Compositions and Methods for Immuno-Oncology

CRISPR systems with gRNA molecules are used to modify T cells for precise genome editing and chimeric antigen receptor expression, addressing the need for effective T-cell targeting in cancer therapy.

JP7709408B2Active Publication Date: 2025-07-16NOVARTIS AG +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2022095202
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-09-14
Filing Date
2022-06-13
Publication Date
2025-07-16
Estimated Expiration
2036-12-02

AI Technical Summary

Technical Problem

Current technologies lack effective methods for modifying T cells to target specific sequences in their genomes for immunotherapy, particularly in treating cancer, with a need for precise genome editing and expression of chimeric antigen receptors.

Method used

The use of CRISPR systems, specifically gRNA molecules targeting allogeneic T-cell sequences, to modify T cells for genome editing and expression of chimeric antigen receptors, enabling precise targeting and modification of T cells for cancer treatment.

Benefits of technology

Achieves high efficiency in modifying T cells to express chimeric antigen receptors, enhancing their cancer-targeting capabilities and reducing off-target effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007709408000571
    Figure 0007709408000571
  • Figure 0007709408000572
    Figure 0007709408000572
  • Figure 0007709408000573
    Figure 0007709408000573
Patent Text Reader

Abstract

Provided are gRNAs that can improve the efficacy, survival, function, and / or viability of allogeneic cells, e.g., allogeneic T cells (e.g., comprising a nucleic acid sequence encoding a chimeric antigen receptor), by reducing or eliminating host-versus-graft or graft-versus-host responses, and the like. [Solution] A gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a targeting domain complementary to a target sequence within B2M, and the targeting domain comprises 17, 18, 19, or 20 consecutive nucleotides of a specific sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 263,169, filed on December 4, 2015 ; U.S. Provisional Patent Application No. 62 / 316,784, filed on April 1, 2016; and U.S. Provisional Patent Application No. 62 / 394,290, filed on September 14, 2016 . The entire contents of these applications are incorporated herein by reference .

[0002] Background CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) evolved in bacteria as an adaptive immune system to defend against viral attack . Upon exposure to a virus, short segments of viral DNA are integrated into the CRISPR locus of the bacterial genome . RNA is transcribed from a portion of the CRISPR locus that contains the viral sequence . This RNA, which contains a sequence complementary to the viral genome, mediates the targeting of the Cas9 protein to a sequence within the viral genome . The Cas9 protein cleaves the viral target, thereby silencing the viral target .

[0003] In recent years, the CRISPR / Cas system has been adapted for genome editing in eukaryotic cells. Introduction of site-specific single-strand breaks (SSBs) or double-strand breaks (DSBs) enables alteration of target sequences, for example, via non-homologous end joining (NHEJ) or homology-directed repair (HDR) .

[0004] Summary of the Invention The invention described herein is directed to compositions and methods for immuno - oncology, e.g., cells modified at specific target sequences within their genomes, the cells being modified by introduction of a CRISPR system comprising a gRNA molecule targeting said target sequence, and methods of making and using them. For example, the present disclosure relates to gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of T cells, e.g., T cells further engineered to express a chimeric antigen receptor, and useful for treating diseases such as cancer. cells modified at specific target sequences within their genomes, the cells being modified by introduction of a CRISPR system comprising a gRNA molecule targeting said target sequence and methods of making and using them. For example, the present disclosure relates to gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of cells, e.g., T cells, e.g., T cells further engineered to express a chimeric antigen receptor, and useful for treating diseases such as cancer. In a first aspect, the invention provides a gRNA molecule comprising a tracr and a crRNA, wherein the crRNA comprises a targeting domain complementary to a target sequence of an allogeneic T - cell target selected from B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HLA - A, HLA - B, HLA - C, DCK, CD52, FKBP1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C1. In a plurality of embodiments for the gRNA molecule,

[0005] either (a) the allogeneic T - cell target is B2M and the targeting domain comprises any one of SEQ ID NO: 1 - SEQ ID NO: 83 or SEQ ID NO: 5492 - SEQ ID NO: 5527; or (b) the allogeneic T - cell target is TRAC and the targeting domain comprises any one of SEQ ID NO: 5528 - SEQ ID NO: 5623 or SEQ ID NO: 5816 - SEQ ID NO: 5965.

[0006] ​​​​​​​​​​​2(c) The allogeneic T cell target is TRBC1, and the targeting domain contains any one of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097; 2(d) The allogeneic T cell target is TRBC2, and the targeting domain contains any one of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226; 2(e) The allogeneic T cell target is CD247, and the targeting domain contains any one of SEQ ID NO: 84 to SEQ ID NO: 392; 2(f) The allogeneic T cell target is CD3D, and the targeting domain contains any one of SEQ ID NO: 393 to SEQ ID NO: 532, or SEQ ID NO: 10780 to SEQ ID NO: 10794; 2(g) The allogeneic T cell target is CD3E, and the targeting domain contains any one of SEQ ID NO: 533 to SEQ ID NO: 839, or SEQ ID NO: 10677 to SEQ ID NO: 10764; 2(h) The allogeneic T cell target is CD3G, and the targeting domain contains any one of SEQ ID NO: 840 to SEQ ID NO: 968, or SEQ ID NO: 10765 to SEQ ID NO: 10779; 2(i) The allogeneic T cell target is HLA-A, and the targeting domain contains any one of SEQ ID NO: 969 to SEQ ID NO: 1345; 2(j) The allogeneic T cell target is HLA-B, and the targeting domain contains any one of SEQ ID NO: 1346 to SEQ ID NO: 1698; 2(k) The allogeneic T cell target is HLA-C, and the targeting domain contains any one of SEQ ID NO: 1699 to SEQ ID NO: 2037; 2(l) The allogeneic T cell target is HLA-DRB1, and the targeting domain contains any one of SEQ ID NO: 2038 to SEQ ID NO: 2372; 2(m) The allogeneic T cell target is HLA-DQB1, and the targeting domain contains any one of SEQ ID NO: 2373 to SEQ ID NO: 2648; 2(n) The allogeneic T cell target is HLA-DPA1, and the targeting domain contains any one of SEQ ID NO: 2649 to SEQ ID NO: 2830; 2(o) The allogeneic T cell target is HLA-DPB1, and the targeting domain contains any one of SEQ ID NO: 2831 to SEQ ID NO: 3101; 2(p) The allogeneic T cell target is CD4, and the targeting domain contains any one of SEQ ID NO: 3102 to SEQ ID NO: 3357; 2(q) The allogeneic T cell target is CD8A, and the targeting domain contains any one of SEQ ID NO: 3358 to SEQ ID NO: 3573; 2(r) The allogeneic T cell target is CD8B, and the targeting domain contains any one of SEQ ID NO: 3574 to SEQ ID NO: 3788; 2(s) The allogeneic T cell target is CD28, and the targeting domain contains any one of SEQ ID NO: 3789 to SEQ ID NO: 3993; 2(t) The allogeneic T cell target is CTLA4, and the targeting domain contains any one of SEQ ID NO: 3994 to SEQ ID NO: 4198; 2(u) The allogeneic T cell target is PDCD1, and the targeting domain contains any one of SEQ ID NO: 4199 to SEQ ID NO: 4403; 2(v) The allogeneic T cell target is LAG3, and the targeting domain contains any one of SEQ ID NO: 4404 to SEQ ID NO: 4608; 2(w) The allogeneic T cell target is TIM3, and the targeting domain contains any one of SEQ ID NO: 4609 to SEQ ID NO: 4813; 2(x) The allogeneic T cell target is TIGIT, and the targeting domain contains any one of SEQ ID NO: 4814 to SEQ ID NO: 5018; comprising any one of SEQ ID NOs: 1699 to 2068; 2(l) The allogeneic T cell target is DCK, and the targeting domain comprises any one of SEQ ID NOs: 5278 to 5491; 2(m) The allogeneic T cell target is CD52, and the targeting domain comprises any one of SEQ ID NOs: 6227 to 6324; 2(n) The allogeneic T cell target is FKBP1A, and the targeting domain comprises any one of SEQ ID NOs: 6325 to 6583, or any one of SEQ ID NOs: 6662 to 6749; 2(o) The allogeneic T cell target is NR3C1, and the targeting domain comprises any one of SEQ ID NOs: 2069 to 2941; 2(p) The allogeneic T cell target is CIITA, and the targeting domain comprises any one of SEQ ID NOs: 6750 to 7716, or any one of SEQ ID NOs: 7717 to 7804; or 2(q) The allogeneic T cell target is NLRC5, and the targeting domain comprises any one of SEQ ID NOs: 8622 to 10089.

[0007] In a plurality of embodiments of the gRNA molecule, the allogeneic T cell target is TRAC, and the targeting domain is SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 559 8, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID ​​comprising Accession No. 5608, Accession No. 5617, Accession No. 5619, or Accession No. 5620, For example, the targeting domain comprises Accession No. 5569, Accession No. 5586, Accession No. 5587, Accession No. 5592, Accession No. 5599, or Accession No. 5600, for example , the targeting domain comprises Accession No. 5569, Accession No. 5587, Accession No. 5592 , or Accession No. 5586, for example, the targeting domain comprises Accession No. 556 9.

[0008] In multiple embodiments of the gRNA molecule, the allogeneic T cell target is TRBC2, and the targeting domain comprises Accession No. 5719, Accession No. 5694, Accession No. 570 6, Accession No. 5696, Accession No. 5711, Accession No. 5708, Accession No. 5709, Accession No. 5712, Accession No. 5703, Accession No. 5707, Accession No. 5687, Accession No. 57 05, Accession No. 5713, Accession No. 5715, or Accession No. 5710.

[0009] In multiple embodiments of the gRNA molecule, the allogeneic T cell target is B2M, and the targeting domain comprises Accession No. 5519, Accession No. 5497, Accession No. 5499, Accession No. 5498, Accession No. 5503, Accession No. 5496, Accession No. 5507, Accession No. 5515, Accession No. 5493, Accession No. 5506, Accession No. 5509, Accession No. 5517 , Accession No. 5521, Accession No. 5520, Accession No. 5500, Accession No. 5494, Accession No. 5508, Accession No. 5514, or Accession No. 5492, for example, the targeting domain comprises Accession No. 5496, Accession No. 5498, or Accession No. 5509.

[0010] In multiple embodiments of the gRNA molecule, the allogeneic T cell target is CIITA and the targeting domain comprises SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 777 3, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 77 85, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 775 0, for example, the targeting domain comprises SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785.

[0011] In multiple embodiments of the gRNA molecule, the allogeneic T cell target is CD3E and the targeting domain comprises SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10 764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO : 10722.

[0012] In multiple embodiments of the gRNA molecule, the allogeneic T cell target is FKBP1A and the targeting domain comprises SEQ ID NO: 6693, SEQ ID NO: 6705, SEQ ID NO: 66 94, SEQ ID NO: 6708, or SEQ ID NO: 6699.

[0013] In a second aspect, the invention is a gRNA molecule comprising a tracr and a crRNA, wherein the crRNA is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTL A4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or C EACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B 4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HV EM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MH C class II, GAL9, adenosine, and TGF beta, or selected from PTPN11 An inhibitory molecule, or a targeting domain complementary to the effector target sequence downstream of signal transduction via the inhibitory molecule A gRNA molecule is provided that includes a targeting domain complementary to the effector target sequence.

[0014] In multiple embodiments of the gRNA molecule, 15(a) The inhibitory molecule is CD274 (PD-L1), and the targeting domain includes any one of SEQ ID NO: 2942 to SEQ ID NO: 3270; 15(b) The inhibitory molecule is HAVCR2 (TIM3), and the targeting domain includes any one of SEQ ID NO: 3271 to SEQ ID NO: 3541; 15(c) The inhibitory molecule is LAG3, and the targeting domain includes any one of SEQ ID NO: 35 42 to SEQ ID NO: 4032; 15(d) The inhibitory molecule is PDCD1 (PD-1), and the targeting domain is , any one of SEQ ID NO: 4033 to SEQ ID NO: 4589, or SEQ ID NO: 5720 to SEQ ID NO: 5815 ; or 15(e) The effector downstream of signal transduction via the inhibitory molecule is PTPN1 and the targeting domain includes any one of SEQ ID NO: 4590 to SEQ ID NO: 5277 one.

[0015] In multiple embodiments of the gRNA molecule, the inhibitory molecule is PDCD1, and the tar geting domain is SEQ ID NO: 5743, SEQ ID NO: 5798, SEQ ID NO: 5748, SEQ Number 5722, Accession Number 5800, Accession Number 5735, Accession Number 5724, Accession Number 57 31, Accession Number 5725, Accession Number 5775, Accession Number 5766, Accession Number 5727, including Accession Number 5744, Accession Number 5751, or Accession Number 5734, for example, a targeting domain includes Accession Number 5775.

[0016] Multiple embodiments of the gRNA molecule, in embodiments including any of the foregoing multiple aspects and multiple embodiments, the targeting domain includes any one of the listed targeting domain sequences, 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence), 23 (when present in the reference sequence), 24 (when present in the reference sequence), or 25 (when present in the reference sequence) of consecutive nucleic acids. In other embodiments including any of the foregoing multiple aspects and multiple embodiments of the gRNA molecule, the targeting domain consists of 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence), 23 (when present in the reference sequence), or 24 (when present in the reference sequence), or 25 (when present in the reference sequence) of consecutive nucleic acids of any one of the listed targeting domain sequences. In multiple embodiments of the gRNA molecule, in embodiments including any of the foregoing multiple aspects and multiple embodiments, any one of the listed targeting domain sequences, 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence), 23 (when present in the reference sequence), or 24 (when present in the reference sequence), or 25 (when present in the reference sequence) of consecutive nucleic acids. present in the reference sequence), 22 (when present in the reference sequence), 23 (when present in the reference sequence), or 24 (when present in the reference sequence), or 25 (when present in the reference sequence)​ When present, the continuous nucleic acid is located at the 3' end of the listed targeting domain sequence of 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence ), 23 (when present in the reference sequence), or 24 (when present in the reference sequence ), or 25 (when present in the reference sequence), which is a continuous nucleic acid. Any of the foregoing multiple aspects and multiple embodiments for the gRNA molecule including, in other embodiments, any one of the listed targeting domain sequences of 17, 18 , 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence ), 23 (when present in the reference sequence), or 24 (when present in the reference sequence ), or 25 (when present in the reference sequence), or a continuous nucleic acid of 25 (when present in the reference sequence) is located at the 5' end of the listed targeting domain sequence of 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence ), 23 (when present in the reference sequence), or 24 (when present in the reference sequence ), or 25 (when present in the reference sequence), which is a continuous nucleic acid. Any of the foregoing multiple aspects and multiple embodiments for the gRNA molecule including, in other embodiments, any one of the listed targeting domain sequences of 17, 18, 19, 20, 21 (when present in the reference sequence), 22 (when present in the reference sequence ), 23 (when present in the reference sequence), or 24 (when present in the reference sequence), or 25 (when present in the reference sequence), the continuous nucleic acid does not include the 5' or 3' nucleic acid of the listed targeting domain sequence . . . . .

[0017] Multiple embodiments of the gRNA molecule, including any of the foregoing multiple aspects and multiple embodiments, the targeting domain consists of the listed targeting domain sequences. In embodiments that include any of the foregoing multiple aspects and multiple embodiments, the targeting domain consists of the listed targeting domain sequences.

[0018] The following general aspects of the gRNA molecule may be combined, may be alone, or may be in combination with any of the targeting domains described herein, for example, the targeting domains listed in any of the foregoing multiple aspects and multiple embodiments, including any of the gRNAs.

[0019] Multiple embodiments of the gRNA molecule, including any of the foregoing multiple aspects and multiple embodiments, in the embodiments, the crRNA portion and the tracr portion hybridize to form a flagpole containing SEQ ID NO: 6584 or SEQ ID NO: 6585. In other embodiments, the flagpole further includes a first flagpole extension located on the 3' side with respect to the crRNA portion of the flagpole, and the first flagpole extension contains SEQ ID NO: 6586. In other embodiments, the flagpole further includes a second flagpole extension located on the 3' side with respect to the crRNA portion of the flagpole and, if present, the first flagpole extension, and the second flagpole extension contains SEQ ID NO: 6587.

[0020] Multiple embodiments of the gRNA molecule, including any of the foregoing multiple aspects and multiple embodiments, in the embodiments, tracr is (a) Optionally, at the 3' end, one additional, two, three, four, five, six​​​​​​​​​​​​​ or SEQ ID NO: 7820, further comprising seven uracil (U) nucleotides; (b) SEQ ID NO: 6660; or (c) SEQ ID NO: 6661 comprising, for example, consisting of. In such embodiments, the crRNA of the flagpole portion comprises SEQ ID NO: 6607 or SEQ ID NO: 6608.

[0021] A plurality of embodiments of the gRNA molecule, in embodiments comprising any of the foregoing plurality of aspects and plurality of embodiments the tracr comprises SEQ ID NO: 6589 or SEQ ID NO: 6590, and optionally, when a first flagpole extension is present, a first tracr extension located 5' to SEQ ID NO: 6 589 or SEQ ID NO: 6590, and the first tracr extension comprises SEQ ID NO: 6591.

[0022] A plurality of embodiments of the gRNA molecule, in embodiments comprising any of the foregoing plurality of aspects and plurality of embodiments the targeting domain and the tracr are disposed on separate nucleic acid molecules.

[0023] A plurality of embodiments of the gRNA molecule, in embodiments comprising any of the foregoing plurality of aspects and plurality of embodiments the crRNA is, from 5' to 3', [targeting domain]-: a) SEQ ID NO: 6584; b) SEQ ID NO: 6585; c) SEQ ID NO: 6605; d) SEQ ID NO: 6606; e) SEQ ID NO: 6607; f) SEQ ID NO: 6608; or g) SEQ ID NO: 7806 comprising (e.g., consisting of). ​​​

[0024] Multiple embodiments of the gRNA molecule, including any of the foregoing multiple aspects and multiple embodiments, in which tracr is from 5' to 3': a) SEQ ID NO: 6589; b) SEQ ID NO: 6590; c) SEQ ID NO: 6609; d) SEQ ID NO: 6610; e) SEQ ID NO: 6660; f) SEQ ID NO: 6661; g) SEQ ID NO: 7820; h) SEQ ID NO: 7807; i) SEQ ID NO: 7808; j) SEQ ID NO: 7809; k) At the 3' end, further comprising at least 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides, such as 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides, any of a) - j) above; l) At the 3' end, further comprising at least 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides, such as 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides, any of a) - k) above; or m) At the 5' end (e.g., 5' terminus), further comprising at least 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides, such as 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides, any of a) - l) above including (e.g., consisting of).

[0025] ​​​​​​​​​​A preferred embodiment of the gRNA molecule, which includes any of the foregoing aspects and embodiments, is one in which the targeting domain and tracr are arranged on separate nucleic acid molecules, and the nucleic acid molecule containing the targeting domain optionally contains SEQ ID NO: 6607 disposed immediately 3' to the targeting domain, and the nucleic acid molecule containing tracr contains SEQ ID NO: 6660, e.g., consists of this. In another embodiment, which includes any of the foregoing aspects and embodiments of the gRNA molecule, the targeting domain and tracr are arranged on a single nucleic acid molecule, and tracr is arranged 3' to the targeting domain. In such an embodiment of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule further includes a loop, e.g., consisting of SEQ ID NO: 6588, which is arranged 3' to the targeting domain and 5' to tracr. In a plurality of embodiments of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule, from 5' to 3', is: (a) SEQ ID NO: 6601;

[0026] In another embodiment, which includes any of the foregoing aspects and embodiments of the gRNA molecule, the targeting domain and tracr are arranged on separate nucleic acid molecules, and the nucleic acid molecule containing the targeting domain optionally contains SEQ ID NO: 6607 disposed immediately 3' to the targeting domain, and the nucleic acid molecule containing tracr contains SEQ ID NO: 6660, e.g., consists of this. In another embodiment, which includes any of the foregoing aspects and embodiments of the gRNA molecule, the targeting domain and tracr are arranged on a single nucleic acid molecule, and tracr is arranged 3' to the targeting domain. In such an embodiment of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule further includes a loop, e.g., consisting of SEQ ID NO: 6588, which is arranged 3' to the targeting domain and 5' to tracr. In a plurality of embodiments of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule, from 5' to 3', is: In another embodiment, which includes any of the foregoing aspects and embodiments of the gRNA molecule, the targeting domain and tracr are arranged on separate nucleic acid molecules, and the nucleic acid molecule containing the targeting domain optionally contains SEQ ID NO: 6607 disposed immediately 3' to the targeting domain, and the nucleic acid molecule containing tracr contains SEQ ID NO: 6660, e.g., consists of this. In another embodiment, which includes any of the foregoing aspects and embodiments of the gRNA molecule, the targeting domain and tracr are arranged on a single nucleic acid molecule, and tracr is arranged 3' to the targeting domain. In such an embodiment of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule further includes a loop, e.g., consisting of SEQ ID NO: 6588, which is arranged 3' to the targeting domain and 5' to tracr.

[0027] In a plurality of embodiments of the gRNA molecule, which includes any of the foregoing aspects and embodiments, the gRNA molecule, from 5' to 3', is: (a) SEQ ID NO: 6601; (b) SEQ ID NO: 6602; (c) SEQ ID NO: 6603; (d) SEQ ID NO: 6604; (e) SEQ ID NO: 7811; or (f) at the 3' end, one, two, three, four, five, six, or seven uracils (e) SEQ ID NO: 7811; or (f) at the 3' end, one, two, three, four, five, six, or seven uracils Further comprising a (U) nucleotide, any one of the above (a) to (e) Comprising (e.g., consisting of).

[0028] A preferred embodiment of the gRNA molecule, in an embodiment comprising any one of the foregoing plurality of aspects and plurality of embodiments, the targeting domain and tracr Are arranged on a single nucleic acid molecule, the nucleic acid molecule comprising the targeting domain and, optionally, SEQ ID NO: 660 Which is arranged immediately 3' to the targeting domain, and, for example, consisting of. 1 1

[0029] A preferred embodiment of the gRNA molecule, in an embodiment comprising any one of the foregoing plurality of aspects and plurality of embodiments, the targeting domain and tracr Are arranged on a single nucleic acid molecule, the nucleic acid molecule comprising the targeting domain and, optionally, SEQ ID NO: 781 Which is arranged immediately 3' to the targeting domain, and, for example, consisting of. 1 1

[0030] In a plurality of embodiments, the gRNA molecule consists of unmodified RNA nucleotides and nucleic acid binding. In other embodiments, the gRNA molecule contains, for example, one or more modifications described herein. A plurality of embodiments of the gRNA molecule, in an embodiment comprising any one of the foregoing plurality of aspects and plurality of embodiments, one of the nucleic acid molecules of the gRNA molecule, or, optionally, more than one, is a) At the 3' end of said one or more nucleic acid molecules, a certain, for example three phosphorothioate modifications; 1 1 1 a) At the 3' end of said one or more nucleic acid molecules, a certain, for example three phosphorothioate modifications; 1 b) a phosphorylation of at least one of the nucleic acid molecules, for example, three phosphorylations at the 5' end of the nucleic acid molecule or molecules Thioate (phosphorothioate) modification; c) a 2'-O 3 -terminus, e.g., three 2'-O 3 -terminus, at the 3' end of said one or more nucleic acid molecules; -Methyl modification; d) a 2'-O 3 nucleotide sequence, such as three 2'-O 3 nucleotides, at the 5' end of said one or more nucleic acid molecules; -Methyl modification; e) a fourth, a third, and a fourth position relative to the end of said one or more nucleic acid molecules; and a 2'-O-methyl modification at each of the second 3' residue to the terminus; or f) Any combination of these Includes.

