Compositions useful for the treatment of metachromatic leukodystrophy

Abstract

A recombinant adeno-associated virus (rAAV) is provided, which has an AAVhu68 capsid and a vector genome including a nucleic acid sequence encoding functional human arylsulfatase A (ARSA). Also provided are a production system useful for producing the rAAV, a pharmaceutical composition including the rAAV, and a method for treating a subject with metachromatic leukodystrophy, or ameliorating the symptoms of metachromatic leukodystrophy, or slowing the progression of metachromatic leukodystrophy, by administering an effective amount of the rAAV to a subject in need thereof.

Description

Background Art

[0001] Metachromatic leukodystrophy (MLD) is a single-gene autosomal recessive sphingolipid storage disorder caused by mutations in the gene encoding the lysosomal enzyme ARSA (Von Figura et al., 2001, Gieselmann and Krageloh-Mann, 2010). ARSA deficiency results in the accumulation of its natural substrate, sulfated galactosphingolipids (galactosylceramide-3-O-sulfate and galactosylsphingosine-3-O-sulfate), commonly referred to as sulfatide. Sulfatide accumulates within the lysosomes of oligodendrocytes, microglia, and certain types of neurons in the central nervous system (CNS), in addition to Schwann cells and macrophages in the peripheral nervous system (PNS) (Peng and Suzuki, 1987). Although the PNS and CNS are primarily affected, sulfatide accumulation also occurs in visceral organs, most prominently in the kidneys, liver (Toda et al., 1990), and gallbladder (Rodriguez-Waitkus et al., 2011, McFadden and Ranganathan, 2015).

[0002] Patients with MLD (i.e., patients with mutations in both alleles) typically have ARSA enzyme activity that is 0-10% of the control value in assays based on synthetic substrates. ARSA mutation carriers, who have a single mutant ARSA allele and one normal allele, are clinically unaffected and usually have ARSA enzyme activity that is approximately 10% of the control value, while asymptomatic individuals with a pseudodeficiency (PD, a genetically distinct form of ARSA deficiency) allele have ARSA enzyme activity that is approximately 10-20% of that of healthy controls (Gomez-Ospina, 2017). Clinically, the three forms of MLD can be distinguished based on the age of onset of symptoms across a broad continuous spectrum of disease severity: the rapidly progressive severe late infantile form, the juvenile form, and the late-onset slowly progressive adult form, which constitute approximately 50-60%, 20-30%, and 15-20% of MLD diagnoses, respectively (Gomez-Ospina, 2017; Wang et al., 2011). Infantile MLD is considered a rare disease. Late infantile MLD presents before 30 months of age and is the most severe form of the disease. The late infantile form has a uniform clinical presentation and a rapidly progressive, predictable disease course. Juvenile MLD is characterized by an age of onset between 30 months and 16 years, and the median age of onset is 6 years 2 months (Kehrer et al., 2011a)-10 years (Mahmood et al., 2010), depending on the study. To better characterize the clinical phenotype, a subset of juvenile MLD patients, termed early juvenile MLD, has been described, and these patients have a clinical age of onset of 6 years or younger and have a similar but less rapid initial disease progression compared to children with late infantile MLD (Biffi et al., 2008; Chen et al., 2016; Sessa et al., 2016). The early juvenile and late infantile phenotypes are collectively referred to as the early-onset form of MLD (Sessa et al., 2016). In late juvenile MLD patients (i.e., patients who develop symptoms between 7 and 16 years of age), problems with behavior, attention deficit, or cognitive decline usually occur first and sometimes occur in conjunction with gait disturbances.

[0003] There is no approved treatment or disease-modifying therapy for MLD. Since MLD is caused by a defective ARSA, various research approaches aim to correct the biochemical defect by replacing functional ARSA in the nerve tissue affected in the CNS. Enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) rely on providing normal enzymes to ARSA-deficient cells, while gene therapy approaches are based on overexpression of wild-type ARSA in different cell types (Patil and Maegawa, 2013). Hematopoietic stem cell transplantation (HSCT) using umbilical cord blood (UCB), allogeneic peripheral blood stem cells, or allogeneic bone marrow is effective depending on the MLD phenotype and the timing of intervention for the patient's disease state (Patil and Maegawa, 2013, van Rappard et al., 2015). Bone marrow transplantation (BMT) requires the availability of a human leukocyte antigen-matched sibling donor for the best results (Boucher et al., 2015) and has risks of transplantation- and conditioning-related complications such as graft-versus-host disease (GvHD), infections, and death. Umbilical cord blood (UCB) transplantation offers an alternative to BMT with the advantages of more rapid availability, lower risk of GvHD, lower mortality, higher complete donor chimerism rates, and good correction of enzyme deficiency (Batzios and Zafeiriou, 2012, Martin et al., 2013). However, BMT is not widely available in Europe. Brain engraftment is slow and often takes months for cells to engraft, migrate to the CNS, differentiate, and restore enzyme levels. Furthermore, the physiological enzyme levels achieved with HSCT may not be sufficient to correct the defect throughout the CNS. This can explain why transplantation is not effective in early-onset MLD where the disease progresses rapidly and all aspects of the disease cannot be corrected or stabilized even if performed before symptom onset (de Hosson et al., 2011, Martin et al., 2013, Boucher et al., 2015).

[0004] Accordingly, there remains a substantially unmet need for rapidly initiated therapies that can halt or prevent disease progression in these patients.

[0005] In addition to HSCT, there are various other cell-based approaches that treat the neurological symptoms of MLD, including (over)expressing ARSA, delivering the enzyme to diseased cells, microencapsulated recombinant cells, oligodendrocytes and neural progenitor cells, as well as embryonic stem cells. These cell therapies have shown significant clearance of sulfatide accumulation in animal models (Patil and Maegawa, 2013), but have not yet been tested in humans.

[0006] Ex vivo lentiviral gene therapy, which combines hematopoietic stem cell transplantation and gene therapy by transducing autologous CD34+ cells with a human ARSA-encoding lentiviral vector and re-administering the gene-corrected cells to the patient (HSC-GT), has been attempted (Biffi et al., 2013). This therapy is promising for patients identified at the pre-symptomatic stage (after diagnosis in older affected siblings), but has not been shown to be effective in patients who are already symptomatic. Unfortunately, because neonatal screening is not yet available, most new MLD diagnoses are made after symptom onset, which reduces the potential for treatment options for many MLD patients. Additionally, there are risks inherent in the myeloablative conditioning regimen and the risk of insertional mutagenesis associated with these integrating vectors.

[0007] Pharmacotoxicity tests in NHP have shown significant dose-limiting toxicity due to brain inflammation (encephalitis) localized around the injection site (Zerah et al., 2015). Similarly, a Phase 1 / 2 clinical trial (NCT01801709) (Aubourg, 2016) is ongoing to evaluate the safety and efficacy of AAVrh10-mediated ARSA gene transfer in the brains of children affected by early-onset MLD, which is involved in intracerebral vector administration at 12 sites within the white matter of the brain (Zerah et al., 2015). The results of the trial have not been published except in abstract form, and a preliminary report suggests a lack of efficacy in preventing onset or halting disease progression (Sevin et al., 2018). The reason for the lack of efficacy has not been considered by the trial sponsor. In addition to AAVrh10-mediated gene therapy, intracranial delivery lentiviral gene therapy is also being employed in patients with any type of MLD (NCT03725670).

[0008] Enzyme replacement therapy (ERT) is currently the standard of care (SOC) for several lysosomal storage diseases (LSDs) (Sands, 2014) and relies on the ability of cells to take up the enzyme injected via the mannose-6-phosphate receptor (Ghosh et al., 2003). In MLD, ERT is Arsa - / -Reduces sulfatide accumulation in the kidneys, peripheral nerves, and CNS of mice (Matzner et al., 2005). In an advanced MLD mouse model with immune tolerance to human ARSA and supernormal sulfatide synthesis, improvement of MLD symptoms and reduction of sulfatide accumulation were only seen in mice treated at an early time point, suggesting that ERT administered IV may not function in patients with advanced symptoms (Matthes et al., 2012). In the same model, continuous IT infusion of recombinant ARSA to bypass the BBB (Stroobants et al., 2011) resulted in complete reversal of sulfatide accumulation and correction of CNS dysfunction, while other non-clinical studies in mice have led to reduction of sulfatide accumulation and improvement of functional outcome (Matzner et al., 2009, Piguet et al., 2012). However, in humans, the degree of metabolic correction by ERT may not be sufficient and timely to prevent the rapid cerebral demyelination that occurs in early-onset MLD (Rosenberg et al., 2016). Since the BBB restricts access of most large proteins to the CNS, ERT is likely to function only when delivered directly to the CNS (Abbott, 2013) and is thought to require frequent administration due to its short half-life. This hypothesis has been demonstrated in ERT clinical trials attempting to overcome these limitations by frequent high-dose IV administration (NCT00681811) or IT infusion (Giugliani et al., 2018). However, the results of IV-administered ERT in late-infantile MLD patients (NCT00418561) were disappointing, along with IT-administered ERT in early-onset and late-juvenile MLD (NCT01510028).

[0009] Small molecule-based therapies have the potential to overcome the limitations of current therapies for MLD (e.g., by crossing the BBB) and can also address different disease mechanisms. Warfarin (coumadin) is an anticoagulant that has been tested as a substrate reducer in a small cohort of late infantile MLD patients. There was no beneficial effect on urinary sulfatide levels or the levels of the brain biomarkers N-acetylaspartic acid and myo-inositol (Patil and Maegawa, 2013).

[0010] When combined with the overall disappointing preclinical results obtained from other research approaches, the limited benefits, restricted populations, narrow therapeutic concentration ranges, and associated risks of HSCT and HSC-GT represent an important unmet clinical need for other viable treatment options, particularly for patients with early-onset MLD.

[0011] What is desired are alternative therapies for treating abnormal ARSA genes and / or conditions associated with metachromatic leukodystrophy. SUMMARY OF THE INVENTION

[0012] Provided herein are therapeutic, recombinant, and replication-deficient adeno-associated viruses (rAAVs) that are useful for treating subjects in need of treatment for diseases associated with arylsulfatase A gene (ARSA) mutations (e.g., metachromatic leukodystrophy, i.e., MLD, or ARSA pseudodeficiency). The rAAV preferably is replication-deficient and has a vector genome that includes inverted terminal repeats (ITRs) and a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) under the control of regulatory sequences that direct the expression of hARSA in target cells. In certain embodiments, the rAAV further includes the AAVhu68 capsid in which the vector genome is packaged. In certain embodiments, the vector genome does not contain the AAVhu68 genomic sequence and is completely exogenous to the AAVhu68 capsid.

[0013] In certain embodiments, the functional hARSA has a signal peptide and the sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2. In certain embodiments, the native hARSA signal peptide, e.g., aa1 to aa18 of SEQ ID NO: 2, is used. In certain embodiments, the signal peptide is aa1 to aa20 of SEQ ID NO: 4. In certain embodiments, the functional hARSA has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

[0014] In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to nucleotides (nt) 55 to nt1521 of SEQ ID NO: 1. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. In further embodiments, the hARSA coding sequence encodes the sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2. In still further embodiments, the hARSA coding sequence encodes the sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

[0015] In certain embodiments, the regulatory sequences include one or more of a regulatory element derived from the chicken β-actin (BA) promoter and the human cytomegalovirus immediate early enhancer (CMV IE) (e.g., the CB7 promoter which is nt198 to nt862 of SEQ ID NO: 5), a chimeric intron consisting of a chicken BA splice donor and a rabbit β-globin (rBG) splice acceptor element (e.g., CI which is nt956 to nt1928 of SEQ ID NO: 5), and a polyadenylation (polyA) signal derived from the rBG gene (e.g., rBG which is nt3539 to nt3665 of SEQ ID NO: 5). In certain embodiments, the vector genome has the sequence of nucleotides (nt) 1 to nt3883 of SEQ ID NO: 5. In certain embodiments, the rAAV or a composition comprising rAAV can be administered to a subject in need thereof to improve the symptoms of a disease associated with an ARSA mutation (e.g., MLD) and / or delay the progression of a disease associated with an ARSA mutation (e.g., MLD).

[0016] In another aspect, a production system useful for producing rAAV is provided. In this system, cells are cultured that contain a nucleic acid sequence encoding the AAVhu68 capsid protein, a vector genome as described herein, and sufficient AAV rep and helper functions to enable packaging of the vector genome into an AAV capsid.

[0017] In one aspect, a vector useful for treating a subject in need of treatment for a disease associated with an ARSA mutation (e.g., MLD) is provided herein. The vector has a nucleic acid sequence encoding a functional human arylsulfatase A (hARSA) under the control of regulatory sequences that direct the expression of hARSA in target cells. In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to SEQ ID NO: 1. Additionally or alternatively, the functional hARSA protein has the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1. In certain embodiments, the vector or composition comprising the vector is administrable to a subject in need thereof to improve symptoms of a disease associated with an ARSA mutation (e.g., MLD) and / or delay the progression of a disease associated with an ARSA mutation (e.g., MLD).

[0018] In a further aspect, a composition comprising an rAAV or vector as described herein and an aqueous suspension medium is provided herein. In certain embodiments, an aqueous composition comprising a formulation buffer and the rAAV or vector described is provided. In certain embodiments, the formulation buffer comprises a buffered saline and an artificial cerebrospinal fluid containing one or more of sodium, calcium, magnesium, potassium, or mixtures thereof, and a surfactant. In certain embodiments, the formulation buffer comprises about 0.0005% to about 0.001% surfactant . In certain embodiments, the composition has a pH of 7.2 to 7.8.

[0019] In another aspect, provided is a method of treating a subject having a disease associated with an ARSA mutation (e.g., MLD), or improving the symptoms of a disease associated with an ARSA mutation (e.g., MLD), or delaying the progression of a disease associated with an ARSA mutation (e.g., MLD). The method includes administering to a subject in need thereof an effective amount of the rAAV or vector described herein. In certain embodiments, the vector or rAAV is administrable to a patient via intracisternal injection (ICM), e.g., suboccipital injection under CT guidance into the cisterna magna. In certain embodiments, provided is a vector or composition administrable to a patient having metachromatic leukodystrophy who is 7 years of age or younger, or 6 years of age or younger. In certain embodiments, the method includes delivering the rAAV or vector to a human patient in a single dose.

[0020] These and other aspects of the invention will become apparent from the following detailed description of the invention.

Brief Description of the Drawings

[0021]

Figure 1

Figure 2

Figure 3

Figure 4

Figures 5A-5B

Figure 6

Figure 7

Figure 8

Figures 9A-9B

Figure 10

Figure 11

Figures 12A-12B

Figures 13A-13L

Figures 14A-14I

BRIEF DESCRIPTION OF THE INVENTION

[0022] Compositions and methods for treating diseases (e.g., metachromatic leukodystrophy (MLD)) caused by mutations in the arylsulfatase A (ARSA) gene and / or deficiencies in normal levels of functional arylsulfatase A are provided herein. In certain embodiments, compositions and methods for treating diseases or conditions caused by mutations in the ARSA gene and / or deficiencies in normal levels of functional arylsulfatase A are also provided. An effective amount of recombinant adeno-associated virus (rAAV) packaged with a vector genome having the AAVhu68 capsid and encoding a functional human arylsulfatase A (hARSA) protein therein is delivered to a subject in need thereof. Desirably, this rAAV is formulated with an aqueous buffer. In certain embodiments, the suspension is suitable for intrathecal injection. In certain embodiments, the rAAV vector is designated AAVhu68.hARSAco, and the hARSA coding sequence is an engineered hARSA coding sequence (referred to as "hARSAco" or "hARSA" unless otherwise specified, e.g., nucleotides (nt) 55 to nt 1521 of SEQ ID NO: 1, SEQ ID NO: 3, or sequences that are at least about 95% to about 99.9% identical thereto). In certain embodiments, hARSAco is SEQ ID NO: 1. In certain embodiments, hARSAco is SEQ ID NO: 3. In certain embodiments, the rAAV vector is designated AAVhu68.CB7.hARSAco, and the engineered hARSA coding sequence is under the control of regulatory sequences including a chicken β-actin promoter having a cytomegalovirus enhancer (CB7; SEQ ID NO: 16). In certain embodiments, the composition is delivered via intracisternal magna (ICM) injection.

[0023] The nucleic acid sequences encoding the capsids of adeno-associated virus (AAV) of clade F, designated AAVhu68 herein, are utilized for the production of AAVhu68 capsids having vector genomes and recombinant AAV (rAAV). Additional details related to AAVhu68 are provided in WO2018 / 160582 and in this detailed description. The AAVhu68 vectors described herein are well-suited for delivering a vector genome containing an engineered hARSA coding sequence to cells within the central nervous system (CNS), including the brain, hippocampus, motor cortex, cerebellum, and motor neurons, as well as to the peripheral nervous system (PNS), including nerves and ganglia outside of the brain and spinal cord. These vectors can be used to target other cells within the CNS and / or PNS, as well as certain other tissues and cells, such as the kidney or liver or gallbladder.

[0024] I. Arylsulfatase A (hARSA) Arylsulfatase A (ARSA) has enzymatic activity to hydrolyze cerebroside sulfate (i.e., the following reaction: cerebroside 3-sulfate + H2O = cerebroside + sulfate). Two isoforms of the human ARSA (hARSA) protein (UniProtKB - P15289, ARSA_HUMAN) have been identified: P51608 - 1, SEQ ID NO: 2, and P51608 - 2, SEQ ID NO: 15. Throughout this specification, references to ARSA are to hARSA unless otherwise specified.

[0025] As used herein, a functional hARSA protein refers to an isoform, natural variant, variant, polymorph, or truncated form of an hARSA protein having at least about 10% of the enzymatic activity (i.e., enzyme activity) of the wild-type hARSA protein (e.g., P51608-1, SEQ ID NO: 2, or P51608-2, SEQ ID NO: 15). See OMIM #607574 (omim.org / entry / 607574), genecards.org / cgi-bin / carddisp.pl?gene=ARSA and uniprot.org / uniprot / P15289. Each of those web pages is hereby incorporated by reference in its entirety. In certain embodiments , the functional hARSA protein has at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more of the enzymatic activity of the wild-type hARSA protein (e.g., P51608-1, SEQ ID NO: 2, or P51608-2, SEQ ID NO: 15). In certain embodiments, the functional hARSA protein has from about 10% to about 15%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 30%, from about 10% to about 50%, from about 10% to about 75%, from about 10% to about 90%, from about 10% to about 100%, from about 10% to about 3-fold, from about 15% to about 20%, from about 15% to about 25%, from about 15% to about 30%, from about 15% to about 50%, from about 15% to about 75%, from about 15% to about 90%, from about 15% to about 100%, from about 15% to about 3-fold, from about 20% to about 25%, from about 20% to about 30%, from about 20% to about 50%, from about 20% to about 75%, from about 20% to about 90%, from about 20% to about 100%, from about 20% to about 3-fold, from about 25% to about 30%, from about 25% to about 50%, from about 25% to about 75%, from about 25% to about 90%, from about 25% to about 100%, from about 25% to about 3-fold, from about 50% to about 75%, from about 50% to about 90%, from about 50% to about 100%, from about 50% to about 3-fold, from about 75% to about 90%, from about 75% to about 100%, or from about 75% to about 3-fold of the enzymatic activity of the wild-type hARSA protein (e.g., P51608-1, SEQ ID NO: 2, or P51608-2, SEQ ID NO: 15).Methods for measuring the enzymatic activity of ARSA (e.g., by assays based on synthetic substrates and / or by sulfatide loading assays) can be found in the Examples as well as in various publications, such as Kreysing et al., High residual arylsulfatase A (ARSA) activity in a patient with late-infantile metachromatic leukodystrophy. Am J Hum Genet. 1993 Aug;53(2):339-46., Lee-Vaupel M and Conzelmann E. A simple chromogenic assay for arylsulfatase A. Clin Chim Acta. 1987 Apr 30;164(2):171-80, Bohringer et al., Enzymatic characterization of novel arylsulfatase A variants using human arylsulfatase A-deficient immortalized mesenchymal stromal cells. Hum Mutat. 2017 Nov;38(11):1511-1520.doi:10.1002 / humu.23306.Epub 2017 Sep 6, and Francesco. Morena, et al., A new analytical bench assay for the determination of arylsulfatase a activity toward galactosyl-3-sulfate ceramide: implication for metachromatic leukodystrophy diagnosis. Anal Chem. 2014 Jan 7;86(1):473-81.doi:10.1021 / ac4023555.Epub 2013 Dec 11.

[0026] In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of SEQ ID NO: 15 (i.e., aa85 to aa507 of SEQ ID NO: 2), or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of amino acids (aa) 19 to aa444 of SEQ ID NO: 2 a column, or an amino acid sequence that is at least about 90% identical thereto (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical), and (iii) the amino acid sequence of aa448-aa507 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% identical thereto (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical). In a further embodiment, the amino acid sequence of (ii) can be linked to the amino acid sequence of (iii) by a disulfide bond. Other chemical bonds, such as covalent bonds and non-covalent bonds (including hydrogen bonds, ionic bonds, hydrophobic bonds, and Van Der Waals bonds), may be utilized. In still further embodiments, the linkage between the amino acid sequences of (ii) and (iii) is formed by a combination of the described bonds. In another embodiment, the linkage between the amino acid sequences of (ii) and (iii) is a peptide linker (see, e.g., parts.igem.org / Protein_domains / Linker). In certain embodiments, the functional hARSA protein comprises (i) a signal peptide, (ii) the amino acid sequence of amino acids (aa) 85-aa444 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% identical thereto (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical), and (iii) the amino acid sequence of aa448-aa507 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% identical thereto (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical). In a further embodiment, the amino acid sequence of (ii) can be linked to the amino acid sequence of (iii) by a disulfide bond. Other chemical bonds, such as covalent bonds and non-covalent bonds (including hydrogen bonds, ionic bonds, hydrophobic bonds, and Van Der Waals bonds), may be utilized. In still further embodiments, the linkage between the amino acid sequences of (ii) and (iii) is formed by a combination of the described bonds.In another embodiment, the linkage between the amino acid sequences of (ii) and (iii) is a peptide linker (see, for example, parts.igem.org / Protein_domains / -Linker). In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of amino acids (aa) 23 to aa 348 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of amino acids (aa) 19 to aa 448 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein comprises (i) a signal peptide and (ii) the amino acid sequence of amino acids (aa) 448 to aa 507 of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein having the specified identity has its modification outside of aa 85 to aa 507 based on the numbering of SEQ ID NO: 2, and / or outside of any one or more of aa 29, 69, 123, 125, 150, 229, 281, 282 based on the numbering of SEQ ID NO: 2, and / or outside of any of the hARSA conserved domains (e.g., the sulfatase domain having Pfam: PF00884), and / or outside of aa 19 to aa 444 based on the numbering of SEQ ID NO: 2, and / or outside of aa 448 to aa 507 based on the numbering of SEQ ID NO: 2, and / or outside of aa 23 to aa 348 based on the numbering of SEQ ID NO: 2, or any combination thereof.For example, see von Bulow R et al, Crystal structure of an enzyme-substrate complex provides insight into the interaction between human arylsulfatase A and its substrates during catalysis, J Mol Biol. 2001 Jan 12;305(2):269-77.

[0027] In certain embodiments, the functional hARSA protein has the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto. In certain embodiments, the functional hARSA protein has the amino acid sequence of SEQ ID NO: 4, or an amino acid sequence that is at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical thereto.

