain (FERM BP-7875) and KSM-64 strain (FERM BP-2886) can improve the expression of a target gene. Patent Document 2 describes that a modified promoter with a base insertion between positions 326 and 330 of the nucleotide sequence of the promoter region of the alkaline cellulase gene of KSM-64 strain can improve the expression of the target gene. Patent Documents 3 and 4 describe that the 5' untranslated region (5'UTR) sequence obtained from the Bacillus subtilis aprE gene is operably linked to a heterologous gene to improve the expression of the gene. Patent Document 5 describes that a modified mRNA processing / stabilizing sequence with a Shine-Dalgarno sequence added is linked downstream of the promoter region of the target gene and upstream of the ribosome binding region to improve the expression of the target gene. Patent Document 6 describes a method for increasing the production of a target substance by introducing a specific DNA sequence forming a stem-loop more than 7 nucleotides downstream of the transcription start site of a gene related to the synthesis of the target substance. Non-Patent Document 1 describes that the expression of sacB was controlled by introducing a Shine-Dalgarno-like sequence into the 5'UTR of the sacB repressor gene sacR in Bacillus subtilis, and the expression increased or decreased depending on the number and position of the introduction. Non-Patent Document 2 describes that the expression of a target gene was improved by introducing multiple sequences containing a ribosome binding site (RBS) and a start codon into the 5'UTR region of the target gene in the genus Bacillus.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Non-Patent Document

[0005]

Non-Patent Document 1

Non-Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0006] Improvement in productivity in the production of target substances by microorganisms is desired. The present invention relates to a DNA molecule containing a modified 5'UTR that promotes gene expression or a promoter containing the same, and a method for producing a target substance using the same.

Means for Solving the Problems

[0007] The present inventors have found that by replacing at least a part of the 5'UTR contained in the promoter of a target gene in a microorganism with a specific DNA fragment derived from the 5'UTR of the Bacillus endoglucanase gene, the expression of the target gene is significantly promoted.

[0008] Therefore, in one embodiment, the present invention is a DNA molecule containing a modified promoter, wherein The modified promoter includes a modified 5'UTR containing a heterologous polynucleotide, The heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70, or a nucleotide sequence having at least 80% identity with said sequence. DNA molecule, is provided. In another embodiment, the present invention provides a transformant containing said DNA molecule. In yet another embodiment, the present invention provides a method for producing a target substance comprising culturing said transformant. In yet another embodiment, the present invention is a method for producing a modified promoter, The method includes modifying the 5'UTR contained in the parental promoter, The modification of the 5'UTR includes substituting part or all of the 5'UTR with a heterologous polynucleotide, or adding the heterologous polynucleotide to the 5'UTR, The heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70, or a nucleotide sequence having at least 80% identity with said sequence, The parental promoter is a promoter containing a 5'UTR that does not contain the heterologous polynucleotide. Method, is provided.

Advantages of the Invention

[0009] According to the present invention, the productivity of the target substance by microorganisms can be significantly improved.

Brief Description of the Drawings

[0010]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

BEST MODE FOR CARRYING OUT THE INVENTION

[0011] All patent documents, non-patent documents, and other publications cited in this specification are hereby incorporated by reference in their entirety.

[0012] In this specification, the identity of amino acid sequences and nucleotide sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by analyzing using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12 (Nippon Server Co., Ltd.) with Unit size to compare (ktup) set to 2.

[0013] As used herein, "at least 80% identity" with respect to an amino acid sequence and a nucleotide sequence means an identity of 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% or more, and still more preferably 99% or more.

[0014] As used herein, unless otherwise defined, "one or several" used with respect to deletions, substitutions, additions or insertions of amino acid residues or nucleotides in an amino acid sequence or a nucleotide sequence preferably means 1 to 5, more preferably 1 to 4, still more preferably 1 to 3, and still more preferably 1 to 2. As used herein, "addition" of an amino acid residue or a nucleotide includes addition of an amino acid residue or a nucleotide to one end and both ends of a sequence.

[0015] As used herein, "corresponding position" or "corresponding region" on an amino acid sequence or a nucleotide sequence can be determined by aligning the target sequence and a reference sequence (for example, the amino acid sequence of SEQ ID NO: 3) so as to give the maximum homology. Alignment of an amino acid sequence or a nucleotide sequence can be performed using a known algorithm, and the procedure is known to those skilled in the art. For example, alignment can be performed by using the Clustal W multiple alignment program (Thompson, J.D. et al, 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Clustal W can be used, for example, on the website of the DNA Data Bank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]) operated by the National Institute of Genetics. The position of the target sequence aligned at any position of the reference sequence by the above alignment is regarded as the "corresponding position" at the said any position. Further, the region sandwiched by the corresponding positions, or the region consisting of the corresponding motif, is regarded as the corresponding region.

[0016] As used herein, the term "amino acid residue" refers to the 20 amino acid residues that make up proteins, alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0017] As used herein, the term "promoter" refers to a DNA sequence having a function of controlling the expression of a gene (a polynucleotide encoding an expression product). Generally, the "promoter" of a certain gene is located upstream of the open reading frame (ORF) of the gene and controls the expression of the ORF. The promoter may include regions such as a transcription start point and a 5' untranslated region (5'UTR), or can be defined as a region further including an enhancer, a cis element, etc. The enhancer and cis element are located upstream of the transcription start point and improve the activity of the promoter by binding to transcription factors, etc. The activation of the promoter promotes the transcription of the gene into mRNA. The 5'UTR is the region from the transcription start point to before the start codon downstream, which is itself transcribed into mRNA but not translated, and functions as a regulatory region when translating mRNA into protein. The 5'UTR of Bacillus bacteria contains the Shine-Dalgarno (SD) sequence, which is a ribosome binding site.

[0018] As used herein, the term "open reading frame (ORF)" refers to the region from the start codon to the stop codon. The ORF includes the coding region (CDS) of the gene.

[0019] As used herein, the "expression control region" (or simply "control region") refers to a DNA sequence having a function of controlling gene transcription or translation, including a promoter, the 5'UTR constituting the same, a transcription start point, a ribosome binding site, and other sites and regions, an enhancer and cis element that improve the transcriptional activity of the promoter, and a 3' untranslated region (3'UTR), etc.

[0020] As used herein, "upstream" and "downstream" with respect to a gene or a control region such as a promoter or 5'UTR refer to the 5'-side and 3'-side of the gene or region, respectively. Unless otherwise defined, the upstream and downstream of a gene are not limited to the upstream and downstream regions adjacent to the ORF of the gene. Also, unless otherwise defined, the upstream and downstream with respect to a promoter or 5'UTR are not limited to the upstream region adjacent to the 5'-end of the region and the downstream region adjacent to the 3'-end of the region.

[0021] As used herein, "operably linked" between a control region and a gene means that the gene (ORF) and the control region are linked such that the gene can be expressed under the control of the control region. Also, as used herein, "operably linked" between each region (e.g., a promoter and 5'UTR) contained in a control region means that in the control region, the respective regions are linked such that they can control the expression of the downstream gene (ORF). Therefore, basically, the "gene" that is operably linked to a control region herein refers to the ORF. The procedure for "operably linking" a gene and a control region or each region in a control region is well known to those skilled in the art.

[0022] As used herein, the "expression cassette" refers to a polynucleotide construct for controlling the expression of a target gene contained therein. Usually, the expression cassette contains the target gene to be expressed and a control region for controlling the expression of the gene. The control region preferably includes a promoter, and the promoter is located upstream of the ORF of the target gene and is operably linked thereto. For example, when the target gene encodes a polynucleotide encoding a preproprotein containing a signal peptide, the promoter is located upstream of the region encoding the signal peptide, is operably linked to the polynucleotide encoding the preproprotein, and controls the expression of the preproprotein. The expression cassette may also contain the 3' untranslated region (3'UTR) of the target gene. Preferably, the expression cassette has, at its ends, a restriction enzyme recognition site for enabling insertion of the expression cassette into a vector or genomic DNA. The expression cassette can be used for constructing an expression vector or introducing a foreign gene into genomic DNA. Preferably, the expression cassette of the present invention is a DNA construct.

[0023] As used herein, "heterologous" with respect to a polynucleotide such as a gene or a control region means that two elements are not derived from the same polynucleotide strand. For example, when two polynucleotides are "heterologous" to each other, they are derived from separate polynucleotide strands, regardless of whether they are derived from genes of the same name or genes of different names. Thus, when replacing the 5'UTR of a promoter of a certain gene with a foreign DNA fragment, the 5'UTR and the DNA fragment are "heterologous" to each other and the DNA fragment is heterologous to the promoter, even if they are derived from genes of the same name. Therefore, "heterologous" with respect to a polynucleotide encompasses the meaning that two elements are not derived from the same gene. In this case, when replacing the 5'UTR of a certain gene with a DNA fragment derived from a different gene, the 5'UTR and the DNA fragment are "heterologous" to each other.

[0024] As used herein, the term "Bacillus bacterium" refers to a bacterium belonging to the genus Bacillus of the family Bacillaceae. Examples of Bacillus bacteria include B. subtilis (Bacillus subtilis), B. cereus, B. thuringiensis, B. megaterium, B. amyloliquefaciens, B. pumilus, B. licheniformis, B. licheniformis, and mutants thereof.