[0031] Embodiments of the gRNA molecule, including the above aspects and implementations. In embodiments, including any of the above forms, the gRNA molecule (e.g., CRISPR systems (e.g., RNPs described herein, e.g., When an RNP containing a Cas9 molecule as described herein is introduced into a cell, it is capable of expressing a gRNA molecule. Indels are formed in or near a target sequence that is complementary to the targeting domain of In some embodiments, the indel is a frameshift mutation. In terms of morphology, indels are shown in Figures 34A, 34B, 36, 38, 41, 44, and 48. , FIG. 49, FIG. 50, or FIG. 53.

[0032] Embodiments of the gRNA molecule, including the above aspects and implementations. In embodiments, including any of the above forms, the gRNA molecule (e.g., CRISPR systems (e.g., RNPs described herein, e.g., When an RNP containing the Cas9 molecule described in the specification is introduced into a cell population, among the cells of the population, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% of them, an indel is formed in or near the target sequence complementary to the targeting domain of the g RNA molecule. In a plurality of embodiments, among the cells of the population, at least about 20%, for example, at least about 30%, for example, at least about 35%, for example, at least about 40% of them, for example, at least about 45%, for example, at least about 50%, for example, at least about 5 5%, for example, at least about 60%, for example, at least about 65%, for example, at least about 70%, for example, at least about 75%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95%, for example, at least about 99% of them, a frameshift mutation indel is formed in or near the target sequence complementary to the targeting domain of the gRNA molecule. In a plurality of embodiments, among the cells of the population, at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70 %, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% of them, an indel is formed in or near the target sequence complementary to the targeting domain of the gRNA molecule. In a plurality of embodiments, among the cells of the population, at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70 %, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least is also about 98%, for example, at least about 99%, among which the indels are those listed in FIGS. 34A, 34B, FIG 36, FIG. 38, FIG. 41, FIG. 44, FIG. 48, FIG. 49, FIG. 50, or FIG. 53. In multiple embodiments, the five indels detected most frequently within the cell population include three or more, for example, four, for example, five, of the indels associated with any gRNA listed in FIGS. 34A, 34B, FIG. 36, FIG. 38, FIG. 41, FIG. 44, FIG 48, FIG. 49, FIG. 50, or FIG. 53. An indel or a pattern of indels is as measured and / or, for example, quantified by next-generation sequencing (NGS). In multiple embodiments of gRNA molecules, including any of the foregoing multiple aspects and multiple embodiments, when a CRISPR system (for example, an RNP described herein, for example, an RNP containing a Cas9 molecule described herein) containing a

[0033] gRNA molecule (for example, as described herein) is introduced into a cell (or cell population) described herein, the expression of a gene containing a target sequence complementary to the targeting domain of the gRNA molecule is reduced or eliminated within the cell. In multiple embodiments, among at least about 40%, for example, at least about 50%, for example at least about 60%, for example, at least about 70%, for example, at least about 80%, for example at least about 90%, for example, at least about 95%, for example, at least about 96% for example, at least about 97%, for example, at least about 98%, for example, at least about 9 9% of the cells in the population, the expression of the gene is reduced or eliminated. In multiple embodiments 、The reduced or abolished expression is measured by flow cytometry. In other embodiments, for example, in the case of FKBP1A, the reduced or abolished expression is measured by a functional assay as described herein.

[0034] In a plurality of embodiments of the gRNA molecule, in embodiments comprising any of the foregoing plurality of aspects and plurality of embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP as described herein, e.g., an RNP comprising a Cas9 molecule as described herein) is introduced into a cell as described herein, off-target indels detectable by, for example, next-generation sequencing and / or nucleotide insertion assays are not formed within the cell.

[0035] In a plurality of embodiments of the gRNA molecule, in embodiments comprising any of the foregoing plurality of aspects and plurality of embodiments, when a CRISPR system comprising a gRNA molecule (e.g., as described herein) (e.g., an RNP as described herein, e.g., an RNP comprising a Cas9 molecule as described herein) is introduced into a cell population as described herein, off-target indels detectable by, for example, next-generation sequencing and / or nucleotide insertion assays are detected in no more than about 5%, e.g., no more than about 1%, e.g., no more than about 0.1%, e.g., no more than about

[0036] In any of the foregoing plurality of aspects and plurality of embodiments of the cell, the cell , mammalian, primate, or human cells, e.g., human cells (or cell populations). Any of the above aspects and embodiments of the cell may be used. In either case, the cell is an immune effector cell, e.g., a T cell or a NK cell, e.g. For example, T cells, e.g., CD4+ T cells, CD8+ T cells, or a combination thereof. (or the cell population includes these).

[0037] In any of the above aspects and embodiments of the cell, the cell ( or cell population) has been engineered to express a chimeric antigen receptor (CAR), In some embodiments, the CAR is (a) CD19 CAR; or (b) BCMA CAR In some embodiments, (a) CAR is an antibody comprising any one of SEQ ID NOs: 7883 to 7898. Is it a CD19 CAR that contains a native binding domain; (b) the CAR is a CD19 CAR comprising SEQ ID NO: 7909 or SEQ ID NO: 7920. Is there; (c) CAR is an antibody comprising any one of SEQ ID NOs: 7939 to 8112. BCM comprising an antigen-binding domain, e.g., an antigen-binding domain of SEQ ID NO: 7949 A CAR; or (d) CAR includes any one of SEQ ID NOs: 8549 to 8621; For example, a BCMA CAR comprising sequence number 8559.

[0038] In any of the foregoing aspects and embodiments of the cell, the cell In another embodiment, the cells are allogeneic with respect to the patient to whom the cells are administered. The cells are autologous with respect to the patient to whom they are administered.

[0039] In another aspect, the invention relates to the above aspects and aspects further comprising a Cas9 molecule. A composition comprising the first gRNA molecule of any of the embodiments is provided. In the form, the Cas9 molecule is represented by SEQ ID NO: 6611, or SEQ ID NO: 7821 to SEQ ID NO: 78 31. In some embodiments, the Cas The Cas9 molecule is an active or inactive S. pyogenes Cas9. In embodiments, the first gRNA molecule and the Cas9 molecule are integrated into a ribonucleoprotein complex (R NP).

[0040] In some embodiments, the composition comprises more than one gRNA molecule, each of which is It may contain more than one gRNA molecule complexed with a Cas9 molecule as described herein. For example, in some embodiments, the composition comprises a second gRNA molecule; and a third gRNA molecule; or a second gRNA molecule, a third gRNA molecule, and a first gRNA molecule. The present invention further comprises a first gRNA molecule, a second gRNA molecule, a third gRNA molecule (if present), If present, the first gRNA molecule, the second gRNA molecule, and the fourth gRNA molecule, if present, are selected from the gRNA sequences described herein. For example, a gRNA molecule of any of the above aspects and embodiments. Each gRNA molecule of the composition is complementary to a different target sequence (i.e., a different target sequence). In some embodiments, the first gRNA molecule, the second gRNA molecule, The gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (if present) In the case), it is complementary to the target sequence within the same gene. In such an embodiment, the first g RNA molecule, the second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (if present) are 20,000 nucleotides or less, 10,000 nucleotides or less, 6,000 or less, 5,000 nucleotides or less, 4,000 or less, 1,000 nucleotides or less, 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, 200 nucleotides or less, 100 nucleotides or less, 90 nucleotides or less, 80 nucleotides or less, 70 nucleotides or less, 60 nucleotides or less, 50 nucleotides or less, 4 0 nucleotides or less, 30 nucleotides or less, 20 nucleotides or less, or 10 nucleotides apart and are complementary to the target sequence. In other embodiments, the first gRNA molecule the second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (if present) are complementary to target sequences within different genes or at different loci, e.g., target sequences within different genes described herein.

[0041] In multiple embodiments, the first gRNA molecule is any one of the gRNA molecules of 2(b), 2(c), 2(d), 2(d ), 2(e), 2(f), 2(g), or 2(h); the second gRNA molecule is any one of the gRNA molecules of 2(a), 2(i), 2(j), 2(k), or 2(q ); the third gRNA molecule is any one of the gRNA molecules of 15(a), 15( b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is any one of the gRNA molecules of 2(b), 2(c), 2(d), 2(d ), 2(e), 2(f), 2(g), or 2(h); the second gRNA molecule is any one of the gRNA molecules of 2(a), 2(i), 2(j), 2(k), or 2(q ); the third gRNA molecule is any one of the gRNA molecules of 15(a), 15( ) with any of the gRNA molecules of 2(e), 2(f), 2(g), or 2(h) yes; the second gRNA molecule is any of 2(l), 2(m), 2(n), or 2(o) any of the gRNA molecules; the third gRNA molecule is any of 15(a), 15(b), 15 (c), 15(d), or 15(e). In other embodiments the first gRNA molecule is any of 2(b), 2(c), 2(d), 2(d), 2(e ) 2(f), 2(g), or 2(h); the second gRNA molecule is any of 2(l), 2(m), 2(n), or 2(o) In other embodiments, the first gRNA molecule is 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or any of 2(h); the second gRNA molecule is any of 2(a), 2(i), 2(j), or 2(k). In other embodiments, the first gRNA molecule is 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or also 2(h); the second gRNA molecule is 15(a) , 15(b), 15(c), 15(d), or any of 15(e) In other embodiments, the first gRNA molecule is 15(a), 15(b), 15 (c), 15(d), or 7(e); the second g RNA molecule is 15(a), 15(b), 15(c), 15(d), or any of 15(e). In any of the foregoing embodiments, in a plurality of embodiments, the third gRNA is present and the third gRNA molecule is 15(a), 15 with any one of the gRNA molecules of (b), 15(c), 15(d), or 15(e) There is. In a plurality of embodiments, the composition comprises a plurality of aspects of the aforementioned gRNA molecule and comprises two gRNA molecules, any one of a plurality of embodiments. In a plurality of embodiments the composition comprises three gRNA molecules, any one of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule. In a plurality of embodiments, the composition is the first gRNA molecule, any one of a plurality of aspects and a plurality of embodiments of the aforementioned plurality, wherein the targeting domain of the first gRNA molecule is the targeting domain of any one of 2(a), 2(i), 2(j), or 2(k); and the second gRNA molecule, any one of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule, wherein the targeting domain of the second gRNA molecule is the targeting domain of any one of 2(b), 2(c), 2(d), 2(f), 2(g), 2(h), or 2(i). In a plurality of embodiments, the composition comprises two gRNA molecules, wherein the targeting domain of the first gRNA molecule comprises SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499 SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO : 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO

[0042] In a plurality of embodiments, the composition comprises two gRNA molecules, and the targeting domain of the first gRNA molecule comprises SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 5499 SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID NO : 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO : 5517, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID NO: 5508, SEQ ID NO: 5514, or SEQ ID NO: 5492, and for example, consists of this ; the targeting domain of the second gRNA molecule is SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589 , SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 559 1, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, or also comprises SEQ ID NO: 5620, for example, consists of this.

[0043] In a plurality of embodiments, the composition comprises two gRNA molecules, and the targeting domain of the first gRNA molecule comprises SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, for example, consists of this; the targeting domain of the second gRNA molecule comprises SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ NO: 5599, or SEQ ID NO: 5600, for example, consists of this.

[0044] In a plurality of embodiments, the composition comprises two gRNA molecules, and the targeting domain of the first gRNA molecule comprises SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, for example, consists of this; the targeting domain of the second gRNA molecule comprises SEQ ID NO: 5569, for example, consists of this.

[0045] In a plurality of embodiments, the composition comprises two gRNA molecules, and the targeting domain of the first gRNA molecule comprises SEQ ID NO: 5496, SEQ ID NO: 5498, or SEQ ID NO: 5 509, for example, consists of this; the targeting domain of the second gRNA molecule n includes SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 107 89, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722, for example, consisting of this.

[0046] In multiple embodiments, including any of the foregoing multiple aspects and multiple embodiments, the composition further includes, in this specification, for example, a third gRNA molecule described in any of the foregoing multiple aspects and multiple embodiments for the gRNA molecule, and the targeting domain of the third gRNA molecule is either the targeting domain of 2(n) or 2(q). In multiple embodiments, the tar geting domain of the third gRNA molecule is, for example, consisting of SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID NO: 7758, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 77 70, SEQ ID NO: 7749, SEQ ID NO: 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 7772, SEQ ID NO: 7743, or SEQ ID NO: 7750; for example, consisting of this; for example, consisting of SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 77 39, or SEQ ID NO: 7785 (for example, consisting of this).

[0047] In multiple embodiments, including any of the foregoing multiple aspects and multiple embodiments, the composition further includes, in this specification, for example, a fourth gRNA molecule described in any of the foregoing multiple aspects and multiple embodiments for the gRNA molecule, and the targeting domain of the fourth gRNA molecule is the target of an NK inhibitory molecule, for example, LILR ​​It is complementary to the target sequence of B1. In a plurality of embodiments, the targeting domain of the fourth gRNA molecule is a) any one of SEQ ID NOs: 10090 to 10673; b) 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides of any one of SEQ ID NOs: 10090 to 10673, preferably 20 consecutive nucleotides; c) 17 on the 5' side of any one of SEQ ID NOs: 10090 to 10673, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides ; or d) 17 on the 3' side of any one of SEQ ID NOs: 10090 to 10673, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides ; including, for example, consisting of.

[0048] In a plurality of embodiments of the composition (including any of the foregoing aspects and a plurality of embodiments), the targeting domain of the first gRNA molecule (described herein), the targeting domain of the second gRNA molecule (described herein), and when present, the targeting domain of the third gRNA molecule (described herein) are a) combinations A1 to A72 in Table 33; b) combinations B1 to B84 in Table 34; c) combinations C1 to C42 in Table 35; d) combinations D1 to D36 in Table 36; e) combinations E1 to E30 in Table 37; or f) combinations F1 to F60 in Table 38 any of the sequences of ; ​Comprising, for example, consisting of.

[0049] In any of the foregoing aspects and embodiments, each of the gRNA molecules is, together with the Cas9 molecule described herein, within a ribonucleoprotein complex (RNP) therein.

[0050] In a plurality of embodiments, the gRNA molecule or composition is formulated in a medium suitable for electroporation.

[0051] In embodiments where each of the gRNA molecules is within an RNP together with the Cas9 molecule described herein, each of the RNP complexes is at a concentration of less than about 10 μM, such as less than about 3 μM, such as less than about 1 μM, such as less than about 0.5 μM, such as less than about 0.3 μM , such as less than about 0.1 μM.

[0052] In a plurality of embodiments, the composition further comprises cells, such as a cell population, such as immune effector cells, such as immune effector cells expressing a CAR as described herein

[0053] In another aspect, the present invention provides a nucleic acid encoding (e.g., all) the components of any of the gRNA molecules of any of the foregoing aspects and embodiments for the gRNA molecules described above, or any of the compositions of any of the foregoing aspects and embodiments for the compositions described above. In a plurality of embodiments, the nucleic acid comprises a promoter operably linked to a sequence encoding the gRNA molecule. In a plurality of embodiments, the promoter is a promoter recognized by RNA polymerase II or RNA polymerase III. Other ​​​​​​​​​In an embodiment, the promoter is a U6 promoter or an HI promoter. In multiple embodiments, the nucleic acid further encodes a Cas9 molecule. In multiple embodiments, the nucleic acid comprises a promoter operably linked to a sequence encoding a Cas9 molecule, such as an EF-1 promoter, a CMV IE gene promoter, an EF-1α promoter, a ubiquitin C promoter, or a phosphoglycerate kinase (PGK) promoter.

[0054] In another aspect, the present invention provides a vector comprising any of the nucleic acids of multiple aspects and multiple embodiments of the foregoing nucleic acid. In multiple embodiments, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nanoplasmid, and an RNA vector.

[0055] In another aspect, the present invention provides a composition comprising any of the gRNA molecules of multiple aspects and multiple embodiments of the foregoing gRNA molecule and, for example, a nucleic acid encoding a Cas9 molecule described herein.

[0056] In another aspect, the present invention provides a composition comprising any of the gRNA molecules of multiple aspects and multiple embodiments of the foregoing gRNA molecule and, for example, a nucleic acid encoding a Cas9 molecule described herein.

[0057] In multiple embodiments of any of the compositions of the present invention, the composition further comprises a template nucleic acid.Further includes. In a plurality of embodiments, the template nucleic acid is a nucleotide corresponding to the nucleotide of the target sequence of the gRNA molecule. In a plurality of embodiments, the template nucleic acid includes, for example, a nucleic acid encoding a chimeric antigen receptor (CAR) described herein. In a plurality of embodiments, the CAR is (a) a CD19 CAR described, for example, in WO 2012 / 079000 pamphlet or WO 2014 / 153270 pamphlet; or (b) a BCMA CAR described herein, for example, a BCMA CAR including SEQ ID NO: 8559. In a plurality of embodiments, the template nucleic acid includes, for example, a nucleic acid encoding an NK inhibitory molecule described herein. In a plurality of embodiments, the template nucleic acid includes nucleotides corresponding to the nucleotides of the target sequence of the gRNA molecule. In a plurality of embodiments, the template nucleic acid includes, for example, a nucleic acid encoding a chimeric antigen receptor (CAR) described herein. In a plurality of embodiments, the CAR is (a) a CD19 CAR described, for example, in WO 2012 / 079000 pamphlet or WO 2014 / 153270 pamphlet; or (b) a BCMA CAR described herein, for example, a BCMA CAR including SEQ ID NO: 8559. In a plurality of embodiments, the template nucleic acid includes, for example, a nucleic acid encoding an NK inhibitory molecule described herein. In another aspect, the present invention is a method for altering a target sequence of a cell, for example, altering its structure, for example, altering the sequence, the method comprising: the cell is contacted with a) any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; b) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; c) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA

[0058] molecule, and, for example, a Cas9 molecule described herein; d) any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; e) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; f) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; g) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; h) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; i) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; j) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; k) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; l) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA molecule, and, for example, a Cas9 molecule described herein; m) a nucleic acid encoding any of the gRNA molecules of the plurality of aspects and plurality of embodiments for the aforementioned gRNA molecule, for example, more than one gRNA A nucleic acid encoding more than one gRNA molecule, and, for example, C as described herein a nucleic acid encoding the Cas9 molecule; e) any one of a) to d) above, and a template nucleic acid ; f) any one of a) to d) above, and a nucleic acid comprising a sequence encoding a template nucleic acid ; g) a composition of any one of the plurality of aspects and plurality of embodiments of the foregoing composition ; or h) a method comprising contacting with any one of the plurality of aspects and plurality of embodiments of the foregoing vector. In a plurality of embodiments a gRNA molecule or a nucleic acid encoding a gRNA molecule and a Cas9 molecule or a nucleic acid encoding a Cas9 molecule are formulated in a single composition. In other embodiments, a gRNA molecule or a nucleic acid encoding a gRNA molecule and a Cas9 molecule or a nucleic acid encoding a Cas9 molecule are formulated in more than one composition. In a plurality of embodiments, more than one composition is delivered simultaneously or sequentially, for example, to a cell as described herein, simultaneously or sequentially. In a plurality of embodiments, the cell is an animal cell, for example, a mammalian animal, a primate, or a human cell. In a plurality of embodiments, the cell is an immune effector cell (e.g., a population of immune effector cells), for example, a T cell or an NK cell, for example, a T cell, for example, a CD4+ T cell, a CD8+ T cell, or a combination thereof. In a plurality of embodiments, the cell is engineered or will be engineered to express, for example, a chimeric antigen receptor (CAR ) as described herein. In a plurality of embodiments the cell comprises or will comprise, for example, a chimeric antigen receptor (CAR) as described herein. In a plurality of embodiments, the cell is, for example, as described herein ​​​​ comprises or will comprise a nucleic acid encoding a chimeric antigen receptor (CAR). In multiple embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMA CAR. In multiple embodiments, the CAR is a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898. In multiple embodiments, the CAR is a CD19 CAR comprising any one of SEQ ID NOs: 7908 to 7920. In multiple embodiments, the CAR is a BCMA CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7939 to 8112. In multiple embodiments, the CAR is a BCMA CAR comprising any one of SEQ ID NOs: 8549 to 8621, for example, comprising SEQ ID NO: 8559. In multiple embodiments, the cell is allogeneic with respect to the patient to whom the cell is administered. In multiple embodiments, the cell is isolated from a healthy human donor. In multiple embodiments, the cell is autologous with respect to the patient to whom the cell is administered. In another aspect, the present invention provides a cell modified by any of the methods of multiple aspects and multiple embodiments of the foregoing method, for example, modified by the method described herein. In another aspect, the present invention provides a first gRNA molecule of any of the multiple aspects and multiple embodiments of the foregoing gRNA molecule, or a composition of any of the multiple aspects and multiple embodiments of the foregoing composition, a nucleic acid of any of the multiple aspects and multiple embodiments of the foregoing nucleic acid, or a vector of the foregoing