[0028] ​As used herein, a signal peptide (also sometimes referred to as a signal sequence, targeting signal, localization signal, localization sequence, transport peptide, leader sequence, or leader peptide) is a short peptide (usually 15 - 30 amino acids in length) present at the N-terminus of most newly synthesized proteins destined for the secretory pathway (Blobel G, Dobberstein B (Dec 1975). “Transfer of proteins across membranes. I. Presence of proteolytically processed and unprocessed nascent immunoglobulin light chains on membrane-bound ribosomes of murine myeloma”. J Cell Biol. 67(3):835 - 51). These proteins include those present within specific organelles (endoplasmic reticulum, Golgi or endosome), those secreted from the cell, or those inserted into most cell membranes. In certain embodiments, the signal peptide has the amino acid sequence of aa1 - aa18 of SEQ ID NO: 2, or the amino acid sequence of aa1 - aa20 of SEQ ID NO: 4. In certain embodiments, the signal peptide is derived from another protein secreted by CNS cells (e.g., neurons), PNS cells, or another cell (e.g., kidney cells, or liver cells). The signal peptide is preferably of human origin or a derivative of a human signal peptide, and is about 15 - about 30 amino acids, preferably about 17 - 25 amino acids, or about 18 amino acids in length. In certain embodiments, the signal peptide is the native signal peptide (amino acids 1 - 18 of SEQ ID NO: 2). In certain embodiments, the functional hARSA protein includes an exogenous leader sequence in place of the native signal peptide. In another embodiment, the signal peptide can be derived from human IL2 or a mutant signal peptide. In another embodiment, the human serpin F1 secretion signal can be used as the signal peptide.Such chimeric hARSA proteins that include an exogenous signal peptide and the mature portion of hARSA (e.g., aa19-507 of SEQ ID NO:2, aa19-aa444 of SEQ ID NO:2, aa85-aaa507 of SEQ ID NO:2, aa23-aa348 of SEQ ID NO:2, or aa448-507 of SEQ ID NO:2) are included in the various embodiments described herein when reference is made to functional hARSA proteins.

[0029] Provided herein are nucleic acid sequences encoding a functional hARSA protein, referred to herein as an hARSA coding sequence or an ARSA coding sequence or hARSA or ARSA. In certain embodiments, the hARSA coding sequence is modified or engineered (hARSA or hARSAco). In certain embodiments, the hARSA coding sequence has the sequence of nucleotides (nt) 55-nt1521 of SEQ ID NO:1, or a sequence that is at least 95%-99.9% identical thereto. In certain embodiments, the hARSA coding sequence is nt55-nt1521 of SEQ ID NO:1, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9% identical nucleic acid sequence. In certain embodiments, the hARSA coding sequence is at least 95% - 99.9% identical to SEQ ID NO: 1 or the same sequence as it. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical nucleic acid sequence. In certain embodiments, the hARSA coding sequence is at least 95% - 99.9% identical to SEQ ID NO: 3 or the same sequence as it. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 3, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%) identical nucleic acid sequence.

[0030] Transcription variants of hARSA (which is also the hARSA coding sequence) can be found as NCBI reference sequences NM_000487.5, NM_001085425.2, NM_001085426.2, NM_001085427.2, NM_001085428.2, NM_001362782.1, AB448736.1, AK092752.1, AK098659.1, AK301098.1, AK310564.1, AK315011.1, BC014210.2, BI770997.1, BM818814.1, BP306351.1, BQ184813.1, BU632196.1, BX648618.1, CA423492.1, CN409235.1, CR456383.1, DA844740.1, DB028013.1, GQ891416.1, KU177918.1, KU177919.1, and X52151.1. Each of the NCBI reference sequences is hereby incorporated by reference in its entirety. In certain embodiments, the modified or engineered hARSA coding sequence shares less than about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity with one of the NCBI reference sequences. In certain embodiments, the modified or engineered hARSA coding sequence shares about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity with one of the NCBI reference sequences.

[0031] "Nucleic acid" or "nucleotide", as described herein, may be RNA, DNA, or modifications thereof, may be single-stranded or double-stranded, and may be selected, for example, from the group consisting of nucleic acids encoding a protein of interest, oligonucleotides, nucleic acid analogs such as peptide nucleic acids (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acids (LNA), and the like. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequences encoding a protein that acts as a transcriptional repressor, antisense molecules, ribozymes, small inhibitory nucleic acid sequences such as, but not limited to, RNAi, shRNAi, siRNA, microRNAi (mRNAi), antisense oligonucleotides, and the like.

[0032] The terms "percent (%) identity", "sequence identity", "percent sequence identity", or "percent identical" in the context of a nucleic acid sequence refer to residues in two sequences that are the same when aligned correspondingly. The length of the comparison of sequence identity can span the entire length of the genome, the entire length of the gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides is desired. However, for example, identity between smaller fragments of at least about 9 nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides may also be desired. Identity between smaller fragments of at least about 9 nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides may also be desired.

[0033] Percent identity can be readily determined for the full length of a protein, a polypeptide, about 32 amino acids, about 330 amino acids, or an amino acid sequence over a peptide fragment thereof, or the corresponding nucleic acid sequence encoding the sequence. Suitable amino acid fragments can be at least about 8 amino acids in length and can be up to about 700. Generally, when referring to "identity", "homology", or "similarity" between two different sequences, "identity", "homology", or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to a plurality of nucleic acid sequences or protein (amino acid) sequences and, when compared to a reference sequence, often includes corrections for gaps or additional bases or amino acids.

[0034] Alignment is performed using any of a variety of publicly available or commercially available multiple sequence alignment programs. In the case of amino acid sequences, sequence alignment programs such as "Clustal X", "Clustal Omega", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs are available. Generally, any of these programs is used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the same level of identity or alignment as that provided by the reference algorithms and programs. See, for example, J.D. Thomson et al, Nucl. Acids Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690(1999).

[0035] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include "Clustal W", "Clustal Omega", "CAP Sequence Assembly", "BLAST", "MAP", and "MEME", which are accessible through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the Vector NTI utility can also be used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using the Fasta™ program, which is part of the GCG version 6.1 program. Fasta™ provides the alignment of the best overlapping regions and percent sequence identity between a query sequence and a search sequence. For example, the percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (word size 6 and NOPAM factor for the scoring matrix), as provided in GCG version 6.1 (incorporated herein by reference).

[0036] II. Metachromatic leukodystrophy (MLD) As used herein, there are provided rAAVs, vectors, methods, and compositions useful for treating a "disease", such as metachromatic leukodystrophy, a disease or abnormal condition caused by a mutation in the arylsulfatase A (ARSA) gene and / or a deficiency of normal levels of functional arylsulfatase A. See, for example, omim.org / entry / 250100.

[0037] Metachromatic leukodystrophy (MLD) can be classified into the following types: infantile ML D (typically starting before 30 months of age), early juvenile MLD (early-onset MLD including those typically starting between 30 months and 6 years of age (inclusive); juvenile MLD (including early juvenile MLD and late juvenile MLD) typically starting between 7 and 16 years of age (inclusive of 16 years); and adult MLD (onset after 16 years of age). Late infantile MLD patients have a severe disease course with rapid and predictable decline, being homogeneous in both motor and cognitive impairment symptoms (Kehrer et al., 2011a, Sessa et al., 2016). Most of these children die before 5 years of age, with an average survival of 4.2 years for 98 patients and a 5-year survival rate of 25% (Mahmood et al., 2010). The phenotype of children with early juvenile MLD (symptom onset between 30 months and 6 years of age) is very similar to that of children with late infantile MLD, although early juvenile MLD patients may have a less rapid initial disease progression (Biffi et al., 2008, Chen et al., 2016, Sessa et al., 2016). However, once obvious symptoms appear, especially when early juvenile MLD patients lose the ability to walk independently, the disease course of these patients may deteriorate as rapidly as that of late infantile MLD patients. Also, these children have the same signs and symptoms as late infantile MLD patients and initially develop neuromuscular disorders that occur alone or concomitantly with behavioral and cognitive symptoms (Groeschel et al., 2011, Kehrer et al., 2014). The early juvenile and late infantile phenotypes are collectively referred to as early-onset MLD (Sessa et al., 2016).

[0038] In certain embodiments, the rAAV, vectors, compositions, and methods described herein are useful for the treatment of MLD, early-onset MLD, infantile MLD, late-infantile MLD, juvenile MLD, early-juvenile MLD, late-juvenile MLD, or adult-onset MLD. In certain embodiments, the rAAV, vectors, compositions, and methods described herein can improve disease symptoms in a subject and / or delay the progression of the disease. In certain embodiments, the rAAV, vectors, compositions, and methods described herein are useful for the treatment of late-infantile MLD and early-juvenile MLD.

[0039] In certain embodiments, a subject or patient to whom the rAAV, vectors, methods, or compositions described herein are administered has or is diagnosed with MLD. In certain embodiments, a subject or patient to whom the rAAV, vectors, methods, or compositions described herein are administered is diagnosed with late-infantile MLD or early-juvenile MLD. Diagnosis of MLD can be performed through both genetic testing and biochemical testing. Genetic testing can identify mutations in ARSA, while biochemical testing includes sulfatase enzyme activity and urinary sulfatide excretion. Magnetic resonance imaging (MRI) can confirm the diagnosis of MLD. MRI shows images of the human brain and can indicate the presence or absence of myelin. The brains of individuals affected by MLD have a classical pattern of myelin loss. As the disease progresses, imaging shows that damage to the brain accumulates. In infants, initial brain imaging can be normal.

[0040] In certain embodiments, the subject of the rAAV, vector, method, or composition described herein is a human less than 18 years old (e.g., less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 months old, or less than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 years old). Additionally or alternatively, the subject is a neonate or a human over 1 month old (e.g., over about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 months old, or over about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 years old). In certain embodiments, the patient is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 months old, or about 1, 1.5, 2, 2.5, 3 , 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, 18 years old. In certain embodiments, the patient is about 30 months old to about 7 years old. In certain embodiments, the patient is about 30 months old to 16 years old, 7 years old to 16 years old, or 16 years old to 40 years old.

[0041] As used herein, "patient" or "subject" are interchangeable and mean a male or female mammal, veterinary or farm animal, breeding or pet animal, and an animal commonly used in clinical research, including humans. In one embodiment, the subject of these rAAV, vector, method, and composition is a human patient. In one embodiment, the subject of these rAAV, vector, method, and composition is a male or female human. In certain embodiments, the subject of these rAAV, vector, method, and composition is diagnosed with metachromatic leukodystrophy and / or symptoms of metachromatic leukodystrophy.

[0042] Disease symptoms (e.g., MLD symptoms compared to healthy controls without MLD) may include, but are not limited to: decreased concentration and / or level and / or bioactivity of ARSA (e.g., in serum or CSF), increased urinary sulfatide, CNS myelination (demyelination burden and pattern), white matter atrophy measured by MRI, abnormal (decreased or increased) levels of neuronal metabolites N-acetylaspartate (NAA), myo-inositol (mI), choline (Cho), and / or lactate (Lac) (e.g., measured by proton magnetic resonance spectroscopy (MRS)), increased levels of CSF sulfatide and lyso-sulfatide, abnormal visual evoked potential (VEP), abnormal brainstem auditory evoked response (BAER), gallbladder wall thickening (e.g., by ultrasound evaluation), motor dysfunction (e.g., measured by the Gross Motor Function Classification for Metachromatic Leukodystrophy (GMFC-MLD) or Gross Motor Function Measure (GMFM)), age at achievement, age at loss, and delay in achieving motor milestones (defined by World Health Organization [WHO] criteria) evaluated by the proportion of children maintaining or acquiring motor milestones, cognitive impairment (e.g., total intelligence quotient [IQ] and subdomain IQ measured by the Bayley Scales of Infant and Toddler Development [BSID-III], Wechsler Intelligence Scale for Children, Fifth Edition [WISC-V]), increased lifespan (compared to patients), abnormal results of neurological clinical examination (NCE), decreased nerve conduction velocity (NCV) of the ulnar, deep peroneal, median, and sural nerves, earlier onset age and higher frequency of seizures captured by seizure diaries, behavioral dysfunction (e.g., measured by the Vineland Adaptive Behavior Scales, Third Edition (Vineland-III)), lower Lansky Performance Index, decrease in Pediatric Quality of Life Inventory (e.g., PedsQL and PedsQL-IS), and / or decrease in caregiver / parent quality of life.

[0043] In certain embodiments, disease symptoms (e.g., MLD symptoms compared to healthy controls without MLD) may include abnormal characteristics (e.g., biomarker activity, electrophysiological activity, and / or imaging parameters) and clinical observations (e.g., impairments in gross and fine motor function, impairments in cognitive and language development, abnormal neurological examination findings, impairments in behavioral and milestone development, and reported declines in caregiver / parent-reported outcomes and quality of life assessments).

[0044] Abnormal characteristics may include dysfunction of myelin-producing oligodendrocytes and Schwann cells, peripheral nerve conduction abnormalities, peripheral neuropathy with slow nerve conduction velocity (NCV), typical white matter (e.g., corpus callosum and enlarged occipital-parietal white matter, projection fibers, cerebellar white matter, brainstem ganglia, and thalamus) patterns (e.g., the "tigroid pattern" of radial stripes with bands of normal signal intensity within abnormal white matter, e.g., see Gieselmann and Krageloh-Mann, 2010, Martin et al., 2012, van Rap pard et al., 2015) shown by magnetic resonance imaging (MRI) of the brain, U-fiber lesions and cerebellar changes, white matter demyelination, particularly bilateral regions of white matter hypodensity in the frontal lobe, and cerebral atrophy reflecting myelin loss), abnormal levels of the brain biomarkers N-acetylaspartate and myo-inositol, but are not limited thereto.

[0045] Clinical observations include, but are not limited to, clumsiness, toe walking, and gross motor disorders that manifest as frequent falls, fine motor skills, gait abnormalities, spastic diplegia or ataxic movements, neuromuscular disorders, neurological symptoms (signs of weakness, spasticity and loss of coordination progressing to incontinence), low blood pressure, and diminished deep tendon reflexes, seizures, dementia, epilepsy, dysuria spasm, dysphagia, limb pain, speech function disorders, cognitive skill disorders, visual and auditory impairments, loss of previously acquired motor and cognitive milestones, decreased school or work performance, inattention, abnormal behavior, psychiatric symptoms, intellectual disability, uncontrollable laughter, cortical disorders (e.g., apraxia, aphasia, agnosia), alcohol or drug use, inadequate financial management, emotional instability, inappropriate affect, and neuropsychiatric symptoms (including psychosis, schizophrenia, delusions, and hallucinations).

[0046] Disease progression refers to the onset age, frequency of appearance, severity, or recurrence of the disease symptoms in the subject. Delayed disease progression usually means an increase in the onset age of the disease symptoms, a decrease in the frequency of appearance, a decrease in severity, or less recurrence.

[0047] As noted above, "increase", "decrease", "reduce", "improve", "elevate", "low", "high", "few", "many", "enhance", "delay", "impair", "abnormal", "thick", or any grammatical variation thereof, or any similar terms indicating a change, means a variation of about 5-fold, about 2-fold, about 1-fold, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5% compared to a corresponding reference (e.g., an untreated control or a subject in a normal state without MLD), unless otherwise specified.

[0048] The compositions and methods of the present specification provide immediate-acting disease-modifying treatments to symptomatic early-onset patients for whom there is no standard treatment (HSCT and HSC-GT are ineffective), and / or can preserve or correct both CNS pathology and peripheral nerve function, the latter of which is not corrected by HSCT and causes progressive fine and gross motor loss and respiratory failure, provide a therapy that is only effective when administered prior to the onset of symptoms and that cannot substantially address peripheral neuropathy in all patients, and require a harsh myeloablative pre-transplant treatment, and provide an alternative treatment option to HSC-GT.

[0049] In certain embodiments, the patient receives a combination therapy that would not be eligible without the rAAV, vector, composition, or method described herein. Such combination therapy can include enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) via umbilical cord blood (UCB), allogeneic peripheral blood stem cells, or allogeneic bone marrow.

[0050] Optionally, an immunosuppressive combination therapy may be used in subjects in need thereof. Immunosuppressive agents for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T cell inhibitors, macrolides (e.g., rapamycin or rapalogs), and cell division inhibitors (including alkylating agents, antimetabolites, cytotoxic antibiotics, antibodies, or agents active against immunophilins). Immunosuppressive agents include nitrogen mustard, nitrosourea, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mitramycin, IL-2 receptor (CD25)-specific antibodies or CD3-specific antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirol It may contain a mus, IFN-β, IFN-γ, opioid, or TNF-α (tumor necrosis factor-α) binder. In certain embodiments, the immunosuppressive therapy can be initiated on the day 0, 1, 2, 3, 4, 5, 6, 7 or more days before or after the gene therapy administration. Such immunosuppressive therapy may involve the administration of one, two or more drugs (e.g., glucocorticoids, prednelison, mycophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)). Such immunosuppressive drugs can be administered to the subject in need, once, twice, or more, at the same dose or an adjusted dose. Such therapy may include the co-administration of two or more drugs (e.g., prednelison, mycophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after the gene therapy administration at the same dose or an adjusted dose. Such therapy may be about 1 week (7 days), about 60 days, or more, as needed. In certain embodiments, a regimen without tacrolimus is selected.

[0051] III. Expression cassette As used herein, provided is a nucleic acid sequence comprising an hARSA coding sequence encoding a functional hARSA protein and a regulatory sequence that directs the expression of hARSA in a target cell, also referred to as an expression cassette. As used herein, an "expression cassette" refers to a nucleic acid molecule comprising a coding sequence (e.g., an hARSA coding sequence), a promoter, and may include other regulatory sequences therefor. The required regulatory sequences are operably linked to the hARSA coding sequence in a manner that enables its transcription, translation, and / or expression in the target cell. As used herein, "operably linked" sequences include both expression control sequences adjacent to the hARSA coding sequence and expression control sequences that act in trans or remotely to control the hARSA coding sequence. Such regulatory sequences typically include one or more of, for example, a promoter, enhancer, intron, Kozak sequence, polyadenylation sequence, and TATA signal. In certain embodiments, the promoter is a chicken β-actin promoter having a cytomegalovirus enhancer (CB7) promoter (e.g., nucleotides 198 to 862 of SEQ ID NO: 5, also referred to herein as hSyn or Syn). However, in certain embodiments, other promoters, or additional promoters, may be selected.

[0052] In certain embodiments, the regulatory sequence directs the expression of hARSA in target cells. In certain embodiments, the target cells are nervous system cells, oligodendrocytes, microglia, central nervous system (CNS) cells, neurons within the CNS, peripheral nervous system (PNS) cells, Schwann cells, macrophages within the PNS, or cells within visceral organs (e.g., kidney cells, liver cells, and gallbladder cells). In certain embodiments, the target cells can be central nervous system cells. In certain embodiments, the target cells are one or more of excitatory neurons, inhibitory neurons, glial cells, cortical cells, prefrontal cortical cells, cerebral cortical cells, spinal cord cells. In certain embodiments, the target cells are peripheral nervous system (PNS) cells, such as retinal cells. Other cells other than cells derived from the nervous system can also be selected as target cells such as monocytes, B lymphocytes, T lymphocytes, NK cells, lymph node cells, tonsil cells, bone marrow mesenchymal cells, stem cells, bone marrow stem cells, heart cells, epithelial cells, esophageal cells, stomach cells, fetal cut cells, colon cells, rectal cells, liver cells, kind cells, lung cells, salivary gland cells, thyroid cells, adrenal cells, breast cells, pancreatic cells, islets of Langerhans, gallbladder cells, prostate cells, bladder cells, skin cells, uterine cells, cervical cells, testicular cells, or any other cells that express a functional hARSA protein in a subject without MLD. See genecards.org / cgi-bin / carddisp.pl?gene=ARSA&keywords=arsa#expression.

[0053] In certain embodiments, the regulatory sequence includes a ubiquitous promoter, such as the CB7 promoter. In certain embodiments, the regulatory element includes one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal.

[0054] In certain embodiments, as part of the expression control sequence (regulatory sequence), for example, additional or alternative promoter sequences located between the selected 5’ ITR sequence and the coding sequence may be included. Constitutive promoters, inducible promoters [see, for example, WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters that respond to physiological stimuli may be utilized in the vectors described herein. Promoters can be from different sources, such as the human cytomegalovirus (CMV) immediate early enhancer / promoter, the SV40 early enhancer / promoter, the JC polyomavirus promoter, the myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, the herpes simplex virus (HSV-1) latency-associated promoter (LAP), the Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, the neuron-specific promoter (NSE), the platelet-derived growth factor (PDGF) promoter, hSYN, the melanin-concentrating hormone (MCH) promoter, CBA, the matrix metalloprotein promoter (MPP), and the chicken β-actin promoter.

[0055] In addition to the promoter, the expression cassette may include one or more other suitable transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, such as WPRE, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, optionally, sequences that enhance the secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the regulatory sequence includes one or more expression enhancers. In one embodiment, the regulatory sequence contains two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include the CMV immediate early enhancer (SEQ ID NO: 19). This enhancer may be present in two copies located adjacent to each other. Alternatively, the double copies of the enhancer may be separated by one or more sequences. In yet another embodiment, the expression cassette further includes an intron, such as the chicken β-actin intron (SEQ ID NO: 17). In a particular embodiment, the intron is a chimeric intron (CI), a hybrid intron consisting of a human β-globin splice donor and an immunoglobulin G (IgG) splice acceptor element. Other suitable introns include those known in the art, for example, those described in WO 2011 / 126808. Examples of suitable polyA sequences include, for example, rabbit globin polyA, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be engineered upstream of the polyA sequence and downstream of the coding sequence (see, for example, MA Zanta-Boussif, et al, Gene Therapy (2009) 16:605-619). In a particular embodiment, the WPRE sequence is absent.

[0056] Optionally, in certain embodiments, in addition to the hARSA coding sequence, another non-AAV coding sequence, such as a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest may be included. Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNA (mRNA). miRNAs are typically naturally expressed as final non-translated RNA products of 19-25 nucleotides. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenous expressions miRNAs form hairpin precursors and are then processed into miRNA duplexes and further into "mature" single-stranded miRNA molecules. This mature miRNA induces a multi-protein complex miRISC that identifies target sites on target mRNAs, for example, within the 3′UTR region, based on complementarity to the mature miRNA.

[0057] In certain embodiments, the expression cassette may further comprise a dorsal root ganglion (drg)-specific miRNA detargetting sequence for modulating expression levels in the CNS or peripheral dorsal root ganglia. In certain embodiments, the expression cassette or vector genome comprises one or more miRNA target sequences in the untranslated region (UTR) 3' of the gene product coding sequence. In certain embodiments, there is at least one target sequence specific for miR-183, miR-182, or miR-96. In certain embodiments, at least two drg-specific miRNA target sequences are located both 5' and 3' of the hARSA coding sequence. In certain embodiments, at least the first miRNA target sequence and / or at least the second miRNA target sequence of the expression cassette mRNA or DNA plus strand is selected from: (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 20), (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 21), (iii) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 22), and (iv) AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 23). In certain embodiments, the construct further comprises at least two tandem repeats, comprising at least one first miRNA target sequence and at least one second miRNA target sequence, which may be the same or different. In certain embodiments, the tandem miRNA target sequences are contiguous or separated by a spacer of 1 to 10 nucleic acids, which is not a miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA target sequences located 3' of the hARSA coding sequence. In certain embodiments, the first start of at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3' end of the hARSA coding sequence. In certain embodiments, the first start of at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3' end of the hARSA coding sequence. In certain embodiments, the miRNA tandem repeats comprise from 200 to 1200 nucleotides in length.In certain embodiments, there are at least two drg-specific miRNA target sequences, which are located 5' to the hARSA coding sequence. In certain embodiments, two or more consecutive miRNA target sequences are contiguous and not separated by a spacer. In certain embodiments, two or more miRNA target sequences are separated by a spacer, and each spacer is independently selected from one or more of (A) GGAT, (B) CACGTG, or (C) GCATGC. In certain embodiments, a spacer located between miRNA target sequences can be located 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence. In certain embodiments, the spacers between miRNA target sequences are the same.