[0025] As used herein, the term "target substance" refers to any substance (e.g., peptide, protein, metabolite, etc.) that is desired to be produced by a host cell. As used herein, the term "target gene" refers to a polynucleotide that encodes a target substance or a substance that promotes its production process (e.g., biosynthesis or extracellular transport). For example, target genes include genes that encode proteins or peptides that are the target substances, genes that encode proteins involved in the biosynthesis of metabolites that are the target substances, genes that encode proteins involved in the extracellular transport of the target substances, and the like. The target gene may be a heterologous gene encoding a heterologous expression product, a homologous gene introduced from the outside, a gene encoding an expression product originally possessed by the host cell, or a gene encoding any other expression product (protein, peptide, etc.).

[0026] Examples of substances encoded by the target gene include enzymes, antibodies, insecticidal proteins, hormones, cytokines, other bioactive peptides, biosynthetic enzymes for metabolites, transporters involved in the extracellular excretion of metabolites, etc., but enzymes and insecticidal proteins are preferred. Examples of enzymes include oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase or synthetase, etc. Preferred examples include cellulase-based biomass degrading enzymes such as cellulase and hemicellulase, exoglucanase, endoglucanase, β-glucosidase, laccase, lactase, esterase, pectate lyase, pectinase, peroxidase, phytase, pullulanase, PETase, protease, lipase, mannanase, arabinase, galactase, amylase, etc., and more preferably protease, lipase and amylase. Examples of insecticidal proteins include Cry proteins produced by Bacillus thuringiensis, preferably Cry proteins classified into Cry4, Cry5 and Cry11, more preferably Cry5B, Cry4Aa, Cry4Ba and Cry11Aa, and even more preferably Cry5B.

[0027] In this specification, the "expression" of a gene encompasses both the process of transcription from the gene to mRNA and the process of translation from mRNA to protein, and is used appropriately according to the context. Basically, when the expression level of the target gene increases, the production amount of the target substance increases. The expression level of the target gene can be measured by gene expression analysis or by quantifying the production amount of the protein expressed from the target gene. For example, when comparing the production amounts of the same target substance produced in different cells, the concentration of the produced target substance may be compared, or when the target substance is an enzyme, the enzyme activity value may be compared. The enzyme activity value and the substance concentration are measured by methods well-known to those skilled in the art. Also, in this specification, "improvement" and "promotion" are interchangeable with respect to gene expression, and "increase" and "improvement" are interchangeable with respect to the production amount of protein.

[0028] Unless otherwise specified, the names of the genes or proteins described in this specification follow the registration information of the Protein Data Bank (PDB) ([www.rcsb.org / ]).

[0029] The present invention provides a modified 5'UTR, a modified promoter containing the same, and their use in the production of a target substance by a microorganism.

[0030] The modified 5'UTR provided by the present invention can be constructed by modifying the 5'UTR to be modified (hereinafter also referred to as the "parent 5'UTR") using a heterologous polynucleotide. More specifically, the modified 5'UTR of the present invention can be constructed by substituting part or all of the parent 5'UTR with a heterologous polynucleotide or by adding a heterologous polynucleotide to the parent 5'UTR. Therefore, the parent 5'UTR of the modified 5'UTR is a 5'UTR that does not contain the heterologous polynucleotide.

[0031] The heterologous polynucleotide used for the modification of the 5'UTR is a polynucleotide that is heterologous to the parental 5'UTR (i.e., derived from a different polynucleotide strand). Preferably, the heterologous polynucleotide is a fragment derived from the 5'UTR of a Bacillus endoglucanase gene. Examples of the Bacillus endoglucanase gene include the endoglucanase (e.g., alkaline cellulase) gene of Bacillus sp. KSM-S237 strain (FERM BP-7875).

[0032] The heterologous polynucleotide contains the Shine-Dalgarno (SD) sequence GGAGG that functions as a ribosome binding site in the Bacillus gene. Preferably, the heterologous polynucleotide contains AGGAGG (SEQ ID NO: 1). More preferably, the heterologous polynucleotide contains AGGAGGTAATATG (SEQ ID NO: 2). Preferably, the heterologous polynucleotide has a length of at least 20 nt. The upper limit of the length of the heterologous polynucleotide is not particularly limited, but is preferably 100 nt or less.

[0033] Preferably, the heterologous polynucleotide comprises a nucleotide sequence of WAWWTTWAGGAGGTAATATG (SEQ ID NO: 70, where W is A or T), or a nucleotide sequence having at least 80% identity thereto. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 70. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 70. In one embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 70. In one embodiment, the heterologous polynucleotide has a sequence derived from the 5'UTR of the Bacillus endoglucanase gene adjacent to the 5'-terminal side of the nucleotide sequence of SEQ ID NO: 70. For example, the heterologous polynucleotide consists of a fragment from the 3'-terminal region of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 69 or a sequence having at least 80% identity thereto (the 3'-terminal consists of the nucleotide sequence of SEQ ID NO: 70).

[0034] In one embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3. The nucleotide sequence of SEQ ID NO: 3 is derived from the 5'UTR (SEQ ID NO: 69) of the alkaline cellulase gene of Bacillus sp. KSM-S237 (FERM BP-7875). In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 3.

[0035] In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 3. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 3. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of SEQ ID NO: 3. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3.

[0036] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4. The nucleotide sequence of SEQ ID NO: 4 is derived from the 5'UTR (SEQ ID NO: 69) of the alkaline cellulase gene of Bacillus sp. KSM-S237 (FERM BP-7875) and contains the nucleotide sequence of SEQ ID NO: 3. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 4. In another preferred embodiment, the heterologous polynucleotide is a fragment (21-93 nt) of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 that contains the nucleotide sequence of SEQ ID NO: 3.

[0037] In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 4 described above or a fragment thereof. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 4. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of SEQ ID NO: 4 described above or a fragment thereof. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3.

[0038] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 5. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 5. In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 5. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 5. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of SEQ ID NO: 5. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 5.

[0039] In another embodiment, the heterologous polynucleotide comprises the nucleotide sequence of SEQ ID NO: 6. In a preferred embodiment, the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO: 6. In another embodiment, the heterologous polynucleotide comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 6. In a preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 6. In another preferred embodiment, the heterologous polynucleotide consists of a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of SEQ ID NO: 6. However, these heterologous polynucleotides contain AGGAGG (SEQ ID NO: 1) at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 6. Preferably, these heterologous polynucleotides contain AGGAGGTAATATG (SEQ ID NO: 2) at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 6.

[0040] SEQ ID NO: 3: AATATTTAGGAGGTAATATG SEQ ID NO: 4: GTTTTTTTAAAACTTTAACGAAAGCACTTTCGGTAATGCTTATGAATTTAGCTATTTGAT TCAATTACTTTAAAAATATTTAGGAGGTAATATG SEQ ID NO: 5: TAATTTTAGGAGGTAATATG SEQ ID NO: 6: TAATTTAAGGAGGTAATATG

[0041] The heterologous polynucleotide can be prepared according to genetic engineering techniques known in the art. For example, the heterologous polynucleotide can be isolated from the genome of Bacillus bacteria (e.g., KSM-S237) according to known methods. Alternatively, a heterologous polynucleotide having a desired nucleotide sequence can be prepared by introducing mutations into the isolated polynucleotide according to known methods. Methods for nucleotide deletion, substitution, insertion, or addition to a nucleotide sequence are described, for example, in Dieffenbach et al. (Cold Spring Harbar Laboratory Press, New York, 581-621, 1995). Alternatively, the heterologous polynucleotide can be chemically synthesized. For chemical synthesis of polynucleotides, commercially available DNA synthesis services can be utilized.

[0042] The parental 5'UTR to be modified by the heterologous polynucleotide is preferably a 5'UTR contained in the promoter of a Bacillus gene. The promoter is preferably a high-function promoter that exhibits high transcriptional promoting activity in Bacillus bacteria. Examples of such promoters include promoters of genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, aprE, nprE, and amyE of Bacillus subtilis, and amyL and amyQ of B. licheniformis; the promoter of the Bacillus subtilis spoVG gene; promoters of ribosomal RNA genes and ribosome-related genes, such as those selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; the promoter of the cry crystal protein gene of B. thuringensis, such as the cryIIIA gene; the P43 promoter, SP82 promoter, or scr promoter of Bacillus bacteria, and the like. However, the parental 5'UTR does not have the sequence of SEQ ID NO: 70.

[0043] Preferably, the parental 5'UTR is derived from a promoter of a gene different from the gene from which the heterologous polynucleotide is derived. For example, when the heterologous polynucleotide contains the nucleotide sequences of SEQ ID NOs: 3 to 6, it is preferable that the parental 5'UTR is not the 5'UTR of the alkaline cellulase gene of Bacillus sp. KSM-S237.