[0059] In another aspect, the present invention provides a cell modified by any of the methods of multiple aspects and multiple embodiments of the foregoing method, for example, modified by the method described herein. In another aspect, the present invention provides a first gRNA molecule of any of the multiple aspects and multiple embodiments of the foregoing gRNA molecule, or a composition of any of the multiple aspects and multiple embodiments of the foregoing composition, a nucleic acid of any of the multiple aspects and multiple embodiments of the foregoing nucleic acid, or a vector of the foregoing composition, a nucleic acid of any of the multiple aspects and multiple embodiments of the foregoing nucleic acid, or a vector of the foregoing Provided are vectors, in any of a plurality of aspects and embodiments, of a cutter. In a plurality of embodiments, a gRNA molecule, composition, nucleic acid, or vector is introduced ex vivo into the cells. In other embodiments, a gRNA molecule, composition, nucleic acid, or vector is introduced in vivo into the cells. In a plurality of embodiments, the cells are animal cells, such as mammalian, primate, or human cells. In a plurality of embodiments, the cells are immune effector cells (e.g., a population of immune effector cells), such as T cells or NK cells, such as T cells, such as CD4+ T cells, CD8+ T cells, or combinations thereof. In a plurality of embodiments, the cells are engineered or will be engineered to express, for example, a chimeric antigen receptor (CAR) as described herein. In a plurality of embodiments, the cells contain or will contain, for example, a chimeric antigen receptor (CAR) as described herein. In a plurality of embodiments, the cells contain or will contain a nucleic acid encoding, for example, a chimeric antigen receptor (CAR) as described herein. In a plurality of embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMA CAR. In a plurality of embodiments, the CAR is a CD19 CAR containing an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898. In a plurality of embodiments, the CAR is a CD19 CAR and comprises any one of SEQ ID NOs: 7908 to 7920. In a plurality of embodiments, the CAR is a BCMA CAR containing an antigen-binding domain comprising any one of SEQ ID NOs: 7939 to 8112. In a plurality of embodiments, the CA Provide cells. In a plurality of embodiments, a gRNA molecule, composition, nucleic acid, or vector is introduced into the cells ex vivo. In other embodiments, a gRNA molecule, composition, nucleic acid, or vector is introduced into the cells in vivo. In a plu rality of embodiments, the cells are animal cells, such as mammalian, primate, or human cells are. In a plurality of embodiments, the cells are immune effector cells (e.g., a population of immune effector cells ), such as T cells or NK cells, such as T cells, such as CD4+ T cells cells, CD8+ T cells, or combinations thereof. In a plurality of embodiments, the cells are, for example, engineered or will be engineered to express a chimeric antigen receptor (CAR) as described herein . In a plurality of embodiments, the cells contain or will contain, for example, a chimeric antigen receptor (CAR) as described herein . In a plurality of embodiments, the cells contain or will contain a nucleic acid encoding, for example, a chimeric antigen receptor (CAR) as described herein . In a plurality of embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMA CAR. In a plurality of embodiments the CAR is a CD19 CAR containing an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898 . In a plurality of embodiments, the CAR is a CD19 CAR and comprises any one of SEQ ID NOs: 7908 to 7920 . In a plurality of embodiments, the CAR is a BCMA CAR containing an antigen-binding domain comprising any one of SEQ ID NOs: 7939 to 8112 . In a plurality of embodiments, the CAR is a CD19 CAR and comprises any one of SEQ ID NOs: 7908 to 7920. In a plu rality of embodiments, the CAR is a BCMA CAR containing an antigen-binding domain comprising any one of SEQ ID NOs: 7939 to 8112 . In a plurality of embodiments, the CA R is a BCMA CAR, any one of SEQ ID NOs: 8549 to 8621 In some embodiments, the cell comprises one of the following: In some embodiments, the cells are allogeneic with respect to the patient to whom they are administered. In some embodiments, the cells are autologous with respect to the patient to whom the cells are administered. In some embodiments, the cells are further comprised of a second gRNA of any one of claims 1 to 60. The present invention relates to a method for the preparation of a gRNA molecule comprising the steps of: Any of the nucleic acids encoding the second gRNA molecule, In other words, the first gRNA molecule and the second gRNA molecule have non-identical targeting domains. In some embodiments, the first gRNA molecule comprises a targeting domain for allogeneic T cells. A targeting domain complementary to the target sequence (e.g., any of those listed in Tables 1, 3, 4, or 5). a targeting domain (which is a targeting domain that ... A targeting sequence complementary to the target sequence of a downstream effector of signal transduction via an inhibitory molecule. A targeting domain (e.g., a targeting domain listed in Table 2 or Table 6) In some embodiments, the inhibitory molecule or the inhibition of signal transduction through the inhibitory molecule is Downstream effectors include CD274, HAVCR2, LAG3, PDCD1, and PD-L2. , CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD16 0, 2B4, CD80, CD86, B7-H3(CD113), B7-H4(VTCN1 )、HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGF beta, or PTPN1 1. In multiple embodiments, the first gRNA molecule is complementary to a target sequence of TRAC, TRBC1, TRB C2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule contains a targeting domain complementary to the target sequence of NLRC5 , for example, a targeting domain containing any one of SEQ ID NOs: 8622 to 10089 (e.g., consisting of). In multiple embodiments , the first gRNA molecule contains a targeting domain complementary to a target sequence of TRAC, TRBC1, TRBC2, CD247, CD 3D, CD3E, or CD3G, and the second gRNA molecule contains a targeting domain complementary to the target sequence of B2M, HLA-A, HLA-B or HLA-C . In multiple embodiments, the cell further contains, contains, or will contain a nucleic acid encoding a third gRNA molecule for any one of multiple aspects and multiple embodiments of the aforementioned gRNA molecules, or a third gRNA molecule for any one of multiple aspects and multiple embodiments of the aforementioned gRNA molecules, and the first gRNA molecule, the second gRNA molecule, and the third gRNA molecule contain non-identical targeting domains. In multiple embodiments, the third gRNA molecule contains a targeting domain complementary to a target sequence of CIITA, RFXANK, RFX5, or RFXAP, for example, CIITA , and for example, contains any one of SEQ ID NOs: 7717 to 7804, for example, consisting of a targeting domain . . . . . In multiple embodiments, the third gRNA molecule contains a targeting domain complementary to a target sequence of CIITA, RFXANK, RFX5, or RFXAP, for example, CIITA , and for example, contains any one of SEQ ID NOs: 7717 to 7804, for example, consisting of a targeting domain . including, for example, any one of SEQ ID NO: 7769, SEQ ID NO: 7771, or SEQ ID NO: 7785, and including, for example, a targeting domain consisting of this. In a plurality of embodiments, the cell includes three gRNA molecules. The first gRNA molecule includes a targeting domain complementary to the target sequence of TRAC; the second gRNA molecule includes a targeting domain complementary to the target sequence of B2M; and the third gRNA molecule includes a targeting domain complementary to the target sequence of CIITA. In a plurality of embodiments, the cell includes three gRNA molecules. The first gRNA molecule includes a targeting domain complementary to the target sequence of TRAC; the second gRNA molecule includes a targeting domain complementary to the target sequence of NLRC5; and the third gRNA molecule includes a targeting domain complementary to the target sequence of CIITA. In a plurality of embodiments, the cell includes two gRNA molecules. The first gRNA molecule includes a targeting domain complementary to the target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, C D3E, or CD3G, and the second gRNA molecule includes a targeting domain complementary to the target sequence of NR3C1, DCK, CD52, or FKBP1A. For a plurality of embodiments of cells containing gRNA molecules (e.g., more than one gRNA molecule as described herein), (1) the first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule includes SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: For a plurality of embodiments of cells containing gRNA molecules (e.g., more than one gRNA molecule as described herein), the first gRNA molecule includes a targeting domain complementary to the target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, C D3E, or CD3G, and the second gRNA molecule includes a targeting domain complementary to the target sequence of NR3C1, DCK, CD52, or FKBP1A. targeting domain.

[0060] In a plurality of embodiments of cells containing gRNA molecules (e.g., more than one gRNA molecule as described herein), (1) the first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule includes SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: ID NO: 5492 to SEQ ID NO: Does it contain a targeting domain selected from the group consisting of column number 5527? (2) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345? (3) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698? (4) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068? (5) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941? (6) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491? (7) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5492 to SEQ ID NO: 5627? (8) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5628 to SEQ ID NO: 5761? (9) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5762 to SEQ ID NO: 5895? (10) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5896 to SEQ ID NO: 6029? (11) Does the first gRNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: NO: 5816 to SEQ ID NO: 5965, and does the second guide RNA molecule contain a targeting domain selected from the group consisting of SEQ ID NO: 6030 to SEQ ID NO: 6163? (7) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; (8) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; (9) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527; (10) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345; (11) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698; (12) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2040; (13) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2041 to SEQ ID NO: 2393; (14) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2394 to SEQ ID NO: 2746; (15) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2747 to SEQ ID NO: 3099; (16) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: (12) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068; or (13) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941; or (14) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491; or (15) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; or (16) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; or (17) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ (16) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; or (17) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ (17) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ comprising a targeting domain selected from the group consisting of SEQ ID NO: 6098 to SEQ ID NO: 6226 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527; or (18) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345; or (19) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698; or (20) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068; or (21) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941; or (22) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ comprises a targeting domain selected from the group consisting of SEQ ID NO: 6098 to SEQ ID NO: 6226 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491; (23) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; (24) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; (25) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527; (26) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345; (27) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698; ​​​​​​​​​ (28) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068; or (29) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941; (30) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491; or (31) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; (32) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; (33) The first gRNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule includes a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83, and SEQ ID NO: 5492 to SEQ ID NO: 5527; or (34) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (35) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (36) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (37) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (38) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (39) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (40) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (41) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (42) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule (43) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532 and includes a targeting domain, and the second guide RNA molecule comprises a targeting domain to be targeted, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345; or (35) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698; or (36) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068; or (37) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941; or (38) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491; or (39) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; or (40) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6324; or (41) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6324; or (42) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to (43) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6324; or comprise a targeting domain selected from the group consisting of SEQ ID NO: 6583; (41) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 1 to 83 and SEQ ID NOs: 5492 to 5527; or (42) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 969 to 1345; or (43) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 1346 to 1698; or (44) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 1699 to 2068; or (45) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 2069 to 2941; or (46) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 533 to 839 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NOs: 5278 to 5491; or (47) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; or (48) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583; or (49) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 83 and SEQ ID NO: 5492 to SEQ ID NO: 5527; or (50) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 969 to SEQ ID NO: 1345; or (51) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1346 to SEQ ID NO: 1698; or (52) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 1699 to SEQ ID NO: 2068; or (53) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 comprises a targeting domain to be targeted, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2069 to SEQ ID NO: 2941; or (54) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5491; or (55) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6227 to SEQ ID NO: 6324; or (56) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583. (56) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 6325 to SEQ ID NO: 6583. In some embodiments, including any of the plurality of aspects and embodiments for the cells described above, the cell further comprises a third gRNA molecule comprising a targeting domain complementary to the target sequence of an inhibitory molecule or an effector downstream of signal transduction via the inhibitory molecule, and the inhibitory molecule or the effector downstream of signal transduction via the inhibitory molecule is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CE

[0061] ACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM -5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD8 ​​​​​0, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TN FRSF14 or CD107), KIR, A2aR, MHC class I, MHC class I I, GAL9, adenosine, and TGF-beta, or PTPN11, for example, The third gRNA molecule contains a targeting domain of any one of 15(a) to 15(e). Including.

[0062] In a plurality of embodiments of cells containing gRNA molecules (e.g., more than one gRNA molecule described herein), (1) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; (2) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; (3) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; (4) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; (2) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; (3) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; (3) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; (4) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; (4) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5 720 to SEQ ID NO: 5815; or (5) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623, or SEQ ID NO ID NO: 5816 to SEQ ID NO: 5965, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or (6) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; or (7) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; or (8) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (9) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (10) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589; or (11) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or (12) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5527; or (13) The first gRNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule contains a targeting domain selected from the group consisting of SEQ ID NO: 5528 to SEQ ID NO: 5623; or , the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5 720 to SEQ ID NO: 5815; or (10) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5624 to SEQ ID NO: 5643, or SEQ ID NO: 5966 to SEQ ID NO: 6097, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or (11) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; or (12) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; or (13) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (14) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (15) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589; or (16) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or (17) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5278 to SEQ ID NO: 5815; or (18) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719, or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5816 to SEQ ID NO: 6226; or See, the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815; or ; (15) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or ; (16) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; or ; (17) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; or ; (18) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or ; (19) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589 and SEQ ID NO: 5720 to SEQ ID NO: 5815; or ; ; (20) The first gRNA molecule is selected from the group consisting of SEQ ID NO: 84 to SEQ ID NO: 392 comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277, or the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, or the second guide RNA molecule (21) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270, or comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule (22) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541, or comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule (23) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032, or comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule (24) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815, or comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277, or (25) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277, or comprises a targeting domain selected from the group consisting of SEQ ID NO: 393 to SEQ ID NO: 532, and the second guide RNA molecule (26) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839, and comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; or (27) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3271 to SEQ ID NO: 3541; or (28) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (29) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815; or comprises a targeting domain to be used; (30) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 533 to SEQ ID NO: 839 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277; or (31) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 2942 to SEQ ID NO: 3270; or (32) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 comprises a targeting domain to be used, and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3271 to comprise a targeting domain selected from the group consisting of SEQ ID NO: 3541; (33) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 3542 to SEQ ID NO: 4032; or (34) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4033 to SEQ ID NO: 4589, and SEQ ID NO: 5720 to SEQ ID NO: 5815; or (35) The first gRNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 840 to SEQ ID NO: 968 and the second guide RNA molecule comprises a targeting domain selected from the group consisting of SEQ ID NO: 4590 to SEQ ID NO: 5277. In multiple embodiments for the cell, the targeting domain of the first gRNA molecule and

[0063] the targeting domain of the second gRNA molecule and, if present, the targeting domain of the third gRNA molecule are g) Combinations A1 to A72 in Table 33; h) Combinations B1 to B84 in Table 34; i) Combinations C1 to C42 in Table 35; j) Combinations D1 to D36 in Table 36; k) Combinations E1 to E30 in Table 37; or l) Combinations F1 to F60 in Table 38 including, for example, consisting of any of the sequences thereof.

[0064] ​In multiple embodiments of the cell, the first gRNA molecule comprises a targeting domain comprising SEQ ID NO: 5569, SEQ ID NO: 5592, or SEQ ID NO: 5586, and the second g RNA molecule comprises a targeting domain comprising SEQ ID NO: 5775.

[0065] In any of the multiple aspects and multiple embodiments of the aforementioned cells, a gene comprising a target sequence complementary to the targeting domain of the first gRNA molecule, and, optionally, a gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule and / or a gene comprising a target sequence complementary to the targeting domain of the third gRNA molecule is modified to reduce or eliminate the expression of the gene comprising a target sequence complementary to the targeting domain of the first gRNA molecule, and, optionally, the functional product of the gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule, and / or the functional product of the gene comprising a target sequence complementary to the targeting domain of the third gRNA molecule. gene, and, optionally, the functional product of the gene comprising a target sequence complementary to the targeting domain of the second gRNA molecule, and / or the functional product of the gene comprising a target sequence complementary to the targeting domain of the third gRNA molecule. In another aspect, the present invention provides a method of effecting anti-tumor immunity in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells. In another aspect, the present invention provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells.

[0066] In another aspect, the present invention provides a method of effecting anti-tumor immunity in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells. amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells.

[0067] In another aspect, the present invention provides a method of treating cancer in a subject, the method comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells. amount of a cell as described herein, e.g., a cell of any of the multiple aspects and multiple embodiments of the aforementioned cells.

[0068] In another aspect, the present invention provides a method for treating a subject having a disease associated with the expression of a tumor antigen, such as a proliferative disease, a pre cancerous condition, cancer, and a non-cancer related indication associated with the expression of a tumor antigen, the method comprising administering to the subject an effective amount of a cell described herein, such as a cell of any of the plurality of aspects and the plurality of embodiments described above for said cell. In a plurality of embodiments, the disease associated with the expression of a tumor antigen is cancer or a non-cancer related indication. In a plurality of embodiments, the disease is colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal canal region cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumor, bladder cancer, kidney or ureteral cancer, renal pelvis cancer, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axial tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T cell lymphoma, environmentally induced cancer, combinations of said cancers, and metastatic lesions of said cancers. In a plurality of embodiments, the cancer is chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphocytic leukemia (ALL), B cell acute lymphocytic leukemia (B-ALL), T cell acute lymphocytic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML ), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, In a plurality of embodiments, the cancer is selected from the group consisting of: cancer selected from the group consisting of: . In a plurality of embodiments, the cancer is chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphocytic leukemia (ALL), B cell acute lymphocytic leukemia (B-ALL), T cell acute lymphocytic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML ), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, T cell acute lymphocytic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML ), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, Diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma , marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin lymphoma , Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and preleukemia and is a blood cancer selected from the group consisting of .

[0069] In multiple embodiments of any of the foregoing methods, the method further comprises administering a chemotherapeutic agent , for example, cyclophosphamide, fludarabine, or cyclophosphamide and fludarabine . In multiple embodiments of the method, the method comprises administering a lymphocyte depleting agent or immunosuppressive drug to the subject prior to the step of administering an effective amount of the cells described herein, for example, the cells of any of the foregoing aspects and multiple embodiments .

[0070] In another aspect, the invention is a method of preparing cells (e.g., a cell population) for immunotherapy comprising: (a) modifying the cells by reducing or eliminating the expression of components of the T cell receptor (TCR) by introducing into the cells, for example, any of the gRNA molecules of 2b-2h (described herein ), for example, more than one gRNA molecule, for example, any of the gRNA molecules of claims 3, 4, 5, 10, 11 or 12, for example, more than one gRNA molecule; and (b) introducing into the cells, for example, any of the gRNA molecules of 2a, 2i, 2 j, or 2k (described herein), for example, 1 . .​​ more than one gRNA molecule, such as a gRNA molecule of any one of claims 6 or 7, such as introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of HLA (e.g., HLA-A, HLA-B, and / or HLA-C) or B2M, thereby modifying the cell; and (c) expanding said cell to provide a method comprising the steps of. In a plurality of embodiments, the method is, for example, a gRNA molecule (described herein), for example, more than one gRNA molecule of 2p, such as a gRNA molecule of any one of claims 8 or 9, such as introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of CIITA, thereby further comprising the step of modifying the cell, wherein, prior to the step of expanding said cell, said step of modifying is optionally performed. In another aspect, the present invention provides a method for preparing cells (e.g., a cell population) for immunotherapy, comprising: (a) for example, a gRNA molecule of any one of 2b to 2h (described herein), for example, more than one gRNA molecule, such as a gRNA molecule of any one of claims 3, 4, 5, 10, 11 or 12 (described herein), for example, introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) for example, a gRNA molecule of any one of 2l, 2m, 2n, or 2o (described herein), for example, more than one gRNA molecule (described herein), for example, introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b)

[0071] In another aspect, the present invention provides a method for preparing cells (e.g., a cell population) for immunotherapy, comprising: (a) for example, a gRNA molecule of any one of 2b to 2h (described herein), for example, more than one gRNA molecule, such as a gRNA molecule of any one of claims 3, 4, 5, 10, 11 or 12 (described herein), for example, introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) for example, a gRNA molecule of any one of 2l, 2m, 2n, or 2o (described herein), for example, more than one gRNA molecule (described herein), for example, introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) for example, a gRNA molecule of any one of 2l, 2m, 2n, or 2o (described herein), for example, more than one gRNA molecule (described herein), for example, introducing more than one gRNA molecule into said cell to reduce or eliminate the expression of the components of the T cell receptor (TCR), thereby modifying the cell; and (b) The gRNA molecule of claim 13 (described herein), for example, more than one gRNA molecule, is introduced into the cell to reduce or eliminate the expression of the target of the immunosuppressive drug, thereby modifying the cell; (c) expanding the cell. A method comprising the steps is provided. In a plurality of embodiments of any of the foregoing methods of preparing a cell, the method comprises (d) For example, the gRNA molecule of claim 14 or 15 (described herein), for example, more than one gRNA molecule, is introduced into the cell to reduce or eliminate the expression of a first inhibitory molecule or an effector downstream of signal transduction via the inhibitory molecule, thereby further modifying the cell, wherein the modifying step is optionally performed before the expanding step.

[0072] In a plurality of embodiments of any of the foregoing methods of preparing a cell, the method (d) For example, the gRNA molecule of claim 14 or 15 (described herein), for example, more than one gRNA molecule is introduced into the cell to reduce or eliminate the expression of a first inhibitory molecule or an effector downstream of signal transduction via the inhibitory molecule, thereby further modifying the cell, and in this case, the modifying step is optionally performed before the step of expanding the cell.

[0073] In another aspect, the present invention is a method of preparing a cell (e.g., a cell population) for immunotherapy, comprising (a) for example, the gRNA molecule of claim 14 (described herein), for example, more than one gRNA molecule, for example, any of the gRNA molecules of claims 15 to 17, for example, more than one gRNA molecule is introduced into the cell to reduce or eliminate the expression of a first inhibitory molecule or an effector downstream of signal transduction via the inhibitory molecule, thereby modifying the cell; (c) expanding the cell. A method comprising the steps is provided. or eliminating it, thereby modifying the cell; (c) expanding the cell. A method comprising the steps is provided.

[0074] In a plurality of embodiments of any of the foregoing methods of preparing a cell, the method (e) For example, by introducing the gRNA molecule of claim 14 or 15, for example, more than one gRNA molecule, into the cell, reducing or eliminating the expression of a second inhibitory molecule or an effector downstream of signal transduction mediated by the inhibitory molecule, further comprising the step of modifying the cell, wherein the effector downstream of signal transduction mediated by the first inhibitory molecule or the inhibitory molecule is different from the effector downstream of signal transduction mediated by the second inhibitory molecule or the inhibitory molecule. In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the introduction of each gRNA molecule is simultaneous or sequential. In a plurality of embodiments, the introduction of each gRNA molecule is sequential and is spaced apart by at least 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days. In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises introducing into the cell, for example, a nucleic acid encoding a chimeric antigen receptor (CAR) as described herein.

[0075] In a plurality of embodiments, the nucleic acid encoding the CAR is placed on a template nucleic acid. In a plurality of embodiments, the nucleic acid encoding the CAR is placed on an RNA vector. In a plurality of embodiments, the nucleic acid encoding the CAR is placed on a lentiviral vector. In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises isolating cells that are negative for the expression of TCR. In a plurality of embodiments

[0076] In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises introducing into the cell, for example, a nucleic acid encoding a chimeric antigen receptor (CAR) as described herein. In a plurality of embodiments, the nucleic acid encoding the CAR is placed on a template nucleic acid. In a plurality of embodiments, the nucleic acid encoding the CAR is placed on an RNA vector. In a plurality of embodiments, the nucleic acid encoding the CAR is placed on a lentiviral vector. In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises isolating cells that are negative for the expression of TCR. In a plurality of embodiments In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises isolating cells that are negative for the expression of TCR.