[0058] See U.S. Provisional Patent Application No. 62 / 783,956, filed December 21, 2018, and International Application No. PCT / US2019 / 067872, filed December 20, 2019 (which are incorporated herein by reference). In certain embodiments, the miR sequence is not included in the expression cassette or vector genome.

[0059] IV.AAVhu68 The AAVhu68 serotype selected as the capsid for AAVhu68.CB7.CI.hARSAco.RBG is 99% identical to AAV9 at the amino acid level. AAVhu68 exhibits transduction properties in the NHP and mouse nervous systems comparable to AAV9. This includes widespread transduction of cortical neurons (data not shown), and a small subset of myelin-producing oligodendrocytes. Further, AAVhu68 Transduce motor neurons that have axons projecting into the PNS and DRG sensory neurons, along with axons projecting into the spinal cord and peripheral nerves (data not shown). Transduction was observed in lower motor neurons of the ventral horn and sensory neurons of the DRG. The transduced motor neurons have axons that contribute to the peripheral nerves. Thus, the AAVhu68 capsid targets cells in both the CNS and PNS that are affected in MLD patients. Furthermore, newly synthesized ARSA can be transported directly from the trans-Golgi network to lysosomes, but it can also be secreted, taken up by other cells via the mannose-6-phosphate receptor, and then transported to lysosomes. Thus, the endogenous defect can be cross-corrected by the rAAVhu68.hARSA-expressed ARSA enzyme supplied to adjacent cells in the CNS that lack the functional enzyme.

[0060] Based on the numbering of SEQ ID NO: 7, AAVhu68 (formerly designated AAV3G2) differs from the virus AAV9 of another clade F by two encoded amino acids at positions 67 and 157 of vp1. In contrast, other AAVs of clade F (AAV9, hu31, hu31) have Ala at position 67 and Ala at position 157. Novel AAVhu68 capsids and / or engineered AAV capsids are provided that have valine (Val or V) at position 157 based on the numbering of SEQ ID NO: 7, and optionally, glutamate (Glu or E) at position 67 based on the numbering of SEQ ID NO: 7. In certain embodiments, the AAV capsid stereotype can be selected from AAVhu31 vp1 (SEQ ID NOs: 11 and 12) or AAVhu32 vp1 (SEQ ID NOs: 13 and 14).

[0061] As used herein, the term "clade" in relation to a group of AAVs refers to a group of AAVs that are phylogenetically related to each other and is determined using the Neighbor-Joining algorithm based on the alignment of the AAV vp1 amino acid sequences with a bootstrap value of at least 75% (out of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less. The Neighbor-Joining algorithm is described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequence of the AAV vp1 capsid protein, one of ordinary skill in the art can readily determine whether a selected AAV is included in one of the clades specified herein, in another clade, or outside of these clades. See, for example, G Gao, et al, J Virol 2004 Jun;78(10:6381-6388). This identifies clades A, B, C, D, E, and F and provides the nucleic acid sequences of novel AAVs (GenBank accession numbers AY530553 - AY530629). See also WO2005 / 033321.

[0062] In certain embodiments, the AAVhu68 capsid further features one or more of the following. The AAVhu68 capsid protein is the AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of positions 1 to 736 of SEQ ID NO: 7, the vp1 protein produced from SEQ ID NO: 6, or the vp1 protein produced from a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 6 encoding the predicted amino acid sequence of positions 1 to 736 of SEQ ID NO: 7; the AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least approximately amino acids 138 to 736 of SEQ ID NO: 7, the vp2 protein produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 6, or the vp2 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 6 encoding the predicted amino acid sequence of at least approximately amino acids 138 to 736 of SEQ ID NO: 7; and / or the AAVhu68 vp3 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 7, the vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 6, or the vp3 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 6 encoding the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 7. Including the vp3 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 6 encoding the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 7.

[0063] The AAVhu68 vp1, vp2, and vp3 proteins are typically expressed as alternative splicing variants encoded by the same nucleic acid sequence that encodes the full-length vp1 amino acid sequence (amino acids 1 - 736). Optionally, the vp1 coding sequence is used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence can be co-expressed with one or more of a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence (about aa203 - 736) that does not have the vp1 unique region (about aa1 - about aa137) and / or the vp2 unique region (about aa1 - about aa202), or the complementary strand thereof, the corresponding mRNA or tRNA (e.g., the mRNA transcribed from about nucleotide (nt) 607 - about nt2211 of SEQ ID NO: 6), or a sequence that is at least 70% - at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 6 encoding aa203 - 736 of SEQ ID NO: 7. Additionally, or alternatively, the vp1 coding sequence and / or the vp2 coding sequence can be co-expressed with a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence (about aa138 - 736) of SEQ ID NO: 7 that does not have the vp1 unique region (about aa1 - about 137), or the complementary strand thereof, the corresponding mRNA or tRNA (e.g., the mRNA transcribed from nt412 - 2211 of SEQ ID NO: 6), or a sequence that is at least 70% - at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 6 encoding about aa138 - 736 of SEQ ID NO: 7.

[0064] As described herein, rAAVhu68 has an rAAVhu68 capsid produced in a production system that expresses the capsid from an AAVhu68 nucleic acid sequence encoding the vp1 amino acid sequence of SEQ ID NO: 7 and optionally from additional nucleic acid sequences (e.g., a sequence encoding a vp3 protein that does not contain the vp1 and / or vp2 unique regions). rAAVhu68 obtained from production using a single nucleic acid sequence vp1 produces a heterogeneous population of vp1 protein, vp2 protein, and vp3 protein. More specifically, the AAVhu68 capsid contains subpopulations within the vp1 protein, within the vp2 protein, and within the vp3 protein, and has modifications from the predicted amino acid residues of SEQ ID NO: 7. These subpopulations contain at least deamidated asparagine (N or Asn) residues. For example, asparagine in an asparagine-glycine pair is highly deamidated.

[0065] In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 6 or the complementary strand thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 protein can be expressed from a nucleic acid sequence different from vp1, e.g., to vary the ratio of vp proteins in a selected expression system. In certain embodiments, the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 7 (about aa203 - 736) that does not have the vp1 unique region (about aa1 - about aa137) and / or the vp2 unique region (about aa1 - about aa202), or the complementary strand thereto, the corresponding mRNA or tRNA (about nt607 - about nt2211 of SEQ ID NO: 6) is also provided. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 7 (about aa138 - 736) that does not have the vp1 unique region (about aa1 - about aa137), or the complementary strand thereto, the corresponding mRNA or tRNA (nt412 - 2211 of SEQ ID NO: 6) is also provided.

[0066] However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 7 can be selected for use in the production of the rAAVhu68 capsid. In certain embodiments, the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 6, or a sequence that is at least 70% - 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 6 and encodes SEQ ID NO: 7. In certain embodiments, the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO: 6, or a sequence that is at least 70% - 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to nucleotides about nt412 to about nt2211 of SEQ ID NO: 6 and encodes the vp2 capsid protein of SEQ ID NO: 7 (about aa138 - 736). In certain embodiments, the nucleic acid sequence is the nucleic acid sequence of about nt607 to about nt2211 of SEQ ID NO: 6, or a sequence that is at least 70% - 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to nt607 - nt2211 of SEQ ID NO: 6 and encodes the vp3 capsid protein of SEQ ID NO: 7 (about aa203 - 736).

[0067] Designing a nucleic acid sequence encoding this AAVhu68 capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA), is within the knowledge of those skilled in the art. In certain embodiments, the nucleic acid sequence encoding the AAVhu68 vp1 capsid protein is provided in SEQ ID NO: 6. See, for example, WO2018 / 160582, which is incorporated herein by reference in its entirety. In certain embodiments, the AAVhu68 capsid is produced using at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% of the sequence encoding the vp1 amino acid sequence of SEQ ID NO: 7, including the nucleic acid sequence of SEQ ID NO: 6 or the modifications described herein (e.g., deamidated amino acids). In certain embodiments, the vp1 amino acid sequence is reproduced in SEQ ID NO: 7.

[0068] As used herein, when used to refer to a vp capsid protein, the term "heterologous" or any grammatical variation thereof refers to a population of elements that are not the same, having, for example, vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 7 provides the encoded amino acid sequence of the AAVhu68 vp1 protein. The term "heterologous" as used in connection with vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. The AAV capsid contains subpopulations within the vp1 protein, within the vp2 protein, and within the vp3 protein, having modifications from the predicted amino acid residues. These subpopulations contain at least certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation contains at least 1, 2, 3, or 4 highly deamidated asparagine (N) positions in an asparagine-glycine pair, optionally further containing other deamidated amino acids, and deamidation results in amino acid changes and other optional modifications.

[0069] As used herein, a "subpopulation" of vp proteins, unless otherwise specified, refers to a group of vp proteins having at least one defined common characteristic and consisting of fewer members than all members of the reference group from at least one group member.

[0070] For example, a "subpopulation" of vp1 protein, unless otherwise specified, assembled A At least one (1) vp1 protein in the AV capsid, which is less than all vp1 proteins. A "subpopulation" of vp3 proteins can be one (1) vp3 protein that is less than all vp3 proteins in the assembled AAV capsid, unless otherwise specified. For example, the vp1 protein can be a subpopulation of vp proteins, the vp2 protein can be a separate subpopulation of vp proteins, and vp3 can be a further subpopulation of vp proteins in the assembled AAV capsid. In another example, the vp1, vp2, and vp3 proteins can include subpopulations that differ, for example, by at least one, two, three, or four highly deamidated asparagines, such as asparagine-glycine pairs.

[0071] Unless otherwise specified, high-level deamidation refers to at least 45% deamidation, at least 50% deamidation, at least 60% deamidation, at least 65% deamidation, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidation at the reference amino acid position compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagine at amino acid 57 based on SEQ ID NO: 7 (AAVhu68) can be deamidated based on the total vp1 protein and can be deamidated based on the total vp1, vp2, and vp3 proteins). Such percentages can be determined using 2D gels, mass spectrometry techniques, or other suitable techniques.

[0072] While not intending to be bound by theory, deamidation of at least highly deamidated residues in the vp proteins of the AAV capsid is thought to be essentially non-enzymatic and is caused by functional groups within the capsid protein that deamidate the selected asparagine, and to a lesser extent by glutamine residues. Efficient capsid assembly of most deamidated vp1 proteins indicates that these events occur after capsid assembly or that deamidation in individual monomers (vp1, vp2, or vp3) is structurally well tolerated and mostly does not affect the assembly kinetics. In general, extensive deamidation in the VP1-unique (VP1-u) region (about aa1 - 137), which is generally thought to be located internally prior to cell entry, suggests that VP deamidation can occur prior to capsid assembly. Deamidation of N can occur by a nucleophilic attack on the carbon atom of the side chain amide group of Asn via the backbone nitrogen atom of its C-terminal residue. An intermediate cyclic closed succinimide residue is thought to be formed. The succinimide residue then undergoes rapid hydrolysis to yield the final products aspartic acid (Asp) or isoaspartic acid (IsoAsp). Thus, in certain embodiments, deamidation of asparagine (N or Asn) results in Asp or IsoAsp and can be interconverted via a succinimide intermediate, for example, as illustrated below.

Chem.

[0073] As provided herein, each deamidated N in VP1, VP2, or VP3 can independently be asparagine (Asp), isoasparagine (isoAsp), aspartate, and / or an interconverted blend of Asp and isoAsp, or combinations thereof. Any suitable ratio of α- and isoasparagine can be present. For example, in certain embodiments, the ratio can be an asparagine to isoasparagine of 10:1 to 1:10, about 50:50 asparagine:isoasparagine, or about 1:3 asparagine:isoasparagine, or another selected ratio.

[0074] In certain embodiments, one or more glutamines (Q) can be deamidated to glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a blend of α- and γ-glutamic acid, and can be interconverted via a common glutaryl imide intermediate. Any suitable ratio of α- and γ-glutamic acid can be present. For example, in certain embodiments, the ratio can be an α to γ of 10:1 to 1:10, about 50:50 α:γ, or about 1:3 α:γ, or another selected ratio.

Chemical formula

[0075] Thus, rAAV contains a subpopulation in the rAAV capsid of vp1, vp2, and / or vp3 proteins having deamidated amino acids, including at least one subpopulation containing at least one highly deamidated asparagine. In addition, other modifications can include isomerization at specifically selected aspartic acid (D or Asp) residue positions. In yet other embodiments, the modification can include amidation at the Asp position.

[0076] In certain embodiments, the AAV capsid comprises subpopulations of vp1, vp2, and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, at least 1 to 10% of which are deamidated compared to the encoded amino acid sequence of the vp protein. Most of these can be N residues. However, Q residues can be deamidated.

[0077] In certain embodiments, the rAAV has an AAV capsid having vp1, vp2 and vp3 proteins having subpopulations that include combinations of two, three, four or more deamidated residues at positions shown in the table provided in Example 11 and incorporated herein by reference. Deamidation of rAAV can be determined using 2D gel electrophoresis, and / or mass spectrometry (MS), and / or protein modeling techniques. Online chromatography Raffi can be performed on an Acclaim PepMap column coupled to a Q Exactive HF equipped with a NanoFlex source (Thermo Fisher Scientific) and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific). MS data is Q Acquired using the Exactive HF's data-dependent Top-20 method, dynamically select the most abundant yet unsequenced precursor ions from the survey scan (200 - 2000 m / z). Sequencing was performed via higher energy collisional dissociation fragmentation at a target value of 1e5 ions determined by predicted automatic gain control, and precursor isolation was performed in a 4 m / z window. Survey scans were acquired at a resolution of 120,000 at m / z 200. The resolution of the HCD spectra can be set to 30,000 at m / z 200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level can be set to 50 to optimize the transmission rate of the m / z region occupied by peptides from the digest. Precursor ions can be excluded if they are single, unassigned, or have more than six charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) can be used for the analysis of the acquired data. For peptide mapping, a single-entry protein FASTA database with carbamidomethylation set as a fixed modification, oxidation, deamidation, and phosphorylation set as variable modifications, a 10 ppm mass accuracy, high protease specificity, and a confidence level of 0.8 for the MS / MS spectra are used for the search. Examples of suitable proteases can include, for example, trypsin or chymotrypsin. Deamidation adds a mass of +0.984 Da (mass difference between -OH and -NH2 groups) to the intact molecule, so the mass spectrometric identification of deamidated peptides is relatively straightforward. The deamidation rate of a specific peptide is determined by dividing the mass area of the deamidated peptide by the sum of the areas of the deamidated and native peptides. Considering the number of possible deamidation sites, isotopic species deamidated at different sites can co-elute at a single peak. Therefore, fragment ions derived from peptides with multiple potential deamidation sites can be used to identify or distinguish multiple deamidation sites. In these cases, the relative intensities within the observed isotopic pattern can be used to specifically determine the relative abundances of different deamidated peptide isomers.This method assumes that the fragmentation efficiency is the same for all isomeric species and is independent at the deamidation site. It will be understood by those skilled in the art that several variations of these exemplary methods can be used. For example, suitable mass spectrometers include, for example, quadrupole time-of-flight mass spectrometers (QTOF) such as Waters Xevo or Agilent 6530, or Orbitrap Fusion or Orbitrap. It may include an Orbitrap device such as Velos (Thermo Fisher). Suitable liquid chromatography systems include, for example, Acquity manufactured by Waters UPLC system or Agilent system (1100 or 1200 series). Suitable data analysis software may include, for example, MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Further other techniques may be described, for example, in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255 - 267, published online on June 16, 2017.

[0078] In addition to deamidation, other modifications may occur, but one amino acid is not converted to a different amino acid residue. Such modifications may include acetylated residues, isomerization, phosphorylation, or oxidation.

[0079] Regulation of deamidation: In certain embodiments, AAV is modified to change the glycine of the asparagine - glycine pair to reduce deamidation. In other embodiments, asparagi It is changed to different amino acids, such as glutamine that deamidates at a slower rate, or amino acids lacking an amide group (e.g., glutamine and asparagine contain an amide group), and / or amino acids lacking an amine group (e.g., lysine, arginine, and histidine contain an amine group). As used herein, amino acids lacking an amide or amine side group refer to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and / or proline. Modifications as described can be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine-glycine pairs. Thus, the method for reducing the deamidation of AAV and / or engineered AAV variants has a lower deamidation rate. Additionally, or alternatively, one or more other amide amino acids can be changed to non-amide amino acids to reduce the deamidation of AAV. In certain embodiments, the mutant AAV capsid described herein contains a mutation in the arginine-glycine pair such that glycine is changed to alanine or serine. The mutant AAV capsid can contain one, two, or three mutations in which the reference AAV naturally contains four NG pairs. In certain embodiments, the AAV capsid can contain one, two, three, or four such mutations in which the reference AAV naturally contains five NG pairs. In certain embodiments, the mutant AAV capsid contains only a single mutation in the NG pair. In certain embodiments, the mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, the mutant AAV capsid has two different NG pairs containing mutations and is located at structurally distinct positions in the AAV capsid. In certain embodiments, the mutation is not in the VP1 unique region. In certain embodiments, one of the mutations is in the VP1 unique region. Optionally, the mutant AAV capsid does not contain a modification in the NG pair but contains a mutation to minimize or eliminate the deamidation of one or more asparagines or glutamines located outside the NG pair.

[0080] In the AAVhu68 capsid protein, four residues (N57, N329, N452, N512) routinely exhibit deamidation levels over 70% across various lots, and most often over 90%. Additional asparagine residues (N94, N253, N270, N304, N409, N477, and Q599) also exhibit deamidation levels up to approximately 20% across various lots. Deamidation levels were first identified using trypsin digestion and verified with chymotrypsin digestion.

[0081] The AAVhu68 capsid contains subpopulations within the vp1 protein, within the vp2 protein, and within the vp3 protein, and has modifications from the predicted amino acid residues of SEQ ID NO: 7. These subpopulations contain at least certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation contains at least one, two, three, or four highly deamidated asparagine (N) positions in the asparagine-glycine pairs of SEQ ID NO: 7, optionally further containing other deamidated amino acids, and deamidation results in amino acid changes and other optional modifications. SEQ ID NO: 8 provides the amino acid sequence of a modified AAVhu68 capsid and illustrates positions that may have a percentage of deamidated amino acids or otherwise modified amino acids. Various combinations of these and other modifications are described herein.

[0082] As used herein, "AAV9 capsid" is a self-assembling AAV capsid consisting of multiple AAV9 vp proteins. The AAV9 vp proteins are typically expressed as alternative splice variants encoded by the nucleic acid sequence of SEQ ID NO: 9, or a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical thereto, and encode the vp1 amino acid sequence of GenBank accession number AAS99264. In certain embodiments, "AAV9 capsid" is 99% identical to AAS99264, or the sequence It includes AAV having an amino acid sequence that is 10 to 99% identical. Also, see US7906111 and WO2005 / 033321. As used herein, "AAV9 variant" includes, for example, the variants described in WO2016 / 049230, US8,927,514, US2015 / 0344911, and US8,734,809.

[0083] Capsids, methods for generating their coding sequences, and methods for the production of rAAV viral vectors are described. For example, see Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100(10), 6081-6086(2003) and US 2013 / 0045186A1.

[0084] The terms "substantially homologous" or "substantially similar", when referring to a nucleic acid or a fragment thereof, have nucleotide sequence identity in at least about 95-99% of the aligned sequences when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions. Preferably, the homology is over the full-length sequence, or its open reading frame, or another suitable fragment that is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0085] In the context of nucleic acid sequences, the terms "sequence identity", "percent sequence identity", or "percent identical" refer to residues in two sequences that are the same when aligned to maximize correspondence. The length over which the sequence identity comparison is made can span the full length of the genome, the full length of the gene coding sequence, or, preferably, a fragment of at least about 500 - 5000 nucleotides. However, for example, identity between smaller fragments of at least about 9 nucleotides, usually at least about 20 - 24 nucleotides, at least about 28 - 32 nucleotides, or at least about 36 or more nucleotides may also be desired. Similarly, "percent sequence identity" can be readily determined for the full-length amino acid sequence of a protein or a fragment thereof. Preferably, the fragment is at least about 8 amino acids in length and can be up to about 700 amino acids in length. Examples of preferred fragments are described herein.

[0086] The terms "substantially homologous" or "substantially similar", when referring to an amino acid or a fragment thereof, mean that there is amino acid sequence identity in at least about 95 - 99% of the aligned sequences when optimally aligned with another amino acid (or its complementary strand) with appropriate amino acid insertions or deletions. Preferably, the homology is over the full-length sequence, or a protein thereof, such as the cap protein, rep protein, or a fragment of at least 8 amino acids in length, or more preferably, at least 15 amino acids in length. Examples of preferred fragments are described herein.

[0087] The term "highly conserved" means at least 80% identity, preferably at least 90% identity, more preferably greater than 97% identity. Identity is readily determined by one of ordinary skill in the art using algorithms and computer programs known to those of ordinary skill in the art.

[0088] Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, "identity", "homology", or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to multiple nucleic acid sequences or protein (amino acid) sequences and, when compared to a reference sequence, often includes corrections for missing or additional bases or amino acids. In the examples, the published AAV9 sequence is used as a reference point for AAV alignment. Alignment is performed using any of a variety of publicly available or commercially available multiple sequence alignment programs. Examples of such programs include "Clustal Omega", which is accessible through a web server on the Internet, "C Examples include "Lustal W", "CAP Sequence Assembly", "MAP", and "MEME". Other sources of such programs are known to those skilled in the art. Alternatively, Vector NTI utilities may also be used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those incorporated in the programs described above. As another example, polynucleotide sequences can be compared using the program Fasta™, which is part of the GCG version 6.1. Fasta™ provides the alignment of the best overlapping regions and percent sequence identity between a query sequence and a search sequence. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (word size 6 and NOPAM factor for the scoring matrix) as provided in GCG version 6.1 (incorporated herein by reference). Multiple sequence alignment programs such as "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and the "Match-Box" program are also available for amino acid sequences. Generally, any of these programs are used with their default settings, but those skilled in the art can change these settings if necessary. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the same level of identity or alignment as that provided by the reference algorithms and programs. See, for example, J.D. Thomson et al, Nucl. Acids Res., "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).

[0089] V.rAAV Provided herein are therapeutic, recombinant, and replication-deficient adeno-associated viruses (rAAVs) that are useful for treating subjects in need of treatment for a disease associated with a mutation in the arylsulfatase A gene (ARSA) or a disease caused by a deficiency in normal levels of functional arylsulfatase A (e.g., metachromatic leukodystrophy (MLD)). The rAAV is preferably replication-deficient and has a vector genome that includes inverted terminal repeats (ITRs) and a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) under the control of regulatory sequences, the regulatory sequences directing the expression of hARSA in target cells. In certain embodiments, the hARSA coding sequence includes the sequence of nucleotides (nt) 55 to nt 1521 of SEQ ID NO: 1, which encodes functional hARSA, or a sequence that is at least 95% to 99.9% identical thereto. In certain embodiments, the vector genome includes inverted terminal repeats (ITRs) and an expression cassette as described in Part III. In further embodiments, the rAAV includes an AAV capsid.

[0090] The AAV capsid can be selected based on the target cell. In certain embodiments, the AAV capsid is suitable for delivery of the vector genome in the nervous system (e.g., CNS or PNS). In certain embodiments, the AAV capsid is suitable for delivery of the vector genome in neurons, nervous system cells, oligodendrocytes, microglia, central nervous system (CNS) cells, CNS neurons, peripheral nervous system (PNS) cells, Schwann cells, PNS macrophages, or cells of visceral organs (e.g., kidney cells, liver cells, and gallbladder cells). In certain embodiments, the AAV capsid is suitable for delivery of the vector genome in another target cell described herein.