[0044] The parental 5'UTR may be present in the genome in the cell, may be present in an isolated polynucleotide fragment (for example, a fragment of a region containing an isolated promoter), or may be contained in a vector such as an expression vector. For example, by a homologous recombination method or the like, a heterologous polynucleotide can be directly substituted or added to the parental 5'UTR in the genome in the cell. Alternatively, a modified 5'UTR can be constructed by substituting or adding a heterologous polynucleotide to the parental 5'UTR in a promoter fragment isolated from the genome or the parental 5'UTR on an expression vector.

[0045] The substitution or addition of the heterologous polynucleotide to the parental 5'UTR can be carried out according to a conventional method in the art. For example, a fragment containing the parental 5'UTR and a fragment containing the heterologous polynucleotide are amplified by PCR or the like, and the obtained fragments are ligated by SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): p61-68) to construct a modified 5'UTR. Alternatively, the modified 5'UTR can be constructed by inverse PCR using a primer encoding the polynucleotide of the modified 5'UTR with a vector containing the heterologous polynucleotide as a template.

[0046] In a preferred embodiment, the obtained modified 5'UTR contains the heterologous polynucleotide at its 3'-end. That is, the heterologous polynucleotide is added to the 3'-end of the parental 5'UTR, or the 3'-end of the parental 5'UTR is replaced with the heterologous polynucleotide. Preferably, the modified 5'UTR is constructed by replacing the 3'-end of the parental 5'UTR with the heterologous polynucleotide, and one or more nucleotides at the 3'-end of the parental 5'UTR are lost. The length of the 3'-terminal portion of the parental 5'UTR to be replaced with the heterologous polynucleotide is not particularly limited, for example, it is 20 nt or more, and at most all of the parental 5'UTR may be replaced.

[0047] In a preferred embodiment, the modified 5'UTR is constructed by replacing at least 20 nucleotides (1 to 20 nucleotides from the 3'-end) at the 3'-end of the parental 5'UTR with the heterologous polynucleotide, and does not contain at least 20 nucleotides at the 3'-end of the parental 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing at least 26 nucleotides (1 to 26 nucleotides from the 3'-end) at the 3'-end of the parental 5'UTR with the heterologous polynucleotide, and does not contain at least 26 nucleotides at the 3'-end of the parental 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing the region from the SD sequence (i.e., the sequence consisting of GGAGG) to the 3'-end of the parental 5'UTR with the heterologous polynucleotide, and does not contain the region from the SD sequence to the 3'-end of the parental 5'UTR. In another preferred embodiment, the modified 5'UTR is constructed by replacing the region from the sequence consisting of AGGAGG (SEQ ID NO: 1) to the 3'-end in the parental 5'UTR with the heterologous polynucleotide, and does not contain the region from the sequence consisting of SEQ ID NO: 1 to the 3'-end of the parental 5'UTR. In another preferred embodiment, the modified 5'UTR consists of the heterologous polynucleotide. That is, all of the parental 5'UTR is replaced with the heterologous polynucleotide.

[0048] The modified 5'UTR obtained in the present invention does not necessarily contain the SD sequence of the parental 5'UTR, but it may contain it. The length of the modified 5'UTR obtained in the present invention is not particularly limited as long as it can exert the gene expression enhancing effect.

[0049] In a further embodiment of the present invention, the modified 5'UTR may further contain at least one additional ribosome binding region (RBS) (i.e., a heterologous RBS). The heterologous RBS is located upstream of the SD sequence GGAGG contained in the modified 5'UTR. Preferably, the heterologous RBS is located upstream of the region consisting of AGGAGG (SEQ ID NO: 1) contained in the modified 5'UTR. More preferably, the heterologous RBS is located 8 nucleotides or more upstream of the region consisting of AGGAGG (SEQ ID NO: 1) contained in the modified 5'UTR. Even more preferably, the heterologous RBS is located upstream of the heterologous polynucleotide contained in the modified 5'UTR. When two or more heterologous RBSs are present, all of them are located upstream of the SD sequence contained in the modified 5'UTR, preferably upstream of the region consisting of SEQ ID NO: 1, more preferably 8 nucleotides or more upstream of the region consisting of SEQ ID NO: 1, and even more preferably upstream of the heterologous polynucleotide. When the modified 5'UTR contains two or more SD sequences, for example, when it contains an SD sequence derived from the parental 5'UTR and the heterologous polynucleotide, the heterologous RBS is located upstream of all of them. In this specification, when an RBS is "located upstream of a certain region (or sequence)", it means that the 3' end of the RBS is located upstream of the 5' end of the region (or sequence). Also in this specification, when an RBS is "located N nucleotides upstream of a certain region (or sequence)", it means that the 3' end of the RBS is located N nucleotides upstream of the 5' end of the region (or sequence).

[0050] In one embodiment, the modified 5'UTR does not contain the SD sequence derived from the parental 5'UTR, and the heterologous RBS is located 8 nucleotides or more upstream of the AGGAGG (SEQ ID NO: 1) region derived from the heterologous polynucleotide contained in the modified 5'UTR. When two or more heterologous RBSs are present, all of them are located 8 nucleotides or more upstream of the AGGAGG (SEQ ID NO: 1) region derived from the heterologous polynucleotide.

[0051] In another embodiment, the modified 5'UTR does not contain the SD sequence derived from the parental 5'UTR, and the heterologous RBS is located upstream of the heterologous polynucleotide contained in the modified 5'UTR. When two or more heterologous RBSs are present, all of them are located upstream of the heterologous polynucleotide.

[0052] The heterologous RBS is a polynucleotide containing the nucleotide sequence of AGGAGG (SEQ ID NO: 1). Examples of the heterologous RBS include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of any of the nucleotide sequences of SEQ ID NOs: 7 to 11, and a nucleotide sequence in which one or several nucleotides are deleted, substituted, added or inserted with respect to the nucleotide sequence of SEQ ID NO: 1 and any of the nucleotide sequences of SEQ ID NOs: 7 to 11, provided that it is a polynucleotide consisting of a nucleotide sequence containing AGGAGG (SEQ ID NO: 1). SEQ ID NO: 7: AGGAGGGA SEQ ID NO: 8: GAAAGGAGG SEQ ID NO: 9: GAAAGGAGGGA SEQ ID NO: 10: CGAAAGGAGGGAT SEQ ID NO: 11: CTTGAAAGGAGGGATGCCTAA

[0053] Among the heterologous RBSs, at least one is located 10 to 100 nucleotides downstream, preferably 10 to 60 nucleotides downstream, more preferably 13 to 55 nucleotides downstream from the transcription start point (or the transcription start point of the modified promoter including the modified 5'UTR described below) upstream of the modified 5'UTR. When two or more heterologous RBSs are present, the insertion positions of the remaining RBSs are not particularly limited, but are preferably located 10 to 150 nucleotides downstream, more preferably 10 to 100 nucleotides downstream, still more preferably 10 to 60 nucleotides downstream, and still more preferably 13 to 55 nucleotides downstream from the transcription start point. In this specification, "RBS is located N nucleotides downstream from the transcription start point" means that the 5'-end of the RBS is located N nucleotides downstream from the 3'-end of the transcription start point.

[0054] The modified 5'UTR containing the heterologous RBS can be constructed by substituting, inserting or adding the polynucleotide of the heterologous RBS to the modified 5'UTR containing the heterologous polynucleotide. For example, the polynucleotide of the heterologous RBS may be substituted, inserted or added upstream of the SD sequence or the heterologous polynucleotide region contained in the modified 5'UTR. Alternatively, the modified 5'UTR containing the heterologous RBS can be constructed by substituting, inserting or adding the polynucleotide of the heterologous RBS to the parental 5'UTR and then substituting or adding the heterologous polynucleotide downstream thereof. Alternatively, the modified 5'UTR containing the heterologous RBS can be constructed by substituting, in order from upstream, the polynucleotide of the heterologous RBS and the fragment containing the heterologous polynucleotide for part or all of the parental 5'UTR. The procedure for substituting, inserting or adding the polynucleotide of the heterologous RBS to the parental 5'UTR or the modified 5'UTR can be carried out according to known methods such as SOE-PCR or inverse PCR described above.

[0055] The modified 5'UTR obtained in the present invention functions to improve the expression of a gene controlled by a promoter containing the same. Specifically, the modified 5'UTR is located downstream of the transcription start point in the promoter and upstream of the ORF of the gene, and is operably linked to the ORF of the gene.

[0056] In a preferred embodiment, in the present invention, a modified promoter containing the modified 5'UTR is produced. The modified promoter is produced by modifying the 5'UTR contained in a promoter (parent promoter) containing no such heterologous polynucleotide. The modification of the 5'UTR is performed by substituting part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR. The modification of the 5'UTR may further include substitution, insertion or addition of a heterologous RBS to the 5'UTR. The heterologous polynucleotide and heterologous RBS used for the modification, and the method of substitution, insertion or addition of the heterologous polynucleotide or heterologous RBS to the 5'UTR are as described above. Therefore, the heterologous polynucleotide and heterologous RBS contained in the modified promoter are heterologous (derived from a different polynucleotide chain) with respect to the parent promoter. Preferably, the heterologous polynucleotide contained in the modified promoter is derived from a gene different from the parent promoter.