[0077] In a plurality of embodiments of any of the aforementioned methods of preparing a cell, the method further comprises isolating cells that are negative for the expression of TCR. In a plurality of embodiments Then, the isolating step results in a cell population in which more than about 75% of the cells, for example, about 80%, 85%, 90%, 91%, 92%, 93, 94%, 95%, 96%, 97%, 98%, 9 9% or more than 99.5% are negative for TCR expression. In multiple embodiments, isolating cells negative for TCR expression includes contacting the cell population with a composition comprising an antibody specific for a component of the T cell receptor (TCR) and optionally bound to a solid support or a detection label, and isolating cells that do not bind to the antibody described above. In multiple embodiments, the cells are immune effector cells, for example, T cells or NK cells, for example, T cells. In multiple embodiments the cells are allogeneic to the subject to which they are administered, for example, the cells are isolated from a healthy donor, for example, a donor not suffering from a condition associated with the expression of tumor antigens. In multiple embodiments, the cells are autologous to the subject to which they are administered. In multiple embodiments of any of the aforementioned methods of preparing cells, steps (a) and / or (b) are performed ex vivo. In multiple embodiments, step (c) is performed ex vivo. In multiple embodiments, the expansion of step (c) is carried out for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, or for 2 - 15, 2 - 14, 2 - 13, 2 - 12, 2 - 11, 2 - 10, 3 - 1 0, 2 - 9, 3 - 9, 2 - 8, 3 - 8, 2 - 7, 3 - 7, 2 - 6, 3 - 6, 2 - 5, or 3 - 5 days. In multiple embodiments of any of the aforementioned methods of preparing cells, the gRNA

[0078] In multiple embodiments of any of the aforementioned methods of preparing cells, the gRNA The molecule can be a gRNA molecule as described herein, and can be used in combination with gRNA molecules (e.g., The targeting domains of each of the above (used in the present invention) are shown in Table 33, Table 34, Table 35, Table 36, and Table 3 7 or any of the combinations listed in Table 38, e.g. In some embodiments, the targeting domain of each of the gRNA molecules comprises: a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A 8, combination A37-A40, or combination A41-A44; b) Combination B1 to Combination B84 in Table 34; c) Combination C1 to Combination C42 in Table 35; d) Combinations D1 to D36 in Table 36, for example, combinations D2, D4, and D 20, or combination D22; e) Combinations E1 to E30 in Table 37, for example, combinations E2, E4, and E 8, or combination E10; or f) Combinations F1 to F60 in Table 38, for example, combinations F1 to F4, combinations F5 to F 8. Any of the combinations F13 to F16, or F17 to F20 Any array of Including, for example, consisting of:

[0079] In another aspect, the present invention provides a method of treating a subject in need thereof, comprising administering to said subject a compound as described herein. The method for preparing the described cells, e.g., the above-mentioned methods for preparing the cells Cells prepared by the method of any of the aspects and embodiments (e.g., cells In some embodiments, particularly in the case of an immunosuppressant drug, the method includes administering to the subject a population of immunosuppressants. In some embodiments, the method comprises administering to the subject a gRNA molecule that binds to a target sequence of a target. an agent such as rapamycin, a rapalog, or an mTor inhibitor such as RAD001; In some embodiments, the subject further comprises administering to the subject a tumor antigen associated with expression of the tumor antigen. Diseases that may be associated with the expression of tumor antigens, such as proliferative diseases, precancerous conditions, cancers, and non-cancerous conditions and a cancer-related indication, wherein said administration treats a disease associated with expression of said tumor antigen. In some embodiments, the disease associated with expression of a tumor antigen is cancer or a non-cancer related disease. In some embodiments, the disease is colon cancer, rectal cancer, renal cell carcinoma, liver cancer. , non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, and head and neck cancer. melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal region cancer, stomach cancer , testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's disease lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, Penile cancer, childhood solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS )Neoplasms, primary CNS lymphomas, tumor angiogenesis, spinal axis tumors, brain stem gliomas, pituitary gland tumors, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, In some embodiments, the cancer is selected from the group consisting of cancers including, but not limited to, cancers of the aforementioned types, combinations thereof, and metastatic lesions of said cancers. The cancer is chronic lymphocytic leukemia (CLL), acute leukemia, and acute lymphocytic leukemia (AL). L), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T- ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphoma Myeloid leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large cell type B Cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma a blood cancer selected from the group consisting of a malignant lymphoproliferative condition, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and preleukemia.

[0080] In another aspect, the invention provides a method of treating a patient suffering from a disease, the method comprising: (a) preparing a cell population derived from an allogeneic donor; and (b) introducing into the cells a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a targeting domain complementary to a target sequence within a gene selected from CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, and TRBC2, in a CRISPR system (e.g., a CRISPR system with Streptococcus pyogenes Cas9); ; and (c) optionally, selecting cells in which the expression of a functional TCR has been reduced or eliminated; ; and (d) transducing the cells with a nucleic acid encoding a CAR; and (e) administering the cells to a patient in need thereof, e.g., a patient having a disease associated with the expression of an antigen recognized by the CAR. In multiple embodiments, the first gRNA molecule against CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, or TRBC2 is any of the gRNA molecules of 2(b)-2(h), e.g., any of the gRNA molecules of claims 3, 4, 5, 10, 11 or 12.

[0081] ​​​​​​In multiple embodiments, a method of treating a patient suffering from a disease involves introducing into cells a CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from B2M, HLA-A, HLA-B, or HLA-C. In multiple embodiments, the second gRNA for B2M, HLA-A, HLA-B, or HLA-C is any one of the gRNA molecules of 2(a) or 2(i) - 2(k), e.g., any one of the gRNA molecules of claim 6 or 7. In multiple embodiments, the method further involves introducing into cells a CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. In multiple embodiments, the third gRNA molecule is any one of the gRNA molecules of 2(a) or 2(i) - 2(k), e.g., any one of the gRNA molecules of claim 6 or 7. A targeting domain complementary to a target sequence within a gene selected from HLA-A, HLA-B, or HLA-C. A second gRNA molecule (or a nucleic acid encoding said gRNA molecule) containing a targeting domain complementary to a target sequence within a gene selected from B2M, HLA-A, HLA-B, or HLA-C. A CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from B2M, HLA-A, HLA-B, or HLA-C. In multiple embodiments, a method of treating a patient suffering from a disease involves introducing into cells a CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from B2M, HLA-A, HLA-B, or HLA-C. The second gRNA for B2M, HLA-A, HLA-B, or HLA-C is any one of the gRNA molecules of 2(a) or 2(i) - 2(k), e.g., any one of the gRNA molecules of claim 6 or 7. For example, any one of the gRNA molecules of claim 6 or 7. In multiple embodiments, the method further involves introducing into cells a CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. A targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. A third gRNA molecule (or a nucleic acid encoding said gRNA molecule) containing a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. A CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. For example, a CRISPR system using Streptococcus pyogenes Cas9. In multiple embodiments, the method further involves introducing into cells a CRISPR system (e.g., a CRISPR system using Streptococcus pyogenes Cas9) comprising a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. The third gRNA molecule is any one of the gRNA molecules of 2(a) or 2(i) - 2(k), e.g., any one of the gRNA molecules of claim 6 or 7. For example, any one of the gRNA molecules of claim 6 or 7.

[0082] In other embodiments, a method of treating a patient suffering from a disease involves introducing into cells a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) that contains a targeting domain complementary to a target sequence within a gene selected from DCK, CD52, FKBP1A, or NR3C1. A targeting domain complementary to a target sequence within a gene selected from DCK, CD52, FKBP1A, or NR3C1. A second gRNA molecule (or a nucleic acid encoding said gRNA molecule) containing a targeting domain complementary to a target sequence within a gene selected from DCK, CD52, FKBP1A, or NR3C1. comprising introducing a CRISPR system (e.g., a CRISPR system by Streptococcus pyogenes (S. pyogenes) Cas9) comprising the nucleic acid Further comprising. In multiple embodiments, the second gRNA molecule for DCK, C D52, FKBP1A, or NR3C1 is any of the second gRNA molecules of 2(l)-2 (o), e.g., the second gR NA molecule of claim 13. The second gRNA is for DCK, and the method further comprises administering to the patient a nucleoside analog-based drug. In multiple embodiments, e.g., the nucleoside analog-based drug is cytarabine or gemcitabine. The second gRNA is for CD52, and the method further comprises administering to the patient an anti-CD52 antibody or an antigen-binding fragment thereof. In multiple embodiments, e.g., the anti-CD52 antibody or an antigen-binding fragment thereof is alemtuzumab (CAMPATH (registered trademark)). In multiple embodiments where the second gRNA is for FKBP1A, the method further comprises administering to the patient an mTor inhibitor such as FK506, cyclosporine, rapamycin or a rapalog, or RAD0 01. The second gR NA is for NR3C1, and the method further comprises administering to the patient a corticosteroid. In multiple embodiments, e.g., the corticosteroid is dexamethasone.

[0083] For any of the methods of treating a patient suffering from the aforementioned disease, in multiple embodiments the gRNA molecule is the gRNA molecule described herein, and each targeting domain of the gRNA molecule ( e.g., used in combination) is shown in Table 33, Table 34, Table comprising any of the arrays of the combinations listed in Table 35, Table 36, Table 37 or Table 38, for example, consisting of. In a plurality of embodiments, the targeting domain of each gRNA molecule is, a) combinations A1 - A72 of Table 33, for example, combinations A1 - A4, combinations A5 - A 8, combinations A37 - A40, or combinations A41 - A44; b) combinations B1 - B84 of Table 34; c) combinations C1 - C42 of Table 35; d) combinations D1 - D36 of Table 36, for example, combination D2, combination D4, combination D 20, or combination D22; e) combinations E1 - E30 of Table 37, for example, combination E2, combination E4, combination E 8, or combination E10; or f) combinations F1 - F60 of Table 38, for example, combinations F1 - F4, combinations F5 - F 8, combinations F13 - F16, or any of combinations F17 - F20 any of the arrays comprising, for example, consisting of.

[0084] For any of the methods of treating a patient suffering from the aforementioned disease, in a plurality of embodiments, the method comprises introducing into cells CD274, HAVCR2, LAG3, PDCD1, PD -L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, C D160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VT CN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGF-beta, or PT ​Comprising a targeting domain complementary to a target sequence within a gene selected from PN11, a fourth gRNA molecule (or a nucleic acid encoding said gRNA molecule), of a CRISPR system (e.g., a CRISPR system with Streptococcus pyogenes Cas9) is introduced step, for example, the fourth gRNA molecule is CD274, HAVCR2, L AG3, PDCD1, or against PTPN11, for example, any of the gRNA molecules of 15(a)-(e), for example, any of the gRNA molecules of claims 16 to 17 is.

[0085] In another aspect, the present invention is a method of treating a patient suffering from a disease, (a) preparing a cell population (described herein), for example, immune effector cells step; (b) introducing into the cell population a first gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a targeting domain complementary to a target sequence within a gene selected from CD247, CD3D, CD3E, CD3G, TRAC, TRB C1, and TRBC2, of a CRISPR system (e.g., a CRISPR system with Streptococcus pyogenes Cas9) step; and (c) introducing into the cell population a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a targeting domain complementary to a target sequence within a gene selected from B2M, HLA-A, HLA-B, and HLA-C of a CRISPR system (e.g., a CRISPR system with Streptococcus pyogenes Cas9) step; (d) Optionally, a functional TCR, functional B2M, or functional TCR and B2M (d) Optionally, a functional TCR, a functional B2M, or both a functional TCR and B2M selecting cells in which both expressions have been reduced or lost; (d) introducing a nucleic acid encoding a CAR into a cell population; (e) administering the cell population to a patient in need thereof, such as a patient having a disease associated with the expression of an antigen recognized by the CAR ; and Provided is a method comprising. In a plurality of embodiments of the method, the method further comprises (f) introducing into the cell population a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) comprising a targeting domain complementary to a target sequence within a gene selected from CIITA, RFXANK, RFX5, and RFXAP, wherein the CRISPR system (e.g., the CRISPR system using Cas9 of Streptococcus pyogenes) is used. In a plurality of embodiments, the first gRNA molecule comprises, for example, a targeting domain complementary to a target sequence within a gene selected from TRAC, TRBC1, and TRBC2, such as those described herein, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 ; and RNA molecule). In a plurality of embodiments, the first gRNA molecule comprises, for example, a targeting domain complementary to a target sequence within a gene selected from TRAC, TRBC1, and TRBC2, such as those described herein, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 RNA molecule). In a plurality of embodiments, the first gRNA molecule comprises, for example, a targeting domain complementary to a target sequence within a gene selected from TRAC, TRBC1, and TRBC2, such as those described herein, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 ; and In a plurality of embodiments, the first gRNA molecule comprises, for example, a targeting domain complementary to a target sequence within a gene selected from TRAC, TRBC1, and TRBC2, such as those described herein, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 ; and RNA molecule). In a plurality of embodiments, the first gRNA molecule comprises, for example, a targeting domain complementary to a target sequence within a gene selected from TRAC, TRBC1, and TRBC2, such as those described herein, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5585, SEQ ID NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO: 5591, SEQ ID NO: 5610, SEQ ID NO: 5608, SEQ ID NO: 5617, SEQ ID NO: 5619, and SEQ ID NO: 5620, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5592, SEQ ID NO: 5587, SEQ ID NO: 5599, SEQ ID NO: 5600, and SEQ ID NO: 5586, for example, a targeting domain selected from SEQ ID NO: 5569, SEQ ID NO: 5586, and SEQ ID NO: 5 ; and ; and ; and ; and ; and ; and ; and comprising (e.g., consisting of) a targeting domain selected from 592. In other embodiments the first gRNA molecule comprises a targeting domain complementary to a target sequence within a gene selected from, for example, CD3E, CD3 G, and CD3D as described herein. In multiple embodiments, the second gRNA molecule is, for example, the B2M gene as described herein, and is, for example, SEQ ID NO: 5519, SEQ ID NO: 5497, SEQ ID NO: 549 9, SEQ ID NO: 5498, SEQ ID NO: 5503, SEQ ID NO: 5496, SEQ ID NO: 5507, SEQ ID comprising a targeting domain selected from number 5515, SEQ ID NO: 5493, SEQ ID NO: 5506, SEQ ID NO: 5509, SEQ ID NO: 55 17, SEQ ID NO: 5521, SEQ ID NO: 5520, SEQ ID NO: 5500, SEQ ID NO: 5494, SEQ ID comprising a targeting domain selected from number 5508, SEQ ID NO: 5514, and SEQ ID NO: 5492, for example, a targeting domain selected from SEQ ID NO: 5496, SEQ ID NO: 5498, and SEQ ID NO: 5509 within the B2M gene (e.g., consisting of) a targeting domain complementary to a target sequence within the B2M gene. In multiple embodiments, the third gR NA molecule is, for example, the CIITA gene as described herein, and is, for example, SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID comprising a targeting domain selected from number 775 8, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID comprising a targeting domain selected from number 7754, SEQ ID NO: 7745, SEQ ID NO: 7785, SEQ ID NO: 7731, SEQ ID NO: 77 72, SEQ ID NO: 7743, or SEQ ID NO: 7750, for example, a targeting domain selected from SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: 7785, and (e.g., consisting of) a targeting domain within the CIITA gene complementary to a target sequence. In multiple embodiments, the third gRNA molecule is, for example, the CIITA gene as described herein, and is, for example, SEQ ID NO: 7771, SEQ ID NO: 7769, SEQ ID NO: 7773, SEQ ID NO: 7726, SEQ ID comprising a targeting domain selected from number 775 8, SEQ ID NO: 7739, SEQ ID NO: 7779, SEQ ID NO: 7770, SEQ ID NO: 7749, SEQ ID 72, SEQ ID NO: 7743, or SEQ ID NO: 7750, for example, a targeting domain selected from SEQ ID NO: 7769, SEQ ID NO: 7771, SEQ ID NO: 7739, or SEQ ID NO: It contains a targeting domain complementary to the target sequence within the TA gene. In a preferred embodiment each targeting domain of the gRNA molecules (e.g., those used in combination) contains a sequence of any of the combinations listed in Table 33, Table 34, or Table 38, for example consisting of. In multiple embodiments, each targeting domain of the gRNA molecule is a) combinations A1 - A72 of Table 33, for example, combinations A1 - A4, combinations A5 - A 8, combinations A37 - A40, or combinations A41 - A44; b) combinations B1 - B84 of Table 34; or c) combinations F1 - F60 of Table 38, for example, combinations F1 - F4, combinations F5 - F 8, combinations F13 - F16, or any of combinations F17 - F20 any of the sequences among them including, for example, consisting of.

[0086] In multiple embodiments of a method for treating a patient suffering from a disease, the method further includes the step of introducing into said cell a nucleic acid molecule encoding an NK inhibitory molecule (e.g., as described herein), for example a nucleic acid molecule encoding an HLA - G:B2M fusion, for example, a nucleic acid molecule encoding SEQ ID NO: 10674 . In multiple embodiments of a method for treating a patient suffering from a disease, the cell (or cell population) is an immune effector cell or a population of immune effector cells, for example, a T cell (or a population of T cells). In multiple embodiments, the cell (or cell population) is allogeneic to the patient, for example isolated from a healthy human donor. In other embodiments, the cell (or cell population) is the patient . In some embodiments, the CAR is autologous to the CD19 CAR (e.g., (described in the detailed description), for example, any one of SEQ ID NO: 7883 to SEQ ID NO: 7898 In another embodiment, the CAR is a CD19 CAR comprising an antigen-binding domain comprising one or more of the following: For example, SEQ ID NO: 7939 to SEQ ID NO: 8112, or SEQ ID NO: 8155 to SEQ ID NO: 8166, For example, SEQ ID NO: 7949, for example, SEQ ID NO: 8549 Any one of SEQ ID NO: 8621, for example, SEQ ID NO: 8559, e.g. For example, the antigen recognition domain comprises this.

[0087] In another aspect, the present invention provides a method for the production of modified T-cells that have a) T cell receptor component(s) that are different from unmodified cells of the same type. b) reduced or eliminated expression of B2M; and / or c) CIITA. Modified cells are provided. In some embodiments, the T cell receptor component is TCR alpha. In another embodiment, the TCR is a TCR beta chain, e.g., a TCR alpha chain. is CD3 delta, CD3 epsilon, or CD3 gamma, e.g., In some embodiments, the modified cell (or cell population) is a T cell. Reducing or eliminating expression of receptor components, B2M, and CIITA There are.

[0088] In another aspect, the present invention provides a method for the production of modified T-cells that have a) T cell receptor component(s) that are different from unmodified cells of the same type. a) in a gene encoding the gene; b) in B2M; and / or c) in CIITA, or In this vicinity, modified sequences containing insertions or deletions of base pairs, for example, more than one base pair, are Cells are provided. In multiple embodiments, each of the insertions or deletions is an indel. In multiple embodiments, each of the insertions or deletions is a frameshift mutation. In multiple embodiments, the modified cell (or cell population) contains base pairs, such as, one or more base pair insertions or deletions, in or near the genes encoding components of the T cell receptor, B2M, and CIITA.

[0089] In another aspect, the present invention includes a plurality of aspects of the aforementioned cells (e.g., modified cells) and modified cells of any of a plurality of embodiments, and in at least about 30% of the cells, at least one of the insertions or deletions is a frameshift mutation, such as measured by NGS, to provide a cell population.

[0090] In another aspect, the present invention provides (a) a nucleic acid sequence encoding a CAR as described herein, for example; (b) optionally, a nucleic acid sequence encoding an NK inhibitory molecule as described herein, for example, a nucleic acid encoding HLA-G or an HLA-G:B2M fusion as described herein; (c) an indel in or near the sequence of a gene encoding a component of the TCR (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, e.g., TRAC) or its regulatory element, for example, a targeting domain for a component of the TCR (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, e.g., TRAC), including, for example, a targeting domain listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g, for a gRNA target ​​​​​​​​Indels in or near the array; (d) Indels in or near the sequence of the gene encoding B2M or its regulatory element, e.g., in the targeting domain for B2M, e.g., including the targeting domains listed in Table 1 or Table 3, indels in or near the target sequence of the gRNA; (e) Optionally, indels in or near the sequence of the gene encoding CIITA or its regulatory element, e.g., in the targeting domain for CIITA, e.g., including the targeting domains listed in Table 1 or Table 6c, indels in or near the target sequence of the gRNA; and (f) Optionally, indels in or near the sequence of the gene encoding LILRB1 or its regulatory element, e.g., in the targeting domain for LILRB1, e.g., including the targeting domains listed in Table 6d, indels in or near the target sequence of the gRNA containing cells, wherein the cell (or cell population comprising said cell) expresses a CAR and optionally a NK inhibitory molecule, and exhibits a reduction or loss of expression and / or function of one or more of i) components of the TCR (e.g., TRAC, TRBC1, TRBC2, CD3 D, CD3E, or CD3G, e.g., TRAC), ii) B2M, iii) CIIT A, and / or iv) LILRB1, to provide cells (e.g., cells comprising these, e.g., a cell population comprising more than one cell). In multiple embodiments, gRNAs for components of the TCR, B2M, and CIITA ​​​​​​​​​The targeting domain sequences of molecule A (described herein) are any combination listed in Table 33, Table 34, or Table 38, for example, a) Combinations A1 - A72 in Table 33, such as combinations A1 - A4, combinations A5 - A 8, combinations A37 - A40, or combinations A41 - A44; b) Combinations B1 - B84 in Table 34; or c) Combinations F1 - F60 in Table 38, such as combinations F1 - F4, combinations F5 - F 8, combinations F13 - F16, or combinations F17 - F20, including, for example, consisting of, the targeting domains listed therein.

[0091] In another aspect, the present invention relates to (a) For example, a nucleic acid sequence encoding a CAR as described herein; (b) Optionally, for example, a nucleic acid sequence encoding an NK inhibitory molecule as described herein, for example, a nucleic acid encoding HLA - G as described herein; (c) An indel in or near the sequence of a gene encoding a component of a TCR (such as TRAC, TRBC1, TRBC2, CD3D, C D3E, or CD3G, such as TRAC) or its regulatory element, for example, an indel in or near the sequence of a gene encoding a component of a TCR (such as TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) containing a targeting domain for, for example, the targeting domains listed in Table 1, Table 4, Table 5, Table 6 e, Table 6f, or Table 6g, an indel in or near the target sequence of a gRNA; (d) An indel in or near the sequence of a gene encoding NLRC5 or its regulatory element, for example, containing a targeting domain for NLRC5 ​ 、 for example, indels in or near the target sequence of a gRNA that includes a targeting domain listed in Table 1 ; or in the vicinity thereof; (e) optionally, an indel in or near the sequence of a gene encoding CIITA or its regulatory element, for example, a targeting domain for CIITA that includes, for example, a targeting domain listed in Table 1 or Table 6c, an indel in or near the target sequence of a gRNA; and (f) optionally, an indel in or near the sequence of a gene encoding LILRB1 or its regulatory element, for example, a targeting domain for LILRB1 that includes, for example, a targeting domain listed in Table 6d, an indel in or near the target sequence of a gRNA ; A cell comprising the above, wherein the cell (or a cell population comprising one or more of said cells) expresses a CAR and, optionally, an NK inhibitory molecule, and exhibits a reduction or loss of expression and / or function of i) a component of the TCR (for example, TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, for example, TRAC), ii) β2M, iii) NLRC5, and / or iv) LILRB1 ; provided is a cell (for example, a cell comprising these, for example, a cell population comprising more than one cell). In another aspect, the present invention provides (a) a nucleic acid sequence encoding a CAR as described herein, for example; (b) a component of the TCR (for example, TRAC, TRBC1, TRBC2, CD3D, C D3E, or CD3G, for example, TRAC);

[0092] In another aspect, the invention (a) a nucleic acid sequence encoding a CAR as described herein, for example; (b) a component of the TCR (for example, TRAC, TRBC1, TRBC2, CD3D, C D3E, or CD3G, e.g., TRAC) or its regulatory element, the indels in or near the sequence of the gene encoding it, e.g., in the components of TCR (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), including a targeting domain, e.g., targeting domains listed in Table 1, Table 4, Table 5, Table 6e, Table 6f, or Table 6g, the indels in or near the target sequence of the gRNA; and and (c) the indels in or near the sequence of the gene encoding FKBP1A or its regulatory element, e.g., including a targeting domain for FKBP1A, e.g., targeting domains listed in Table 1 or Table 6b, the indels in or near the target sequence of the gRNA comprising a cell, wherein the cell (or cells containing these, e.g., a cell population containing more than one cell) expresses CAR, and exhibits a reduction or loss of expression and / or function of one or more of i) the components of TCR (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), and / or ii) FKBP12, providing a cell (e.g., cells containing these, e.g., a cell population containing more than one cell). In multiple embodiments, the targeting domain sequences of the gRNA molecules for the components of TCR and FKBP1A (described herein) are any combination listed in Table 35, Table 36, or Table 37, e.g., a) combinations C1 to C42 in Table 35; b) combinations D1 to D36 in Table 36, e.g., combination D2, combination D4, combination D and a) Combinations C1 - C42 of Table 35; b) Combinations D1 - D36 of Table 36, e.g., combination D2, combination D4, combination D 20, or combination D22; or c) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E 8, or combination E10 comprising a targeting domain listed in, for example, consisting of these.