[0091] In certain embodiments, the AAV capsid is a cy02 capsid, rh43 capsid, AAV8 capsid, rh01 capsid, AAV9 capsid, rh8 capsid, rh10 capsid, bb01 capsid, hu37 capsid, rh02 capsid, rh20 capsid, rh It is selected from 39 capsid, rh64 capsid, AAV6 capsid, AAV1 capsid, hu44 capsid, hu48 capsid, cy05 capsid, hu11 capsid, hu32 capsid, pi2 capsid, or variants thereof. In certain embodiments, the AAV capsid is a capsid of clade F such as AAV9 capsid, AAVhu68 capsid, AAV-PHP.B capsid, hu31 capsid, hu32 capsid, or variants thereof. See, for example, WO2005 / 033321, WO2018 / 160582, and US2015 / 0079038, published on April 14, 2015 (each of which is incorporated herein by reference in its entirety). In certain embodiments, the AAV capsid is a capsid that is not of clade F, for example, a capsid of clade A, B, C, D, or E. In certain embodiments, the capsid that is not of clade F is AAV1 or a variant thereof. In certain embodiments, the AAV capsid transduces target cells other than nervous system cells. In certain embodiments, the AAV capsid is a capsid of clade A (e.g., AAV1, AAV6), a capsid of clade B (e.g., AAV2), a capsid of clade C (e.g., hu53), a capsid of clade D (e.g., AAV7), or a capsid of clade E (e.g., rh10). Nevertheless, other AAV capsids may be selected.

[0092] In certain embodiments, the rAAV comprises an AAVhu68 capsid in which the vector genome is packaged. In certain embodiments, the AAVhu68 capsid is produced from a sequence encoding the predicted amino acid sequence of SEQ ID NO: 7.

[0093] For more details, see Part V. In certain embodiments, the vector genome does not contain the AAVhu68 genomic sequence and is completely exogenous to the AAVhu68 capsid.

[0094] Functional hARSA is described in Part I. In certain embodiments, functional hARSA has a signal peptide and the sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2. In certain embodiments, the native hARSA signal peptide, e.g., aa1 to aa18 of SEQ ID NO: 2 is used. In certain embodiments, the signal peptide has the amino acid sequence of aa1 to aa20 of SEQ ID NO: 4. In certain embodiments, functional hARSA has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

[0095] In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to nucleotides (nt) 55 to nt1521 of SEQ ID NO: 1. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. In further embodiments, the hARSA coding sequence encodes the sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2. In still further embodiments, the hARSA coding sequence encodes the sequence of SEQ ID NO: 2 or SEQ ID NO: 4. See Part I for more details regarding the hARSA coding sequence.

[0096] In certain embodiments, the regulatory sequence directs the expression of hARSA in nervous system cells. In certain embodiments, the regulatory sequence comprises a ubiquitous promoter, such as the CB7 promoter. In further embodiments, the regulatory element comprises one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal. In certain embodiments, the regulatory sequence comprises a regulatory element derived from the chicken β-actin (BA) promoter and the human cytomegalovirus immediate early enhancer (CMV IE) (e.g., the CB7 promoter which is nt198 to nt862 of SEQ ID NO: 5), a chimeric intron consisting of a chicken BA splice donor and a rabbit β-globin (rBG) splice acceptor element (e.g., the CI which is nt956 to nt1928 of SEQ ID NO: 5), and a polyadenylation (polyA) signal derived from the rBG gene (e.g., the rBG which is nt3539 to nt3665 of SEQ ID NO: 5). In certain embodiments, the vector genome has the sequence of nucleotides (nt) 1 to nt388 of SEQ ID NO: 5 having the sequence of 3. See Part III for more details.

[0097] In certain embodiments, an rAAV or a composition comprising rAAV can be administered to a subject in need thereof to improve the symptoms of a disease associated with an ARSA mutation or a disease caused by a deficiency in functional arylsulfatase A at normal levels (e.g., MLD) and / or to delay the progression of a disease associated with an ARSA mutation or a disease caused by a deficiency in functional arylsulfatase A at normal levels (e.g., MLD). See Part II for more details.

[0098] In certain embodiments, the rAAV described herein is suitable for administration to a patient via intracerebroventricular injection (ICM), including via posterior suboccipital injection under CT guidance into the cerebral ventricle. In certain embodiments, the rAAV described herein is suitable for administration to a subject 7 years of age or younger. In certain embodiments, the rAAV described herein is suitable for administration to those subjects in need thereof to improve the symptoms of metachromatic leukodystrophy or a disease associated with an arylsulfatase A (ARSA) gene mutation and / or to delay the progression of a disease associated with metachromatic leukodystrophy or an arylsulfatase A (ARSA) gene mutation. For more details, see Sections II and VIII. In certain embodiments, the rAAV described herein is administered to a subject in a single dose.

[0099] In certain embodiments, the vector genome is a single-stranded AAV vector genome. In certain embodiments, an rAAV vector containing a self-complementary (sc) AAV vector genome can be utilized in the present invention.

[0100] The necessary regulatory control elements are operably linked to a gene (e.g., the hARSA coding sequence) in a manner that enables its transcription, translation, and / or expression in the cells that take up the rAAV. As used herein, "operably linked" sequences include both expression control sequences adjacent to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Such regulatory sequences typically include one or more of, for example, a promoter, enhancer, intron, polyA, self-cleaving linker (e.g., Furin, Furin-F2A, IRES). The following examples utilize the CB7 promoter for the expression of hARSA. However, in certain embodiments, other promoters, or additional promoters, may be selected. In certain embodiments, as part of the expression control sequence (regulatory sequence), for example, additional or alternative promoter sequences may be included that are located between the selected 5’ ITR sequence and the coding sequence. Constitutive promoters, regulatable promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters that respond to physiological stimuli may be utilized in the vectors described herein. The promoter may be selected from different sources, such as the human cytomegalovirus (CMV) immediate early enhancer / promoter, SV40 early enhancer / promoter, JC polyomavirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latency-associated promoter (LAP), Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and chicken β-actin promoter.In addition to the promoter, the vector may include one or more other suitable transcription initiation sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, such as WPRE, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability. Sequences to do so, and optionally, sequences that enhance the secretion of the encoded product. Examples of suitable enhancers are CMV enhancers. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the regulatory sequence includes one or more expression enhancers. In one embodiment, the regulatory sequence contains two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include the CMV early enhancer (SEQ ID NO: 19). This enhancer may be present in two copies located adjacent to each other. Alternatively, the double copy of the enhancer may be separated by one or more sequences. In yet another embodiment, the expression cassette further includes an intron, such as the chicken β-actin intron (SEQ ID NO: 17). In a particular embodiment, the intron is a chimeric intron (CI), a hybrid intron consisting of a human β-globin splice donor and an immunoglobulin G (IgG) splice acceptor element. Other suitable introns include those known in the art, for example, those described in WO 2011 / 126808. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be engineered upstream of the polyA sequence and downstream of the coding sequence (see, for example, MA Zanta-Boussif, et al, Gene Therapy (2009) 16:605-619). In a particular embodiment, the WPRE sequence is absent.

[0101] In certain embodiments, in addition to the hARSA coding sequence, another non-AAV coding sequence, such as a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest may be included. Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNA (mRNA). miRNAs are typically naturally expressed as final 19 - 25 non-translated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA duplexes and further into "mature" single-stranded miRNA molecules. This mature miRNA induces the multi-protein complex miRISC, which identifies the target site of the target mRNA within, for example, the 3′UTR region, based on complementarity to the mature miRNA.

[0102] The AAV sequences of the vectors typically include cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, e.g., B.J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequences are about 145 base pairs (bp) in length. Preferably, the entire sequence substantially encoding the ITRs is used within the molecule, although some minor modifications of these sequences are tolerated. The ability to modify these ITR sequences is within the scope of the art (see, e.g., Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such a molecule utilized in the present invention is a "cis-acting" plasmid that contains a transgene in which the selected transgene sequence and associated regulatory elements are flanked by 5' and 3' AAV ITR sequences. In one embodiment, the ITRs are from AAV that is different from that which supplies the capsid. In one embodiment, the ITR sequences are from AAV2. A shortened version of the 5' ITR, designated ΔITR, in which the D sequence and the terminal resolution site (trs) are deleted, has been described. In other embodiments , the full-length AAV 5' and 3' ITRs are used. However, ITRs from other AAV origins may be selected. If the origin of the ITR is from AAV2 and the AAV capsid is from another AAV origin, the resulting vector may be referred to as pseudotyped. However, other configurations of these elements may also be suitable.

[0103] In certain embodiments, a vector genome comprising a 5’ AAV ITR - promoter - optional enhancer - optional intron - hARSA or hARSAco coding sequence - polyA - 3’ ITR, referred to as AAV.promoter.optional enhancer.optional intron.hARSA or hARSAco.polyA, is constructed. In certain embodiments, the ITR is derived from AAV2. In certain embodiments, there are two or more promoters. In certain embodiments, the enhancer is present in the vector genome. In certain embodiments, there are two or more enhancers. In certain embodiments, the intron is present in the vector genome. In certain embodiments, both an enhancer and an intron are present. In certain embodiments, the intron is a chimeric intron (CI), a hybrid intron consisting of a human β - globin splice donor and an immunoglobulin G (IgG) splice acceptor element. In certain embodiments, the polyA is SV40 polyA (i.e., a polyadenylation (polyA) signal derived from the simian virus 40 (SV40) late gene). In certain embodiments, the polyA is rabbit β - globin (RBG) polyA. In certain embodiments, the vector genome comprises a 5’ AAV ITR - CB7 promoter - hARSA coding sequence - polyA - 3’ ITR.

[0104] As used herein, a vector genome or rAAV comprising the vector genome is exemplified herein as AAV.promoter (optional).Kozak (optional).intron (optional).hARSA coding sequence (e.g., hARSA, hARSAco).miRNA (optional).polyA (optional).Stuffer (optional). In certain embodiments, the rAAV is exemplified herein as AAV capsid.promoter (optional).Kozak (optional).intron (optional).hARSA coding sequence.miRNA (optional).polyA (optional).Stuffer (optional).

[0105] In another aspect, a production system useful for producing rAAV is provided. In this system, a cell containing a nucleic acid sequence encoding an AAVhu68 capsid protein, a vector genome described herein, and sufficient AAV rep functions and helper functions to enable packaging of the vector genome into an AAV capsid was cultured. In certain embodiments, the vector genome has the sequence of nt1 to nt3883 of SEQ ID NO: 5. In certain embodiments, the cell culture is a human embryonic kidney 293 cell culture. In certain embodiments, the AAV rep is from an AAV different from AAVhu68, for example, derived from AAV2. In certain embodiments, the AAV rep coding sequence and the cap gene are on the same nucleic acid molecule and optionally, a spacer is present between the rep sequence and the cap gene. In a further embodiment, the spacer is atgacttaaaccaggt (SEQ ID NO: 24).

[0106] For use in the production of AAV viral vectors (e.g., recombinant (r)AAV), the vector genome can be carried on any suitable vector, e.g., a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered, inter alia, to be suitable for in vitro replication and packaging in prokaryotic, insect, and mammalian cells. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one of ordinary skill in the art. Exemplary production processes are provided in FIGS. 6-7. In certain embodiments, the plasmid has the sequence of SEQ ID NO: 5.

[0107] Methods for generating and isolating AAV suitable for use as a vector are known in the art. Generally, see, for example, Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J. Gene Med. 10:717-733, and the references cited below (each of which is incorporated herein by reference in its entirety). For packaging a gene into a virion, the ITR is the only AAV component that is required in cis in the same construct as the nucleic acid molecule containing the gene. The cap and rep genes can be supplied in trans.

[0108] In one embodiment, the selected gene element can be delivered to the AAV packaging cell by any suitable method including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA coating pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be produced. The methods used to create such constructs are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0109] The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid that lacks the desired genomic sequence packaged therein. These may be referred to as "empty" capsids. Such capsids may not contain a detectable genomic sequence of the expression cassette or may contain only a partially packaged genomic sequence that is insufficient to achieve expression of the gene product. These empty capsids are non-functional for introducing the gene of interest into host cells.

[0110] The recombinant adeno-associated virus (AAV) described herein may be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, US7588772B2. Such methods include culturing a host cell containing a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, an expression cassette consisting of at least an AAV inverted terminal repeat (ITR) and a transgene, and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein. Methods for producing capsids, the coding sequences therefor, and methods for producing rAAV viral vectors are described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100(10), 6081-6086 (2003) and US2013 / 0045186A1.

[0111] In one embodiment, a production cell culture useful for producing recombinant AAVhu68 is provided. Such cell cultures include a nucleic acid that expresses an AAVhu68 capsid protein in a host cell, a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, e.g., a vector genome containing an AAV ITR, and a non-AAV nucleic acid sequence encoding a gene operably linked to regulatory sequences that direct expression of the gene in the host cell, and sufficient AAV rep functions and adenovirus helper functions to permit packaging of the vector genome into the recombinant AAVhu68 capsid. In one embodiment, the cell culture It is composed of mammalian cells (e.g., especially human embryonic kidney 293 cells) or insect cells (e.g., Spodoptera frugiperda (Sf9) cells). In certain embodiments, the baculovirus provides the helper functions necessary to package the vector genome into the recombinant AAVhu68 capsid.

[0112] Optionally, the rep function is provided by an AAV other than AAVhu68. In certain embodiments, at least a portion of the rep function is derived from AAVhu68. In another embodiment, the rep protein is a heterologous rep protein other than AAVhu68rep, e.g., but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein, AAV8 rep protein, or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52, or fragments thereof, or from another source. Any of these AAVhu68 or mutant AAV capsid sequences can be under the control of exogenous regulatory control sequences that direct their expression in the host cell.

[0113] In one embodiment, the cells are produced in a suitable cell culture (e.g., HEK293 or Sf9) or suspension. The methods for producing the gene therapy vectors described herein include methods well known in the art, such as the production of plasmid DNA used for the production of gene therapy vectors, the production of vectors, and the purification of vectors. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmids are an AAV cis-plasmid encoding the AAV vector genome and the gene of interest, an AAV trans-plasmid containing the AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process may include steps of methods such as the initiation of cell culture, the passage of cells, the seeding of cells, the transfection of cells with plasmid DNA, the medium exchange to a serum-free medium after transfection, and the recovery of cells and culture medium containing the vector. The recovered vector-containing cells and culture medium are referred to herein as the crude cell harvest. In yet another system, the gene therapy vector is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, generally, for example, see Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20:922-929, the content of each of which is incorporated herein by reference in its entirety. The methods of manufacture and use of these and other AAV production systems are also described in the following U.S. patents, the content of each of which is incorporated herein by reference in its entirety: 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0114] The crude cell harvest can then be subjected to process steps such as concentration of the vector harvest, diafiltration of the vector harvest, micro-solubilization of the vector harvest, nuclease digestion of the vector harvest, filtration of the micro-solubilized intermediate, rough purification by chromatography, rough purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare the bulk vector.

[0115] Purify the vector formulation and remove empty capsids using two-step affinity chromatography purification at high salt concentration, followed by anion exchange resin chromatography. These methods are described in more detail in WO2017 / 160360, filed December 9, 2016, International Patent Application No. PCT / US2016 / 065970, and its priority documents, U.S. Patent Application No. 62 / 322,071, filed April 13, 2016, and U.S. Patent Application No. 62 / 226,357, entitled "Scalable Purification Method for AAV9", filed December 11, 2015, which are incorporated herein by reference. For calculating the empty and full particle content, the VP3 band volume for a selected sample (e.g., in the examples herein, an iodixanol gradient-purified preparation, where (GC) = number of particles) is plotted against the loaded GC particles. The obtained linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test substance peak. Then multiply the number of particles per 20 μL loaded (pt) by 50 to obtain particles (pt) / mL. Divide pt / mL by GC / mL to obtain the ratio of particles to genomic copies (pt / GC). Pt / mL~GC / mL gives the empty pt / mL. Divide the empty pt / mL by pt / mL and then multiply by 100 to obtain the percentage of empty particles.

[0116]

[0117] ​Methods for assaying AAV vector particles that generally contain empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330, Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method subjects the treated AAV stock to SDS-polyacrylamide gel electrophoresis consisting of any gel capable of separating the three capsid proteins (e.g., a gradient gel containing 3-8% Tris-acetate in buffer), then runs the gel until the sample material separates, and includes blotting the gel onto a nylon or nitrocellulose membrane (preferably nylon). The anti-AAV capsid antibody is then used as the primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used that includes means for detecting the binding to the primary antibody, preferably an anti-IgG antibody containing a detection molecule covalently bound to the antibody, most preferably a goat anti-mouse IgG antibody covalently bound to horseradish peroxidase. A method for detecting the binding is used to semi-quantitatively determine the binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emission, electromagnetic radiation, or a color change, most preferably a chemiluminescence detection kit is used. For example, in SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and the capsid proteins are resolved in a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, namely SYPRO Ruby or Coomassie staining, may also be performed.In one embodiment, the concentration of AAV vector genome (vg) in a column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is further diluted and amplified using primers and a TaqMan™ fluorescent generating probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. A standard curve in the Q-PCR reaction is generated using plasmid DNA containing the same sequence as that contained in the AAV vector. The cycle threshold (Ct) value obtained from the sample is normalized against the Ct value of the plasmid standard curve. Thereby, the vector genome titer is determined. Digital PCR-based endpoint assays can also be used.

[0118] In one aspect, an optimized q-PCR method is used that utilizes a broad-spectrum serum protease, such as Proteinase K (commercially available from Qiagen, etc.). More specifically, the optimized qPCR genomic titer assay is similar to a standard assay except that after DNaseI digestion, the sample is diluted with Proteinase K buffer, treated with Proteinase K, and subsequently heat inactivated. Preferably, the sample is diluted with an amount of Proteinase K buffer equal to the sample size. The Proteinase K buffer may be concentrated more than 2-fold. Typically, the Proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55 °C for about 15 minutes, but may be carried out at a lower temperature (e.g., about 37 °C to about 50 °C) for a longer time (e.g., about 20 minutes to about 30 minutes), or at a higher temperature (e.g., up to about 60 °C) for a shorter time (e.g., about 5 - 10 minutes). Similarly, the heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 - about 90 °C) and the time may be extended (e.g., about 20 minutes to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.

[0119] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for measuring single-stranded and self-complementary AAV vector genomic titers by ddPCR have been described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2):115 - 25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0120] Briefly, a method for separating rAAVhu68 particles having a packaged genomic sequence from a genomic-deficient AAVhu68 intermediate involves subjecting a suspension comprising recombinant AAVhu68 virus particles and AAVhu68 capsid intermediates to high performance liquid chromatography, wherein the AAVhu68 virus particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at a pH of about 10.2 and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 nanometers (nm) and about 280 nm. Although not optimal for rAAVhu68, the pH can be in the range of about 10.0 - 10.4. In this method, AAVhu68 full capsids are recovered from the fraction that elutes when the ratio of A260 / A280 reaches an inflection point. In one embodiment, for the affinity chromatography step, the diafiltered product may be applied to Capture Select™ Poros-AAV2 / 9 affinity resin (Life Technologies) that efficiently captures the AAV2 / hu68 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and protein flows through the column and the AAV particles are efficiently captured.

[0121] rAAV.hARSA is suspended in a suitable physiologically compatible composition (e.g., buffered saline). This composition is frozen for storage and later thawed and optionally diluted with a suitable diluent. Alternatively, the vector can be prepared as a composition suitable for delivery to a patient without proceeding through the freezing and thawing steps.

[0122] As used herein, the term "NAb titer" is a measure of how much neutralizing antibody (e.g., anti-AAV Nab) that neutralizes the physiological effect of its targeted epitope (e.g., AAV) is produced. The anti-AAV NAb titer is, for example, as described in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associat Measured as described in ed Viruses. Journal of Infectious Diseases, 2009. 199(3): p. 381 - 390, which is incorporated herein by reference.

[0123] The abbreviation "sc" refers to self - complementary. "Self - complementary AAV" refers to a construct in which the coding region carried by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double - stranded DNA template. Upon infection, rather than waiting for cell - mediated synthesis of the second strand, the two complementary halves of scAAV associate to form one double - stranded DNA (dsDNA) unit capable of immediate replication and transcription. See, for example, D M McCarty et al, “Self - complementary recombinant adeno - associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248 - 1254. Self - complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0124] "Replication-deficient virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged within a viral capsid or envelope, and any viral genomic sequences packaged within the viral capsid or envelope are also replication-deficient, i.e., they are unable to produce progeny virions but can retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless" containing only the gene of interest adjacent to signals required for artificial genomic amplification and packaging), and these genes can be supplied during production. Thus, it is considered safe for use in gene therapy because replication and infection by progeny virions can only occur in the presence of viral enzymes required for replication.

[0125] Often, rAAV particles are referred to as being DNase resistant. However, in addition to this endonuclease (DNase), other endonucleases and exonucleases can be used in the purification steps described herein to remove contaminating nucleic acids. Such nucleases can be selected to degrade single-stranded DNA and / or double-stranded DNA, and RNA. Such steps can include a single nuclease, or a mixture of nucleases directed at different targets, and can be endonucleases or exonucleases.

[0126] The term "nuclease resistant" indicates that the AAV capsid is fully constructed around an expression cassette designed to deliver a gene to a host cell and protects these packaged genomic sequences from degradation (digestion) during a nuclease incubation step designed to remove contaminating nucleic acids that may be present from the production process.

[0127] VI. Other Vectors In one aspect, provided herein are vectors useful for treating subjects in need of treatment for a disease associated with an ARSA mutation or a disease caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD). The vector has a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) under the control of regulatory sequences that direct the expression of hARSA in target cells. In certain embodiments, the hARSA coding sequence is about 95% to 100% identical to SEQ ID NO: 1. Additionally or alternatively, the functional hARSA protein has the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1. In certain embodiments, the vector or a composition comprising the vector is for improving the symptoms of a disease associated with an ARSA mutation or a disease caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD), and / or for delaying the progression of a disease associated with an ARSA mutation or a disease caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD), and is administrable to a subject in need thereof.

[0128] In certain embodiments, the vector comprises an expression cassette. In certain embodiments, the expression cassette comprises a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) under the control of regulatory sequences that direct the expression of hARSA. In certain embodiments, the functional hARSA protein comprises a signal peptide and the amino acid sequence of amino acids (aa) 19 to aa507 of SEQ ID NO: 2. In certain embodiments, the signal peptide has the amino acid sequence of aa1 to aa18 of SEQ ID NO: 2, or the amino acid sequence of aa1 to aa20 of SEQ ID NO: 4. In certain embodiments, the hARSA coding sequence has the sequence of nucleotides (nt) 55 to nt1521 of SEQ ID NO: 1, which encodes functional hARSA, or a sequence that is at least 95% to 99.9% identical thereto. In certain embodiments, the hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3. For more details, see Sections I and III.

[0129] In certain embodiments, the vector is a viral vector selected from recombinant parvovirus, recombinant lentivirus, recombinant retrovirus, or recombinant adenovirus, or a non-viral vector selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based formulations. The selected vector can be delivered by any suitable method including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection, and protoplast fusion. The methods used to make such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0130] In certain embodiments, the vector is suitable for administration to a patient via intracisternal injection (ICM), including via posterior suboccipital injection under CT guidance into the cisterna magna. In certain embodiments, the vector is suitable for administration to a subject less than 7 years of age. In certain embodiments, the vector is suitable for administration to subjects in need thereof to ameliorate the symptoms of a disease associated with metachromatic leukodystrophy or an arylsulfatase A (ARSA) gene mutation and / or to delay the progression of a disease associated with metachromatic leukodystrophy or an arylsulfatase A (ARSA) gene mutation. In certain embodiments, the vector is administered as a single dose. For more details, see Sections II and VIII.