[0057] The parent promoter to be modified may be a promoter derived from the regulatory region of any gene, preferably a promoter of a Bacillus gene. The parent promoter is preferably a high-function promoter capable of exhibiting high transcriptional promoting activity in Bacillus bacteria. Preferred examples of the parent promoter include genes encoding secreted proteins of Bacillus bacteria, such as the endoglucanase gene of Bacillus sp. KSM-64, the endoglucanase gene of Bacillus sp. KSM-S237, aprE, nprE, and amyE of Bacillus subtilis, and promoters of genes selected from the group consisting of amyL and amyQ of B. licheniformis; the promoter of the Bacillus subtilis spoVG gene; promoters of ribosomal RNA genes and ribosome-related genes, such as genes selected from the group consisting of rrnO, rrnE, rrnI, rrnJ, rrnB, rpsD, rpsJ, and rpoD; the promoter of the cry crystal protein gene of B. thuringensis, such as the cryIIIA gene promoter; the P43 promoter, the SP82 promoter, the scr promoter, and modified promoters derived therefrom. Preferred examples include the promoter derived from the alkaline cellulase gene of Bacillus sp. KSM-64 represented by SEQ ID NO: 72, and the promoter of the Bacillus subtilis spoVG gene represented by SEQ ID NO: 76. Another preferred example of the parent promoter is a polynucleotide consisting of a nucleotide sequence having at least 80% identity with the nucleotide sequence represented by SEQ ID NO: 72 and having a function of controlling gene expression, or a polynucleotide consisting of a nucleotide sequence having at least 80% identity with the nucleotide sequence represented by SEQ ID NO: 76 and having a function of controlling gene expression. The function of controlling gene expression by the promoter polynucleotide can be measured by known methods.

[0058] The parent promoter may be present in the genome within the cell, may be an isolated polynucleotide fragment, or may be contained in a vector such as an expression vector. For example, a polynucleotide fragment of a parental promoter can be prepared from a Bacillus bacterium, and a modified promoter fragment can be constructed by replacing part or all of the 5'UTR contained in the fragment of the parental promoter with a heterologous polynucleotide, or by adding a heterologous polynucleotide to the 5'UTR. Alternatively, the 5'UTR contained in the parental promoter in the genome of a Bacillus bacterium can be modified by homologous recombination or the like to replace part or all of the 5'UTR with a heterologous polynucleotide, or to add a heterologous polynucleotide to the 5'UTR, thereby constructing a modified promoter in the genome. Alternatively, a modified promoter can be constructed in the genome by replacing the promoter in the genome of a Bacillus bacterium with a modified promoter containing the modified 5'UTR by homologous recombination or the like.

[0059] When the modified 5'UTR is placed in a promoter, it acts to improve gene expression. A modified promoter containing the modified 5'UTR can improve gene expression more than a parental promoter (i.e., the promoter before being modified to contain the modified 5'UTR) containing the parental 5'UTR before modification. Preferably, the modified promoter containing the modified 5'UTR increases the gene expression level by at least 10%, preferably at least 20%, more preferably at least 25%, and even more preferably at least 30% compared to the parental promoter. When the modified 5'UTR contains the aforementioned heterologous RBS, the modified promoter can further improve the gene expression level, preferably at least 40%, more preferably at least 50%, even more preferably at least 100%, even more preferably at least 200%, even more preferably at least 300%, and even more preferably at least 400% compared to the parental promoter.

[0060] The modified 5'UTR and the modified promoter containing the same can be used to improve the expression of a target gene. Accordingly, the present invention provides a polynucleotide containing the modified 5'UTR or the modified promoter containing the same, as well as their use for the expression of a target gene. Preferably, the polynucleotide is DNA.

[0061] In one embodiment, the polynucleotide containing the modified 5'UTR or the modified promoter can be directly introduced into the genome of a host cell. For example, the polynucleotide containing the modified 5'UTR or the modified promoter can be introduced into the genome of a host cell and operably linked to the target gene.

[0062] In one embodiment, the polynucleotide containing the modified 5'UTR or the modified promoter is an expression cassette. The expression cassette may further contain a cis element that improves the transcriptional activity of the promoter, or a 3'UTR, etc. in addition to the modified 5'UTR or the modified promoter. Furthermore, the expression cassette may contain a selection marker gene such as a drug resistance gene or an auxotrophic marker gene.

[0063] In one embodiment, the polynucleotide containing the modified 5'UTR or the modified promoter further contains a target gene. The target gene is operably linked to the modified 5'UTR or the modified promoter.

[0064] In one embodiment, the expression cassette is an expression vector. For example, the expression vector can be prepared by inserting the polynucleotide containing the modified 5'UTR or the modified promoter into any vector by a conventional method. For example, the polynucleotide is constructed to have restriction enzyme recognition sequences at both ends thereof. By incorporating this into an expression vector cleaved with a restriction enzyme, the expression vector of the present invention can be constructed (restriction enzyme method). Preferably, in the expression vector, the modified 5'UTR or the modified promoter is operably linked upstream of the polynucleotide of the target gene.

[0065] The type of the vector is not particularly limited, and it may be any vector such as a plasmid, phage, phagemid, cosmid, virus, YAC vector, shuttle vector, etc. The vector may be a vector for introduction into the genome of a host cell or a vector retained outside the genome. The vector is preferably a vector that can be amplified in bacteria, more preferably in Bacillus bacteria (e.g., Bacillus subtilis or its mutant strain). Preferably, the vector is an expression vector capable of inducing the expression of the introduced gene in Bacillus bacteria.

[0066] Examples of the vector include pUC-based vectors such as pBluescript II SK(-) (Stratagene), pUC18 / 19, pUC118 / 119 (Takara Bio), pET-based vectors (Takara Bio), pGEX-based vectors (GE Healthcare), pCold-based vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Plasmid, 1986, 15(2): 93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW-based vectors such as pMW118 / 119, pMW218 / 219 (Nippon Gene), pRI-based vectors such as pRI909 / 910 (Takara Bio), pBI-based vectors (Clontech), IN3-based vectors (Implanti Novations), pPTR1 / 2 (Takara Bio), pDJB2 (Gene, 1985, 36: 321-331), pAB4-1 (Mol Gen Genet, 1987, 206: 71-75), pLeu4 (Gene, 1989, 84: 335-343), pPyr225 (Mol Genet Genomics, 2002, 268: 397-406), pFG1 (Curr Genet, 1990, 18: 447-451), yeast expression vectors pNAN8142 (Biosci Biotechnol Biochem, 1996, 60: 383-389), pMA91 (Biosci Biotechnol Biochem, 1998, 62: 1615-1618), and the like.

[0067] The present invention also provides a transformant containing a polynucleotide comprising the modified 5'UTR or modified promoter. The transformant can be produced by introducing the polynucleotide comprising the modified 5'UTR or modified promoter into a host.

[0068] Examples of hosts for the transformant include microbial cells, preferably bacteria of the genus Bacillus, Clostridium bacteria, yeast, Escherichia coli, etc. Among these, bacteria of the genus Bacillus are preferred, and Bacillus subtilis or its mutant strains are more preferred. Therefore, the transformant of the present invention is preferably a recombinant bacterium of the genus Bacillus, more preferably a recombinant of Bacillus subtilis or its mutant strain.

[0069] For introducing the polynucleotide comprising the modified 5'UTR or modified promoter into a host cell, well-known transformation techniques such as the calcium phosphate method, electroporation method, lipofection method, particle gun method, PEG method, etc. can be applied. For example, methods applicable to Bacillus subtilis or its mutant strains include the competent cell transformation method (J Bacteriol, 1967, 93: 1925-1937), electroporation method (FEMS Microbiol Lett, 1990, 55: 135-138), protoplast transformation method (Mol Gen Genet, 1979, 168: 111-115), Tris-PEG method (J Bacteriol, 1983, 156: 1130-1134), etc.

[0070] The above-mentioned transformant can be used for the expression of a target gene. In the cells of the transformant, the modified 5'UTR or the modified promoter enhances the expression of the target gene operably linked thereto, thereby improving the productivity of the target substance by the transformant. For example, when the expression level of the target gene in the cells containing the expression cassette containing the modified promoter including the modified 5'UTR and the target gene is set to 100% of that in the cells containing the expression cassette containing the parental promoter and the target gene, the expression level of the target gene is preferably increased by at least 10%, more preferably by at least 20%, still more preferably by at least 30%. Further, when the modified 5'UTR contains the above-described heterologous RBS, the expression level of the target gene can be further improved. For example, when the expression level of the target gene in the cells containing the expression cassette containing the modified promoter including the modified 5'UTR containing the heterologous RBS and the target gene is set to 100% of that in the cells containing the expression cassette containing the parental promoter and the target gene, the expression level of the target gene is preferably increased by at least 50%, more preferably by at least 100%, still more preferably by at least 200%, still more preferably by at least 300%, still more preferably by at least 400%.

[0071] Therefore, the present invention also provides a method for producing a target substance including culturing the above-mentioned transformant. The culturing of the transformant can be carried out according to a general method in the art. For example, when the transformant is Bacillus subtilis or a mutant strain thereof, the medium for culturing it may contain a carbon source necessary for the growth of Bacillus subtilis and an inorganic nitrogen source or an organic nitrogen source. If necessary, the medium may contain other nutrients such as inorganic salts, vitamins, antibiotics and the like. Culture conditions such as temperature, aeration and agitation conditions, pH of the medium and culture time can be appropriately selected according to the type and properties of the microorganism, the culture scale and the like.