[0093] In another aspect, the present invention is (a) a nucleic acid sequence encoding a CAR as described herein, for example; (b) a nucleic acid sequence encoding rapamycin-resistant mTor as described herein , for example, an mTor encoding the S2035 mutation, for example, the S2035I mutation nucleic acid sequence; and (c) an indel in or near the sequence of a gene encoding a component of the TCR (e.g., TRAC, TRBC1, TRBC2, CD3D, C D3E, or CD3G, e.g., TRAC) or its regulatory element, for example, a targeting domain for a component of the TCR (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), for example, comprising a targeting domain listed in Table 1, Table 4, Table 5, Table 6 e, Table 6f, or Table 6g, an indel in or near the target sequence of the gRNA comprising a targeting domain listed in, for example, a cell wherein the indel is in or near the target sequence of the gRNA comprising a cell, a cell (or said cell, e.g., a cell population comprising more than one of said cells) expresses a CAR and rapamycin-resistant mTor, and exhibits a reduction or loss of expression and / or function of a component of the TCR (e.g., TR AC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRA C), providing a cell (e.g., a cell comprising these, e.g., a cell population comprising more than one cell). do.

[0094] Indels or IL-1 in genes encoding components of the TCR, B2M, and CIITA In some embodiments, the indels are directed to components of the TCR, including indels at or near these components. The targeting domain of the gRNA molecule that targets B2M The targeting domain of the gRNA molecule for CIIRA is a) a template of the gRNA molecule listed in any combination of A1 to A72 in Table 33, b) a targeting domain sequence, or c) any of B1 to B84 of Table 34. The combination of the targeting domain sequences of each gRNA molecule is, for example, It consists of this.

[0095] Indels or deficiencies in genes encoding components of the TCR and FKBP1A In some embodiments, the gR gene is a gene encoding a TCR component, and the gR gene is an indel in the vicinity of the TCR component. The targeting domain of the NA molecule and the targeting domain of the gRNA molecule against FKBP1A The binding domains are each selected from the group consisting of a) any combination of C1 to C42 in Table 35; a) a targeting domain sequence of the gRNA molecule; b) any combination of D1 to D36 in Table 36 or c) a targeting domain sequence of said gRNA molecule, as listed in Table 37. Any combination of E1 to E30 of the targeting domain of the gRNA molecule is listed. The sequence may include, for example, consist of:

[0096] Any of the aspects and embodiments of the cells described above. In a plurality of embodiments, each of the indels in the cell is introduced into the cell, each of which contains a targeting domain complementary to the target sequence at or near each of the indels in a gRNA molecule, e.g., more than one gRNA molecule (e.g., each of the gRNA molecules, e.g., each of the more than one gRNA molecules) in a CRISPR system, e.g., more than one CRISPR system).

[0097] In another aspect, the present invention provides a cell population in which at least about 30%, e.g., at least about 50%, e.g., at least about 75%, e.g., at least about 90% of the cells in the population are cells of any one of the plurality of aspects or embodiments for the cells described above . In a plurality of embodiments, in at least about 30% of the cells (e.g., in at least about 40% of the cells, e.g., in at least about 50% of the cells, e.g., in at least about 60% of the cells, e.g., in at least about 70% of the cells, e.g., in at least about 80% of the cells, e.g., in at least about 90% of the cells, e.g., in at least about 95% of the cells, e.g., in at least about 99% of the cells) of the cells, each of the indels is a frameshift mutation. In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 34A, FIG. 34B , or FIG. 49. In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48 . In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48 . In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48 . In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48 . In a plurality of embodiments including any one of the plurality of aspects and embodiments for the cells described above, the present invention provides a cell (or cell population) containing an indel listed in FIG. 36 or FIG. 48 Provide a cell (or cell population). Among the multiple aspects and multiple embodiments of the aforementioned cells, In some embodiments, which include any of the foregoing, the present invention provides a cell (or cell population) comprising an indel listed in FIGS. 38, 41, 44, or 50. In some embodiments, which include any of the foregoing, the present invention provides a cell (or cell population) comprising an indel listed in FIG. 53. In some embodiments, which include any of the foregoing, the present invention provides a cell (or cell population) comprising an indel listed in FIG. 53. In some embodiments, which include any of the foregoing, the present invention provides a cell (or cell population) comprising an indel listed in FIG. 53.

[0098] In another aspect, the present invention provides a cell population comprising any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, at least about 20% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, at least about 50% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, less than about 5%, for example, less than about 1%, for example, less than about 0.01% of the cells in the cell population contain off-target indels. In some embodiments, the cells of the cell population are engineered to express a chimeric antigen receptor (CAR). In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. In other embodiments, the CAR is, for example, any one of SEQ ID NOs: 7939 to 8112, or any one of SEQ ID NOs: 8155 to 8166. In some embodiments, at least about 20% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, at least about 20% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, at least about 50% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, at least about 50% of the cells in the cell population are any of the cells of the foregoing multiple aspects and multiple embodiments of the cells. In some embodiments, less than about 5%, for example, less than about 1%, for example, less than about 0.01% of the cells in the cell population contain off-target indels. In some embodiments, less than about 5%, for example, less than about 1%, for example, less than about 0.01% of the cells in the cell population contain off-target indels. In some embodiments, the cells of the cell population are engineered to express a chimeric antigen receptor (CAR). In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. In some embodiments, the CAR is a CD19 CAR (e.g., as described herein), for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NOs: 7883 to 7898, or comprising the sequence of SEQ ID NO: 7909 or SEQ ID NO: 7920. An antigen recognition domain containing two, for example, containing SEQ ID NO: 7949, for example, hereinafter A BCMA CAR containing an antigen recognition domain as described above, or, for example, any one of SEQ ID NOs: 8549 to SEQ ID NO: 8621, for example, containing SEQ ID NO: 8559, for example A BCMA CAR containing an antigen recognition domain consisting of the foregoing. In multiple embodiments, The cell is an animal cell, for example, a mammalian, primate, or human cell, for example, a human cell is. In multiple embodiments, the cell is an immune effector cell (e.g., a population of immune effector cells), for example, a T cell or an NK cell, for example, a T cell, for example, a CD4+ T cell, a CD8+ T cell, or a combination thereof. In multiple embodiments, the cell is allogeneic to the patient to whom the preceding cells are administered, for example, the cells are isolated from a healthy human subject. In other embodiments, the cells are autologous to the patient to whom the cells are administered.

[0099] In another aspect, the present invention is a method for treating a disease, for example, cancer, in a patient in need thereof, comprising administering any one of the multiple aspects and multiple embodiments of the foregoing cells for the foregoing cells. In multiple embodiments, in particular, the method further comprises reducing or eliminating the expression or function of a target of an immunosuppressive drug. In multiple embodiments, the method further comprises the step of administering an immunosuppressive drug, for example, RAD001.

[0100] In another aspect, the present invention provides a gRNA molecule described herein for use as a medicament (e.g., a gRNA molecule in any one of the multiple aspects and multiple embodiments of the foregoing gRNA molecules), a composition described herein (e.g., the foregoing composition in any one of the multiple aspects and multiple embodiments), A composition in any of a plurality of aspects and a plurality of embodiments of the article), the present nucleic acid described in the specification (e.g., nucleic acid in any of a plurality of aspects and a plurality of embodiments of the aforementioned nucleic acid), the vector described in the present specification (e.g., vector in any of a plurality of aspects and a plurality of embodiments of the aforementioned vector), or the cell (or cell population) described in the present specification (e.g., any of a plurality of aspects and a plurality of embodiments of the aforementioned cell (e.g., modified cell) or cell population) provides a cell (or cell population). In another aspect, the present invention provides a gRNA molecule described in the present specification (e.g., a gRNA molecule in any of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule), a composition described in the present specification (e.g., composition in any of a plurality of aspects and a plurality of embodiments of the aforementioned composition), the nucleic acid described in the present specification (e.g., nucleic acid in any of a plurality of aspects and a plurality of embodiments of the aforementioned nucleic acid), the vector described in the present specification (e.g., vector in any of a plurality of aspects and a plurality of embodiments of the aforementioned vector), or the cell (or cell population) described in the present specification (e.g., any of a plurality of aspects and a plurality of embodiments of the aforementioned cell (e.g.,

[0101] modified cell) or cell population) provides a cell (or cell population). In another aspect, the present invention provides a gRNA molecule described in the present specification (e.g., a gRNA molecule in any of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule), a composition described in the present specification (e.g., composition in any of a plurality of aspects and a plurality of embodiments of the aforementioned composition), the nucleic acid described in the present specification (e.g., nucleic acid in any of a plurality of aspects and a plurality of embodiments of the aforementioned nucleic acid), the vector described in the present specification (e.g., vector in any of a plurality of aspects and a plurality of embodiments of the aforementioned vector), or the cell (or cell population) described in the present specification (e.g., any of a plurality of aspects and a plurality of embodiments of the aforementioned cell (e.g., ) provides a cell (or cell population). In another aspect, the present invention provides a gRNA molecule described in the present specification (e.g., a gRNA molecule in any of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule), a composition described in the present specification (e.g., composition in any of a plurality of aspects and a plurality of embodiments of the aforementioned composition), the nucleic acid described in the present specification (e.g., nucleic acid in any of a plurality of aspects and a plurality of embodiments of the aforementioned nucleic acid), the vector described in the present specification (e.g., vector in any of a plurality of aspects and a plurality of embodiments of the aforementioned vector), or the cell (or cell population) described in the present specification (e.g., any of a plurality of aspects and a plurality of embodiments of the aforementioned cell (e.g., modified cell) or cell population) provides a cell (or cell population). In another aspect, the present invention provides a gRNA molecule described in the present specification (e.g., a gRNA molecule in any of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule), a composition described in the present specification (e.g.,

[0102] In another aspect, the present invention provides a gRNA molecule described in the present specification (e.g., a gRNA molecule in any of a plurality of aspects and a plurality of embodiments of the aforementioned gRNA molecule) for use in the treatment of a disease, a composition described in the present specification (e.g., RNA molecules (e.g., gRNA molecules in any of the multiple aspects and multiple embodiments for the aforementioned gRNA molecules ), the compositions described herein (e.g., compositions in any of the multiple aspects and multiple embodiments for the aforementioned compositions), the nucleic acids described herein (e.g., nucleic acids in any of the multiple aspects and multiple embodiments for the aforementioned nucleic acids), the vectors described herein (e.g., vectors in any of the multiple aspects and multiple embodiments for the aforementioned vectors ), or the cells (or cell populations) described herein (e.g., the cells (e.g., modified cells) or cell populations in any of the multiple aspects and multiple embodiments for the aforementioned cells (or cell populations)) are provided.

[0103] In another aspect, the present invention relates to the treatment of diseases associated with the expression of tumor antigens, such as proliferative diseases, pre cancerous conditions, cancer, and diseases that are non-cancer-related indications associated with the expression of tumor antigens. For use in this regard, the gRNA molecules described herein (e.g., gRNA molecules in any of the multiple aspects and multiple embodiments for the aforementioned gRNA molecules ), the compositions described herein (e.g., compositions in any of the multiple aspects and multiple embodiments for the aforementioned compositions), the nucleic acids described herein (e.g., nucleic acids in any of the multiple aspects and multiple embodiments for the aforementioned nucleic acids ), the vectors described herein (e.g., vectors in any of the multiple aspects and multiple embodiments for the aforementioned vectors), or the cells described herein are provided. A cell (or cell population) (e.g., the cell (e.g., modified cell) or cell population described above, with respect to any of a plurality of aspects and a plurality of embodiments thereof, provides a cell (or cell population).

[0104] In another aspect, the present invention relates to chronic lymphocytic leukemia (CLL), acute leukemia, acute lympho cytic leukemia (ALL), B-cell acute lymphocytic leukemia (B-ALL), T-cell acute lympho cytic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell type follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin lymphoma Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenström macroglobulinemia, and a preleukemia, for use in the treatment of a cancer selected from the group consisting of a gRNA molecule (e.g., a gRNA molecule as described herein, with respect to any of a plurality of aspects and a plurality of embodiments thereof, for the gRNA molecule described above), a composition as described herein (e.g., a composition as described herein, with respect to any of a plurality of aspects and a plurality of embodiments thereof), a nucleic acid as described herein (e.g., a nucleic acid as described herein, with respect to any of a plurality of aspects and a plurality of embodiments thereof), a vector as described herein (e.g., a vector as described herein, with respect to any of a plurality of aspects and a plurality of embodiments thereof), or as described herein a vector), or as described herein with respect to any of a plurality of aspects and a plurality of embodiments thereof), or as described herein The cells (or cell populations) described in any of a plurality of aspects and embodiments of the cells ( or cell populations) of

[0105] In another aspect, the present invention relates to, for example, mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or uveal malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal canal region cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin disease, non-Hodgkin lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder cancer, kidney or ureteral cancer, renal pelvis cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal cord tumors, brainstem glioma, pituitary adenoma, Kaposi sarcoma, epidermoid carcinoma, squamous cell carcinoma, T cell lymphoma, environmental induced cancer, combinations of said cancers, and metastatic lesions of said cancers, for use in the treatment of cancer selected from the group consisting of the gRNA molecules described herein (e.g., any of a plurality of aspects and embodiments of the aforementioned gRNA molecules), the compositions described herein (e.g., any of a plurality of aspects and embodiments of the aforementioned compositions), the nucleic acids described herein (e.g., any of a plurality of aspects and embodiments of the aforementioned nucleic acids), the vectors described herein (e.g., any of a plurality of aspects and embodiments of the aforementioned vectors), or herein nucleic acid), the vectors described herein (e.g., any of a plurality of aspects and embodiments of the aforementioned vectors), or herein the cell (or cell population) described in any of a plurality of aspects and embodiments of the cell ( or cell population) for the cell population is provided.

[0106] In addition to the specific features of the present invention described above, the gRNA molecule, Cas9 molecule, and the following general features of the cell are any aspect and implementation of the present invention described herein form, including the plurality of aspects and embodiments described above, and are assumed to be applicable to the embodiments.

[0107] In any of a plurality of aspects and embodiments disclosed herein, the gR NA molecule (e.g., a gRNA molecule comprising a targeting domain described herein, or a combination of gRNA molecules) may include one or more of the following features.

[0108] In certain embodiments, the gRNA molecule (e.g., a gRNA molecule comprising a targeting domain described herein, or one or more gR of a combination of gRNA molecules NA molecules), the targeting domain and tracr are arranged on separate nucleic acid molecules is a dgRNA molecule. In a plurality of embodiments, crRNA is from 5' to 3', targeting domain]-: a) SEQ ID NO: 6584; b) SEQ ID NO: 6585; c) SEQ ID NO: 6605; d) SEQ ID NO: 6606; e) SEQ ID NO: 6607; f) SEQ ID NO: 6608; or g) SEQ ID NO: 7806 ​comprises. In a preferred embodiment, the crRNA is from 5' to 3', [Targeting domain - [SEQ ID NO: 6607]. In a plurality of embodiments, the tracr is a Streptococcus pyogenes tracr sequence (GUUGGAACCAUUCAAAACAGC AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGC, of which more than 15, e.g., 20 or more or more, 30 or more, 40 or more, 50 or more or more, 60 or more, 70 or more, or 80 or more nucleotides. In a plurality of embodiments, the tracr additionally comprises 1 or more, e.g., 1, 2, 3, 4, 5, 6 or 7, e.g., preferably 4 or 7 U nucleotides at the 3' end. For a preferred embodiment of the dgRNA, the tracr comprises SEQ ID NO: 7820. In a plurality of embodiments, the tracr additionally comprises 1 or more, e.g., 1, 2, 3, 4, 5, 6, or 7, e.g., preferably 4 or 7 U nucleotides at the 3' end. For a preferred embodiment of the dgRNA, the tracr comprises SEQ ID NO: 6660, e.g., consists of this. For a preferred embodiment of the dgRNA, the crRNA comprises [Targeting domain]-SEQ ID NO: 6607 and, e.g., consists of this, and the tracr comprises SEQ ID NO: 7820, e.g., comprises SEQ ID NO: 6660, e.g., consists of this.

[0109] ​In other embodiments, the gRNA molecule (e.g., a gRNA molecule comprising a targeting domain described herein, or a combination of gRNA molecules) is an sgRNA molecule having the targeting domain and tracr disposed on a single nucleic acid molecule. In a plurality of embodiments, the sgRNA molecule is: (a) SEQ ID NO: 6601; - - - (b) SEQ ID NO: 6602; (c) SEQ ID NO: 6603; (d) SEQ ID NO: 6604; or (e) further comprising one, two, three, four, five, six, or seven uracil (U) nucleotides at the 3' end and comprising, for example, consisting of any of (a)-(d) above. In a preferred embodiment, the sgRNA molecule comprises [targeting domain]-SEQ ID NO: 6601. In a preferred embodiment, the sgRNA molecule comprises, for example, consists of [targeting domain]-SEQ ID NO: 7811. - - - -

[0110] In a plurality of embodiments, including any of the foregoing aspects and a plurality of embodiments, one or more of the nucleic acid molecules of the gRNA molecules described herein, for example, all of the nucleic acid molecules of the gRNA molecules described herein, do not contain modifications to the nucleotides or nucleotide linkages. In other embodiments, including any of the foregoing aspects and a plurality of embodiments, one or more of the nucleic acid molecules of the gRNA molecules described herein, for example, contain one or more modifications to the nucleotides or nucleotide linkages as described herein. In a plurality of embodiments, the modification includes a 2'-O-methyl modification. - - - - - - No. In multiple embodiments, the modification includes a phosphorothioate modification. In multiple embodiments, the modification includes a 2'-O-methyl modification at one, two, three, or more, for example, each of three 3'-nucleotides of the nucleic acid of the gRNA molecule. In multiple embodiments, the modification includes a 2'-O-methyl modification at the fourth, third, and second 3'-nucleotides from the end of the nucleic acid of the gRNA molecule. In multiple embodiments, the modification includes a 2'-O-methyl modification at one, two, three, or more, for example, each of three 5'-nucleotides of the nucleic acid of the gRNA molecule. In multiple embodiments, the modification includes a 2'-O-methyl modification at the fourth, third, and second 3'-nucleotides from the end of the nucleic acid of the gRNA molecule, and a 2'-O-methyl modification at one, two, three, or more, for example, each of three 5'-nucleotides of the nucleic acid of the gRNA molecule. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end and 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes a 2'-O-methyl modification at the fourth, third, and second 3'-nucleotides from the end of the nucleic acid of the gRNA molecule, and a 2'-O-methyl modification at one, two, three, or more, for example, each of three 5'-nucleotides of the nucleic acid of the gRNA molecule. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end and 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end and 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end and 5'-end of the nucleic acid molecule of the gRNA. In multiple embodiments, the modification includes one or more, for example, one, two, three, or more, for example, three phosphorothioate bonds at the 3'-end and 5'-end of the nucleic acid molecule of the gRNA. For example, it contains three phosphorothioate bonds. In multiple embodiments involving dgRNA molecules, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein. In multiple embodiments involving, for example, three phosphorothioate bonds, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein. In multiple embodiments involving dgRNA molecules, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein. In multiple embodiments involving dgRNA molecules, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein. In multiple embodiments involving dgRNA molecules, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein. In multiple embodiments involving dgRNA molecules, both the molecule containing tracr and the molecule containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing tracr is not modified, and the molecule containing crRNA is modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is not modified, and the molecule containing tracr is modified as described herein.

[0111] In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules. In multiple aspects of the invention that include more than one gRNA molecule, each gRNA molecule can independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In multiple embodiments, all of the gRNA molecules of the combinations described herein are dgRNA molecules. In multiple embodiments, all of the gRNA molecules of the combinations described herein are sgRNA molecules. In multiple embodiments, one or more of the gRNA molecules of the combinations described herein are dgRNA molecules, and one or more of the other gRNA molecules of the combinations described herein are sgRNA molecules.