[0131] "Replication-deficient virus" or "viral vector" refers to a synthetic or artificial viral particle, where an expression cassette containing a gene of interest (e.g., the hARSA coding sequence) is packaged within a viral capsid or envelope, and any viral genomic sequences packaged within the viral capsid or envelope are also replication-deficient, i.e., they are unable to produce progeny virions but can retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless" containing only the transgene of interest flanked by signals required for artificial genomic amplification and packaging), and these genes can be supplied during production. Thus, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication. Such replication-deficient viruses can be adeno-associated virus (AAV), adenovirus, lentivirus (integrating or non-integrating), or another suitable viral source. Although it does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless" containing only the transgene of interest flanked by signals required for artificial genomic amplification and packaging), these genes can be supplied during production. Thus, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication. Such replication-deficient viruses can be adeno-associated virus (AAV), adenovirus, lentivirus (integrating or non-integrating), or another suitable viral source.

[0132] VII. Compositions In a further aspect, compositions are provided herein that comprise an rAAV or vector described herein and an aqueous suspension medium. In certain embodiments, an aqueous composition is provided that comprises a formulation buffer and the rAAV or vector described. In certain embodiments, the formulation buffer comprises a buffered saline and an artificial cerebrospinal fluid containing one or more of sodium, calcium, magnesium, potassium, or mixtures thereof, and a surfactant. In certain embodiments, the formulation buffer comprises from about 0.0005% to about 0.001% surfactant. In certain embodiments, the composition has a pH of 7.2 to 7.8. In certain embodiments, the AAV.CB7.CI.hARSAco.rBG formulation consists of the non-replicating recombinant adeno-associated virus (rAAV) vector described herein and a formulation buffer.

[0133] In certain embodiments, there is provided an aqueous pharmaceutical composition comprising the rAAV according to any one of claims 1 to 10 and a formulation buffer. In certain embodiments, the formulation buffer comprises buffered saline and artificial cerebrospinal fluid containing one or more of sodium, calcium, magnesium, potassium, or mixtures thereof, and a surfactant. In certain embodiments, the surfactant is present at 0.0005% to about 0.001% of the pharmaceutical composition. In certain embodiments, the composition has a pH in the range of 7.5 to 7.8. In certain embodiments, the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration.

[0134] In certain embodiments, there is provided a pharmaceutical composition comprising the described vector and a formulation buffer. In certain embodiments, the formulation buffer is suitable for intravenous delivery, intrathecal administration, or intracerebroventricular administration.

[0135] In certain embodiments, the composition is suitable for administration to a patient via intracisternal injection (ICM), including via suboccipital injection under CT guidance into the cisterna magna. In certain embodiments, the composition is suitable for administration to subjects 7 years of age or younger. In certain embodiments, the composition is suitable for administration to subjects in need thereof to improve the symptoms of metachromatic leukodystrophy or a disease associated with an arylsulfatase A (ARSA) gene mutation and / or to delay the progression of metachromatic leukodystrophy or a disease associated with an arylsulfatase A (ARSA) gene mutation. In certain embodiments, the composition is administered as a single dose. In certain embodiments, the composition has at least 2.50×10 per mL 13 has GCrAAV.

[0136] Provided herein are compositions comprising at least one rAAV stock (e.g., an rAAVhu68 stock or a mutant rAAVhu68 stock) and optionally a carrier, excipient, and / or preservative. An rAAV stock refers to a plurality of rAAV vectors that are the same and are, for example, in the amounts described below in consideration of concentration and dosage units.

[0137] As used herein, "carrier" includes any solvent, dispersion medium, vehicle, coating, diluent, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffer solutions, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The term "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivery vector genome can be formulated for delivery encapsulated in any of lipid particles, liposomes, vesicles, nanospheres, or nanoparticles. In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be transported as a concentrate that is diluted for administration to the subject. In other embodiments, the composition can be lyophilized and reconstituted at the time of administration.

[0138]

[0139] ​A suitable surfactant or combination of surfactants may be selected from non-toxic non-ionic surfactants. In one embodiment, for example, a difunctional block copolymer surfactant such as Pluronic® F68 [BASF], also known as poloxamer 188, which has a neutral pH and an average molecular weight of 8400 and has primary hydroxyl groups at its ends, is selected. Other surfactants and other poloxamers, i.e., non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (glyceryl polyoxycaprylate), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol may be selected. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using three-digit numbers following the letter "P" (for poloxamers), where the first two digits × 100 gives the approximate molecular mass of the polyoxypropylene core and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. In one embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (w / w%, based on weight ratio) of the suspension. In another embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (v / v%, based on volume ratio) of the suspension. In yet another embodiment, the surfactant is present in an amount of up to about 0.0005% to about 0.001% of the suspension, where n% represents n grams per 100 mL of the suspension. In yet another embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (v / w%, based on weight ratio to volume) of the suspension.

[0140] As used herein, in certain embodiments, when referring to concentration, “%” is a weight ratio, e.g., the ratio of the weight of a substance (dissolved in a solution via a solvent) to the weight of the solvent, or the ratio of the weight of a substance (dissolved in a solution via a solvent) to the weight of the solution. In certain embodiments, when referring to concentration, “%” is a volume ratio, e.g., the ratio of the volume of a substance (dissolved in a solution via a solvent) to the volume of the solvent, or the ratio of the volume of a substance (dissolved in a solution via a solvent) to the volume of the solution. In certain embodiments, when referring to concentration, “%” indicates grams of a substance (dissolved in a solution via a solvent) per 100 mL of solvent or solution. In certain embodiments, when referring to concentration, “%” is a weight-to-volume ratio, e.g., the ratio of the weight of a substance (dissolved in a solution via a solvent) to the volume of the solvent, or the ratio of the weight of a substance (dissolved in a solution via a solvent) to the volume of the solution.

[0141] The vector is administered in an amount sufficient to transfect cells and provide a sufficient level of gene transfer and expression to provide a therapeutic effect without undue adverse effects or with a medically acceptable physiological effect, which can be determined by one of ordinary skill in the art. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the desired organ (e.g., brain, CSF, liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intravitreal, intravenous, intramuscular, subcutaneous, intradermal, parenchymal, intraventricular, intrathecal, ICM, lumbar puncture, and other parenteral routes of administration. The routes of administration may be combined, if desired.

[0142] The dosage of the viral vector depends primarily on factors such as the condition being treated, the age, weight, and health status of the patient, and thus may vary among patients. For example, a therapeutically effective human dosage of the viral vector is generally about 1×10 9 ~1×10 16It ranges from about 25 to about 1000 microliters to about 100 mL of a solution containing the concentration of vector genome copies. In certain embodiments, a volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL of the suspension is delivered. In certain embodiments, a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL of the suspension is delivered. In certain embodiments, a total of about 8.9×10 12 ~2.7×10 14 GC dose is administered at this volume. In certain embodiments, about 1.1×10 10 GC / g brain mass to about 3.3×10 11 GC / g brain mass dose is administered at this volume. In certain embodiments, about 3.0×10 9 , about 4.0×10 9 , about 5.0×10 9 , about 6.0×10 9 , about 7.0×10 9 , about 8.0×10 9 , about 9.0×10 9 , about 1.0×10 10 , about 1.1×10 10 , about 1.5×10 10 , about 2.0×10 10 , about 2.5×10 10 , about 3.0×10 10 , about 3.3×10 10 , about 3.5×10 10 , about 4.0×10 10 , about 4.5×10 10 , about 5.0×10 10 , about 5.5×10 10 , about 6.0×10 10 , about 6.5×10 10 , about 7.0×10 10 , about 7.5×10 10 , about 8.0×10 10 , about 8.5×10 10 , about 9.0×10 10 , about 9.5×10 10 , about 1.0×10 11 , about 1.1×10 11 , about 1.5×10 11 , about 2.0×1011 , about 2.5×10 11 , about 3.0×10 11 , about 3.3×10 11 , about 3.5×10 11 , about 4.0×10 11 , about 4.5×10 11 , about 5.0×10 11 , about 5.5×10 11 , about 6.0×10 11 , about 6.5×10 11 , about 7.0×10 11 , about 7.5×10 11 , about 8.0×10 11 , about 8.5×10 11 , about 9.0×10 11 The dosage of GC is administered at this volume.

Table 1

[0143] To balance the therapeutic effect against any side effects, such dosages may be adjusted, and such dosages may vary depending on the therapeutic use for which the recombinant vector is utilized. The expression level of the transgene can be monitored to determine the dosing frequency resulting in a viral vector (preferably an AAV vector containing a mini-gene). Optionally, a dosing regimen similar to that described for therapeutic purposes can be utilized in the immunization using the compositions of the present invention.

[0144] The replication-deficient viral composition is formulated in dosage units and contains, for a human patient, an amount of replication-deficient virus in the range of about 1.0×10 9 GC to about 1.0×10 16 GC (for treating the subject), and can include all integer or fractional amounts within that range, preferably 1.0×10 GC to 1.0×10 12 GC. In one embodiment, the composition contains at least 1×10 14 per dosage, including all integer or fractional amounts within the range, 9 [[ID=�7]], 2×10 9 , 3×10 9 , 4×109 and 5×10 9 and 6×10 9 and 7×10 9 and 8×10 9 or 9×10 9 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 10 and 2×10 10 and 3×10 10 and 4×10 10 and 5×10 10 and 6×10 10 and 7×10 10 and 8×10 10 or 9×10 10 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 11 and 2×10 11 and 3×10 11 and 4×10 11 and 5×10 11 and 6×10 11 and 7×10 11 and 8×10 11 or 9×10 11 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 12 and 2×10 12 and 3×10 12 and 4×10 12 and 5×10 12 and 6×10 12 and 7×10 12 and 8×10 12 or 9x10 12 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 13 and 2×10 13 and 3×10 13 and 4×10 13 and 5×10 13 and 6×10 13 and 7×10 13 and 8×10 13 or 9×10 13It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 It is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 It is formulated to contain GC. In one embodiment, for human application, the dose can be in the range of 1×10 to about 1×10 per dose, including all integers or fractional amounts within the range 10 ~ about 1×10 12 GC.

[0145] These above dosages can be administered in various volumes of carrier, excipient, or buffer formulation in the range of about 25 to about 1000 microliters, or in higher volumes including all numbers within that range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 700 - 1000 μL.

[0146] In certain embodiments, the dosage can be in the range of about 1×10 9 GC / g brain mass to about 1×10 12 GC / g brain mass. In certain embodiments, the dosage can be in the range of about 1×10 10 GC / g brain mass to about 1×10 12 GC / g brain mass. In certain embodiments, the dosage is about 3×10 10 GC / g brain mass to about 5×10 11 GC / g brain mass.

[0147] In one embodiment, the viral construct can be delivered at a dose of at least about at least 1×10 9 GC to about 1×10 15 GC, or from about 1×10 11 GC to 5×10 13 GC. Suitable volumes and concentrations for delivery of these doses can be determined by those skilled in the art. For example, a volume of about 1 μL to 150 mL may be selected, although higher volumes may be selected for adults. Typically, suitable volumes for neonates are about 0.5 mL to about 10 mL, for older infants about 0.5 mL to about 15 mL are selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, the patient can receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects, and such dosage may vary depending on the therapeutic use for which the recombinant vector is utilized.

[0148] The recombinant vectors described above can be delivered to host cells according to published methods. Preferably, rAAV suspended in a physiologically compatible carrier can be administered to human or non-human mammalian patients. In certain embodiments, for administration to human patients, rAAV is preferably suspended in an aqueous solution containing saline, surfactant, and a physiologically compatible salt, or mixture of salts. Preferably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. Since the pH of cerebrospinal fluid is about 7.28 to about 7.32, a pH within this range is desirable for intrathecal delivery, and a pH of about 6.8 to about 7.2 may be desirable for intravenous delivery. However, other pHs in a wider range, and sub-ranges thereof, can be selected for other delivery routes.

[0149] In another embodiment, the composition comprises a carrier, diluent, excipient and / or adjuvant. Suitable carriers can be readily selected by one of ordinary skill in the art, taking into account the indication to which the introduced virus is directed. For example, one suitable carrier includes physiological saline and can be formulated with various buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile physiological saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the injection tube but do not interfere with rAAV binding activity in vivo. Suitable surfactants, or combinations of surfactants, can be selected from among non-toxic non-ionic surfactants. In one embodiment, for example, a triblock copolymer surfactant with terminal primary hydroxyl groups, such as poloxamer 188 (also known by the trade names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, Kolliphor® P188), which has a neutral pH and an average molecular weight of 8400, is selected. Other surfactants and other poloxamers, i.e., non-ionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (glyceryl polyoxycaprylate), polyoxy-oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol can be selected. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using a three-digit number following the letter "P" (for poloxamer), where the first two digits × 100 gives the approximate molecular mass of the polyoxypropylene core and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant can be present in an amount of up to about 0.0005% to about 0.001% of the suspension.

[0150] In one embodiment, the formulation can contain a buffered aqueous saline solution containing, for example, one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate heptahydrate), potassium chloride, calcium chloride (e.g., calcium chloride dihydrate), dibasic sodium phosphate, and mixtures thereof. Preferably, for intrathecal delivery, the osmolality is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / -article / 2093316-overview. Optionally, for intrathecal delivery, a commercially available diluent can be used as a suspending agent or in combination with another suspending agent and other optional excipients.

[0151] See, for example, Elliotts B® solution [Lukare Medical]. Each 10 mL of Elliotts B solution contains the following: sodium chloride, USP - 73 mg; sodium bicarbonate, USP - 19 mg; dextrose, USP 8 mg; magnesium sulfate heptahydrate, USP 3 mg; potassium chloride, USP - 3 mg; calcium chloride dihydrate, USP - 2 mg; sodium phosphate, dibasic heptahydrate, USP - 2 mg; water for injection, USP qs 10 mL.

[0152] Electrolyte concentrations: sodium 149 mEq / liter; bicarbonate 22.6 mEq / liter; potassium 4.0 mEq / liter; chloride 132 mEq / liter; calcium 2.7 mEq / liter; sulfate 2.4 mEq / liter; magnesium 2.4 mEq / liter; phosphate 1.5 mEq / liter.

[0153] The formulas and molecular weights of the components are [Table 2]

[0154] The pH of Elliott's B solution is 6 to 7.5, and the osmolality is 288 mOsmol per liter (calculated value). In certain embodiments, the composition containing rAAVhu68.hARSA is delivered at a pH in the range of 6.8 to 8, or 7.2 to 7.8, or 7.5 to 8. For intrathecal delivery, a pH greater than 7.5, such as 7.5 to 8, or 7.8 may be desirable.

[0155] In certain embodiments, the formulation may contain a buffered aqueous saline solution that does not contain sodium bicarbonate. Such a formulation may contain a buffered aqueous saline solution such as Harvard buffer, and contain in water one or more of sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof. The aqueous solution may further contain Kolliphor® P188, a poloxamer commercially available from BASF that was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2.

[0156] In another embodiment, the formulation may contain a buffered aqueous saline solution containing 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% poloxamer (e.g., Kolliphor®) 188, pH 7.2. See, for example, harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard buffer is preferred because better pH stability is observed with Harvard buffer. The following table provides a comparison of Harvard buffer and Elliott B buffer.

[0157]

Table 3

[0158] In certain embodiments, the formulation buffer is artificial CSF containing Pluronic F68. In other embodiments, the formulation may contain one or more penetration enhancers. Examples of suitable penetration enhancers can include, for example, mannitol, sodium glycolate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0159] Optionally, in addition to rAAV and the carrier, the compositions of the invention may contain other conventional pharmaceutical ingredients such as preservatives or chemical stabilizers. Exemplary suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Exemplary suitable chemical stabilizers include gelatin and albumin.

[0160] The compositions according to the invention may contain a pharmaceutically acceptable carrier as defined above. Preferably, the compositions described herein are suspended in an effective amount of a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In one example, the composition is formulated for intrathecal delivery.

[0161] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to a route of drug administration by injection into the spinal canal, and more particularly, by injection into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery can include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / subtemporal, and / or C1-2 puncture. For example, the material can be introduced by lumbar puncture to diffuse across the subarachnoid space. In another example, the injection can be into the cisterna magna.

[0162] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to the route of direct drug administration into the cerebrospinal fluid of the cerebellomedullary cistern, more particularly, by suboccipital puncture, or by direct injection into the cistern, or by a permanently placed tube.

[0163] In certain embodiments, the final formulation buffer comprises buffered saline, an artificial cerebrospinal fluid containing one or more of sodium, calcium, magnesium, potassium, or mixtures thereof, and a surfactant. In certain embodiments, the surfactant is from about 0.0005% w / w to about 0.001% w / w of the suspension. In certain embodiments, the surfactant is Pluronic F68. In certain embodiments, Pluronic F68 is present in an amount of about 0.0001% of the suspension. In certain embodiments, the composition has a pH of 7.5 to 7.8 for intrathecal delivery.

[0164] In certain embodiments, treatment with the compositions described herein results in minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and / or human patients that is well tolerated with respect to sensory neurotoxicity and asymptomatic sensory neuropathy.

[0165] In certain embodiments, the compositions described herein are useful for improving the functional and clinical outcomes of the subject being treated. Such outcomes may be measured at about 30 days, about 60 days, about 90 days, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, about 24 months, about 2.5 years, about 3 years, about 3.5 years, about 4 years, about 4.5 years after administration of the composition, and then annually up to about five years. The measurement frequency may be about once a month, about once every two months, about once every three months, about once every four months, about once every five months, about once every six months, about once every seven months, about once every eight months, about once every nine months, about once every ten months, about once every eleven months, or about once a year.

[0166] In certain embodiments, the compositions described herein exhibit pharmacokinetics and clinical efficacy measured in treated subjects as compared to untreated controls.

[0167] In certain embodiments, pharmacokinetic efficacy, clinical efficacy, functional outcome, clinical outcome, disease improvement, or disease progression may be evaluated by one or more of the following: the concentration and / or level and / or bioactivity of ARSA (e.g., in serum or CSF), urinary sulfatide, CNS myelination (demyelination load and pattern), white matter atrophy measured by MRI, the neuronal metabolites N-acetylaspartate (NAA), myo-inositol (mI), choline (Cho), and / or lactate (Lac) levels (e.g., measured by proton magnetic resonance spectroscopy (MRS)), CSF sulfatide and lysosomal-sulfatide levels, visual evoked potential (VEP), brainstem auditory evoked response (BAER), gallbladder wall thickening (e.g., by ultrasound evaluation), motor dysfunction (e.g., measured by the Gross Motor Function Classification for Metachromatic Leukodystrophy (GMFC-MLD) or the Gross Motor Function Measure (GMFM)), age at achievement, age at loss, and motor milestone achievement (defined by World Health Organization [WHO] criteria) of children maintaining or acquiring motor milestones, cognitive dysfunction (e.g., total intelligence quotient [IQ] and subdomain IQ measured by the Bayley Scales of Infant Development [BSID-III], the Wechsler Intelligence Scale for Children, Fifth Edition [WISC-V]), lifespan (compared to patients), neurological clinical examination (NCE), nerve conduction velocity (NCV) of the ulnar, deep peroneal, median, and sural nerves, age of onset and frequency of seizures captured by seizure diaries, behavioral dysfunction (e.g., measured by the Vineland Adaptive Behavior Scales, Third Edition (Vineland-III)), Lansky Performance Index, Pediatric Quality of Life Inventory (e.g., PedsQL and PedsQL-IS), and caregiver / parent quality of life.

[0168] In certain embodiments, pharmacokinetic efficacy, clinical efficacy, functional outcome, clinical outcome, disease improvement, or disease progression can be evaluated by abnormal characteristics (e.g., biomarker activity, electrophysiological activity, and / or imaging parameters) and clinical observations (e.g., gross and fine motor function, cognitive and language development, neurological examination findings, behavioral and milestone development, and caregiver / parent-reported outcomes and reduced quality of life assessments). Other disease improvements or disease progressions may be evaluated; see Sections II and VIII. Their relative sections are hereby incorporated by reference in their entirety.

[0169] Alternatively, or additionally, pharmacokinetic efficacy, clinical efficacy, functional outcome, or clinical outcome can include biomarkers, e.g., the pharmacokinetics and biological activity of rAAVhu68.hARSAco.

[0170] IIX. Methods In another aspect, a method is provided for treating a subject having a disease associated with an ARSA mutation or caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD), or for ameliorating the symptoms of a disease associated with an ARSA mutation or caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD), or for delaying the progression of a disease associated with an ARSA mutation or caused by a deficiency of normal levels of functional arylsulfatase A (e.g., MLD). The method includes administering to a subject in need thereof an effective amount of an rAAV or vector described herein. In certain embodiments, the vector or rA AV can be administered to a patient via intracisternal injection (ICM), e.g., CT-guided suboccipital injection into the cisterna magna. In certain embodiments, a vector or composition is provided that is administrable to a patient having metachromatic leukodystrophy who is 7 years of age or younger. In certain embodiments, the method includes delivering the rAAV or vector as a single dose to a human patient. In certain embodiments, the rAAV is 3.00×10 10Genomic copies (GC) per gram (GC / g) of brain mass ~ 1.00×10 12 administered at a dose of GC / g of brain mass. In certain embodiments, after administration, the disease symptoms of the subject are improved and / or the progression of the disease is delayed.

[0171] Nervous system-directed AAV gene therapy mainly targets in vivo neurons, but the potential for cross-correction opens the possibility of correcting ARSA-deficient myelinating cells that cannot be transduced in vivo by most gene therapy vectors (Cearley et al., 2008, Lawlor et al., 2009).

[0172] In certain embodiments, the "effective amount" herein is the amount that achieves improvement of MLD symptoms and / or delay of MLD progression.

[0173] The vector is administered in an amount sufficient to transfect cells and provide a sufficient level of gene transfer and expression to provide a therapeutic effect without undue adverse effects or with medically acceptable physiological effects, which can be determined by those skilled in the art. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the desired organ (e.g., brain, CSF, liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, parenchymal, intracerebroventricular, intrathecal, ICM, lumbar puncture, and other parenteral routes of administration. Routes of administration may be combined if desired.

[0174] The dosage of the viral vector (e.g., rAAV) depends mainly on factors such as the condition being treated, the age, weight, and health status of the patient, and thus may vary between patients. For example, the therapeutically effective human dosage of a viral vector is generally about 1×10 9 ~1×10 16It ranges from about 25 to about 1000 microliters to about 100 mL of a solution containing the concentration of vector genome copies. In certain embodiments, a volume of suspension of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL is delivered. In certain embodiments, a volume of suspension of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL is delivered. In certain embodiments, a total of about 8.9×10 12 ~2.7×10 14 GC dose is administered at this volume. In certain embodiments, about 1.1×10 10 GC / g brain mass to about 3.3×10 11 GC / g brain mass dose is administered at this volume. In certain embodiments, about 3.0×10 9 , about 4.0×10 9 , about 5.0×10 9 , about 6.0×10 9 , about 7.0×10 9 , about 8.0×10 9 , about 9.0×10 9 , about 1.0×10 10 , about 1.1×10 10 , about 1.5×10 10 , about 2.0×10 10 , about 2.5×10 10 , about 3.0×10 10 , about 3.3×10 10 , about 3.5×10 10 , about 4.0×10 10 , about 4.5×10 10 , about 5.0×10 10 , about 5.5×10 10 , about 6.0×10 10 , about 6.5×10 10 , about 7.0×10 10 , about 7.5×10 10 , about 8.0×10 10 , about 8.5×10 10 , about 9.0×10 10 , about 9.5×10 10 , about 1.0×10 11 , about 1.1×10 11 , about 1.5×10 11 , about 2.0×1011 , about 2.5×10 11 , about 3.0×10 11 , about 3.3×10 11 , about 3.5×10 11 , about 4.0×10 11 , about 4.5×10 11 , about 5.0×10 11 , about 5.5×10 11 , about 6.0×10 11 , about 6.5×10 11 , about 7.0×10 11 , about 7.5×10 11 , about 8.0×10 11 , about 8.5×10 11 , about 9.0×10 11 The dosage of GC is administered at this volume.