[0072] After culturing, the target substance can be recovered from the culture. If necessary, the recovered target substance may be further purified. The method for recovering or purifying the target substance from the culture is not particularly limited, and it may be carried out according to known recovery or purification methods. For example, the culture is recovered, and if necessary, cell disruption treatment such as ultrasonic waves or pressurization is performed, and then the cell components are removed by methods such as the inclination method, filtration, centrifugation, etc., and then the fraction containing the remaining target substance may be recovered. Alternatively, by operably linking a polynucleotide encoding a secretion signal peptide that functions in the transformant to the gene encoding the target substance, the target substance can be secreted and produced extracellularly. In this case, the fraction containing the target substance can be recovered without disrupting the cells.

[0073] If necessary, the fraction containing the recovered target substance can be subjected to methods such as dialysis, salting out, ion exchange method, distillation, solvent extraction, etc., or a combination thereof, to purify the target substance. In the method for producing the target substance according to the present invention, the culture of the transformant and the recovery of the target substance may be carried out by any of batch, semi-batch, and continuous methods.

[0074] As exemplary embodiments of the present invention, the following substances, production methods, uses, methods, etc. are further disclosed in this specification. However, the present invention is not limited to these embodiments.

[0075] [1] A DNA molecule containing a modified promoter, The modified promoter includes a modified 5'UTR containing a heterologous polynucleotide, The heterologous polynucleotide is a polynucleotide containing the nucleotide sequence of SEQ ID NO: 70, or a polynucleotide having at least 80% identity with the sequence, DNA molecule. [2] Preferably, the heterologous polynucleotide is any of the following polynucleotides a), c), d): a) A polynucleotide containing the nucleotide sequence of SEQ ID NO: 3, or a polynucleotide having at least 80% identity with the sequence; c) A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 80% identity with said sequence; d) A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 80% identity with said sequence, is the DNA molecule according to [1]. 〔3〕Preferably, the polynucleotide of a) above is as follows: b) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having at least 80% identity with said sequence, or a fragment thereof, The DNA molecule according to [2], comprising 〔4〕The heterologous polynucleotide is Preferably, it contains the nucleotide sequence of SEQ ID NO: 1 at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 70, More preferably, it contains the nucleotide sequence of SEQ ID NO: 1 at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3, or at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5 or 6, or Preferably, it contains the nucleotide sequence of SEQ ID NO: 2 at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 70, More preferably, it contains the nucleotide sequence of SEQ ID NO: 2 at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3, or at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 5 or 6, The DNA molecule according to any one of [1] to [3]. 〔5〕Preferably, the heterologous polynucleotide is 100 nt or less in length, the DNA molecule according to any one of [1] to [4]. 〔6〕Preferably, the modified 5'UTR is a DNA sequence in which part or all of the 5'UTR before modification is replaced with the heterologous polynucleotide, or a DNA sequence in which the heterologous polynucleotide is added to the 5'UTR before modification, The DNA molecule according to any one of [1] to [5]. 〔7〕Preferably, the heterologous polynucleotide is located at the 3'-end of the modified 5'UTR, and the DNA molecule according to any one of 〔1〕to 〔6〕. 〔8〕Preferably, the modified 5'UTR does not contain at least 20 nucleotides at the 3'-end of the 5'UTR before modification, or does not contain at least 26 nucleotides at the 3'-end of the 5'UTR before modification, or or does not contain the region from the Shine-Dalgarno (SD) sequence to the 3'-end of the 5'UTR before modification, and the DNA molecule according to 〔7〕. 〔7〕The DNA molecule according to 〔7〕. 〔9〕Preferably, in addition to the heterologous polynucleotide, the modified 5'UTR contains a heterologous ribosome-binding region, and the ribosome-binding region is located upstream of the region consisting of the nucleotide sequence of SEQ ID NO: 1 contained in the modified 5'UTR, and the DNA molecule according to any one of 〔1〕to 〔8〕. 〔10〕Preferably, the heterologous ribosome-binding region is located upstream of the heterologous polynucleotide, and the DNA molecule according to 〔9〕. 〔11〕Preferably, the modified 5'UTR contains one heterologous ribosome-binding region, and the heterologous ribosome-binding region is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, or the modified 5'UTR contains two or more heterologous ribosome-binding regions, and at least one of the two or more heterologous ribosome-binding regions is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, and the rest are located 10 to 150 nucleotides downstream from the transcription start point, and the DNA molecule according to 〔9〕or 〔10〕. 〔9〕or 〔10〕The DNA molecule according to 〔9〕or 〔10〕. 〔12〕Preferably, the parental promoter of the modified promoter is a promoter derived from the genus Bacillus, and the DNA molecule according to any one of 〔1〕to 〔11〕. [

[13] ]Preferably, the parent promoter is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 72 or a nucleotide sequence having at least 80% identity with the said sequence, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 or a nucleotide sequence having at least 80% identity with the said sequence, the DNA molecule according to [

[12] ]. [

[14] ]Preferably, the modified promoter consists of the nucleotide sequences of SEQ ID NO: 73, 74, 75, 77, 78, 79, and 80, the DNA molecule according to any one of [[1]] to [

[13] ]. [

[15] ]Preferably, it further contains a target gene, wherein the target gene is a polynucleotide encoding a target substance, or a substance involved in the biosynthesis or extracellular transport thereof, the DNA molecule according to any one of [[1]] to [

[14] ]. [

[16] ]The said target substance is preferably an enzyme or an insecticidal protein more preferably protease, lipase, amylase or Cry5B, the DNA molecule according to [

[15] ]. [

[17] ]Preferably, it is an expression cassette or an expression vector, the DNA molecule according to [

[15] ] or [

[16] ]. [

[18] ]A transformant containing the DNA molecule according to any one of [[1]] to [

[17] ]. [

[19] ]The said transformant contains the DNA molecule according to [

[17] ], which is an expression cassette containing the modified promoter and further containing a target gene, and when the expression level of the target gene in a cell containing an expression cassette containing the parent promoter of the modified promoter and further containing the target gene is taken as 100%, the transformant increases the expression level of the target gene, preferably by at least 10%, more preferably by at least 20%, still more preferably by at least 30%, still more preferably by at least 50%, still more preferably by at least 100%, still more preferably by at least 200%, still more preferably by at least 300%, still more preferably by at least 400%. The transformant described in

[18] . The transformant described in

[18] or

[19] , preferably a bacterium belonging to the genus Bacillus. A method for producing a target substance, comprising culturing the transformant according to any one of

[18] to

[20] .

[0076] A method for producing a modified promoter, which comprises modifying the 5'UTR contained in the parental promoter, wherein the modification of the 5'UTR comprises substituting part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR, the heterologous polynucleotide is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 70 or a nucleotide sequence having at least 80% identity with the sequence, and the parental promoter is a promoter comprising a 5'UTR that does not contain the heterologous polynucleotide. Method. 〔23〕Preferably, the heterologous polynucleotide is any of the following polynucleotides of a), c), and d): a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence having at least 80% identity with the sequence; c) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having at least 80% identity with the sequence; d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having at least 80% identity with the sequence, is the method described in

[22] . 〔24〕Preferably, the polynucleotide of a) is as follows: b) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having at least 80% identity with the sequence, or a fragment thereof, comprising the method described in

[23] . The heterologous polynucleotide is Preferably, it contains the nucleotide sequence of SEQ ID NO: 1 at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 70. More preferably, it contains the nucleotide sequence of SEQ ID NO: 1 at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3, or at a position corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5 or 6. Or Preferably, it contains the nucleotide sequence of SEQ ID NO: 2 at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 70. More preferably, it contains the nucleotide sequence of SEQ ID NO: 2 at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 3, or at a position corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO: 5 or 6. The method according to any one of

[22] to

[24] . 〔26〕Preferably, the method according to any one of

[22] to

[25] , wherein the heterologous polynucleotide has a length of 100 nt or less. 〔27〕Preferably, the modification of the 5'UTR includes substituting or adding the heterologous polynucleotide to the 5'UTR so that it is located at the 3'-end of the modified 5'UTR. The method according to any one of

[22] to

[26] . 〔28〕Preferably, the modification of the 5'UTR includes substituting at least 20 nucleotides at the 3'-end of the 5'UTR with the heterologous polynucleotide, or includes substituting at least 26 nucleotides at the 3'-end of the 5'UTR with the heterologous polynucleotide, or includes substituting the region from the Shine-Dalgarno (SD) sequence to the 3'-end in the 5'UTR with the heterologous polynucleotide. The method according to

[27] . 〔29〕Preferably, the modification of the 5'UTR further includes replacing, inserting or adding a ribosome binding region to the 5'UTR, and the ribosome binding region is located upstream of the region consisting of the nucleotide sequence of SEQ ID NO: 1 contained in the 5'UTR. The method according to any one of 〔22〕~〔28〕. 〔30〕Preferably, the heterologous ribosome binding region is located upstream of the heterologous polynucleotide. The method according to 〔29〕. 〔31〕Preferably, the modification of the 5'UTR includes replacing, inserting or adding one ribosome binding region to the 5'UTR, and the ribosome binding region is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, or the modification of the 5'UTR includes replacing, inserting or adding two or more ribosome binding regions to the 5'UTR, and at least one of the two or more ribosome binding regions is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter, and the rest are located 10 to 150 nucleotides downstream from the transcription start point. The method according to 〔29〕 or 〔30〕. 〔32〕Preferably, the parental promoter is a promoter derived from the genus Bacillus. The method according to any one of 〔22〕~〔31〕. 〔33〕Preferably, the parental promoter is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 72 or a nucleotide sequence having at least 80% identity with the sequence, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 or a nucleotide sequence having at least 80% identity with the sequence. The method according to 〔32〕.