[0112] In multiple embodiments, when the gRNA molecules of the invention are introduced into the cells described herein, they are gRNA molecules that result in indels at or near the target sequence of the gRNA. In multiple embodiments, the gRNA molecules of the invention are, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95 In multiple embodiments, when the gRNA molecules of the invention are introduced into the cells described herein, they are gRNA molecules that result in indels at or near the target sequence of the gRNA. In multiple embodiments, the gRNA molecules of the invention are, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95 In multiple embodiments, when the gRNA molecules of the invention are introduced into the cells described herein, they are gRNA molecules that result in indels at or near the target sequence of the gRNA. In multiple embodiments, the gRNA molecules of the invention are, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95 In multiple embodiments, when the gRNA molecules of the invention are introduced into the cells described herein, they are gRNA molecules that result in indels at or near the target sequence of the gRNA. In multiple embodiments, the gRNA molecules of the invention are, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95 In multiple embodiments, when the gRNA molecules of the invention are introduced into the cells described herein, they are gRNA molecules that result in indels at or near the target sequence of the gRNA. In multiple embodiments, the gRNA molecules of the invention are, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95 %, e.g., at least about 96%, e.g., at least about 97%, e.g., at least about 98%, e.g., at least about 99%, or more, and are gRNA molecules that result in indels. In a plurality of embodiments, the frequency of indels is measured, e.g., by NGS as described herein. In a plurality of embodiments, the one or more indels are or include frameshift mutations. In a plurality of embodiments, the gRNA molecules of the present invention are such that in a cell population into which the gRNA molecules are introduced, e.g., in at least about 30%, e.g., at least about 40%, e.g., at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 75%, e.g., at least about 80%, e.g., at least about 85%, e.g., at least about 90%, e.g., at least about 95%, or more, and are gRNA molecules that result in frameshift mutations. In a plurality of embodiments, the frequency of frameshift mutations is measured, e.g., by NGS as described herein. In a plurality of embodiments, the indels, the frequency of indels, the frameshift mutations, and / or the frequency of frameshift mutations are measured in a cell (or cell population) after introduction of the gRNA molecules as an RNP with a Cas9 molecule as described herein. In a plurality of embodiments, the indels, the frequency

[0113] of indels, the frameshift mutations, and / or the frequency of frameshift When introduced into a population, the gRNA molecule results in indels at off-target sites at a low frequency of up to 1 / 50, for example, up to 1 / 100, such as up to 1 / 1000, in or near the target sequence of the gRNA. In a preferred embodiment, the gRNA results in no detectable indels at any off-target site when introduced into the cells or cell population described herein. In multiple embodiments, analysis of off-target indels is measured, for example, by targeted off-target sequencing of predicted off-target binding sites as described herein. In multiple embodiments, analysis of off-target indels is measured, for example, by nucleotide insertion analysis as described herein. In multiple embodiments, off-target analysis is measured in cells (or a cell population) after introduction of the gRNA molecule as an RNP with the Cas9 molecule described herein. In multiple embodiments, off-target analysis is measured in cells (or a cell population) by electroporation after introduction of the gRNA molecule. In multiple embodiments, the RNP or combination of RNPs is delivered to the cells by a single electroporation. In multiple embodiments, the cells of the present invention are subjected to only a single electroporation step. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple embodiments, the RNP or combination of RNPs is delivered to the cells by a single electroporation. In multiple embodiments, the cells of the present invention are subjected to only a single electroporation step. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features.

[0114] In multiple embodiments, the RNP or combination of RNPs is delivered to the cells by a single electroporation. In multiple embodiments, the cells of the present invention are subjected to only a single electroporation step. In multiple embodiments, the cells of the present invention are subjected to only a single electroporation step.

[0115] In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features. In multiple aspects and embodiments of the present invention, aspects and embodiments that include a combination of gRNA molecules, each of the combined gRNA molecules may independently include any of the foregoing features.

[0116] In any of the multiple aspects and multiple embodiments disclosed herein, Ca s9 molecules may include one or more of the following features.

[0117] In multiple aspects, the Cas9 molecule is the Cas9 of Streptococcus pyogenes (S. Pyogenes), for example, the modified or unmodified Cas9 of Streptococcus pyogenes (S. Pyogenes) described herein is a molecule. In multiple embodiments, the Cas9 molecule includes SEQ ID NO: 6611. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7821. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7822. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7823. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7824. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7825. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7826. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7827. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7828. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7829. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7830. In other embodiments the Cas9 molecule includes, for example, consists of SEQ ID NO: 7831. Preferred Cas9 molecules are Cas9 molecules that include, for example, consist of SEQ ID NO: 7821, SEQ ID NO: 7822, SEQ ID NO: 7825, and SEQ ID NO: 7828.

[0118] One or more RNP complexes, such as those comprising a Cas9 molecule described herein, 1 In a plurality of aspects and embodiments comprising one or more RNP complexes, each of said RNP complexes is at a concentration of less than about 10 uM, such as less than about 3 uM, such as less than about 1 uM, such as less than about 0.5 uM, such as less than about 0.3 uM, such as less than about 0.1 uM. In a plurality of embodiments, said concentration is, for example, as described herein, for example, the concentration of the RNP complex in a composition containing cells (e.g., a cell population), such as those described herein, into which the RNP is introduced by electroporation. In a plurality of embodiments, the culture medium of the composition is suitable for electroporation.

[0119] In a plurality of aspects and embodiments of the invention, in aspects and embodiments comprising a combination of gRNA molecules, such as a combination of RNPs containing different gRNA molecules, each of the Cas9 molecules of the combination can independently include any of the foregoing features.

[0120] In any of the plurality of aspects and embodiments disclosed herein, a cell (e.g., a cell population) can include one or more of the following features.

[0121] In a plurality of aspects, the cell (e.g., a cell population) includes one or more cells in which the expression of a component of the T cell receptor (TCR) is reduced or eliminated. In a plurality of embodiments the reduction or elimination of the expression of a component of the T cell receptor (TCR) includes the reduction or elimination of the expression of TRAC. In a plurality of embodiments, the reduction or elimination of the expression of a component of the T cell receptor (TCR) includes the reduction or elimination of the expression of TRBC1. In a plurality of embodiments, the T cell ​​Reduction or loss of expression of components of the T cell receptor (TCR) includes reduction or loss of expression of TRBC2. In multiple embodiments, reduction or loss of expression of components of the T cell receptor (TCR) includes reduction or loss of expression of CD3G. In multiple embodiments, reduction or loss of expression of components of the T cell receptor (TCR) includes reduction or loss of expression of CD3D. In multiple embodiments, reduction or loss of expression of components of the TCR includes reduction or loss of expression of CD3E. In multiple embodiments, the reduction or loss of expression of the components of the TCR is the result of introduction of one or more gRNA molecules described herein, such as one or two gRNA molecules, such as one gRNA molecule, into the cell. In multiple embodiments, the cell has an indel, such as a frameshift mutation, in or near the target sequence of the targeting domain of the gRNA molecule for the components of the TCR. In multiple embodiments, the cell population exhibits reduction or loss of expression of components of the TCR in at least about 50%, such as at least about 60%, such as at least about 70%, such as at least about 80%, such as at least about 90%, or more cells (as described herein). In multiple embodiments, the reduction or

[0122] loss of expression of the components of the TCR is measured, for example, by the flow cytometry metrics described herein. In multiple aspects (alternatively or in comprises one or more cells in which the expression of has been reduced or eliminated. In multiple embodiments the reduction or elimination of the expression of said B2M is due to the introduction into said cells of one or more gRNA molecules described herein against B2M, for example one or two gRNA molecules, for example one gRNA molecule. In multiple embodiments, the cells have indels, for example frameshift mutations, as described herein, in or near the target sequence of the targeting domain of the gRNA molecule against said B2M . In multiple embodiments, the cell population comprises at least about 50%, for example at least about 60%, for example at least about 70%, for example at least about 80%, for example at least about 90%, or more cells ( as described herein) that exhibit a reduction or elimination of the expression of B2M. In multiple embodiments, the reduction or elimination of the expression of said B2M is measured, for example, by flow cytometry as described herein .

[0123] In multiple aspects (alternatively or additionally comprising a reduction or elimination of the expression of components of the TCR and / or B2M), the cell (e.g., cell population) comprises one or more cells in which the expression of CIITA has been reduced or eliminated. In multiple embodiments the reduction or elimination of the expression of said CIITA is due to the introduction into said cells of one or more gRNA molecules described herein against said CIITA, for example one or two gRNA molecules, for example one gRNA molecule. In multiple embodiments, the cells have indels, for example frameshift mutations, as described herein, in or near the target sequence of the targeting domain of the gRNA molecule against said CIITA . In multiple embodiments the reduction or elimination of the expression of said CIITA is due to the introduction into said cells of one or more gRNA molecules described herein against said CIITA, for example one or two gRNA molecules, for example one gRNA molecule. In multiple embodiments, the cells have indels, for example frameshift mutations, as described herein, in or near the target sequence of the targeting domain of the gRNA molecule against said CIITA in or near the target sequence of the targeting domain of the gRNA molecule against said CIITA and / or in the vicinity thereof, for example, the indels described herein, such as frameshift mutations. In multiple embodiments, the cell population exhibits a reduction or elimination of CIITA expression of at least about 50%, such as at least about 60%, such as at least about 70%, such as at least about 80%, such as at least about 90%, or more cells (described herein). In multiple embodiments, the reduction or elimination of B2M expression is measured, for example, by flow cytometry as described herein.

[0124] In multiple aspects (alternatively or additionally including a reduction or elimination of TCR component expression), the cell (e.g., cell population) contains one or more cells with reduced or eliminated expression of a target of an immunosuppressive drug, such as FKBP1A. In multiple embodiments, the reduction or elimination of FKBP1A expression is the result of introduction into the cell of one or more gRNA molecules, such as one or two gRNA molecules, such as one gRNA molecule, as described herein. In multiple embodiments, the cell contains indels, such as frameshift mutations, in or in the vicinity of the target sequence of the targeting domain of the gRNA molecule for FKBP1A. In multiple embodiments, the cell population exhibits a reduction or elimination of FKBP1A expression of at least about 50%, such as at least about 60%, such as at least about 70%, such as at least about 80%, such as at least about 90%, or more cells (described herein). In​ The reduction or loss of expression of the FKBP1A, for example, can be measured by the flow cytometry described herein.

[0125] In some embodiments, it is desired that the cell exhibits reduction or loss of expression of more than one gene. In certain embodiments, the cell exhibits reduction or loss of expression of components of the TCR (e.g., TRAC, TRB C1, TRBC2, CD3E, CD3G, and / or CD3D), reduction or loss of expression of B2M, and reduction or loss of expression of CIITA. In multiple embodiments, the reduction or loss of expression results from introduction into the cell of a combination of gRNA molecules comprising targeting domain sequences listed in any of combinations A1 - A72. In multiple embodiments, the reduction or loss of expression results from introduction into the cell of a combination of gRNA molecules comprising targeting domain sequences listed in any of combinations B1 - B84. In multiple embodiments, the cell contains indels, e.g., frameshift mutations, at or near each of the target sequences of the gRNA molecule targeting domains listed in Table 33, Table 34, or Table 38 (e.g., any of combinations A1 - A72, B1 - B84, or F1 - F60 of gRNA molecules). In some embodiments, it is desired that the cell exhibits reduction or loss of expression of more than one gene. In certain embodiments, the cell exhibits reduction or loss of expression of components of the TCR (e.g., TRAC, TRB C1, TRBC2, CD3E, CD3G, and / or CD3D).

[0126] In some embodiments, it is desired that the cell exhibits reduction or loss of expression of more than one gene. In certain embodiments, the cell exhibits reduction or loss of expression of components of the TCR (e.g., TRAC, TRB C1, TRBC2, CD3E, CD3G, and / or CD3D). ​​​​​exhibits reduction or loss of expression of a target of ablation and immunosuppressive drugs, e.g., FKBP1A is shown. In multiple embodiments, the reduction or loss of expression results from introduction of a combination of gRNA molecules into a cell, where the combination of gRNA molecules includes a targeting domain sequence listed in any of combinations C1 - C42 In multiple embodiments, the reduction or loss of expression results from introduction of a combination of gRNA molecules into a cell, where the combination of gRNA molecules includes a targeting domain sequence listed in any of combinations D1 - D36 In multiple embodiments, the cell contains indels, e.g., frameshift mutations, at or near each target sequence of a gRNA molecule targeting domain listed in Table 35, Table 36, or Table 37 (e.g., any of gRNA molecules in combinations C1 - C42, D1 - D36, or E1 - E30 In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC

[0127] In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC In preferred embodiments (including additional targets, e.g., multiple additional targets, e.g., expression or function of CIITA is also reduced or lost), where it is intended to reduce or ablate expression of both components of the T cell receptor, e.g., TRAC, and B2M, the gRNA molecule targeting TRAC Selected from, for example, consisting of dgRNAs comprising 7837 and SEQ ID NO: 10798 The gRNA molecule targeting B2M is selected from, for example, consisting of dgRNAs comprising SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, consisting of these dgRNAs, dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 6660, for example, consisting of these dgRNAs, dgRNAs comprising SEQ ID NO: 7856 and SEQ ID NO: 10798, for example, consisting of these dgRNAs, and dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 10798, for example, consisting of these Selected from. As described herein, in multiple embodiments for any of the combinations, each of said gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule as described herein In preferred embodiments (further targets, for example, more than one further target, for example, expression or function of CIITA is also intended to be reduced or eliminated), the gRNA

[0128] molecule targeting TRAC, which is intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRAC, and B2M (including multiple embodiments if expression or function of CIITA is also intended to be reduced or eliminated), is selected from dgRNAs comprising SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, for example, consisting of these, dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 6660, for example, consisting of these, dgRNAs comprising SEQ ID NO: 7836 and SEQ ID NO: 10798, for example, consisting of these, and dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 10798, for example, consisting of these Selected from dgRNAs comprising SEQ ID NO: 7836 and SEQ ID NO: 10798, for example, consisting of these, and dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 10798, for example, consisting of these and the gRNA molecules targeting B2M include SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861, and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7862 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example, dgRNA consisting of these. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, the Cas9 molecules described herein. are selected from. In preferred embodiments (additional targets, for example, more than one additional target, for example, the expression or function of CIITA is also intended to be reduced or eliminated), the gRNA molecules targeting TRAC, which are intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRAC, and B2M, include SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, dgRNA consisting of these. and the gRNA molecules targeting B2M include SEQ ID NO: 7853, SEQ ID NO: 785 are selected from. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, the Cas9 molecules described herein.

[0129] In preferred embodiments (additional targets, for example, more than one additional target, for example, the expression or function of CIITA is also intended to be reduced or eliminated), the gRNA molecules targeting TRAC, which are intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRAC, and B2M, include SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, dgRNA consisting of these. are selected from. and the gRNA molecules targeting B2M include SEQ ID NO: 7853, SEQ ID NO: 785 are selected from. and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, dgRNA consisting of these. are selected from. and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, dgRNA consisting of these. are selected from. 9, SEQ ID NO: 7860, SEQ ID NO: 7861, and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7862 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7861 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example, dgRNA consisting of these. 4. Selected from, for example, dgRNAs comprising SEQ ID NO: 7855, SEQ ID NO: 7856, and SEQ ID NO: 6660, dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 6660, dgRNAs comprising SEQ ID NO: 7856 and SEQ ID NO: 10798, and dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 10798. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule described herein. For example, those consisting of these, dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 6660 For example, those consisting of these, dgRNAs comprising SEQ ID NO: 7856 and SEQ ID NO: 10798 For example, those consisting of these, and dgRNAs comprising SEQ ID NO: 7857 and SEQ ID NO: 10798 Selected from. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule described herein. In multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule described herein. For example, provided as an RNP associated with a Cas9 molecule, such as a Cas9 molecule described herein.

[0130] Intended to reduce or eliminate the expression of components of the T cell receptor, such as TRAC, and both B2M. In preferred embodiments (additional targets, for example, more than one additional target, such as the expression or function of CIITA is also intended to be reduced or eliminated, including multiple embodiments), the gRNA molecule targeting TRAC is selected from dgRNAs comprising SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 And SEQ ID NO: 6660, for example, those consisting of these, dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, those consisting of these, dgRNAs comprising SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, those consisting of these, and dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, those consisting of these. The gRNA molecule targeting B2M is selected from dgRNAs comprising SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, those consisting of these. For example, more than one additional target, such as the expression or function of CIITA is also intended to be reduced or eliminated, including multiple embodiments When it is also intended to be reduced or eliminated, including multiple embodiments, the gRNA molecule targeting TRAC is selected from dgRNAs comprising SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 And SEQ ID NO: 6660, for example, those consisting of these, dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, those consisting of these, dgRNAs comprising SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, those consisting of these, and dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, those consisting of these. For example, those consisting of these, dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 6660 For example, those consisting of these, dgRNAs comprising SEQ ID NO: 7841 and SEQ ID NO: 10798 For example, those consisting of these, and dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 10798 Selected from, for example, those consisting of these. The gRNA molecule targeting B2M is selected from dgRNAs comprising SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, those consisting of these. Selected from dgRNAs comprising SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example, those consisting of these. For example, those consisting of these, dgRNAs comprising SEQ ID NO: 7858, SEQ ID NO: 7859, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660 A dgRNA consisting of these, including SEQ ID NO: 7862 and SEQ ID NO: 6660, for example, this A dgRNA consisting of these, including SEQ ID NO: 7861 and SEQ ID NO: 10798, for example, this A dgRNA consisting of these, and including SEQ ID NO: 7862 and SEQ ID NO: 10798, for example, selected from a dgRNA consisting of these. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule described herein. A preferred embodiment is intended to reduce or

[0131] eliminate the expression of both components of the T cell receptor, such as TRBC, and B2M. (When there are additional targets, for example, more than one additional target, such as the expression or function of CIITA is also intended to be reduced or eliminated, including multiple embodiments) The gRNA molecule targeting TRBC is a dgRNA including SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846 and SEQ ID NO: 6660, for example, consisting of these, a dgRNA including SEQ ID NO: 7847 and SEQ ID NO: 6660, for example, consisting of these, a dgRNA including SEQ ID NO: 7846 and SEQ ID NO: 10798, for example, consisting of these, and a dgRNA including SEQ ID NO: 7847 and SEQ ID NO: 10798, for example, consisting of these, and is selected from these. The gRNA molecule targeting B2M includes SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, consisting of these, a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 6660, for example, consisting of these, a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 6660, for example, consisting of these, A dgRNA consisting of these, for example, including SEQ ID NO: 7856 and SEQ ID NO: 10798, such A dgRNA consisting of these, and for example, including SEQ ID NO: 7857 and SEQ ID NO: 10798, such as, is selected from the dgRNAs consisting of these. As described herein, for any of the combinations, in a plurality of embodiments, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, a Cas9 molecule described herein.

[0132] A gRNA molecule targeting TRBC that is intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRBC, and B2M, in a preferred embodiment (if additional targets, for example, more than one additional target, such as the expression or function of CIITA, are also intended to be reduced or eliminated, including a plurality of embodiments) is selected from dgRNAs including SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846, and SEQ ID NO: 6660, for example, consisting of these, dgRNAs including SEQ ID NO: 7847 and SEQ ID NO: 6660, for example, consisting of these, dgRNAs including SEQ ID NO: 7846 and SEQ ID NO: 10798, for example, consisting of these, and dgRNAs including SEQ ID NO: 7847 and SEQ ID NO: 10798, for example, consisting of these. A gRNA molecule targeting B2M is selected from dgRNAs including SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861, and SEQ ID NO: 6660, for example, consisting of these, dgRNAs including SEQ ID NO: 7862 and SEQ ID NO: 6660, for example, consisting of these, dgRNAs including SEQ ID NO: 7861 and SEQ ID NO: 10798, for example, such A dgRNA consisting of these, and an example containing SEQ ID NO: 7862 and SEQ ID NO: 10798 For example, it is selected from dgRNAs consisting of these. As described herein, for any of the combinations, in a plurality of embodiments, each of the gRNA molecules is provided as an RNP accompanied by a Cas9 molecule, for example, a Cas9 molecule described herein. In a preferred embodiment (additional targets, for example, more than one additional target, for example, the expression or function of CIITA is also intended to be reduced or eliminated), the gRNA molecule targeting TRBC is intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRBC and B2M

[0133] Including SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7852 and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7851 and SEQ ID NO: 10798, for example, a dgRNA consisting of these, and SEQ ID NO: Selected from dgRNAs including 7852 and SEQ ID NO: 10798, for example, consisting of these, and the gRNA molecule targeting B2M includes SEQ ID NO: 7853, SEQ ID NO: 785 4, SEQ ID NO: 7855, SEQ ID NO: 7856 and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7856 and SEQ ID NO: 10798, for example, a dgRNA consisting of these, and a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 10798, for example, selected from dgRNAs consisting of these and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 6660, for example, a dgRNA consisting of these, a dgRNA including SEQ ID NO: 7856 and SEQ ID NO: 10798, for example, a dgRNA consisting of these, and a dgRNA including SEQ ID NO: 7857 and SEQ ID NO: 10798, for example, consisting of these and an example including SEQ ID NO: 7857 and SEQ ID NO: 10798 For example, the dgRNA may be selected from the group consisting of: In some embodiments of any of the above, each of the gRNA molecules comprises a Cas9 The RNP can be provided with a molecule, e.g., a Cas9 molecule, as described herein.

[0134] Reduce the expression of both T cell receptor components, e.g., TRBC and B2M In a preferred embodiment, the target is intended to be eliminated or eliminated (an additional target, e.g., one The expression or function of additional targets beyond those listed above, such as CIITA, may also be reduced or In the case where the IL-16 receptor is deleted, a gRNA targeting the TRBC is used. A molecule is SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851 and SEQ ID NO: 6660, e.g., a dgRNA consisting of these, SEQ ID NO: 7852 and SEQ ID NO: 6660, e.g., a dgRNA consisting of these, SEQ ID NO: 7851 and SEQ ID NO: 10798, for example comprising these, and SEQ ID NO: 7852 and SEQ ID NO: 10798, for example, dgRNAs consisting of these. and gRNA molecules targeting B2M are SEQ ID NO: 7858, SEQ ID NO: 785 9, SEQ ID NO: 7860, SEQ ID NO: 7861 and SEQ ID NO: 6660, for example For example, the dgRNAs include those consisting of SEQ ID NO: 7862 and SEQ ID NO: 6660. For example, the dgRNAs include those consisting of SEQ ID NO: 7861 and SEQ ID NO: 10798. dgRNAs consisting of these, and SEQ ID NO: 7862 and SEQ ID NO: 10798, for example For example, the dgRNA may be selected from the group consisting of: In multiple embodiments for any of these, each of said gRNA molecules is provided as an RNP associated with a Cas9 molecule, e.g., a Cas9 molecule described herein.

[0135] In preferred embodiments (including additional targets, e.g., wherein the expression of both components of the T cell receptor, e.g., TRAC, and FKBP1A, is intended to be reduced or eliminated, and the expression or function of one or more additional targets may also be reduced or eliminated), gRNA molecules targeting TRAC include, for example, consisting of, dgRNAs comprising SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, e.g., dgRNAs consisting of these, dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 6660, e.g., dgRNAs consisting of these, dgRNAs comprising SEQ ID NO: 7836 and SEQ ID NO: 10798, e.g., dgRNAs consisting of these, and dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 10798, e.g., dgRNAs consisting of these, and are selected from dgRNAs comprising SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, e.g., consisting of these, dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 6660, e.g., consisting of these, dgRNAs comprising SEQ ID NO: 7866 and SEQ ID NO: 10798, e.g., consisting of these, and dgRNAs comprising SEQ ID NO: 7867 and SEQ ID NO: 10798, e.g., consisting of these, and are selected from dgRNAs consisting of these. As described herein, in multiple embodiments for any of the combinations, each of said gRNA molecules is a Cas9 molecule, e.g., wherein the expression of both components of the T cell receptor, e.g., TRAC, and FKBP1A, is intended to be reduced or eliminated, and the expression or function of one or more additional targets may also be reduced or eliminated), gRNA molecules targeting TRAC include, for example, consisting of, dgRNAs comprising SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, e.g., dgRNAs consisting of these, dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: For example, it is provided as an RNP with a Cas9 molecule described in this specification.