[0175] To balance the therapeutic effect against any side effects, such dosage may be adjusted, and such dosage may vary depending on the therapeutic use for which the recombinant vector is utilized. The expression level of the transgene can be monitored to determine the dosing frequency that results in a viral vector (preferably an AAV vector containing a mini-gene). Optionally, a dosing regimen similar to that described for therapeutic purposes can be utilized for immunization with the compositions of the present invention.

[0176] The replication-deficient viral composition is formulated in dosage units and contains an amount of replication-deficient virus in the range of about 1.0×10 9 GC~about 1.0×10 16 GC (for treating the subject), including all integer or fractional amounts within that range, preferably 1.0×10 12 GC~1.0×10 14 GC. In one embodiment, the composition contains at least 1×10 per dose, including all integer or fractional amounts within the range 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×109 or 9×10 9 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 or 9×10 10 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 [[ID=�5]], 8×10 11 or 9×10 11 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 or 9×10 12 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 or 9×10 13 is formulated to contain GC. In another embodiment, the composition contains at least 1×10 per dose, including all integers or fractional amounts within the range 14, 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 is formulated to include GC. In another embodiment, the composition is at least 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 is formulated to include GC.

[0177] In one embodiment, for human application, the dose can range from 1×10 10 to about 1×10 15 GC per kg body weight, including all integers or fractional amounts within the range.

[0178] In one embodiment, the effective amount of the vector is about 1×10 9 , 2×10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 GC per kg body weight. In another embodiment, the effective amount of the vector is about 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10It is per kg body weight of GC. In another embodiment, the effective amount of the vector is about 1×10 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 It is per kg body weight of GC. In another embodiment, the effective amount of the vector is about 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It is per kg body weight of GC. In another embodiment, the effective amount of the vector is about 1×10 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 It is per kg body weight of GC. In another embodiment, the effective amount of the vector is all integers or fractional amounts within the range, about 1×10 or, about 1×10 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 It is per kg body weight of GC. In another embodiment, the effective amount of the vector is all integers or fractional amounts within the range, about 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×1015 , 6 × 10 15 , 7 × 10 15 , 8 × 10 15 , or 9 × 10 15 per kg body weight of GC.

[0179] In one embodiment, for administration to humans, the dose can be in the range of 1 × 10 10 to about 1 × 10 15 per gram (g) of brain mass of GC. In one embodiment, the effective amount of the vector can be in the range of about 1 × 10 9 , 2 × 10 9 , 3 × 10 9 , 4 × 10 9 , 5 × 10 9 , 6 × 10 9 , 7 × 10 9 , 8 × 10 9 , or 9 × 10 9 per gram (g) of brain mass of GC. In another embodiment, the effective amount of the vector can be in the range of about 1 × 10 10 , 2 × 10 10 , 3 × 10 10 , 4 × 10 10 , 5 × 10 10 , 6 × 10 10 , 7 × 10 10 , 8 × 10 10 , or 9 × 10 10 per gram (g) of brain mass of GC. In another embodiment, the effective amount of the vector can be in the range of about 1 × 10 11 , 2 × 10 11 , 3 × 10 11 , 4 × 10 11 , 5 × 10 11 , 6 × 10 11 , 7 × 10 11 , 8 × 10 11 , or 9 × 10 11 per gram (g) of brain mass of GC. In another embodiment, the effective amount of the vector can be in the range of about 1 × 10 12 , 2 × 10 12 , 3 × 10 12 , 4 × 1012 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 per gram (g) of brain mass. In another embodiment, the effective amount of the vector is about 1×10, including all integers or fractional amounts within the range 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 per gram (g) of brain mass. In another embodiment, the effective amount of the vector is about 1×10, including all integers or fractional amounts within the range 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 per gram (g) of brain mass. In another embodiment, the effective amount of the vector is about 1×10, including all integers or fractional amounts within the range 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 per gram (g) of brain mass.

[0180] These above dosages can be administered in various volumes of carrier, excipient, or buffer formulation in the range of about 25 to about 1000 microliters, or higher volumes including all numbers within that range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 700 - 1000 μL.

[0181] In certain embodiments, the dosage can be in the range of about 1×10 9 GC / g brain mass to about 1×10 12 GC / g brain mass. In certain embodiments, the dosage can be in the range of about 1×10 10 GC / g brain mass to about 3×10 11 GC / g brain mass. In certain embodiments, the dosage can be in the range of about 1×10 10 GC / g brain mass to about 2.5×10 11 GC / g brain mass. In certain embodiments, the dosage can be in the range of about 5×10 10It can be in the range of GC / g brain mass.

[0182] In one embodiment, the viral construct is at least about at least 1×10 9 GC to about 1×10 15 or about 1×10 11 to 5×10 13 GC and can be delivered at a dose. Suitable volumes and concentrations for delivering these doses can be determined by those skilled in the art. For example, a volume of about 1 μL to 150 mL may be selected, although higher volumes may be selected for adults. Typically, suitable volumes for neonates are about 0.5 mL to about 10 mL, for older infants about 0.5 mL to about 15 mL are selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, the patient can receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects, and such dosage may vary depending on the therapeutic use for which the recombinant vector is utilized.

[0183] The recombinant vectors described above can be delivered to host cells according to published methods. Preferably, rAAV suspended in a physiologically compatible carrier can be administered to human or non-human mammalian patients. In certain embodiments, for administration to human patients, rAAV is preferably suspended in an aqueous solution containing saline, surfactant, and a physiologically compatible salt, or mixture of salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the range of pH 6 to 9, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8. Since the pH of cerebrospinal fluid is about 7.28 to about 7.32, a pH within this range is desirable for intrathecal delivery, and a pH of about 6.8 to about 7.2 may be desirable for intravenous delivery. However, other pHs in a wider range, and sub-ranges thereof, can be selected for other delivery routes.

[0184] In certain embodiments, treatment with the compositions described herein results in minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and / or human patients that is well tolerated with respect to sensory neurotoxicity and asymptomatic sensory neuropathy.

[0185] In certain embodiments, the proposed population for rAAV, vectors, compositions, and methods consists of subjects with early-onset late-infantile and early-onset juvenile MLD, where symptom onset is less than 7 years of age and the predictable and rapid decline supports robust study design and assessment of functional outcomes within a reasonable observation period.

[0186] Treatment with rAAV, vectors, compositions or methods is for amelioration of disease symptoms and delay of disease progression, including stabilizing the underlying pathology, thereby preventing disease onset and allowing normal or near-normal motor and cognitive development, or substantially preventing or delaying loss of skills (such as acquired development and motor milestones) and disease progression. Pre-symptomatic patients are eligible for this treatment.

[0187] The AAVhu68 capsid and ICM ROA of AAV.hARSAco effectively transduce cortical neurons, a small subset of myelin-producing oligodendrocytes, motor neurons with axons projecting into the PNS, and DRG sensory neurons with axons projecting into both the spinal cord and peripheral nerves. Given the broad transduction profile in both the CNS and PNS, ARSA enzyme cross-correction can treat both CNS symptoms and peripheral neuropathy observed in many MLD patients that are not addressed by HSC-GT or HSCT.

[0188] Considering the nature of MLD, CNS damage is considered to be mostly irreversible, with rapid disease progression in the early-onset population, and the rAAV, vectors, compositions or methods described herein are likely to provide the greatest benefit in patients without disease or with mild to moderate disease. AAV gene therapies such as AAV.hARSAco delivered by ICM show rapid kinetics onset compared to those of HSC-based therapies, with ARSA expression peaking in CSF by 3 weeks after administration (see Examples). As a result, AAVhARSAco can halt disease progression even in patients who already have some clinical signs of the disease. Thus, patients with mild gait abnormalities, a clear delay in achieving motor milestones (defined as greater than the 95th percentile for the age at which a given milestone based on WHO criteria is achieved (Wijnhoven et al., 2004)), and mild signs on neurological examination, including those with mild to moderate signs and symptoms of early-onset MLD who are able to walk and independently walk at least 10 steps, are eligible for treatment (referred to as "treatment") with the rAAV, vectors, compositions or methods described herein.

[0189] Indicators of disease progression not commonly found in patients with mild to moderate symptoms include feeding difficulties requiring gastrostomy, onset of seizures, low cognitive function, severe abnormalities found on neurological examination (such as very brisk reflexes, severe hypotonia or spasticity of the extremities, severe swallowing disorders, gross motor disorders, or ataxia), and visual or hearing loss, and these are excluded from the trial. In certain embodiments, this delay in disease progression is shown as stabilization of the disease at a low level of clinical function.

[0190] In certain embodiments, the pharmacodynamics and efficacy outcomes of this method are measured at 1, 3, and 6 months, except for those requiring sedation and / or LP, and then every 6 months during a 2-year short-term follow-up period. During the long-term follow-up phase, the evaluation frequency is reduced to once every 12 months. Considering the rapid disease progression in untreated early-onset MLD patients, the initial time points and 6-month intervals for the first 2 years were also selected.

[0191] In certain embodiments, improvement of disease symptoms or delay of disease progression is indicated by the evaluation of gross motor function. GMFC-MLD is a validated and reliable simple tool for the standardized evaluation of gross motor function and decline over time in MLD patients (Kehrer et al., 2011b). It was modeled after a similar tool that evaluates the motor function of children with cerebral palsy and classifies the children's motor function into one of five levels based on differences in self-initiated movements (Palisano et al., 2006). Kehrer et al. adapted the classification system to provide a classification system relevant to patients with MLD and where the distinction between levels is considered meaningful in the daily life of children with MLD (Table below) (Kehrer et al., 2011a, Kehrer et al., 2011b). GMFC-MLD has been shown to describe the natural history of MLD (Kehrer et al., 2011a) and is used for both evaluating motor function after therapeutic intervention (Sessa et al., 2016). One potential limitation of GMFC-MLD is that this tool has been validated for children older than 18 months of age. This is because this represents the upper age limit at which children typically acquire normal walking patterns (Largo et al., 1985, WHO, 2006). However, this tool is also applicable to children who have achieved walking milestones before this age.

Table 4

[0192] The Gross Motor Function Measure (GMFM) is included as a measure to assess improvement in disease symptoms or delay in disease progression. It is a standardized observational tool designed and validated to measure changes in gross motor function over time and after intervention in children with cerebral palsy (Russell et al., 1989; Lundkvist Josenby et al., 2009; Alotaibi et al., 2014). The GMFM is an 88-item tool that assesses motor function classified across five functional domains: lying and rolling, sitting, crawling and kneeling, standing and walking, running and jumping. Typically, reference curves have also been developed for healthy children who achieve the most difficult skills (walking, running, jumping) on the scale by age 5 (Palisano et al., 2006). This tool has not been validated for children with MLD, but it has been shown to be useful for early-onset MLD patients who received HSC-GT by demonstrating (near) normal gross motor development in subjects treated at the pre-symptomatic stage (Sessa et al., 2016; Fumagalli et al., 2017). One advantage of the 88-item measure is that it contains a large amount of information regarding various aspects of motor function and can summarize and report on smaller areas separately. Due to the plateau effect, this tool may not be informative in older early juvenile patients who may already have reached their maximum GMFM score prior to study enrollment (i.e., it cannot measure the acquisition of new skills), but it may still be able to show the maintenance or loss of gross motor function over time.

[0193] Peripheral neuropathy is a common, painful, and progressive symptom of MLD that can exacerbate fine and gross motor dysfunction in these patients (Gieselmann and Krageloh-Mann, 2010; van Rappard et al., 2015). Treatment based on HSCs does not appear to substantially improve peripheral neuropathy (Boucher et al., 2015; van Rappard et al., 2016). The ability of AAV.hARSAco to transduce neurons, DRGs, and peripheral axonal cells enables the expression of ARSA enzyme within the dysfunctional brain and peripheral nerves. Neurological examinations can be performed to assess the clinical symptoms of peripheral neuropathy, and nerve conduction tests can be performed on representative motor and sensory nerves (deep peroneal nerve, median nerve, ulnar nerve, and sural nerve). Since MLD is primarily a demyelinating disease, nerve conduction velocity is considered a disease-related neurophysiological parameter (Biffi et al., 2008) and can be measured.

[0194] The development of motor milestones depends on the age and disease stage of the subject at the time of registration. Depending on the age of the subject at registration, the subject may or may not have achieved certain motor skills or shown signs of the development of motor milestones. The evaluation tracks the age-at-achievement and age-at-loss for all milestones. The degree of achievement of motor milestones is defined for six gross milestones based on the WHO criteria outlined in the following table.

Table 5

[0195] Neurocognitive and behavioral manifestations can be evaluated to show improvement of disease symptoms or delay of disease progression. Evaluating these manifestations is particularly important in children with early juvenile MLD, an important manifestation of diseases in which behavioral and cognitive symptoms may occur simultaneously with motor dysfunction. Clinical scales may be used to quantify the effects of AAV.hARSAco on the development and changes of cognition, language, and motor function, which may be evaluated using the BSID-III and WISC-V, with a transition to age-appropriate assessment tools according to the estimated developmental age of the patient. Outcomes can be compared to achievement criteria of typically developing children and untreated children. Each proposed scale has been used previously in the MLD population (Clarke et al., 1989, Boucher et al., 2015, Sessa et al., 2016).

[0196] ●BSID-III: This scale was mainly used to evaluate the development of infants and young children aged 1 to 42 months (Albers and Grieve, 2007). It is composed of a series of standardized developmental play tasks. It converts the raw scores of successfully completed items into scale scores and composite scores, and then derives developmental indices by comparing those scores with achievement criteria obtained from typically developing children of the same age. The BSID-III has three main subtests. The cognitive scale includes items such as attention to familiar and unfamiliar objects, searching for dropped objects, and pretending to play. The language scale evaluates language comprehension and expression (e.g., the ability to follow instructions and name objects). The motor scale measures gross and fine motor skills (e.g., grasping, sitting, stacking blocks, and climbing stairs). Therefore, the BSID-III can provide additional motor function information to complement the GMFC-MLD and GMFM.

[0197] ●WISC-V: This scale is an individually administered intelligence test for children aged 6 to 16 years. It generates a Full Scale IQ that represents a child's general intellectual ability and provides five primary index scores: Verbal Comprehension Index, Visual Spatial Index, Fluid Reasoning Index, Working Memory Index, and Processing Speed Index. These indices represent a child's abilities in individual cognitive domains.

[0198] Survival rate is included as a measure of improvement in disease symptoms or delay in disease progression. Most patients diagnosed with late-infantile MLD are predicted to die by 5 years of age, and the 5-year survival rate is 25% (Mahmood et al., 2010), but with current levels of supportive therapy, the survival period can be extended into the teenage years (Gomez-Ospina, 2017). Thus, 5 years of follow-up may be sufficient to demonstrate survival benefit in the late-infantile population but may not be of sufficient length to evaluate survival in the early juvenile cohort. Importantly, with improved levels of supportive therapy, children with early-onset MLD can now survive beyond 10 years of age despite having a very low functional level.

[0199] Seizures are not usually a symptom that appears in the early-onset population but are a feature of the later stages of the disease (Gieselmann and Krageloh-Mann, 2010, Mahmood et al., 2010). Parents may be asked to keep a diary to record seizure activity (onset, frequency, duration, and type of seizures), which allows evaluation of whether AAV.hARSAco can prevent or delay seizure onset or reduce the frequency of seizure events.

[0200] Along with the quality of life of the parent and patient, measures of adaptive behavior can be evaluated using tools previously used in MLD patients to show improvement in disease symptoms or delay in disease progression (Martin et al., 2013, Boucher et al., 2015, Sessa et al., 2016).

[0201] ●Assess adaptive behavior from birth to adulthood (0 - 90 years) across five domains: Vineland-III communication, daily living skills, socialization, motor skills, and maladaptive behavior. Improvements from Vineland-II to Vineland-III incorporate questions for better understanding of developmental disabilities.

[0202] ●PedsQOL and PedsQL-IS: As in the case of severe pediatric diseases, the burden on the family of the disease is significant. The Pediatric Quality of Life Inventory (trademark) is a validated tool for assessing the quality of life of children and their parents (by proxy report of parents). It has been validated in healthy children and adolescents and is used in various pediatric diseases (Iannaccone et al., 2009, Absoud et al., 2011, Consolaro a nd Ravelli, 2016). Therefore, PedsQL is included to evaluate the impact of AAV.hARSAco on the quality of life of patients and their families. This can be applied to parents of children aged 2 years and older and can thus be useful as the age of the child over a 5-year follow-up period. The Pediatric Quality of Life Inventory (trademark) Infant Scale (Varni et al., 2011) is a validated modular instrument completed by parents, designed to measure health-related quality of life for healthy and sick infants aged 1 - 24 months. It also provides the possibility of self-report by children aged 5 years and older.

[0203] ●Lansky Performance Index: A scale that measures an individual's functional status and provides a score representing the individual's ability to perform normal daily activities.

[0204] The effect of an rAAV (e.g., AAV.hARSAco), vector, composition, or method described herein on disease pathology can be measured to show improvement of disease symptoms or delay of disease progression, including myelination, functional outcomes related to myelination, and changes in potential disease biomarkers.

[0205] The central and peripheral demyelination, which are the main features of MLD, can be examined to show improvement of disease symptoms or delay of disease progression after rAAV administration. Central demyelination can be tracked by MRI measurements of white matter regions, and these changes serve as indicators of the disease state and progression (Gieselmann and Krageloh-Mann, 2010, Martin et al., 2012, van Rappard et al., 2015). Central demyelination detected by MRI is positively correlated with the degree of gross motor dysfunction (Groeschel et al., 2011). Peripheral demyelination can be indirectly measured by NCV examination of motor nerves (deep peroneal, tibial, and ulnar nerves) and sensory nerves (sural and median nerves), which also provides a readout of peripheral neuropathy. NCV examination monitors fluctuations indicating changes in biologically active myelin (i.e., F waves and distal latency, amplitude, or presence of responses).

[0206] In addition to measurement of total demyelination score and cerebral white matter atrophy, various brain neuro-metabolites including NAA, mI, CHO, and Lac can be measured over time using proton MRS. There is evidence that NAA levels strongly correlate with gross motor function when the NAA signal intensity decreases with the progression of the disease process (Kruse et al., 1993, Dali et al., 2010). In addition, proton MRS examination has shown a decrease in the NAA / creatinine ratio, an increase in the Cho / creatinine ratio, and mI and Lac levels during MLD disease progression (Martin et al., 2012). Therefore, neuro-metabolites can be evaluated as biomarkers indicating improvement of disease symptoms or delay of disease progression.

[0207] There is evidence that peripheral nerve and CSF sulfatide and lysosulfatide accumulation correlates with abnormal electrophysiological parameters and large myelinated fiber loss in the peroneal nerve (Dali et al., 2015). Thus, CSF (lyso)-sulfatide levels may reflect the severity of disease in the PNS and provide a marker for assessing the impact of treatment on the peripheral nervous system. CSF sulfatide and lyso-sulfatide levels may be included to indicate improvement of disease symptoms or delay of disease progression.

[0208] Similar to seizures, visual loss is not a commonly occurring symptom in early-onset MLD but occurs later in the disease (Gieselmann and Krageloh-Mann, 2010, van Rappard et al., 2015). Tracking visual loss through the use of VEP provides an opportunity to evaluate the ability of the rA described herein to delay or prevent visual loss. VEP can be used to objectively measure the response to visual stimuli as an indicator of central visual impairment or loss. Hearing loss also commonly occurs during disease progression, and early signs of auditory abnormalities can be measured by BAER testing.

[0209] One of the sequelae of MLD in visceral tissue is deposition of sulfatide in the gallbladder wall, which can lead to gallbladder wall thickening and polyps that may require surgical intervention and can be visualized by ultrasound (Rodriguez-Waitkus et al., 2011, Kim et al., 2017). Gallbladder abnormalities are a common finding in MLD, predisposing patients to gallbladder cancer (van Rappard et al., 2016) and occurring in all subtypes of MLD.

[0210] In certain embodiments, the assays listed below may be performed to indicate improvement of disease symptoms and / or delay of disease progression. Hematology, Serum Chemistry, Coagulation, LFT; Urinalysis; HepB / HepC / HIV Serology; Serum Biomarker (ARSA); Vector DNA in Serum and Urine; Serum Anti-AAVhu68 nAb; ELISpot (Capsid and ARSA); CSF Collection and Evaluation; LP (for CSF Collection); CSF Cytology and Chemistry; CSF Disease Biomarkers (ARSA, Sulfatide, Lyso-Sulfatide); CSF Anti-AAVhu68 nAb; Vector DNA in CSF; Physical Examination (including Height and Weight); Neurological Examination; Vital Signs; ECGd; Sensory Nerve Conduction Study; GMFC-MLD; GMFM; BSID-IIIe; WISC-V; Vineland-IIIe; Lansky Performance Index; PedsQL; PedsQL-IS; Caregiver / Parent QoL Assessment; Motor Milestone Assessment; Training for Completion of Seizure Diary; Review of Seizure Diary; Imaging Evaluation; MRI; MRS; NCV Measurement; and VEP.

[0211] The related abbreviations are listed below. AAVhu68, Adeno-associated virus serotype hu68; AE, Adverse Event; ARSA, Arylsulfatase A; BAER, Brainstem Auditory Evoked Response; BSID-III, Bayley Scales of Infant and Toddler Development, Third Edition; CSF, Cerebrospinal Fluid; DNA, Deoxyribonucleic Acid; ECG, Electrocardiogram; ELISpot, Enzyme-Linked Immunospot; GMFC-MLD: Gross Motor Function Classification in Metachromatic Leukodystrophy; GMFM, Gross Motor Function Measure; HepB, Hepatitis B; HepC, Hepatitis C; HIV, Human Immunodeficiency Virus; ICM, In-Cage Monitoring; LFT, Liver Function Test; LP, Lumbar Puncture; MRI, Magnetic Resonance Imaging; MRS, Magnetic Resonance Spectroscopy; nAb, Neutralizing Antibody; NCV, Nerve Conduction Velocity; PedsQL / PedQL-IS, Pediatric Quality of Life Survey; QoL, Quality of Life; VEP, Visual Evoked Potential; Vineland-III, Vineland Adaptive Behavior Scales, Third Edition; WISC-V, Wechsler Intelligence Scale for Children, Fifth Edition.

[0212] rAAV, vectors, compositions, and methods provide supra-physiological levels of ARSA enzyme to both the CNS and PNS within days of administration, both of which are affected in MLD patients. The AAVhu68 capsid and the ICM route were selected based on the observation of excellent transduction of neurons, DRG, and peripheral nerve axons. Vector transduction of myelinating cells is limited, but the potential for cross-correction will allow enzyme uptake by oligodendrocytes. Furthermore, the AAV vector and the ARSA enzyme can be transported along axons, expanding the expression of the therapeutic enzyme into the brain and periphery.

[0213] X. Devices and Methods for Delivery of Pharmaceutical Compositions into Cerebrospinal Fluid In certain embodiments, AAV.CB7.CI.hARSAco.rBG is administered as a single dose via a suboccipital injection under computerized tomography (CT) guidance (intracisternal [ICM]) into the cisterna magna.

[0214] Many animal models of single-gene CNS diseases have been successfully treated using AAV-mediated gene transfer, and some initial human studies using first-generation AAV vectors have shown the safety of vector delivery to the brain (Janson et al., 2002, Mandel and Burger, 2004, Kaplitt et al., 2007, Mittermeyer et al., 2012, Bartus et al., 2014). However, the low efficiency of these vectors has hindered the translation of efficacy in animal models to clinical benefit. The emergence of second-generation AAV vectors has greatly increased the potential for gene transfer to the brain. In particular, some clade F isolates such as AAV9 have shown extremely efficient brain transduction (Gray et al., 2013, Haurigot et al., 2013, Hinderer et al., 2014, Bell et al., 2015). Using these more efficient vectors, gene therapy has greatly enhanced the potential to treat various neuropathies, and several programs utilizing second-generation vectors have advanced to clinical trials (Haurigot et al., 2013, Hinderer et al., 2014, Bell et al., 2015, Gurda et al., 2016, Hinderer et al., 2016).