Example

[0077] Hereinafter, the present invention will be described more specifically using examples. In the following examples and figures, a.u. means arbitrary unit.

[0078] Example 1 Construction of a plasmid for introducing a KP43 protease expression cassette A plasmid for introducing a protease expression cassette into the amyE locus in the B. subtilis genome by homologous recombination was constructed as follows. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 12) and the reverse primer (SEQ ID NO: 13) with the pMW119 plasmid as a template. Next, the insert fragment was amplified by PCR using the forward primer (SEQ ID NO: 14) and the reverse primer (SEQ ID NO: 15) with the ORF sequence of the amyE gene and the B. subtilis 168 strain genome as a template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-amy plasmid. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 16) and the reverse primer (SEQ ID NO: 17) with the pMW-amy plasmid as a template. Next, the insert fragment containing the ORF sequence of the spectinomycin resistance gene was amplified by PCR using the forward primer (SEQ ID NO: 18) and the reverse primer (SEQ ID NO: 19) with the kao119 strain genome (Patent No. 6088282) as a template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-amy-sp plasmid.

[0079] The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 16) and the reverse primer (SEQ ID NO: 20) with the pMW-amy-sp plasmid as a template. Next, the insert fragment was amplified by PCR using the forward primer (SEQ ID NO: 21) and the reverse primer (SEQ ID NO: 22) with P SP64 -TS43 (SEQ ID NO: 71) as a template. This insert fragment contains a synthetic promoter (P SP64, an expression cassette containing the ORF of the gene encoding the alkaline protease (KP43 protease) derived from Bacillus sp. KSM-KP43 (FERM BP-6532) (Accession No. 72) was included. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-TS43 plasmid.

[0080] Example 2 Construction of a Plasmid for Introducing a KP43 Protease Expression Cassette Containing a Modified 5'UTR The 5'UTR (UTR SP64 ) of the promoter (P SP64 ) contained in the pMW-TS43 plasmid constructed in Example 1 was modified. 1) Using the pMW-TS43 plasmid as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 24). Next, using pHY-YR288 (Japanese Patent Application Laid-Open No. 2022-019601) as a template, an insert fragment containing the sequence of SEQ ID NO: 4 was amplified by PCR using a forward primer (SEQ ID NO: 25) and a reverse primer (SEQ ID NO: 26). The sequence of SEQ ID NO: 4 was a partial fragment (94 nt) of the 5'UTR contained in the promoter of the endoglucanase gene derived from KSM-S237. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain the pMW-UTR S237 -a-TS43 plasmid. The promoter contained in the pMW-UTR S237 -a-TS43 plasmid was designated as P SP64 -UTR S237 -a.

[0081] 2) Further, a fragment was constructed by inverse PCR using pMW-TS43 as a template with a forward primer (SEQ ID NO: 27) and a reverse primer (SEQ ID NO: 28), and introduced into Escherichia coli by transformation to obtain pMW-UTR S237-b-TS43 plasmid was obtained. Furthermore, a fragment was constructed by inverse PCR using the forward primer (SEQ ID NO: 29) and the reverse primer (SEQ ID NO: 30) with pMW-TS43 as the template, and introduced into Escherichia coli by transformation to obtain pMW-UTR S237 -c-TS43 plasmid was obtained.

[0082] pMW-UTR S237 -a-TS43, pMW-UTR S237 -b-TS43, and pMW-UTR S237 The promoters respectively contained in -c-TS43, P SP64 -UTR S237 -a (SEQ ID NO: 73), P SP64 -UTR S237 -b (SEQ ID NO: 74), and P SP64 -UTR S237 -c (SEQ ID NO: 75) each had the modified 5'UTR shown in Figure 1. As shown in Figure 1, P SP64 -UTR S237 -a had the sequence (hatched part) of SEQ ID NO: 4 at the 3' end of the 5'UTR region, and P SP64 -UTR S237 -b and P SP64 -UTR S237 -c each had the sequence (hatched part) of SEQ ID NO: 3 at the 3' end of the 5'UTR.

[0083] Example 3 Construction of a plasmid for introducing a spoVG expression cassette containing a modified 5'UTR The promoter of the pMW-TS43 plasmid constructed in Example 1 was replaced with the promoter (P spoVG , SEQ ID NO: 76) of the spoVG gene of B. subtilis 168 strain. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 31) and the reverse primer (SEQ ID NO: 32) with the pMW-TS43 plasmid as the template. Next, by PCR using the forward primer (SEQ ID NO: 33) and the reverse primer (SEQ ID NO: 34) with the B. subtilis 168 strain genome as the template, the promoter (P spoVGThe insert fragment containing ()) was amplified. The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -TS43 plasmid.

[0084] In the above pMW-P spoVG The 5'UTR region (UTR spoVG ) of P in -TS43 plasmid was modified. Using pMW-P spoVG -TS43 as a template, a fragment was constructed by inverse PCR using a forward primer (SEQ ID NO: 35) and a reverse primer (SEQ ID NO: 36), and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -UTR spoVG -TS43 plasmid. As shown in Figure 2, the control region P S237 -UTR spoVG in this plasmid (SEQ ID NO: 77) had all of the 5'UTR of the parental promoter replaced with the sequence of SEQ ID NO: 3 (hatched part). S237 (SEQ ID NO: 77) had all of the 5'UTR of the parental promoter replaced with the sequence of SEQ ID NO: 3 (hatched part).

[0085] Example 4 Construction of a plasmid for introducing an amylase expression cassette containing a modified 5'UTR The YR288 amylase expression cassette was constructed as follows. Using the pMW-TS43 plasmid constructed in Example 1 as a template, a vector fragment was amplified by PCR using a forward primer (SEQ ID NO: 23) and a reverse primer (SEQ ID NO: 37). Next, using pHY-YR288 (Japanese Patent Laid-Open No. 2022-019601) as a template, an insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using a forward primer (SEQ ID NO: 38) and a reverse primer (SEQ ID NO: 39). The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -YR288 plasmid.

[0086] The pMW-UTR constructed in Example 2 S237The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 40) with the -a-TS43 plasmid as the template. Next, the insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using the forward primer (SEQ ID NO: 41) and the reverse primer (SEQ ID NO: 39) with pHY-YR288 as the template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -UTR S237 -a-YR288 plasmid.

[0087] pMW-P constructed in Example 3 spoVG -TS43 as the template, the vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 42). Next, the insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using the forward primer (SEQ ID NO: 43) and the reverse primer (SEQ ID NO: 39) with pHY-YR288 as the template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -YR288 plasmid.

[0088] pMW-P constructed in Example 3 spoVG -UTR S237 -TS43 as the template, the vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 44). Next, the insert fragment containing the ORF sequence of the YR288 amylase gene was amplified by PCR using the forward primer (SEQ ID NO: 41) and the reverse primer (SEQ ID NO: 39) with pHY-YR288 as the template. The vector fragment and the insert fragment were ligated by an In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -UTR S237 -YR288 plasmid.

[0089] pMW-P spoVG -UTRS237 - Using inverse PCR with the -YR288 plasmid as a template and forward primer (SEQ ID NO: 45) and reverse primer (SEQ ID NO: 46), a fragment was constructed and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -UTR S237 -mut1-YR288 plasmid was obtained. Also, pMW-P spoVG -UTR S237 - Using inverse PCR with -YR288 as a template and forward primer (SEQ ID NO: 47) and reverse primer (SEQ ID NO: 48), a fragment was constructed and introduced into Escherichia coli by transformation to obtain pMW-P spoVG -UTR S237 -mut2-YR288 plasmid was obtained. The regulatory regions P spoVG -UTR S237 -mut1 (SEQ ID NO: 78) and P spoVG -UTR S237 -mut2 (SEQ ID NO: 79) each had the sequences of SEQ ID NO: 5 and SEQ ID NO: 6 at the 3' end of the 5'UTR.

[0090] Example 5 Construction of Plasmid for Introducing Cry5B Expression Cassette Containing Modified 5'UTR A Cry5B expression cassette was constructed. The vector fragment was amplified by PCR using the pMW-TS43 plasmid constructed in Example 1 as a template and forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 37). Next, the insert fragment containing the ORF sequence of the Cry5B gene was amplified by PCR using pHY-Pscry5B (Patent No. 7218090) as a template and forward primer (SEQ ID NO: 49) and reverse primer (SEQ ID NO: 50). The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -cry5B plasmid.