[0136] Reduce the expression of both components of the T cell receptor, such as TRAC, and FKBP1A or cause it to disappear. In a preferred embodiment (additional targets, such as expression or function of one or more additional targets is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from dgRNAs comprising, for example, consisting of, SEQ ID NO: 7833, SEQ ID NO: 7834, SEQ ID NO: 7835, SEQ ID NO: 7836 and SEQ ID NO: 6660, such as dgRNAs comprising, for example, consisting of SEQ ID NO: 7837 and SEQ ID NO: 6660, such as dgRNAs comprising, for example, consisting of SEQ ID NO: 7836 and SEQ ID NO: 10798, such as dgRNAs comprising, for example, consisting of, and dgRNAs comprising SEQ ID NO: 7837 and SEQ ID NO: 10798, such as dgRNAs comprising, for example, consisting of. The gRNA molecule targeting FKBP 1A is selected from dgRNAs comprising, for example, consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, such as dgRNAs comprising, for example, consisting of SEQ ID NO: 7872 and SEQ ID NO: 6660, such as dgRNAs comprising, for example, consisting of SEQ ID NO: 7871 and SEQ ID NO: 10798, such as dgRNAs comprising, for example, consisting of SEQ ID NO: 7872 and SEQ ID NO: 10798, such as dgRNAs comprising, for example, consisting of. As described in this specification, for any of the combinations in a plurality of embodiments, each of the gRNA molecules is provided as an RNP with a Cas9 molecule, such as the Cas9 molecule described in this specification.

[0137] ​​Reduce the expression of both components of the T cell receptor, such as TRAC, and FKBP1A Or, in preferred embodiments (additional targets, such as , where the expression or function of one or more additional targets is also reduced or eliminated, which includes multiple embodiments), the gRNA molecules targeting TRAC are sequences Including SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7842 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7841 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7842 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and are selected from dgRNA containing SEQ ID NO: 7842 and SEQ ID NO: 10798, and the gRNA molecules targeting FKBP 1A include SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866 and SEQ ID NO: 6660, for example, dgRNA consisting of these SEQ ID NO: 7867 and SEQ ID NO: 6660, for example, dgRNA consisting of these SEQ ID NO: 7866 and SEQ ID NO: 10798, for example, dgRNA consisting of these SEQ ID NO: 7867 and SEQ ID NO: 10798, for example, dgRNA consisting of these And are selected from dgRNA containing SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, such as The Cas9 molecule described herein.

[0138] Reduce the expression of both components of the T cell receptor, such as TRAC, and FKBP1A ​In preferred embodiments (additional targets, e.g., wherein the expression or function of one or more additional targets is also intended to be reduced or eliminated, embodiments include multiple embodiments), the gRNA molecules targeting TRAC are sequences selected from, for example, consisting of dgRNAs comprising SEQ ID NO: 7838, SEQ ID NO: 7839, SEQ ID NO: 7840, SEQ ID NO: 7841 and SEQ ID NO: 6660, e.g., dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 6660, e.g., consisting of these dgRNAs, dgRNAs comprising SEQ ID NO: 7841 and SEQ ID NO: 10798, e.g., consisting of these dgRNAs, and dgRNAs comprising SEQ ID NO: 7842 and SEQ ID NO: 10798, e.g., consisting of these dgRNAs, and are selected from FKBP The gRNA molecules targeting 1A are selected from, for example, consisting of dgRNAs comprising SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871 and SEQ ID NO: 6660, e.g., consisting of these dgRNAs, dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 6660, e.g., consisting of these dgRNAs, dgRNAs comprising SEQ ID NO: 7871 and SEQ ID NO: 10798, e.g., consisting of these dgRNAs, and dgRNAs comprising SEQ ID NO: 7872 and SEQ ID NO: 10798, e.g., consisting of these dgRNAs. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, e.g., the Cas9 molecules described herein. In preferred embodiments (additional targets, e.g., wherein the expression of both components of the T cell receptor, e.g., TRBC, and FKBP1A is intended to be reduced or eliminated, e.g., embodiments include multiple embodiments),

[0139] wherein the expression of both components of the T cell receptor, e.g., TRBC, and FKBP1A is intended to be reduced or eliminated, A situation where the expression or function of one or more additional targets is also reduced or eliminated (including multiple embodiments) involves gRNA molecules targeting TRBC that are selected from, for example, consisting of dgRNAs including SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846, and SEQ ID NO: 6660, dgRNAs including SEQ ID NO: 7847 and SEQ ID NO: 6660, dgRNAs including SEQ ID NO: 7846 and SEQ ID NO: 10798, and dgRNAs including SEQ ID NO: 7847 and SEQ ID NO: 10798. The gRNA molecules targeting FKBP1A are selected from, for example, consisting of dgRNAs including SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866, and SEQ ID NO: 6660, dgRNAs including SEQ ID NO: 7867 and SEQ ID NO: 6660, dgRNAs including SEQ ID NO: 7866 and SEQ ID NO: 10798, and dgRNAs including SEQ ID NO: 7867 and SEQ ID NO: 10798. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, the Cas9 molecules described herein. In the case (including multiple embodiments) where the gRNA molecules targeting TRBC include SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846, and SEQ ID NO: 6660, for example, consisting of these dgRNAs, SEQ ID NO: 7847 and SEQ ID NO: 6660, for example, consisting of these dgRNAs, SEQ ID NO: 7846 and SEQ ID NO: 10798, for example, consisting of these dgRNAs, and SEQ ID NO: 7847 and SEQ ID NO: 10798, for example, consisting of these dgRNAs, and are selected from the dgRNAs The gRNA molecules targeting FKBP1A include SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866, and SEQ ID NO: 6660, for example, consisting of these dgRNAs, SEQ ID NO: 7867 and SEQ ID NO: 6660, for example, consisting of these dgRNAs, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example, consisting of these dgRNAs, and SEQ ID NO: 7867 and SEQ ID NO: 10798, for example, consisting of these dgRNAs. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, the Cas9 molecules described herein.

[0140] It is intended to reduce or eliminate the expression of both components of the T cell receptor, for example, TRBC, and FKBP1A, in a preferred embodiment (where additional targets, for example ), the expression or function of one or more additional targets is also reduced or eliminated (including multiple embodiments) A situation where the expression or function of one or more additional targets is also reduced or eliminated (including multiple embodiments) ​In the context (which includes multiple embodiments) where a gRNA molecule targeting TRBC is concerned, the sequences include SEQ ID NO: 7843, SEQ ID NO: 7844, SEQ ID NO: 7845, SEQ ID NO: 7846, and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7847, and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7846, and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7847 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and is selected from dgRNA targeting FKBP 1A. The gRNA molecules targeting FKBP1A include SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871, and SEQ ID NO: 6660, for example, dgRNA consisting of these SEQ ID NO: 7872 and SEQ ID NO: 6660, for example, dgRNA consisting of these SEQ ID NO: 7871 and SEQ ID NO: 10798, for example, dgRNA consisting of these SEQ ID NO: 7872 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and is selected from dgRNA As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP accompanied by a Cas9 molecule, for example, the Cas9 molecules described herein.

[0141] In preferred embodiments (which include multiple embodiments) where it is intended to reduce or eliminate the expression of components of the T cell receptor, such as TRBC, and both FKBP1A, or further reduce or eliminate the expression or function of additional targets, for example, more than one additional target, in the context (which includes multiple embodiments) where a gRNA molecule targeting TRBC is concerned, the sequences include Numbers 7848, 7849, 7850, 7851, and 6660, for example, dgRNA consisting of these, SEQ ID NO: 7852, and 6660, for example, dgRNA consisting of these, SEQ ID NO: 7851, and 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7852 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and selected from gRNA molecules targeting FKBP1A are SEQ ID NO: 7863, SEQ ID NO: 7864, SEQ ID NO: 7865, SEQ ID NO: 7866, and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7867 and SEQ ID NO: 6660, for example, dgRNA consisting of these, SEQ ID NO: 7866 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and SEQ ID NO: 7867 and SEQ ID NO: 10798, for example, dgRNA consisting of these, and are selected. As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, for example, the Cas9

[0142] molecule described herein. In preferred embodiments (further targets, for example, the expression or function of one or more further targets is also intended to be reduced or eliminated, and cases including multiple embodiments), the gRNA molecule targeting TRBC is SEQ ID NO: 7848, SEQ ID NO: 7849, SEQ ID NO: 7850, SEQ ID NO: 7851, and SEQ ID NO: dgRNAs comprising, for example, consisting of 6660, SEQ ID NO: 7852, and SEQ ID NO: dgRNAs comprising, for example, consisting of 6660, SEQ ID NO: 7851, and SEQ ID NO: dgRNAs comprising, for example, consisting of 10798, and SEQ ID NO: 7852 and selected from dgRNAs comprising, for example, consisting of SEQ ID NO: 10798, where the gRNA molecule targeting FKBP 1A includes, for example, consisting of SEQ ID NO: 7868, SEQ ID NO: 7869, SEQ ID NO: 7870, SEQ ID NO: 7871, and dgRNAs comprising, for example, consisting of SEQ ID NO: 6660 dgRNAs comprising, for example, consisting of SEQ ID NO: 7872 and SEQ ID NO: 6660 dgRNAs comprising, for example, consisting of SEQ ID NO: 7871 and SEQ ID NO: 10798 dgRNAs comprising, for example, consisting of SEQ ID NO: 7872 and SEQ ID NO: 10798, and is selected from As described herein, in multiple embodiments for any of the combinations, each of the gRNA molecules is provided as an RNP associated with a Cas9 molecule, such as the Cas9 molecules described herein. In one aspect, the cell exhibits a reduction or loss of expression of only one component of a TCR (it may also exhibit a reduction or loss of expression of a target that is not a component of one or more other TCRs). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR).

[0143] In one aspect, the cell exhibits a reduction or loss of expression of only one component of a TCR (it may also exhibit a reduction or loss of expression of a target that is not a component of one or more other TCRs). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR). In multiple embodiments, the cell contains an indel in or near a target sequence within only a single gene (or its regulatory element) that is a component of the TCR (the cell may also contain an indel in or near a target sequence within one or more additional genes (or their regulatory elements) that are not components of the TCR). Uruga). Therefore, in multiple embodiments, the cell does not contain indels within a gene that is one or more of the components of the TCR. In multiple embodiments, the cell does not contain indels within TRAC and the gene encoding the second TCR component, such as TRBC1 or TRBC2. Within, there are no indels.

[0144] In one aspect, the cell does not exhibit reduced or absent expression of a gene containing an inhibitory molecule or a target sequence of an effector downstream of signal transduction through the inhibitory molecule (although it may exhibit reduced or absent expression of one or more other genes). In multiple embodiments, the cell does not contain indels at or near the target sequence of the gene of the inhibitory molecule or the effector downstream of signal transduction through the inhibitory molecule (although indels may be present in one or more other genes (or their regulatory elements)). In multiple embodiments, the cell does not contain indels within PDCD1 or its regulatory element. In multiple embodiments, the cell does not contain indels within the gene of the inhibitory molecule or the effector downstream of signal transduction through the inhibitory molecule (or its regulatory element). (or in the vicinity of) the target sequence, and does not contain indels (although indels may be present in one or more other genes (or their regulatory elements)). In multiple embodiments, the cell does not contain indels within or in its regulatory element. In multiple embodiments, the cell does not contain indels within or in its regulatory element. In multiple embodiments, the cell does not contain indels within or in its regulatory element.

[0145] In multiple aspects, the cell is an animal cell, such as a mammalian, primate, or human cell, such as a human cell. In multiple aspects, the cell is an immune effector cell (e.g., a cell population containing one or more immune effector cells), such as a T cell or an NK cell, such as a T cell, such as a CD4+ T cell, a CD8+ T cell, or a combination thereof. In multiple aspects, the cell is an immune effector cell (e.g., a cell population containing one or more immune effector cells), such as a T cell or an NK cell, such as a T cell, such as a CD4+ T cell, a CD8+ T cell, or a combination thereof. In multiple aspects, the cell is an immune effector cell (e.g., a cell population containing one or more immune effector cells), such as a T cell or an NK cell, such as a T cell, such as a CD4+ T cell, a CD8+ T cell, or a combination thereof. is.

[0146] In multiple aspects, the cell is autologous with respect to the patient to whom the cell is administered. In other multiple aspects, the cell is allogeneic with respect to the patient to whom the cell is administered. In multiple embodiments, the cell is allogeneic with respect to the patient to whom the cell is administered. In this case, the cells are allogeneic with respect to the patient to whom the cells are administered and are induced pluripotent stem cells or cells derived therefrom. In a plurality of embodiments, the cells are allogeneic with respect to the patient to whom the cells are administered and are immune effector cells, such as T cells isolated from healthy human donors .

[0147] In a plurality of aspects, for example, the cells (or cell populations) described herein, such as the CAR-expressing cells described herein, are modified and / or altered ex vivo, for example, by the methods described herein . In a further plurality of aspects, for example, the cells (or cell populations) described herein, such as the CAR-expressing cells described herein, are modified and / or altered in vivo, for example, by the methods described herein . In a plurality of aspects, the CRISPR system, gRNA molecules (including those within the RNP complex with a Cas9 molecule as described herein), and / or compositions of the present invention (for example, a composition comprising more than one gRNA molecule of the present invention) are introduced ex vivo into the cells described herein, such as the CAR-expressing cells described herein . In a further plurality of aspects, the CRISPR system, gRNA molecules (including those within the RNP complex with a Cas9 molecule as described herein), and / or compositions of the present invention (for example, a composition comprising more than one gRNA molecule of the present invention) are introduced in vivo into the cells described herein, such as the CAR-expressing cells described herein . In a plurality of aspects, the cells express a chimeric antigen receptor (CAR) as described herein . . In a further plurality of aspects, the CRISPR system, gRNA molecules (including those within the RNP complex with a Cas9 molecule as described herein), and / or compositions of the present invention (for example, a composition comprising more than one gRNA molecule of the present invention) are introduced in vivo into the cells described herein, such as the CAR-expressing cells described herein . . In a plurality of aspects, the CRISPR system, gRNA molecules (including those within the RNP complex with a Cas9 molecule as described herein), and / or compositions of the present invention (for example, a composition comprising more than one gRNA molecule of the present invention) are introduced in vivo into the cells described herein, such as the CAR-expressing cells described herein .

[0148] . In a plurality of aspects, the cells express a chimeric antigen receptor (CAR) as described herein is being operated, will be operated, or is to be operated (e.g., a cell comprises or will comprise a nucleic acid sequence encoding a CAR). In multiple embodiments the CAR is, for example, CD19; CD123; CD22 as described herein ; CD30; CD171; CS-1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule 1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII) ; ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)a Neu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TN F receptor family member B cell maturation (BCMA); Tn antigen ((TnAg) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (F LT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin 13 receptor subunit alpha-2 (IL-13R a2 or CD213A2); mesothelin; interleukin 11 receptor alpha (IL -11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen ; CD24; platelet-derived growth factor receptor beta (PDGFR beta); stage-specific embryonic antigen 4 (SSEA-4); CD20; folate receptor alpha; receptor-type protein tyrosine phosphatase 4 (PTP4A3); CD138; CD133; CD47; CD70; CD74; CD126; CD137; CD155; CD164; CD229; CD244; CD279; CD300a; CD300c; CD300f; CD300g; CD300h; CD300i; CD300j; CD300k; CD300l; CD300m; CD300n; CD300o; CD300p; CD300q; CD300r; CD300s; CD300t; CD300u; CD300v; CD300w; CD300x; CD300y; CD300z; CD300aa; CD300ab; CD300ac; CD300ad; CD300ae; CD300af; CD300ag; CD300ah; CD300ai; CD300aj; CD300ak; CD300al; CD300am; CD300an; CD300ao; CD300ap; CD300aq; CD300ar; CD300as; CD300at; CD300au; CD300av; CD300aw; CD300ax; CD300ay; CD300az; CD300ba; CD300bb; CD300bc; CD300bd; CD300be; CD300bf; CD300bg; CD300bh; CD300bi; CD300bj; CD300bk; CD300bl; CD300bm; CD300bn; CD300bo; CD300bp; CD300bq; CD300br; CD300bs; CD300bt; CD300bu; CD300bv; CD300bw; CD300bx; CD300by; CD300bz; CD300ca; CD300cb; CD300cc; CD300cd; CD300ce; CD300cf; CD300cg; CD300ch; CD300ci; CD300cj; CD300ck; CD300cl; CD300cm; CD300cn; CD300co; CD300cp; CD300cq; CD300cr; CD300cs; CD300ct; CD300cu; CD300cv; CD300cw; CD300cx; CD300cy; CD300cz; CD300da; CD300db; CD300dc; CD300dd; CD300de; CD300df; CD300dg; CD300dh; CD300di; CD300dj; CD300dk; CD300dl; CD300dm; CD300dn; CD300do; CD300dp; CD300dq; CD300dr; CD300ds; CD300dt; CD300du; CD300dv; CD300dw; CD300dx; CD300dy; CD300dz; CD300ea; CD300eb; CD300ec; CD300ed; CD300ee; CD300ef; CD300eg; CD300eh; CD300ei; CD300ej; CD300ek; CD300el; CD300em; CD300en; CD300eo; CD300ep; CD300eq; CD300er; CD300es; CD300et; CD300eu; CD300ev; CD300ew; CD300ex; CD300ey; CD300ez; CD300fa; CD300fb; CD300fc; CD300fd; CD300fe; CD300ff; CD300fg; CD300fh; CD300fi; CD300fj; CD300fk; CD300fl; CD300fm; CD300fn; CD300fo; CD300fp; CD300fq; CD300fr; CD300fs; CD300ft; CD300fu; CD300fv; CD300fw; CD300fx; CD300fy; CD300fz; CD300ga; CD300gb; CD300gc; CD300gd; CD300ge; CD300gf; CD300gg; CD300gh; CD300gi; CD300gj; CD300gk; CD300gl; CD300gm; CD300gn; CD300go; CD300gp; CD300gq; CD300gr; CD300gs; CD300gt; CD300gu; CD300gv; CD300gw; CD300gx; CD300gy; CD300gz; CD300ha; CD300hb; CD300hc; CD300hd; CD300he; CD300hf; CD300hg; CD300hh; CD300hi; CD300hj; CD300hk; CD300hl; CD300hm; CD300hn; CD300ho; CD300hp; CD300hq; CD300hr; CD300hs; CD300ht; CD300hu; CD300hv; CD300hw; CD300hx; CD300hy; CD300hz; CD300ia; CD300ib; CD300ic; CD300id; CD300ie; CD300if; CD300ig; CD300ih; CD300ii; CD300ij; CD300ik; CD300il; CD300im; CD300in; CD300io; CD300ip; CD300iq; CD300ir; CD300is; CD300it; CD300iu; CD300iv; CD300iw; CD300ix; CD300iy; CD300iz; CD300ja; CD300jb; CD300jc; CD300jd; CD300je; CD300jf; CD300jg; CD300jh; CD300ji; CD300jj; CD300jk; CD300jl; CD300jm; CD300jn; CD300jo; CD300jp; CD300jq; CD300jr; CD300js; CD300jt; CD300ju; CD300jv; CD300jw; CD300jx; CD300jy; CD300jz; CD300ka; CD300kb; CD300kc; CD300kd; CD300ke; CD300kf; CD300kg; CD300kh; CD300ki; CD300kj; CD300kk; CD300kl; CD300km; CD300kn; CD300ko; CD300kp; CD300kq; CD300kr; CD300ks; CD300kt; CD300ku; CD300kv; CD300kw; CD300kx; CD300ky; CD300kz; CD300la; CD300lb; CD300lc; CD300ld; CD300le; CD300lf; CD300lg; CD300lh; CD300li; CD300lj; CD300lk; CD300ll; CD300lm; CD300ln; CD300lo; CD300lp; CD300lq; CD300lr; CD300ls; CD300lt; CD300lu; CD300lv; CD300lw; CD300lx; CD300ly; CD300lz; CD300ma; CD300mb; CD300mc; CD300md; CD300me; CD300mf; CD300mg; CD300mh; CD300mi; CD300mj; CD300mk; CD300ml; CD300mm; CD300mn; CD300mo; CD300mp; CD300mq; CD300mr; CD300ms; CD300mt; CD300mu; CD300mv; CD300mw; CD300mx; CD300my; CD300mz; CD300na; CD300nb; CD300nc; CD300nd; CD300ne; CD300nf; CD300ng; CD300nh; CD300ni; CD300nj; CD300nk; CD300nl; CD300nm; CD300nn; CD300no; CD300np; CD300nq; CD300nr; CD300ns; CD300nt; CD300nu; CD300nv; CD300nw; CD300nx; CD300ny; CD300nz; CD300oa; CD300ob; CD300oc; CD300od; CD300oe; CD300of; CD300og; CD300oh; CD300oi; CD300oj; CD300ok; CD300ol; CD300om; CD300on; CD300oo; CD300op; CD300oq; CD300or; CD300os; CD300ot; CD300ou; CD300ov; CD300ow; CD300ox; CD300oy; CD300oz; CD300pa; CD300pb; CD300pc; CD300pd; CD300pe; CD300pf; CD300pg; CD300ph; CD300pi; CD300pj; CD300pk; CD300pl; CD300pm; CD300pn; CD300po; CD300pp; CD300pq; CD300pr; CD300ps; CD300pt; CD300pu; CD300pv; CD300pw; CD300px; CD300py; CD300pz; CD300qa; CD300qb; CD300qc; CD300qd; CD300qe; CD300qf; CD300qg; CD300qh; CD300qi; CD300qj; CD300qk; CD300ql; CD300qm; CD300qn; CD300qo; CD300qp; CD300qq; CD300qr; CD300qs; CD300qt; CD300qu; CD300qv; CD300qw; CD300qx; CD300qy; CD300qz; CD300ra; CD300rb; CD300rc; CD300rd; CD300re; CD300rf; CD300rg; CD300rh; CD300ri; CD300rj; CD300rk; CD300rl; CD300rm; CD300rn; CD300ro; CD300rp; CD300rq; CD300rr; CD300rs; CD300rt; CD300ru; CD300rv; CD300rw; CD300rx; CD300ry; CD300rz; CD300sa; CD300sb; CD300sc; CD300sd; CD300se; CD300sf; CD300sg; CD300sh; CD300si; CD300sj; CD300sk; CD300sl; CD300sm; CD300sn; CD300so; CD300sp; CD300sq; CD300sr; Ros kinase ERBB2 (Her2 / neu); cell surface-associated mucin 1 (MUC1); Epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prosta tatic acid phosphatase (PAP); mutant elongation factor 2 (ELF2M); ephrin B2 ; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (I GF-1 receptor); carbonic anhydrase IX (CAIX); beta type 9 proteasome (pro teasome, macropain) subunit (LMP2); glycoprotein 100 (gp100) ; breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl) oncogene fusion protein (bcr-abl); tyrosine -ase; type A ephrin receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1- 4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD 2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial mar ker 7-related (TEM7R); claudin6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179 a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of globoH glycosphingolipid (GloboH); mammary differentiation antigen (NY-BR-1) ; uroplakin 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); ad renergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein co -acting receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO -1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen 1 (MAD-CT-1 ); melanoma cancer testis antigen 2 (MAD-CT-2); Fos-related antigen 1; tumor protein p 53 (p53); p53 mutant; prostain; survivin; telomerase; prostate cancer tumor antigen 1 (PCTA-1 or galectin 8); melanoma antigen recognized by T cells 1 (MelanA or MART1); rat sarcoma (Ras) mutant; human telomerase -reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma apoptosis inhibitor (ML-I AP); ERG (transmembrane serine protease 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyl-transferase V (NA17); paired box transcription factor Pax-3 (PAX3); androgen receptor; CyclinB1; v-myc avian myelocytomatosis virus oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Sites); Squamous Cell Carcinom a Antigen Recognized by T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); Proacrosin-binding protein s p32 (OY-TES1); Lymphocyte-specific protein tyrosine kinase (LCK); A Kinase anchor protein 4 (AKAP-4); Synovial sarcoma, X breakpoint 2 (SSX2); Receptor for advanced glycation end products (RAGE-1); Renal ubiquitous 1 (RU1); Renal ubiquitous 2 (R U2); Legumain; Human papillomavirus E6 (HPV E6); Human papillomavirus E7 (HPV E7); Intestinal carboxylesterase; Mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; Leuk ocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILR A2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); Bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); Lymphocyte antigen 75 ( LY75); Glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); And immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0149] In multiple embodiments, the CAR comprises, for example, an antigen recognition domain that binds to CD19 as described herein. In multiple embodiments, the CAR comprises an anti-CD19 binding domain that comprises, for example, SEQ ID NO: 7895 or consists of the like. In multiple embodiments, the CAR comprises an anti-CD19 binding domain that comprises, for example, SEQ ID NO: 7884 or consists of the like.