[0215] Initial studies of CNS gene delivery were difficult not only due to the low gene delivery efficiency of first-generation AAV vectors but also due to limitations in available delivery methods. Most initial non-clinical and clinical studies utilized direct vector injection into the brain or spinal cord parenchyma (Vite et al., 2005, Worgall et al., 2008, Colle et al., 2010, Ellinwood et al., 2011, Tardieu et al., 2014). This method resulted in robust transduction near the injection site, but conversion of this approach for diseases affecting cells throughout the CNS was difficult because large amounts of vector injection were required to achieve widespread transgene delivery. A further obstacle to CNS gene delivery was the finding that parenchymal vector injection could cause inflammation at the injection site and promote an adaptive immune response to the transgene product (Worgall et al., 2008, Colle et al., 2010, Ellinwood et al., 2011, Ciesielska et al., 2013). Two alternative vector delivery methods have been developed to more safely and effectively target large regions of the CNS.

[0216] First, it is based on the discovery that several AAV vectors, including AAV9, can transduce cells within the CNS after IV delivery (Foust et al., 2009). However, there are two major limitations to IV vector delivery. First, the low efficiency of vector entry into the CNS requires extremely high vector doses to achieve therapeutic levels of transgene expression, increasing the risk of systemic toxicity and potentially requiring amounts of vector that are impossible to manufacture for many patient populations (Gray et al., 2011, Hinderer et al., 2014, Gurda et al., 2016). Second, gene transfer into the CNS after IV vector delivery is highly restricted by pre-existing NAbs to the vector capsid (Gray et al., 2011). Given the high prevalence of AAV NAbs in humans, this leaves a significant portion of the patient population ineligible for IV AAV therapy. To circumvent the limitations of IV AAV for targeting the CNS, IT vector delivery has been developed as an alternative approach. Using CSF as a vehicle for vector dispersion, IT ROA has the potential to achieve transgene delivery throughout the CNS and PNS with a single minimally invasive injection. Animal studies have shown that by eliminating the need to cross the blood-brain barrier, IT delivery results in considerably more efficient CNS gene transfer at much lower vector doses than required for the IV approach (Gray et al., 2011, Hinderer et al., 2014). Since antibodies are present at very low levels in the CSF, IT vector delivery is not affected by pre-existing NAbs to the AAV capsid, making this approach applicable to a broader patient population (Haurigot et al). al., 2013). IT AAV delivery can be performed using various routes for CSF access. Lumbar puncture (LP) is the most common method for accessing CSF and has thus been evaluated as a route for AAV administration in NHPs. Delivery of the AAV9 vector into the CSF via LP was found to be at least 10-fold less efficient in transducing cells of the brain and spinal cord compared to better vector infusion at the cisternal level (Hinderer et al., 2014).

[0217] Due to the excellent brain transduction achieved by single ICM injection in NHPs, this ROA was selected for the clinical study of AAV.CB7.CI.hARSAco.rBG. In the general procedure, ICM injection (also known as suboccipital puncture) was ultimately replaced by LP in the pre-imaging era due to rare cases of damage to the brainstem or nearby blood vessels (Saunders and Riordan, 1929). Today, procedures can be performed under real-time CT guidance that enables visualization of important structures such as the medulla, vertebral artery, and posterior inferior cerebellar artery during needle insertion (Pomerantz et al., 2005, Hinderer et al., 2014).

[0218] In one aspect, the vectors provided herein can be administered intrathecally via the methods and / or devices provided in this section and described in WO2018 / 160582 (incorporated herein by reference). Alternatively, other devices and methods can be selected.

[0219] In certain embodiments, the method includes the step of CT-guided suboccipital injection into the cisterna magna of a patient via a spinal needle. As used herein, the term computed tomography (CT) refers to radiography in which a three-dimensional image of a body structure is constructed from a series of planar cross-sectional images created along an axis by a computer.

[0220] On the treatment date, prepare rAAVhu68.hARSAco at an appropriate concentration. Deliver a syringe containing 5.6 mL of rAAVhu68.hARSAco at the appropriate concentration to the treatment room. For the administration of the investigational drug, the following personnel shall be present: the interventional physician performing the treatment, anesthesiologist and respiratory therapist, nurse and physician assistant, CT (or operating room) technician, and facility research coordinator. Prior to drug administration, perform a lumbar puncture to remove a predetermined volume of CSF, and then inject an iodine contrast agent intrathecally (IT) to assist in visualizing the relevant anatomical structures of the cistern. An intravenous (IV) contrast agent can be administered before or during the needle puncture as an alternative to the intrathecal contrast agent. The decision to use an IV or IT contrast agent is left to the discretion of the interventional physician. The subject is anesthetized, intubated, and placed on the treatment table. Prepare the injection site using sterile technique and drape. Under fluoroscopy, advance a spinal needle (22 - 25G) into the cistern. A larger introducer needle may be used to assist in needle placement. After confirming the needle placement, attach an extension set to the spinal needle and fill it with CSF. At the discretion of the interventional physician, a syringe containing the contrast agent may be connected to the extension set and a small amount injected to confirm that the needle is placed within the cistern. After confirming the needle placement by CT guidance + / - contrast agent injection, connect a syringe containing 5.6 mL of rAAVhu68.hARSAco to the extension set. Slowly inject the contents of the syringe over 1 - 2 minutes to deliver a volume of 5.0 mL. The injection needle is slowly removed from the subject.

[0221] In one embodiment, the dose is scaled by brain mass to provide an approximation of the size of the CSF compartment. In further embodiments, the dose conversion is based on a brain mass of 0.4 g in adult mice, 90 g in juvenile rhesus macaques, and 8 00 g in children aged 4 - 18 months. The following table provides exemplary doses for mouse MED studies, NHP toxicity tests, and equivalent human doses.

Table 6

[0222] In certain embodiments, the rAAVhu68.hARSAco vector is administered to a subject as a single dose. In certain embodiments, multiple doses (e.g., 2 doses) may be desired. For example, in the case of infants less than 6 months of age, multiple doses at several days, weeks, or months intervals may be desirable.

[0223] In certain embodiments, a single dose of the rAAVhu68.hARSAco vector is from about 1×10 9 GC to about 3×10 11 GC. In certain embodiments, the dose of rAAVhu68.HARSA is from about 1×10 10 GC / brain mass to about 3.33×10 11 GC / brain mass. In other embodiments, different doses may be selected.

[0224] The composition is formulated in dosage units to contain an amount of AAV in the range of from about 1×10 9 genomic copies (GC) to about 5×10 13 GC (for treating an average subject of 70 kg body weight). In one embodiment, a spinal tap is performed, about 15 mL (or less) to about 40 mL of CSF is removed, the vector is mixed with the CSF and / or suspended in a suitable carrier and delivered to the subject. In one example, the vector concentration is about 3×10 13 GC, but other amounts, e.g., about 1×10 9 GC, about 5×10 9 GC, about 1×10 10 GC, about 5×10 10 GC, about 1×10 11 GC, about 5×10 11 GC, about 1×10 12 GC, about 5×10 12 GC, or about 1.0×10 13 GC may be used.

[0225] Combination therapies can be delivered with the rAAVhu68.hARSAco compositions provided herein. Combination therapies as described previously in this application are incorporated herein by reference.

[0226] The words "comprise", "comprises" and "comprising" are to be interpreted inclusively rather than exclusively. The words "consist", "consisting" and their variants are to be interpreted exclusively rather than inclusively. Although the various embodiments herein are presented using the word "comprising", in other situations it is also contemplated that the relevant embodiments should be interpreted and described using the words "consisting of" or "consisting essentially of".

[0227] The term "expression" is used herein in its broadest sense and includes the production of RNA or RNA and protein. With respect to RNA, the terms "expression" or "translation" specifically relate to the production of peptides or proteins. Expression can be transient or stable.

[0228] As used herein, an "expression cassette" refers to a nucleic acid molecule that includes a coding sequence, a promoter, and may include other regulatory sequences therefor. In certain embodiments, a vector The genome can include two or more expression cassettes. In other embodiments, the term "transgene" can be used interchangeably with "expression cassette". Typically, such an expression cassette for producing a viral vector includes a coding sequence of a gene product described herein adjacent to a packaging signal of the viral genome, and other expression control sequences such as those described herein.

[0229] When used with reference to a protein or nucleic acid, the term "heterologous" indicates that the protein or nucleic acid comprises two or more sequences or subsequences that are not found in nature in the same relationship to each other. For example, a nucleic acid having two or more sequences from unrelated genes arranged to create a novel functional nucleic acid is typically produced recombinantly. For example, in one embodiment, a nucleic acid has a promoter from one gene and is arranged to direct the expression of a coding sequence from a different gene. Thus, with respect to the coding sequence, the promoter is heterologous.

[0230] As used herein, "effective amount" refers to the amount of an rAAV composition that delivers and expresses an amount of a gene product from a vector genome in a target cell. The effective amount can be determined based on an animal model, rather than a human patient. Examples of suitable mouse or NHP models are described herein.

[0231] The term "translation" in the context of the present invention relates to the process at the ribosome where an mRNA strand controls a set of amino acid sequences to produce a protein or peptide.

[0232] The term "a" or "an" refers to one or more; for example, note that "an enhancer" represents one or more enhancers. Thus, the terms "a" (or "an"), "one or more", and "at least one" are used interchangeably herein. As noted above, the term "about", when used to modify a numerical value, means a variation of ± 10% unless otherwise specified.

[0233]

[0234] ​Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to publicly available documents that provide one of ordinary skill in the art with a general guide to many of the terms used herein.

Example

[0235] The following examples are merely illustrative and are not intended to limit the present invention.

[0236] The vector AAVhu68.CB7.CI.hARSAco.rBG (also referred to as AAV.CB7.CI.hARSAco.rBG or AAVhu68.hARSAco or AAV.hARSAco) was delivered to the CSF to achieve therapeutic ARSA expression levels and rescue several biomarkers of MLD.

[0237] In healthy wild-type mice, several proof-of-concept pharmacological tests of AAV.CB7.CI.hARSAco.rBG were conducted. Non-clinical tests in healthy mice and non-human primates (NHPs) have shown that CSF delivery of AAV.CB7.CI.hARSAco.rBG results in overexpression of ARSA in the CNS, PNS, and CSF (Examples 1-4). Example 2 shows the intraventricular (ICV) administration has been shown to result in the expression of enzymatically active ARSA in the brains of healthy wild-type mice. Example 3 showed that the observed ARSA expression was partially due to transduction and / or cross-correction in both cortical neurons and oligodendrocytes, two major cell types affected by ARSA deficiency in MLD patients. In cynomolgus macaques (Example 4), which are animals relevant in size, potentially therapeutic levels of ARSA have also been obtained, and efficacy tests are being conducted in in vivo and / or in vitro MLD disease models. Additional experiments testing the dose range have also been conducted in healthy adult cynomolgus macaques, demonstrating that neurons in the brain, spinal cord, and DRG showed robust expression of ARSA for at least 6 weeks after ICM administration of AAV.CB7.CI.hARSAco.rBG, despite the induction of anti-human ARSA (hARSA) antibodies (Example 4). A doubling of the baseline CSF ARSA activity level was also observed 2 weeks after treatment (Example 4), suggesting the potential to achieve therapeutic expression levels of ARSA in early-onset MLD patients.

[0238] For subsequent use in the MED study (Example 6), experiments are also conducted to evaluate the pharmacology and toxicology of AAV.CB7.CI.hARSAco.rBG in a new mouse model of MLD (Experiment 5). In vitro models are being investigated to test the efficacy of AAV.CB7.CI.hARSAco.rBG in reducing disease biomarkers in cell lines derived from MLD patients (Example 7). Furthermore, Example 8 provides the pharmacology and toxicology studies of AAV.CB7.CI.hARSAco.rBG in juvenile rhesus monkeys. Example 10 shows the study of AAV.CB7.CI.hARSAco.rBG in the pediatric MLD population.

[0239] Example 1 - AAV.hARSAco Vector The components of AAV.hARSAco are shown in the following table.

Table 7

[0240] The vector is constructed from a cis plasmid containing the coding sequence for human ARSA (SEQ ID NO: 1 and SEQ ID NO: 3) expressed from a chicken β-actin promoter having a cytomegalovirus enhancer (CB7; SEQ ID NO: 16) adjacent to the AAV2 inverted terminal repeat.

[0241] The vector is packaged into the AAV serotype hu68 capsid by triple transfection of adherent HEK293 cells (WO2018 / 160582), Lock, M., et al. Rapid, Simple, and Versatile Manufacturing of Recombinant Adeno-Associated Viral Vectors at Scale. Human Gene Ther apy 21, 1259-1271 (2010) and purified by iodixanol gradient centrifugation as previously described.

[0242] More specifically, AAV.CB7.CI.hARSAco.rBG is produced by triple plasmid transfection of cells of a HEK293 working cell bank (WCB) using an AAV cis plasmid (pENN.AAV.CB7.CI.hARSAco.rBG.KanR), an AAV trans plasmid (pAAV2 / hu68.KanR) encoding the genes for AAV2 rep and AAVhu68 cap, and a helper adenovirus plasmid (pAdΔF6.KanR). The size of the AAV.CB7.CI.hARSAco.rBG packaging vector genome is 3883 bases (nt1 to nt3883 of SEQ ID NO: 5).

[0243] The cis plasmid (Figure 2) contains the following vector genome sequence elements: Inverted terminal repeat (ITR): The ITRs are identical inverted complementary sequences, derived from AAV2 (130 base pairs [bp], GenBank: NC_001401), and flank all components of the vector genome. The ITR sequences function as both the origin of replication of vector DNA and the packaging signal of the vector genome when AAV and adenoviral helper functions are provided in trans. Thus, the ITR sequences represent only the cis sequences required for replication and packaging of the vector genome.

[0244] Human cytomegalovirus immediate-early enhancer (CMV IE): This enhancer sequence is derived from human cytomegalovirus (382 bp, GenBank: K03104.1) and increases the expression of downstream transgenes.

[0245] Chicken β-actin (BA) promoter (SEQ ID NO: 18): This ubiquitous promoter (281 bp, GenBank: X00182.1) was selected to drive the expression of transgenes in any cell type.

[0246] Chimeric intron (CI): The hybrid intron consists of the chicken BA splice donor (973 bp, GenBank: X00182.1) and the rabbit β-globin splice acceptor element. The intron is transcribed but is removed from the mature messenger ribonucleic acid (mRNA) by splicing together with sequences at either end of it. The presence of an intron in the expression cassette has been shown to facilitate mRNA transport from the nucleus to the cytoplasm, thereby enhancing the accumulation of a certain level of mRNA for translation. This is a common feature in gene vectors intended to increase gene expression levels.

[0247] Coding sequence: The engineered complementary deoxyribonucleic acid (cDNA) of the human ARSA gene (SEQ ID NO: 1 or SEQ ID NO: 3) encodes arylsulfatase A, which is a lysosomal enzyme involved in the desulfation of sulfated galactosphingolipids, galactosylceramide-3-O-sulfate, and galactosylsphingosine-3-O-sulfate (1527 bp; 509 amino acids [aa], GenBank: NP_000478.3).

[0248] Polyadenylation signal of rabbit β-globin (rBG PolyA): The rBG PolyA signal (127 bp, GenBank: V00882.1) promotes efficient polyadenylation of the introduced gene's mRNA in cis. This element functions as a signal for transcription termination, specific cleavage events at the 3'-end of the nascent transcript, and the addition of a long polyadenyl tail.

[0249] All component parts of the plasmid have been verified by direct sequencing.

[0250] The AAV2 / hu68 transfer plasmid (Figure 3) is pAAV2 / hu68.KanR. It is 8030 bp in length and encodes the four wild-type AAV2 rep proteins required for replication and packaging of the AAV vector genome. Also, the pAAV2 / hu68.KanR plasmid encodes the three wild-type AAVhu68 virion protein capsid (Cap) proteins that assemble into the virion shell of AAV serotype hu68 to accommodate the AAV vector genome. The novel AAVhu68 sequence was obtained from human heart tissue DNA.

[0251] To generate the pAAV2 / hu68.KanR plasmid, the AAV9 cap gene from plasmid pAAV2 / 9n (encoding wild-type AAV2 rep and AAV9 cap genes on a plasmid backbone derived from the pBluescript KS vector) was removed and replaced with the AAVhu68 cap gene. The ampicillin resistance (AmpR) gene was also replaced with a kanamycin resistance (KanR) gene to obtain pAAV2 / hu68.KanR. In this cloning strategy, the AAV p5 promoter sequence (which normally drives the expression of rep) was moved from the 5’ end of rep to the 3’ end of cap, leaving a truncated p5 promoter upstream of rep. This truncated promoter downregulates the expression of rep and, as a result, plays a role in maximizing vector production. All component parts of the plasmid were verified by direct sequencing.

[0252] The plasmid pAdDeltaF6(KanR) (Figure 4) was constructed and is 15,770 bp in size. This plasmid contains regions of the adenovirus genome important for AAV replication, namely E2A, E4, and VA RNA (the function of adenovirus E1 is provided by HEK293 cells). However, this plasmid does not contain other adenovirus replication or structural genes. The plasmid does not contain cis elements important for replication such as adenovirus ITRs, and thus, the production of infectious adenovirus is not expected. The plasmid is derived from an Ad5 E1, E3 deletion molecular clone (pBHG10, a pBR322-based plasmid). Deletions were introduced into Ad5 to remove the expression of unwanted adenovirus genes and to reduce the amount of adenovirus DNA from 32 kb to 12 kb (Figure 5A). Finally, the ampicillin resistance gene was replaced with a kanamycin resistance gene to generate pAdeltaF6(KanR) (Figure 5B). The remaining E2, E4, and VA adenovirus genes in this plasmid, together with E1 present in HEK293 cells, are necessary for the production of AAV vectors.

[0253] AAV.CB7.CI.hARSAco.rBG is produced by transient transfection of HEK293 cells followed by downstream purification. Figures 6 and 7 show the flow diagrams of the manufacturing process. The main reagents entering the product preparation are shown on the left side of the figure, and the quality evaluations within the process are shown on the right side of the figure. Descriptions of each production and purification step are also provided. Product manufacturing follows a linear flow of unit operations and utilizes a disposable closed bioprocessing system unless otherwise specified. All steps of the production process involving cell culture, from cell seeding to harvest, are performed aseptically using sterilized, single-use disposable tubing and bag assemblies. Cells are grown using Corning flatware (T-Flasks, CellSTACKs [CS-10] and / or HYPERStacks [HS-36]). Cells are transfected in a bioreactor, and all open operations are performed within a Class II biological safety cabinet (BSC) in an ISO Class 5 environment. The purification process is performed in a closed system whenever possible.

[0254] Developed a manufacturing process for AAV.CB7.CI.hARSAco.rBG by transient transfection of human embryonic kidney 293 (HEK293) cells with plasmid DNA It is accompanied by a solution. The HEK293 working cell bank (WCB) used in production was tested and qualified as detailed in the FDA and International Conference on Harmonization (ICH) guidelines. To support clinical development, single or multiple batches of bulk drug substance (BDS) are produced by polyethyleneimine- (PEI-) mediated triple transfection of HEK293 cells in a bioreactor. The recovered AAV material is continuously purified, if possible, in a disposable closed bioprocessing system by clarification, tangential flow filtration (TFF), affinity chromatography, and anion exchange chromatography. This product is formulated in intrathecal final formulation buffer (ITFFB, artificial CSF containing 0.001% Pluronic F-68). The BDS batches are frozen, then thawed, pooled if necessary, adjusted to the target concentration, sterile filtered through a 0.22 μm filter, and filled into vials.

[0255] Two different bioreactors are used, a small-scale or pilot-scale bioreactor and a large-scale bioreactor. The small-scale bioreactor is a linearly scaled bioreactor having an equal bed height for cell growth relative to the large-scale bioreactor. The use of the small-scale bioreactor and the large-scale bioreactor enables scalable manufacturing with minimal process and material effects. The large-scale bioreactor and / or the small-scale bioreactor are utilized for the production of toxic lots. The large-scale bioreactor is used for the production of drug substance (DS) lots meeting appropriate manufacturing standards (GMP) for clinical trials and regulatory approval. The large-scale GMP production batch size is planned to meet the required vector amount for formulation (DP) supply as needed and is generated in multiple batches that are pooled. The manufacturing process for AAV.CB7.CI.hARSAco.rBG remains mostly unchanged as the product moves from non-clinical testing in the IND application through clinical development and also through regulatory approval. Process parameters assumed to affect product quality are not changed. The PEI and plasmid DNA utilized in GMP manufacturing are GMP-Source™ or INDReady™ grade materials, but most critical raw materials, including the HEK293 WCB, remain the same.

[0256] A scale-up manufacturing process with a large-scale bioreactor is implemented, and any potential impacts associated with process changes are addressed through comparative testing to confirm that there are no changes to product identity, purity, potency, and safety based on combined manufacturing experience in the current bioreactor platform. Comparative testing, which is performed to compare new lots manufactured with the latest procedures or new materials to previous lots, consists of a subset of the tests included in the Certificate of Analysis (COA). The new lots meet previously established specifications, and any tests included in the comparative evaluation (in the table below) are completed using a similar methodology and, if possible, at the same test site.

Table 8

[0257] The cell culture and harvest manufacturing process includes four main manufacturing steps: (a) seeding and growth of cells, (b) transient transfection, (c) vector harvest, and (d) clarification of the vector. The settings of these processes are shown in the general process diagram (Figure 6). A general description of each of these processes is provided below.

[0258] (a) Seeding and growth of cells A fully characterized HEK293 cell line is used in the production process. The WCB is produced. The cell culture used for vector production is started from one or two thawed WCB vials and grown according to the master batch record (MBR) document. The cells are grown using tissue culture plastic and can generate a sufficient cell mass for seeding on the surface area of a large-scale bioreactor vessel for vector production per DS batch. The cells are cultured in a medium consisting of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% gamma-irradiated fetal bovine serum (FBS) of New Zealand origin. The cells are anchorage-dependent, and cell dissociation is achieved using TrypLE (TM) Select, a reagent for cell dissociation free of animal products. Cell seeding is achieved using sterilized, single-use disposable bioprocess bags and tube sets. The reactor has its temperature, pH, and dissolved oxygen (DO-) controlled.

[0259] (b) Transient transfection After approximately 4 days of growth (DMEM medium + 10% FBS), the cell culture medium is replaced with fresh serum-free DMEM medium, and the cells are transfected with three production plasmids using a PEI-based transfection method. All plasmids used in the production process are produced in the context of the above CMO quality system with control of infrastructure utilization to ensure traceability, documentation management, and material separation. A sufficient plasmid DNA transfection complex is prepared in a BSC for transfection of up to 500 m 2 (per BDS batch . First, a DNA / PEI mixture containing the cis (vector genome) plasmid, the trans (rep and cap genes) plasmid, and the helper plasmid is prepared at an optional ratio with GMP-grade PEI (PEIPro HQ, PolyPlus Transfection SA). This plasmid ratio was determined to be optimal for AAV production in small-scale optimization studies. After thorough mixing, the solution is left to stand at room temperature for up to 25 minutes, then added to serum-free medium to quench the reaction and finally added to the bioreactor. The reactor has its temperature and DO regulated, and the cells are incubated for 5 days.

[0260] (c) Vector recovery The transfected cells and medium are recovered from the bioreactor using a disposable bioprocess bag by aseptically pumping the medium out of the bioreactor. After recovery, detergent, endonuclease, and MgCl2 (a cofactor for the endonuclease) are added to release the vector and digest the unencapsidated DNA. The product (inside the disposable bioprocess bag) is incubated at 37 °C for 2 hours in a temperature-controlled single-use mixer to provide sufficient time for enzymatic digestion of residual cells and plasmid DNA present in the recovered material (obtained from the transfection procedure). This step is carried out to minimize the amount of residual DNA in the final vector DP. After incubation, NaCl is added to a final concentration of 500 mM to assist in filtration and recovery of the product in downstream TFF.