[0091] pMW-UTR constructed in Example 2 S237The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 40) with the -a-TS43 plasmid as the template. Next, the insert fragment containing the ORF sequence of the Cry5B gene was amplified by PCR using the forward primer (SEQ ID NO: 51) and the reverse primer (SEQ ID NO: 50) with pHY-Pscry5B as the template. The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -UTR S237 -a-cry5B plasmid.

[0092] Example 6 Construction of a plasmid for introducing a lipase expression cassette containing a modified 5'UTR A lipase expression cassette was constructed. The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 37) with the pMW-TS43 plasmid constructed in Example 1 as the template. Next, the insert fragment containing the ORF sequence of the lipase gene was amplified by PCR using the forward primer (SEQ ID NO: 53) and the reverse primer (SEQ ID NO: 54) with pHY-CnLip (SEQ ID NO: 52) as the template. The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -Lip plasmid.

[0093] pMW-UTR constructed in Example 2 S237 The vector fragment was amplified by PCR using the forward primer (SEQ ID NO: 23) and the reverse primer (SEQ ID NO: 40) with the -a-TS43 plasmid as the template. Next, the insert fragment containing the ORF sequence of the lipase gene was amplified by PCR using the forward primer (SEQ ID NO: 55) and the reverse primer (SEQ ID NO: 54) with pHY-CnLip as the template. The vector fragment and the insert fragment were ligated by In-Fusion reaction and introduced into Escherichia coli by transformation to obtain pMW-P SP64 -UTR S237 -a-Lip plasmid.

[0094] Example 7 Addition of RBS to the KP43 protease control region containing a modified 5'UTR Consideration was given to adding a ribosome binding region (RBS) (CTTGAAAGGAGGGATGCCTAA; SEQ ID NO: 11) to the KP43 protease control region containing a modified 5'UTR. pMW-P constructed in Example 5 SP64 -UTR S237 -a-cry5B plasmid was used as a template to construct a fragment by inverse PCR using a forward primer (SEQ ID NO: 56) and a reverse primer (SEQ ID NO: 57), and the fragment was transformed into Escherichia coli to obtain pMW-P SP64 -UTR S237 -a-RBS-cry5B. As shown in Figure 3, the control region P of this plasmid SP64 -UTR S237 -a-RBS (SEQ ID NO: 80) had an RBS (black bar) added downstream of the transcription start point and had the sequence of SEQ ID NO: 4 (hatched part) at the 3' end of the 5'UTR.

[0095] Example 8 Preparation of recombinant Bacillus bacteria containing a modified 5'UTR 1) Construction of a prsA overexpression strain An overexpression cassette (SEQ ID NO: 58) of the prsA gene was introduced into a sigF gene deletion strain (ΔsigF strain: Patent No. 4336082) of B. subtilis 168 to prepare a prsA overexpression strain. The DNA fragment for introducing the prsA overexpression cassette was constructed by the following method. First, the following PCR fragments 1 to 3 were constructed: PCR fragment 1: forward primer; SEQ ID NO: 59, reverse primer; SEQ ID NO: 60, template DNA; prsA-Ka strain genomic DNA (Patent No. 4839144); PCR fragment 2: forward primer; SEQ ID NO: 61, reverse primer; SEQ ID NO: 62), template DNA: MazF cassette (Genet. Syst., 84(4):315-318,2009); PCR fragment 3: forward primer; SEQ ID NO: 63, reverse primer; SEQ ID NO: 64), template DNA: 168 strain genomic DNA. The PCR fragments 1 to 3 were ligated by SOE-PCR (forward primer; SEQ ID NO: 65, reverse primer; SEQ ID NO: 66) to construct a DNA fragment for introducing the prsA overexpression cassette. The constructed DNA fragment for introducing the prsA overexpression cassette was introduced into the ΔsigF strain, and the prsA overexpression cassette was introduced into the nprE locus of the ΔsigF strain. Gene introduction was performed by homologous recombination according to the marker-free deletion method developed by Morimoto et al. (Genet. Syst., 84(4):315-318, 2009) (Figure 4). Using the obtained prsA overexpressing ΔsigF strain (ΔsigF-prsA strain) as the parent strain, it was used for the preparation of recombinant Bacillus bacteria into which the following target gene expression cassettes were introduced.

[0096] 2) Introduction of the target gene expression cassette into the parent strain genome Strains expressing protease and amylase were constructed by the following method. A PCR fragment for genome introduction was obtained by PCR using the forward primer (SEQ ID NO: 67) and the reverse primer (SEQ ID NO: 68) with the plasmid for introducing the target gene expression cassette constructed in Examples 1 to 4 and 7 as a template. This PCR fragment was introduced into the ΔsigF-prsA strain prepared in 1) above by the competent cell method (see Patent No. 6088282), and was transformed and introduced by homologous recombination into the amyE gene locus on the genome.

[0097] Strains expressing Cry5B and lipase were constructed by the following method. A PCR fragment for genome introduction was obtained by PCR using the forward primer (SEQ ID NO: 67) and the reverse primer (SEQ ID NO: 68) with the plasmid for introducing the target gene expression cassette constructed in Examples 5 to 6 as a template. This PCR fragment was introduced into the ΔsigF strain (Patent No. 4336082) by the competent cell method (see Patent No. 6088282), and was introduced by homologous recombination into the amyE gene locus on the genome to prepare a recombinant Bacillus bacterium into which the expression cassette was introduced.

[0098] Example 9 Production of target protein by culturing recombinant Bacillus bacteria The recombinant Bacillus bacterium into which the target gene expression cassette obtained in Example 8 was introduced was shake-cultured overnight at 30 °C and 180 rpm in 2 mL of LB medium in a 10-mL round-bottom Spitz tube. 500 μL of the obtained culture solution was aliquoted and inoculated into 20 mL of 2×L-maltose medium (2% peptone, 1% yeast extract, 1% NaCl, 7.5% maltose, 7.5 ppm manganese tetra-hydrate, antifoaming agent; % is v / w%). This was cultured at 32 °C (30 °C for the Cry5B-expressing strain and the lipase-expressing strain) and 210 rpm for 72 hours.

[0099] Example 10 Measurement of the production amount of the target protein 1) Method The production amount of the target protein by the recombinant Bacillus bacterium prepared in Example 8 was measured. The production amount of protease was determined as the protease activity value. After completion of the culture in Example 9, the protease activity of the culture supernatant from which the cells had been removed was measured by the following procedure. 0.9 mL of 1 / 15 M phosphate buffer (pH 7.4) and 0.05 mL of a 40 mM Glt-Ala-Ala-Pro-Leu-p-nitroanilide / dimethyl sulfoxide solution were placed in a test tube and incubated at 30 °C for 5 minutes. 0.05 mL of the culture supernatant was added thereto, and after reacting at 30 °C for 10 minutes, 2.0 mL of a 5% (w / v) aqueous citric acid solution was added to stop the reaction, and the absorbance at 420 nm was measured using a spectrophotometer and used as the protease activity value. The protease activity value of the recombinant Bacillus bacterium into which the expression cassette containing the modified 5'UTR was introduced was shown as a relative value (a.u.) with the activity of the recombinant Bacillus bacterium into which the expression cassette containing the unmodified 5'UTR was introduced set to 1.

[0100] The production amount of amylase was determined as the amylase activity value. The amylase activity was measured by the following method. After the completion of the culture in Example 9, the amylase activity of the culture supernatant from which the cells had been removed was measured by the following procedure. An aqueous solution in which 1 tablet of Phadebas amylase test was suspended in 5 mL of 1 / 15 M phosphate buffer (pH 7.4) was added to a test tube at 0.9 mL and incubated at 30 °C for 15 minutes. To this, 0.05 mL of the enzyme solution (culture supernatant) appropriately diluted with 2 mM calcium chloride aqueous solution was added and reacted at 30 °C for exactly 10 minutes, and then 2 mL of 5% (w / v) citric acid aqueous solution was added to stop the reaction. The supernatant obtained by centrifuging the enzyme reaction solution at 3000 rpm for 5 minutes was measured for the absorbance at 750 nm using a spectrophotometer and used as the amylase activity value. The amylase activity value of the recombinant Bacillus bacterium into which the expression cassette containing the modified 5'UTR was introduced was shown as a relative value (a.u.) with the activity of the recombinant Bacillus bacterium into which the expression cassette containing the unmodified 5'UTR was introduced being set to 1.

[0101] The production amount of Cry5B was determined as the protein concentration. The Cry5B protein concentration was measured by the method described in Patent No. 7218090. Specifically, after the completion of the culture in Example 9, the Cry5B concentration in the culture supernatant from which the cells had been removed was measured by the following procedure. SDS-PAGE was performed on the culture supernatant and bovine serum albumin (BSA) (manufactured by Wako Pure Chemical Industries, Ltd.) as a standard protein. The gel was stained with Bio-Safe TM Coomassie (BIO-RAD) while shaking for 1 hour and decolorized with ion-exchanged water. The brightness of each band in the gel image was analyzed using the image software ImageJ (rsb.info.nih.gov / ij / download.html) developed by the National Institutes of Health (NIH) of the United States. A calibration curve was created from the BSA data. The Cry5B protein concentration was calculated from this calibration curve. The Cry5B protein concentration of the recombinant Bacillus bacterium into which the expression cassette containing the modified 5'UTR was introduced was shown as a relative value (a.u.) with the Cry5B protein concentration of the recombinant Bacillus bacterium into which the expression cassette containing the unmodified 5'UTR was introduced being set to 1.