[0150] In multiple embodiments, the CAR comprises, for example, an antigen recognition domain that binds to BCMA as described herein. In multiple embodiments, the CAR comprises an anti-BCMA binding domain that comprises, for example, SEQ ID NO: 7949 or consists of the like.

[0151] In multiple embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In multiple embodiments, the transmembrane domain comprises the sequence of SEQ ID NO: 6644. In multiple embodiments, the intracellular signaling domain comprises a primary signaling domain and / or a co-stimulatory signaling domain. In multiple embodiments, the primary signaling domain comprises, for example, the sequence of SEQ ID NO: 6648 or SEQ ID NO: 6650 or consists of the like. In multiple embodiments, the co-stimulatory signaling domain comprises, for example, the sequence of SEQ ID NO: 6646 or SEQ ID NO: 6636 or consists of the like, for example, comprises the sequence of SEQ ID NO: 6646 or consists of the like. In other embodiments, the co-stimulatory signaling domain comprises a sequence derived from the intracellular signaling domain of CD28.

[0152] In multiple embodiments, the CAR is a CD19 CAR and comprises, for example, the sequence of SEQ ID NO: 7920 or consists of the like. In multiple embodiments, the CAR is a CD19 CAR. Comprising, for example, consisting of, the sequence of SEQ ID NO: 7909. In multiple embodiments, for example The cells described herein comprise a CD19 CAR as described herein, for example, a nucleic acid sequence encoding a CD19 CAR comprising the sequence of SEQ ID NO: 7920 or SEQ ID NO: 7909 In multiple embodiments, the CAR is a BCMA CAR and comprises, for example, consists of, the sequence of SEQ ID NO: 8559. In multiple embodiments, for example, the cells described herein

[0153] comprise a BCMA CAR as described herein, for example, a nucleic acid sequence encoding a BCMA CAR comprising SEQ ID NO: 8559. In multiple embodiments, the nucleic acid sequence encoding the BCMA CAR comprises, for example, consists of, SEQ ID NO: 8574

[0154] In multiple aspects, for example, the cells of the invention described herein (e.g., a cell population of the invention) further comprise a nucleic acid sequence encoding an NK inhibitory molecule. Such cells are preferably when the cells exhibit a reduction or loss of expression of one or more major histocompatibility complex class I (MHC I) molecules (e.g., via reduction or loss of B2M expression, achieved, for example, by the methods described herein) and / or a reduction or loss of expression of one or more major histocompatibility complex class II (MHC II) molecules (e.g., via reduction or loss of CIITA expression, achieved, for example, by the methods described herein) In multiple embodiments, the NK inhibitory molecule is an HLA-G molecule, for example, an HLA-G molecule that does not require B2M, such as HLA-G2, HLA-G3, HLA-G4 ​​​​​​​​​​​​In other embodiments, the NK inhibitory molecule is an HLA-G:B2M fusion molecule. Exemplary HLA-G:B2M fusion molecules include SEQ ID NO: 10674. An exemplary nucleic acid sequence encoding the HLA-G:B2M fusion is SEQ ID NO: 10675.

[0155] In multiple embodiments, the cell (e.g., cell population) exhibits reduced or absent expression of the target of the NK inhibitory molecule, e.g., reduced or absent

[0156] In multiple embodiments, the CAR-expressing cells of the invention (e.g., cells in which the expression or function of one or more proteins has been reduced or eliminated by the methods described herein) maintain the ability to proliferate in response to stimulation, e.g., binding of the CAR to its target antigen. In multiple embodiments, proliferation occurs ex vivo. In multiple embodiments, proliferation occurs in vivo. In multiple embodiments, proliferation occurs both ex vivo and in vivo. In multiple embodiments, the proliferation level is substantially the same as the proliferation level exhibited by the same cell type (e.g., cells of the same type as the CAR-expressing cells), but without the expression or function of one or more proteins reduced or eliminated, e.g., by the methods described herein. In multiple embodiments, the proliferation level is at least 80%, at least 85%, at least 90%, at least 95 %, at least 98%, or more than this level of the proliferation level exhibited by the same cell type (e.g., cells of the same type as the CAR-expressing cells), but without the expression or function of one or more proteins reduced or eliminated, e.g., by the

[0157] Unless otherwise defined, all technical and scientific terms used in this specification shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the practice or testing of the present invention, methods and materials similar or equivalent to those described herein may be used, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this specification are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Headings, sub- headings, or elements by number or letter, e.g., (a), (b), (i), etc., are presented merely for ease of reading. The use of headings or elements by number or letter in this document does not require that steps or elements be performed in alphabetical order nor does it necessarily require that steps or elements be distinct from each other. Other features, objects, and advantages of the present invention will be apparent from the description and drawings, and from the claims.

[0158]

Figure 1

Figure 2

Figure 2

Figure 3

Figure 4

Figure 5-1

Figure 5-2

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17-1

Figure 17-2

Figure 17-3

Figure 17-4

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28-1

Figure 28-2

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33-1

Figure 33-2

Figure 33-3

Figure 34-1

Figure 34-2

Figure 35

Figure 36

Figure 37

Figure 38

Figure 39

Figure 40

Figure 41

Figure 42

Figure 43

Figure 44

Figure 45

Figure 46

Figure 47

Figure 48

Figure 49

Figure 50

Figure 51

Figure 52

Figure 53

Figure 54

Figure 55-1

Figure 55-2

Figure 56

Figure 57

Figure 58-1

Figure 58-2

Figure 58-3

Figure 58-4

Figure 58-5

Figure 58-6

Figure 58-7

Figure 58-8

Figure 58-9

Figure 59

Figure 60

Figure 61

Claims

1. A gRNA molecule comprising a tracr and a crRNA, wherein the crRNA comprises a targeting domain complementary to a target sequence within B2M, and the targeting domain comprises 17, 18, 19, or 20 consecutive nucleotides of SEQ ID NO: 5498.

2. The gRNA molecule according to claim 1, wherein the targeting domain and the tracr are located on separate nucleic acid molecules, the nucleic acid molecule comprising the targeting domain comprises SEQ ID NO: 6607 located immediately 3' to the targeting domain, and the nucleic acid molecule comprising the tracr comprises SEQ ID NO: 6660.

3. The gRNA molecule according to claim 1, wherein the gRNA molecule comprises SEQ ID NO: 7858.

4. The gRNA molecule according to claim 1, wherein the targeting domain and the tracr are located on a single nucleic acid molecule, and the single nucleic acid molecule is an sgRNA molecule.

5. The gRNA molecule comprises one or more nucleic acid molecules, and the one or more nucleic acid molecules comprise a) one or more phosphorothioate modifications at the 3' end of the one or more nucleic acid molecules; b) one or more phosphorothioate modifications at the 5' end of the one or more nucleic acid molecules; c) one or more 2'-O-methyl modifications at the 3' end of the one or more nucleic acid molecules; d) one or more 2'-O-methyl modifications at the 5' end of the one or more nucleic acid molecules; e) one or more 2'-O-methyl modifications at each of the fourth, third, and second 3' residues from the end of the one or more nucleic acid molecules; or f) any combination thereof The gRNA molecule according to any one of claims 1 to 4.

6. A composition comprising a first gRNA molecule according to any one of claims 1 to 5, and a Cas9 molecule or a nucleic acid encoding a Cas9 molecule.

7. The composition according to claim 6, wherein the Cas9 molecule comprises SEQ ID NO: 6611, or any one of SEQ ID NOs: 7821 to 7831, or a sequence having at least 95% homology thereto.

8. The composition according to claim 6 or 7, wherein the first gRNA molecule and the Cas9 molecule are present within a ribonucleoprotein complex (RNP).

9. The composition according to any one of claims 6 to 8, further comprising a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, a third gRNA molecule, and a fourth gRNA molecule, wherein each of the first, second, third, and fourth gRNA molecules is complementary to a different target sequence.

10. a) a first gRNA molecule according to any one of claims 1 to 5; b) a second gRNA molecule comprising tracr and crRNA wherein the crRNA of the second gRNA molecule comprises a targeting domain complementary to any of the following target sequences. A second gRNA molecule. (i) TRAC, wherein the targeting domain comprises a TRAC comprising any one of SEQ ID NO: 5528 to SEQ ID NO: 5623 or SEQ ID NO: 5816 to SEQ ID NO: 5965; (ii) TRBC1, wherein the targeting domain comprises a TRBC1 comprising any one of SEQ ID NO: 5624 to SEQ ID NO: 5643 or SEQ ID NO: 5966 to SEQ ID NO: 6097; (iii) TRBC2, wherein the targeting domain comprises a TRBC2 comprising any one of SEQ ID NO: 5644 to SEQ ID NO: 5719 or SEQ ID NO: 6098 to SEQ ID NO: 6226; (iv) CD3D, wherein the targeting domain comprises a CD3D comprising any one of SEQ ID NO: 393 to SEQ ID NO: 532 or SEQ ID NO: 10780 to SEQ ID NO: 10794; (v) CD3E, wherein the targeting domain comprises a CD3E comprising any one of SEQ ID NO: 533 to SEQ ID NO: 839 or SEQ ID NO: 10677 to SEQ ID NO: 10764; (vi) CD3G, wherein the targeting domain comprises a CD3G comprising any one of SEQ ID NO: 840 to SEQ ID NO: 968 or SEQ ID NO: 10765 to SEQ ID NO: 10779; (vii) HLA-A, wherein the targeting domain comprises an HLA-A comprising any one of SEQ ID NO: 969 to SEQ ID NO: 1345; A composition comprising.

11. a) the first gRNA molecule is the gRNA molecule according to any one of claims 1 to 5; and, b) The second gRNA molecule comprises a targeting domain that is complementary to a target sequence in TRAC and comprises any one of SEQ ID NO: 5569, SEQ ID NO: 5586, SEQ ID NO: 5587, SEQ ID NO: 5592, SEQ ID NO: 5599, or SEQ ID NO: 5600, comprises a targeting domain that is complementary to a target sequence in CD3E and comprises SEQ ID NO: 10729, SEQ ID NO: 10719, SEQ ID NO: 10764, SEQ ID NO: 10789, SEQ ID NO: 10701, SEQ ID NO: 10700, or SEQ ID NO: 10722, The composition according to claim 10.

12. The composition according to claim 10 or 11, further comprising a third gRNA molecule, wherein the targeting domain of the third gRNA molecule is complementary to a target sequence in any of the following; (i) FKBP1A, wherein the targeting domain comprises any one of SEQ ID NO: 6325 to SEQ ID NO: 6583, or SEQ ID NO: 6662 to SEQ ID NO: 6749; (ii) NLRRC5, wherein the targeting domain comprises any one of SEQ ID NO: 8622 to SEQ ID NO: 10089, or (iii) CIIITA, wherein the targeting domain comprises any one of SEQ ID NO: 6750 to SEQ ID NO: 7716, or SEQ ID NO: 7717 to SEQ ID NO: 7804.

13. The composition according to claim 12, wherein the targeting domain of the third gRNA molecule is complementary to a target sequence in CIIITA and comprises any one of SEQ ID NO: 6750 to SEQ ID NO: 7716, or SEQ ID NO: 7717 to SEQ ID NO: 7804.

14. The composition according to claim 12 or 13, further comprising a fourth gRNA molecule, wherein the targeting domain of the fourth gRNA molecule is complementary to a target sequence in a gene encoding a target of an NK inhibitory molecule.

15. The composition according to claim 14, wherein the target of the NK inhibitory molecule is LILRB1.

16. The targeting domain of the fourth gRNA molecule is a) any one of SEQ ID NO: 10090 to SEQ ID NO: 10673; b) any one of SEQ ID NO: 10090 to SEQ ID NO: 10673, 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleotides; c) any one of SEQ ID NOs: 10090 to 10673, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides on the 5' side; or d) the composition according to claim 15, comprising 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides on the 3' side of any one of SEQ ID NOs: 10090 to 10673. **Claim 17** The composition according to any one of claims 6 to 16, further comprising a template nucleic acid. **Claim 18** The composition according to claim 17, wherein the template nucleic acid comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR). **Claim 19** The CAR is a) CD19 CAR; b) BCMA CAR; c) CD20 CAR; d) CD22 CAR; e) CD123 CAR; f) EGFRvIII CAR; or g) mesothelin CAR The composition according to claim 18. **Claim 20** The gRNA molecule according to any one of claims 1 to 5, or the composition according to any one of claims 6 to 19, formulated in a medium suitable for electroporation. **Claim 21** A nucleic acid comprising a sequence encoding the gRNA molecule according to any one of claims 1 to 5. **Claim 22** A vector comprising the nucleic acid according to claim 21. **Claim 23** An ex vivo method for altering a target sequence of a cell, the method comprising contacting the cell with a) the gRNA molecule according to any one of claims 1 to 5, and a Cas9 molecule; b) the gRNA molecule according to any one of claims 1 to 5, and a nucleic acid encoding a Cas9 molecule; c) the gRNA molecule according to any one of claims 1 to 5, and a nucleic acid encoding a Cas9 molecule; d) a nucleic acid encoding the gRNA molecule according to any one of claims 1 to 5, and a nucleic acid encoding a Cas9 molecule; e) any one of a) to d) above, and a template nucleic acid; f) any one of a) to d) above, and a nucleic acid encoding a template nucleic acid; g) any one of a) to f) above, and one or more additional gRNA molecules; The method comprising the step of contacting. **Claim 24** The method according to claim 23, wherein the template nucleic acid comprises a nucleic acid encoding a chimeric antigen receptor (CAR). **Claim 25** The CAR is a) CD19 CAR; b) BCMA CAR; c) CD20 CAR; d) CD22 CAR; (e) CD123 CAR; (f) EGFRvIII CAR; or (g) mesothelin CAR The method according to claim 24, wherein the method is as described above.

26. The step of contacting the cell with the gRNA molecule according to any one of claims 1 to 3 or the nucleic acid according to claim 21, and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule reduces or eliminates the expression of B2M. The method according to any one of claims 23 to 25, wherein the method further comprises the step of expanding the cell.

27. The method according to any one of claims 23 to 26, wherein the gRNA molecule or the nucleic acid encoding the gRNA molecule, the Cas9 molecule or the nucleic acid encoding the Cas9 molecule, and, if present, one or more gRNA molecules are formulated in a single composition.

28. The method according to any one of claims 23 to 27, wherein the gRNA molecule or the nucleic acid encoding the gRNA molecule and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule are formulated in two or more compositions.

29. The method according to claim 23 or 28, wherein the template nucleic acid is delivered into the cell by a vector selected from the group consisting of a lentiviral vector, an AAV vector, an AAV6 vector, an adenoviral vector, a plasmid, a minicircle, or a nanoplasmid.

30. The method according to claim 23 or 28, wherein the gRNA molecule or the nucleic acid encoding the gRNA molecule, the Cas9 molecule or the nucleic acid encoding the Cas9 molecule, and, if present, one or more additional gRNA molecules are delivered into the cell by electroporation.

31. A cell modified by the method according to any one of claims 23 to 30.

32. A cell comprising an indel within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide in or from a target sequence complementary to the gRNA molecule according to any one of claims 1 to 3, wherein the cell exhibits reduced or abolished expression and / or function of B2M.

33. A cell comprising the gRNA molecule according to any one of claims 1 to 5, or the composition according to any one of claims 6 to 19, the nucleic acid according to claim 21, or the vector according to claim 22.

34. The cell according to any one of claims 31 to 33, wherein the cell is an allogeneic cell.

35. The cell according to any one of claims 31 to 34, further comprising a template nucleic acid comprising a sequence encoding a chimeric antigen receptor (CAR).

36. The CAR is (a) CD19 CAR; (b) BCMA CAR; (c) CD20 CAR; (d) CD22 CAR; (e) CD123 CAR; (f) EGFRvIII CAR; or (g) mesothelin CAR The cell according to claim 35.

37. The cell according to any one of claims 31 to 36, or a cell obtained by the method according to any one of claims 23 to 30, for use in the treatment of a disease associated with the expression of a tumor antigen.

38. A pharmaceutical composition comprising the cell according to any one of claims 31 to 36, or a cell obtained by the method according to any one of claims 23 to 30.

39. The pharmaceutical composition according to claim 38, for use in the treatment of a disease.

40. The cell according to claim 37, or the pharmaceutical composition according to any one of claims 38 to 39, wherein the disease is a proliferative disease, a pre-cancerous condition, cancer, or a non-cancer related indication associated with the expression of the tumor antigen.

41. The cancer according to claim 40, wherein the cancer is selected from colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal area cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumor, bladder cancer, kidney or ureteral cancer, renal pelvis cancer, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell carcinoma, T cell lymphoma, environmentally induced cancer, chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B cell acute lymphoblastic leukemia (B-ALL), T cell acute lymphoblastic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML), B cell pre-lymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative condition, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and preleukemia, combinations of the cancers, and metastatic lesions of the cancers, and the cell or pharmaceutical composition according to claim 40.

42. The cell or pharmaceutical composition according to any one of claims 37 to 41, wherein the cell is a transplanted cell.

43. The cell according to any one of claims 31 to 36, for use in transplantation.

44. The cell according to claim 43, wherein the transplantation comprises the step of administering an immunosuppressive drug.

45. The cell according to claim 44, wherein the cell contains an indel at or within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of the target site of the gRNA molecule according to any one of claims 1 to 5, and the cell exhibits a reduction or loss of B2M expression and / or function.

46. A cell for use in transplantation, wherein the cell comprises the gRNA molecule according to any one of claims 1 to 5, an indel at or within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide from the target site of the gRNA molecule according to any one of claims 1 to 5, the composition according to any one of claims 6 to 19, the nucleic acid according to claim 21, and / or the vector according to claim 22.

47. The cell according to claim 46, wherein the cell is an allogeneic cell.

48. The cell according to claim 45 or 47, wherein the transplantation comprises the step of administering an immunosuppressive drug.

49. An in vitro method for preparing a cell for immunotherapy, comprising: (a) modifying the cell by reducing or eliminating the expression of a component of the T cell receptor (TCR), the step comprising introducing into the cell a gRNA molecule comprising tracr and crRNA, the crRNA comprising a targeting domain, and the targeting domain being: (i) complementary to a target sequence in TRAC and comprising any one of SEQ ID NOs: 5528 to 5623, or SEQ ID NOs: 5816 to 5965; (ii) complementary to a target sequence in TRBC1 and comprising any one of SEQ ID NOs: 5624 to 5643, or SEQ ID NOs: 5966 to 6097; (iii) complementary to a target sequence in TRBC2 and comprising any one of SEQ ID NOs: 5644 to 5719, or SEQ ID NOs: 6098 to 6226; (iv) complementary to a target sequence in CD247 and comprising any one of SEQ ID NOs: 84 to 392; (v) complementary to a target sequence in CD3D and comprising any one of SEQ ID NOs: 393 to 532, or SEQ ID NOs: 10780 to 10794; (vi) complementary to a target sequence in CD3E and comprising any one of SEQ ID NOs: 533 to 839, or SEQ ID NOs: 10677 to 10764; (vii) complementary to a target sequence in CD3G and comprising any one of SEQ ID NOs: 840 to 968, or SEQ ID NOs: 10765 to 10779; step; (b) Modifying the cell by reducing or eliminating the expression of B2M, the step comprising introducing into the cell the gRNA molecule according to any one of claims 1 to 5; (c) Introducing a nucleic acid encoding a chimeric antigen receptor (CAR); and, (d) Expanding the cell; A method comprising the above.

50. An indel within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of or from the target sequence in B2M according to any one of claims 1 to 5, or an indel within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of or from the target site complementary to the gRNA molecule according to any one of claims 1 to 5 A cell comprising the above.

51. The cell according to any one of claims 31 to 36 or 50, or the cell obtained by the method according to any one of claims 23 to 30 or 49, for use in the manufacture of a medicament for treating a disease.

52. The disease is selected from proliferative diseases, pre-cancerous conditions, cancers, or diseases that are non-cancer-related indications associated with the expression of the tumor antigen. The cancer is selected from colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small intestine cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal area cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumor, bladder cancer, kidney or ureteral cancer, renal pelvis cancer, central nervous system (CNS) neoplasm, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T cell lymphoma, environmentally induced cancer, chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B cell acute lymphoblastic leukemia (B-ALL), T cell acute lymphoblastic leukemia (T-ALL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML), B cell prelymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative condition, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenström macroglobulinemia, and preleukemia, combinations of the cancers, and metastatic lesions of the cancers, and the non-cancer related indications are selected from autoimmune diseases (e.g., lupus), inflammatory disorders (allergies and asthma), and transplantation. The cell according to claim 51.

53. The cell according to any one of claims 31 to 36 or 50, or the cell obtained by the method according to any one of claims 23 to 30 or 49, for use in transplantation.

Citation Information

Patent Citations

  • Method for rejecting B2M (beta 2-microglobulin) gene segment

    CN104611370A

  • Therapeutic uses of genome editing with crispr / cas systems

    WO2014165825A2

  • Method for generating t-cells compatible for allogenic transplantation

    WO2015136001A1