[0102] The production amount of lipase was determined as the lipase activity value. After the completion of the culture in Example 9, the lipase activity of the culture supernatant from which the cells had been removed was measured by the following method. The activity of lipase was determined by measuring the rate of increase in absorbance associated with the release of p-nitrophenol due to the action of lipase. A substrate solution was prepared by adding p-nitrophenyl butyrate (pNPB) (SIGMA) to 20 mM Tris-HCl (pH 7.0) at a final concentration of 2 mM and mixing. 4 μL of the culture supernatant appropriately diluted with 20 mM Tris-HCl (pH 7.0) and 100 μL of the substrate solution were mixed in each well of a 96-well assay plate, and the change in absorbance at 405 nm (OD / min) was measured at 30°C. The difference ΔOD / min from the blank (sample without addition of the culture supernatant) was determined. The lipase activity of the recombinant Bacillus bacterium into which the expression cassette containing the modified 5'UTR was introduced was shown as a relative value (a.u.) with the lipase activity of the recombinant Bacillus bacterium into which the expression cassette containing the unmodified 5'UTR was introduced set to 1.

[0103] 2) Results Figure 5 shows the improvement in the production amount of KP43 protease by the recombinant Bacillus bacterium into which the KP43 protease expression cassette having the modified P SP64 -promoter (P SP64 -UTR S237 -a, b and c) containing the modified 5'UTR constructed in Example 2 was introduced. When the production amount of KP43 protease using the parental promoter (P SP64 -UTR S237 -a, b and c) containing the unmodified 5'UTR was set to 100%, the production amount of protease in the recombinant Bacillus bacterium was improved by 45%, 38% and 42% respectively compared to the parental promoter. Figure 6 shows the improvement in the production amount of KP43 protease by the recombinant Bacillus bacterium into which the spoVG promoter (P SP64 -UTR SP64 ) containing the modified 5'UTR constructed in Example 3 was introduced. The P spoVG -UTR S237 ) containing the modified 5'UTR shows that the parental promoter (P spoVG -UTR S237 containing the unmodified 5'UTRspoVG -UTR spoVG ) improved the protease production in recombinant Bacillus by 4.0-fold compared with

[0104] Figure 7 shows the improvement in amylase production by recombinant Bacillus into which an amylase expression cassette having the modified 5'-UTR constructed in Example 4, SP64 promoter (P SP64 -UTR S237 -a) was introduced. The P having the modified 5'-UTR SP64 -UTR S237 -a improved the amylase production in recombinant Bacillus by 2.7-fold compared with the parental promoter (P SP64 -UTR SP64 ) containing the unmodified 5'-UTR. Figure 8 shows the improvement in amylase production by recombinant Bacillus into which an amylase expression cassette having the spoVG promoter (P spoVG -UTR S237 , P spoVG -UTR S237 -mut1 and P spoVG -UTR S237 -mut2) containing the modified 5'-UTR was introduced. The P having the modified 5'-UTR spoVG -UTR S237 , P spoVG -UTR S237 , P spoVG -UTR S237 -mut2 improved the amylase production in recombinant Bacillus by 7.5-fold, 2.6-fold, and 7.8-fold, respectively, compared with the parental promoter (P spoVG -UTR spoVG ) containing the unmodified 5'-UTR.

[0105] Figure 9 shows the improvement in Cry5B production by recombinant Bacillus into which a Cry5B expression cassette having the modified 5'-UTR constructed in Example 5, SP64 promoter (P SP64 -UTR S237 -a) was introduced. The P having the modified 5'-UTR SP64 -UTR S237-a improved the Cry5B production level in recombinant Bacillus bacteria by 3.3-fold compared to the parental promoter (P SP64 -UTR SP64 ) that contains the unmodified 5'UTR.

[0106] Figure 10 shows the improvement of lipase production level by recombinant Bacillus bacteria into which a lipase expression cassette having the modified promoter (P SP64 promoter (P SP64 -UTR S237 -a) containing the modified 5'UTR was introduced. P SP64 -UTR S237 -a containing the modified 5'UTR improved the lipase production level in recombinant Bacillus bacteria by 34% compared to the parental promoter (P SP64 -UTR SP64 ) that contains the unmodified 5'UTR.

[0107] Figure 11 shows the improvement of Cry5B production level by recombinant Bacillus bacteria into which a Cry5B expression cassette having the modified promoter (P SP64 promoter (P SP64 -UTR S237 -a-RBS) containing the modified 5'UTR with an additional RBS was introduced. The modified promoter (P SP64 -UTR S237 -a-RBS) with the additional RBS improved the Cry5B production level by 56% compared to the modified promoter (P SP64 -UTR S237 -a) without the additional RBS, when the Cry5B production level using the modified promoter without the additional RBS (P SP64 -UTR S237 -a) is set to 100%. Also, P SP64 -UTR S237 -a-RBS improved the Cry5B production level in recombinant Bacillus bacteria by 5.1-fold compared to the parental promoter (P SP64 -UTR SP64 ) that contains the unmodified 5'UTR.

Claims

1. A DNA molecule comprising a modified promoter, wherein the modified promoter comprises a modified 5'UTR containing a heterologous polynucleotide, and the heterologous polynucleotide is any one of the polynucleotides of a) to d) below: a) A polynucleotide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence of SEQ ID NO: 3 and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3; b) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof containing the nucleotide sequence of SEQ ID NO: 3, or a polynucleotide having at least 90% identity with the polynucleotide or its fragment and consisting of a nucleotide sequence containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3; c) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having at least 90% identity with the sequence and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5; d) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having at least 90% identity with the sequence and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 6, and the modified promoter improves the gene expression level as compared with the parental promoter before being modified to include the modified 5'UTR, DNA molecule.

2. The DNA molecule according to Claim 1, wherein the polynucleotides of a) to d) above contain the nucleotide sequence of SEQ ID NO: 2 at positions corresponding to positions 8 to 20 of the nucleotide sequence of SEQ ID NO:

3.

3. The DNA molecule according to Claim 1, wherein the 3' end of the heterologous polynucleotide consists of the nucleotide sequence of SEQ ID NO:

70.

4. The DNA molecule according to Claim 1, wherein the heterologous polynucleotide is 100 nt or less in length.

5. The DNA molecule according to Claim 1, wherein the heterologous polynucleotide is located at the 3' end of the modified 5'UTR.

6. The modified 5'UTR contains, in addition to the heterologous polynucleotide, a heterologous ribosome binding region, and the ribosome binding region is located upstream of the region consisting of the nucleotide sequence of AGGAGG contained in the modified 5'UTR. The DNA molecule according to claim 1.

7. The DNA molecule according to claim 6, wherein the heterologous ribosome binding region is located upstream of the heterologous polynucleotide.

8. The DNA molecule according to claim 6, wherein the heterologous ribosome binding region is located 10 to 100 nucleotides downstream from the transcription start point of the modified promoter.

9. The DNA molecule according to claim 1, wherein the parent promoter of the modified promoter is a promoter derived from the genus Bacillus.

10. The DNA molecule according to claim 9, wherein the parent promoter is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 72 or a nucleotide sequence having at least 85% identity with the sequence, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 76 or a nucleotide sequence having at least 85% identity with the sequence.

11. The DNA molecule according to claim 1, further comprising a target gene.

12. The DNA molecule according to claim 11, which is an expression cassette or an expression vector.

13. A transformant containing the DNA molecule according to claim 12.

14. The transformant contains the modified promoter and further contains an expression cassette containing a target gene, and when the expression level of the target gene in a cell containing an expression cassette containing the parent promoter of the modified promoter and further containing the target gene is set to 100%, the transformant increases the expression level of the target gene by at least 10%. The transformant according to claim 13.

15. The transformant according to claim 13, which is a bacterium of the genus Bacillus.

16. A method for producing a target substance, comprising culturing the transformant according to claim 13.

17. A method for producing a modified promoter, the method includes modifying the 5'UTR contained in the parent promoter, the modification of the 5'UTR includes substituting part or all of the 5'UTR with a heterologous polynucleotide or adding the heterologous polynucleotide to the 5'UTR. The heterologous polynucleotide is any of the polynucleotides of a) to d) below: a) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity with said sequence and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3; b) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof containing the nucleotide sequence of SEQ ID NO: 3, or A polynucleotide having at least 90% identity with said polynucleotide or a fragment thereof and consisting of a nucleotide sequence containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 3; c) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 90% identity with said sequence and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 5; d) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity with said sequence and containing the nucleotide sequence AGGAGG at positions corresponding to positions 8 to 13 of the nucleotide sequence of SEQ ID NO: 6, wherein the parental promoter is a promoter containing a 5'UTR that does not contain the heterologous polynucleotide, the modified promoter improves the gene expression level as compared with the parental promoter, method.

Images