[0261] (d) Clarification of the vector A prefilter and a depth filter capsule (1.2 / 0.22 μm) connected in series as a sterile closed tube and bag set driven by a peristaltic pump are used to remove cells and cell debris from the product. Clarification ensures protection of downstream filters and chromatography columns from fouling, and filtration to reduce bioburden ensures that any bioburden that may be introduced during the upstream production process is removed prior to downstream purification at the end of the filter train.

[0262] The purification process includes the following four main manufacturing steps: (a) concentration and buffer exchange by TFF, (b) affinity chromatography, (c) anion exchange chromatography, and (d) concentration and buffer exchange by TFF. These process steps are shown in the schematic process diagram (Figure 6). A general description of each of these processes is provided below.

[0263] (a) Large-scale tangential flow filtration Volume reduction (20-fold) of the clarified product is achieved by TFF using custom sterilized closed bioprocessing tubes, bags, and membrane sets. The principle of TFF is to flow the solution under pressure parallel to a membrane of suitable porosity (100 kDa). The pressure differential drives smaller-sized molecules effectively through the membrane into the waste stream while retaining molecules larger than the membrane pores. By recirculating the solution, the parallel flow sweeps the membrane surface, preventing membrane pore fouling and product loss due to binding to the membrane. By selecting an appropriate membrane pore size and surface area, the liquid sample can rapidly reduce in volume while retaining and concentrating the desired molecules. Diafiltration in TFF applications involves adding fresh buffer to the recirculating sample at the same rate that the liquid passes through the membrane into the waste stream. The increase in the amount of small molecules associated with the increase in the diafiltration volume is removed from the recirculating sample. This diafiltration results in a modest purification of the clarified product but also achieves buffer exchange compatible with subsequent affinity column chromatography steps. Thus, a 100 kDa PES (polyethersulfone) membrane is utilized for concentration and then diafiltered with a buffer consisting of 20 mM Tris (pH 7.5) and 400 mM NaCl. The diafiltered product is then further clarified with a 1.2 / 0.22 μm depth filter capsule to remove any precipitated material.

[0264] Affinity chromatography Apply the diafiltered product to Poros™ Capture-Select™ AAV affinity resin (Life Technologies) that efficiently captures AAVhu68 serotype. Under these ionic conditions, a significant percentage of the residual cellular DNA and protein flows through the column and the AAV particles are efficiently captured. After application, treat the column with 5 volumes of a low-salt endonuclease solution (250 U / mL endonuclease, 20 mM Tris (pH 7.5), 40 mM NaCl, and 1.5 mM MgCl2) to remove all remaining host cell and plasmid nucleic acids. Wash the column to remove additional feed impurities and then wash with a low pH step eluent (400 mM NaCl, 20 mM sodium citrate, pH 2.5) and neutralize it immediately by collecting it into 1 / 10 volume of a neutralization buffer (200 mM Bis-Tris propane, pH 10.2).

[0265] (c) Anion exchange chromatography To achieve further reduction of process impurities including empty AAV particles, dilute the Poros-AAV elution pool 50-fold (20 mM Bis-Tris propane, 0.001% Pluronic F-68, pH 10.2) to lower the ionic strength and enable binding to a CIMultus™ QA monolithic matrix (BIA Separations). After a low-salt wash, elute the vector product using a 60 column volume NaCl linear salt gradient (10 - 180 mM NaCl). This shallow salt gradient effectively separates capsid particles without the vector genome (empty particles) from particles containing the vector genome (full particles), and a preparation enriched for full particles is obtained. Collect and neutralize the peak eluate of the full particles. Evaluate the peak area and compare it with previous data to determine the approximate vector yield.

[0266] (d) Concentration and buffer exchange by hollow fiber tangential flow filtration Pool the anion exchange intermediate and exchange the buffer using TFF. In this step, a 100 kDa membrane hollow fiber TFF membrane is used. During this step, bring the product to the target concentration and then exchange the buffer to ITFFB (artificial CSF containing 0.001% Pluronic F-68).

[0267] Samples are removed for testing (Figure 7). Sterile filter the bulk drug substance (BDS) (0.22 μm), store it in a sterile container, and freeze it at -60 °C or below in an isolated location until release for final filling.

[0268] Thaw the frozen bulk drug substance, pool it, and adjust it to the target concentration using the final formulation buffer (FFB) (dilution or concentration step via TFF). Filter this product finally through a 0.22 μm filter and fill it into sterile West Pharmaceutical’s Crystal Zenith (cyclic olefin polymer) vials with a crimp seal stopper. The labeled vials are stored at -60 °C or below.

[0269] The bacterial master cell bank (BMCB) glycerol stocks of the cis, trans, and helper plasmids were prepared by mixing 1 mL from a 1 L overnight culture of transformed Stbl2™ E. coli cells with an equal volume of sterile 50% glycerol. Two 0.5 mL aliquots of BMCB glycerol stock for each construct were prepared from the mixture and stored at -80 °C in Nalgene cryovials. The BMCB glycerol stock To verify ク, the amplified plasmid DNA is subjected to in-house structural analysis including restriction enzyme digestion, followed by gel electrophoresis, and complete plasmid sequence analysis by Sanger sequencing from Qiagen. To prepare a bacterial working cell bank (BWCB) glycerol stock aliquot for transport to the plasmid DNA manufacturer, 3 mL of the culture is inoculated from the BMCB glycerol stock and grown overnight. Next, 1 mL of the overnight culture is used to prepare the BWCB glycerol stock aliquot as described above. The new BWCB glycerol stock aliquot is verified by the aforementioned structural analysis on the DNA extracted from the remaining 2 mL of the overnight bacterial culture. When received from the plasmid DNA manufacturer, the BWCB glycerol stock is stored at -80 °C at a project-specific location. The production culture is inoculated by scraping the frozen BWCB glycerol stock.

[0270] The plasmids used as raw materials for the production of Good Manufacturing Practice (GMP) vectors are generated in facilities that do not have the qualification as GMP facilities, but the plasmids are generated in a manner designed to meet the requirements of current current Good Manufacturing Practice (cGMP) intermediates. Plasmid generation is carried out in dedicated components and dedicated suites. The generation procedures and monitoring are implemented to ensure a consistent quality product with high-purity DNA that meets strict release criteria as seen in the following table. The components used in plasmid generation are "animal-free" (based on the COA from each supplier for the component products), and all components used in the process (fermentation flasks, containers, membranes, resins, columns, tubes, and any component that comes into contact with the plasmid) are dedicated to a single plasmid and are certified to be free of Transmissible Spongiform Encephalopathies (TSEs) / Bovine Spongiform Encephalopathy (BSEs). The PolyFlo® resins, columns, and components utilized are procured for exclusive use in the manufacture of a single plasmid. Plasmid fermentation, lysis, and purification are carried out in dedicated rooms labeled with the designated plasmid name. Other plasmids are not processed simultaneously in those rooms. The rooms and equipment are cleaned between each plasmid generation activity. Before use in the production of recombinant vectors, each manufactured plasmid is fully sequenced using Next Generation Sequencing (NGS) to eliminate contamination by other plasmids, in addition to testing for sterility and the presence of mycoplasma.

[0271] All plasmid DNA used for the production of vectors for pharmacology / toxicology is generated through Puresyn's Premium-Research Ready Program. Puresyn's Premium-Research Ready Program is generated using cleaning and separation procedures and disposable components, but is not generated in a dedicated room.

Table 9

[0272] HEK293 cells were initially generated by transforming HEK cells with sheared adenovirus type 5 (Ad5) DNA (Graham et al., 1977). These cells express the E1A and E1B gene products required for rAAV production. HEK293 cells are highly transfectable and yield high levels of rAAV by plasmid DNA transfection.

[0273] Vector genome identity: DNA sequencing AAV vector (2.00×10 11The GC) is treated with Baseline Zero endonuclease and Plasmid Safe DNAse to eliminate non-encapsulated DNA in the environment, and then incubated at 95 °C for 10 minutes in 1× phosphate-buffered saline (PBS) and 0.5% sodium dodecyl sulfate (SDS) to denature the vector genome. Subsequently, the denatured vector genome is annealed by slowly cooling the reaction mixture to 24 °C at a rate of 0.6 °C / min in a thermocycler, purified using the QIAquick PCR Purification Kit (QIAGEN), and sheared to an average size of 500 bp with a Covaris sonicator. DNA shearing is evaluated with a 2100 Bioanalyzer (Agilent) equipped with the High Sensitivity DNA reagent kit. The sheared DNA is prepared into an NGS library using the NEBNextUltraII Library Kit according to the manufacturer's protocol, size-selected, and purified with Agencourt AMPure XP beads (Beckman Coulter). Then, individual NGS libraries are analyzed again with the Bioanalyzer for fragment size distribution and quantified with a Qubit® 3.0 fluorometer before pooling at equimolar concentrations. The concentration of the finally pooled library is measured with a Qubit® 3.0 fluorometer, denatured, and diluted to 8 pM according to the Illumina Miseq System Denature and Dilute Library Guide. The PhiX control is spiked into the final library at 10%. Sequencing is performed using the Illumina MiSeq Nano Reagent Kit V2 (250 bp paired-end) on a MiSeq sequencer. Data analysis is performed as described above using the NGS alignment approach. Perform.

[0274] Array determination reads are automatically demultiplexed and adapter-trimmed by the MiSeq computer. The trimmed reads of each plasmid are aligned to the corresponding reference sequence, and array variants are called using the BBTools bioinformatics software suite (sourceforge.net / projects / bbmap). Further, BBMap (jgi.doe.gov / data-and-tools / bbtools / ) is used to generate VCF and BAM files. The VCF file is further analyzed by a custom UNIX script to generate a simplified tab-delimited table (retaining only the CHROM, REF, ALT, QUAL, TYPE, DEPTH, AF, RAF, SB, DP4 fields). The BAM file is visually verified with the IGV Integrated Genomic Viewer software (software.broadinstitute.org / software / igv / ) to ensure proper NGS alignment. In parallel with the NGS alignment approach, NOVOPlasty (github.com / ndierckx / NOVOPlasty) is used to perform de novo assembly to construct long circular sequences. The de novo sequences are aligned against the original vector genome reference sequence to characterize large sequence arrangements that may be missed in the alignment approach.

[0275] Identity of vector capsid: Mass spectrometry of VP1 AAV capsid The confirmation of the AAVhu68 serotype of DP is achieved using a new assay developed by the University of Pennsylvania and Bioproximity, LLC, based on the analysis of peptides of the AAV capsid protein. This method involves trypsin digestion of the VP, followed by characterization of tandem mass spectrometry (MS) by Q-Exactive Orbitrap mass spectrometry for the sequences of the capsid protein peptides. A spectral library from the tandem mass spectra is sequenced, and signature peptides that can uniquely identify specific AAV virus particle serotypes are assayed using a targeted MS method. A bank of signature peptides specific for eight serotypes (AAVhu68, AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh10, and AAVhu37) is screened against the tandem mass spectra generated by digestion of the test substance. For a positive identification, only signature peptides from a single serotype are detected.

[0276] Genomic copy titer A ddPCR-based technique has been developed to determine the GC titer for AAV vectors (Lock et al., 2014). A reference standard is generated during the pilot run and used to qualify the assay. This method is practical, reports titers equivalent to or better than qPCR, and does not require a plasmid standard curve. The assay utilized involves digestion with DNase I, followed by ddPCR analysis to measure the encapsulated vector GC. DNA detection is achieved using sequence-specific primers targeting the polyA region in combination with a fluorescently labeled probe that hybridizes to this same region. Multiple standards, verification samples, and controls (for background and DNA contamination) are introduced into the assay. This assay is qualified using a pilot reference standard. This assay is qualified by establishing assay parameters including sensitivity, limit of detection (LOD), qualification range, and intra- and inter-assay accuracy. An internal AAVhu68 reference lot is constructed and used to conduct qualification studies.

[0277] Infectious unit titer Using an infectious unit (IU) assay, measure the productive uptake and replication of the rAAV vector in RC32 cells (rep2-expressing HeLa cells). The 96-well endpoint format utilizes one similar to that previously published. Briefly, RC32 cells are co-infected with serial dilutions of rAAV BDS, with 12 replicates at each dilution of rAAV, and a uniform dilution of Ad5. 72 hours after infection, the cells are lysed and qPCR is performed to detect rAAV vector amplification across the input. Endpoint dilution 50% tissue culture infectious dose (TCID ) calculation (Spearman-Karber) is performed to measure the replication titer expressed as IU / mL. Since the "infectious" values are dependent on the contact of each particle with the cells, receptor binding, internalization, transport to the nucleus, and genome replication, they are affected by the assay geometry, as well as the presence of the appropriate receptor in the cell line used, and the post-binding pathway. The receptor and post-binding pathway are not normally maintained in immortalized cell lines, and thus, the infectious assay titer is not an absolute measure of the number of "infectious" particles present. However, the ratio of GC encapsulated in the capsid to "infectious unit" (described as the GC / IU ratio) can be used as a measure of product consistency from lot to lot. 50 )

[0278] Particle content analysis The sedimentation velocity measured by analytical ultracentrifugation (AUC) can detect aggregates, other minor components, and can provide an appropriate quantification of the relative amounts of different particle species based on their different sedimentation coefficients. This is an absolute method based on fundamental length and time units and does not require standard molecules as references. The vector sample is loaded into a cell with a two-channel charcoal-epon centerpiece having an optical path length of 12 mM. The supplied dilution buffer is loaded into the reference channel of each cell. The loaded cells are then placed in an AN-60Ti analysis rotor and loaded into a Beckman-Coulter ProteomeLab XL-I analytical ultracentrifuge equipped with both absorbance and RI detectors. After complete temperature equilibration at 20 °C, the rotor is brought to a final running speed of 12,000 revolutions per minute (RPM). Absorbance at 280 nm scans is recorded approximately every 3 minutes for about 5.5 hours (110 total scans for each sample). The raw data is analyzed using the c(s) method and implemented in the analysis program SEDFIT. The resulting size distribution is graphed and the peaks are integrated. The percentage value associated with each peak represents the peak area fraction of the total area under all peaks and is based on the raw data generated at 280 nm. In many laboratories, these values are used to calculate the full:empty ratio. However, since empty and full particles have different extinction coefficients at this wavelength, the raw data can be adjusted accordingly. The ratio of the empty particle and full monomer peak values before and after absorbance coefficient adjustment is used to determine the empty:full ratio, and both ratios are recorded.

[0279] Host cell DNA The qPCR assay is used to detect residual HEK293 DNA. After spiking with "unrelated DNA", total DNA (unrelated, vector, and residual genomic DNA) is extracted from approximately 1 mL of the product. HCDNA is quantified using qPCR targeting 18S rDNA. The amount of DNA detected is normalized based on the recovery of spiked unrelated DNA. Three different amplicon sizes are tested to establish the size spectrum of residual HCDNA.

[0280] Host cell protein Perform ELISA to measure the level of contaminating host HEK293 cell proteins. Use the Cygnus Technologies HEK293 Host Cell Proteins 2nd Generation ELISA kit according to the instructions provided by the supplier.

[0281] Assay for replication-competent AAV Samples are analyzed for the presence of replication-competent AAV2 / hu68 (rcAAV) that may occur during the production process. A three-passage assay consisting of cell-based amplification and subculture, followed by detection of rcAAV DNA by real-time qPCR (caphu68 target), has been developed. The cell-based component consists of inoculating test samples and dilutions of wild-type human Ad5 onto a monolayer of HEK293 cells (P1). The maximum amount of the product tested is 1.00×10 10 GC of the vector product. Due to the presence of adenovirus, rcAAV amplifies in cell culture. After 2 days, generate cell lysates and heat-inactivate Ad5. Then, subculture the clarified lysates onto a second set of cells (P2) to enhance sensitivity (again, in the presence of Ad5). After 2 days, generate cell lysates and heat-inactivate Ad5. Then, subculture the clarified lysates onto a third set of cells (P3) to enhance sensitivity (again, in the presence of Ad5). After 2 days, lyse the cells to release DNA, which is then subjected to qPCR to detect the AAVhu68 cap sequence. The presence of rcAAV is indicated by the amplification of the AAVhu68 cap sequence in an Ad5-dependent manner. Using an AAV2 / hu68 alternative positive control containing the AAV2 rep and AAVhu68 cap genes makes it possible to determine the LOD of the assay (0.1 IU, 1 IU, 10 IU, and 100 IU). rAAV (1.00×10 10 GC, 1.00×10 9 GC, 1.00×10 8 GC, and 1.00×10 7Using serial dilution of GC), the approximate amount of rcAAV present in the test sample can be quantified. This test method is implemented.

[0282] In vitro efficacy To correlate the DdPCR GC titer with gene expression, an in vitro relative potency bioassay is performed. Briefly, cells are seeded in a 96-well plate and incubated overnight at 37 °C / 5% CO2. The next day, the cells are infected with serially diluted AAV vectors and incubated at 37 °C / 5% CO2 for up to 3 days. At the end of the culture period, the cell culture medium is harvested and assayed for ARSA activity based on the cleavage of a colorimetric substrate. Optimization of the assay is ongoing.

[0283] Total protein, capsid protein, protein purity, and capsid protein ratio Using the bicinchoninic acid (BCA) assay, the vector sample is first quantified for total protein against a standard curve of bovine serum albumin (BSA) protein. The determination is made by mixing equal amounts of the sample with the Micro-BCA reagent provided in the kit. The same procedure is applied for the dilution of the BSA standard. The mixture is incubated at 60 °C and the absorbance is measured at 562 nm. The standard curve is generated from the standard absorbance at known concentrations using a 4-parameter fit. The unknown samples are quantified according to a 4-parameter regression.

[0284] To provide a semi-quantitative determination of the purity of rAAV, the sample is normalized for genomic titer and 5.00×10 9GCs are separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions. SDS-PAGE gels are then stained with SYPRO Ruby dye. All impurity bands are quantified by densitometry. Stained bands that appear in addition to the three AAV-specific proteins (VP1, VP2, and VP3) are considered protein impurities. The percent impurity mass and approximate molecular weight of the contaminant bands are reported. SDS-PAGE gels are also used to quantify VP1, VP2, and VP3 proteins and determine their ratios.

[0285] Ratio of genome copies to infectious units The GC / IU ratio is a measure of product consistency. Divide the ddPCR titer (GC / mL) by infectious units (IU / mL) to obtain the calculated GC / IU ratio.

[0286] Example 2 - Proof-of-Concept Pharmacology and Dose-Ranging Study in Mice Experiments were performed to demonstrate the efficacy of the AAVhu68.hARSAco vector after ICV injection in mice. The efficacy of the vector was established. Healthy 6-8 week-old C57BL6 / J mice were selected for this proof-of-concept (POC) experiment. The ICV route was chosen because the small size of the mice makes it difficult to reliably inject AAV vectors via the ICM. The age was chosen based on historical data and our previous experience performing ICV injections in mice of this age (Hinderer et al., 2016). The necropsy time point of 21 days was chosen to obtain stable transgene expression based on previous experience with other ICV-administered AAV vectors in mice (Hinderer et al., 2016).

[0287] CSF of C57BL6 / J wild-type mice was 1.00 × 10 10 Low dose of GC or 1.00 × 10 11In either high dose of GC, the AAVhu68.CB7.CI.hARSAco.rBG vector was administered by single ICV injection into the right ventricle. The dose was selected based on previous dose range studies of ICV-administered AAV vectors in different LSD mouse models (Hinderer et al., 2016). As a control, vehicle (PBS) was injected into the right ventricle of age-matched C57BL6 / J mice by single ICV injection to obtain baseline ARSA activity levels. Twenty-one days after administration, the mice were sacrificed, and ARSA activity levels in the dialysis protein extracts from brain, liver, and serum samples were quantified using a colorimetric assay based on the cleavage of the artificial substrate 4-nitrocatechol sulfate.

[0288] Since the brain is the main target tissue for the treatment of MLD, 21 days after AAVhu68.CB7.CI.hARSAco.rBG vector administration, ARSA activity levels were measured in the left versus right cerebral hemispheres. ARSA activity was 12% and 31% higher, respectively, in the brains of mice administered the low dose (1.00×10 10 GC) or high dose (1.00×10 11 GC) of the AAVhu68.CB7.CI.hARSAco.rBG vector compared to PBS-treated controls. Furthermore, no obvious difference in ARSA activity levels between the right and left hemispheres was observed for AAVhu68.CB7.CI.hARSAco.rBG-treated animals (Figure 8). These results suggest that delivery of the AAVhu68.CB7.CI.hARSAco.rBG vector into the CSF by single unilateral ICV injection is sufficient to transduce cells in both cerebral hemispheres and / or is sufficient to promote cross-correction via circulating ARSA enzyme released into the CSF. Both doses of AAV.CB7.CI.HARSACO.RBG result in overexpression of enzymatically active ARSA enzyme in the brain after ICV administration to wild-type mice.

[0289] To quantify functional ARSA enzyme activity in tissues outside the nervous system, serum and liver samples were obtained 21 days after administration of the AAVhu68.CB7.CI.hARSAco.rBG vector. Compared to the baseline levels in the PBS-treated controls, the ARSA activity levels in the serum were 30% and 151% higher, respectively, in mice administered the low-dose (1.00×10 10 GC) or high-dose (1.00×10 11 GC) AAVhu68.CB7.CI.hARSAco.rBG vector (Figure 9A). In the liver, the ARSA activity levels were 11-fold and 28-fold higher, respectively, in mice administered the low-dose (1.00×10 10 GC) or high-dose (1.00×10 11 GC) AAVhu68.CB7.CI.hARSAco.rBG vector (Figure 9B). These results suggest that, in addition to the brain, the CSF-delivered AAVhu68.CB7.CI.hARSAco.rBG vector may have transduced and / or cross-corrected cells in the peripheral organ system, particularly in the liver. Overexpression of enzymatically active ARSA was detected in both the liver and serum at both doses of AAV.CB7.CI.hARSAco.rBG.

[0290] In summary, this experiment confirmed that a single unilateral ICV injection of the AAVhu68.CB7.CI.hARSAco.rBG vector in mice resulted in dose-dependent expression of enzymatically active ARSA enzyme in both hemispheres of the brain within 21 days. Functional A RSA enzyme was also present in the serum and liver, suggesting that the AAVHU68.CB7.CI.HARSACO.RBG vector was transduced in the peripheral organ system. However, since the inventors measured ARSA activity as overexpression above the wild-type baseline level, this overexpression excluded the conversion of these results to potentially effective therapeutic doses. Therefore, to confirm the dose range, a MED test was performed in Arsa - / - mice (Example 4).

[0291] Example 3 - Cell targeting test in mice. After ICV administration of the vector in wild-type mice, the CNS expression profile of the ARSA enzyme was evaluated. It was shown that AAVhu68 mainly transduced neurons and experiments were conducted to determine whether ARSA was localized in myelin-producing oligodendrocytes. Oligodendrocyte-specific expression of ARSA supports the possibility of cross-correction of the major cell types affected in MLD patients. For this study, an AAVhu68 vector similar to AAVhu68.CB7.CI.hARSAco.rBG, AAVhu68.CB7.CI.hARSAcoHA.rBG, which encodes a modified human ARSA enzyme labeled with a C-terminal HA peptide, was utilized. Anti-ARSA antibodies were theoretically able to cross-react with endogenous mouse ARSA in wild-type animals, so anti-hemagglutinin (HA) antibodies were used to evaluate ARSA expression after ICV administration. The observed ARSA expression profile after administration of this similar AAVhu68 vector was predicted to be representative of ARSA expression after administration of AAVhu68.CB7.CI.hARSAco.rBG.

[0292] AAVhu68.CB7.CI.hARSAcoHA.rBG was ICV administered to the CSF of adult C57BL6 / J wild-type mice (6 - 8 weeks old) at either a low dose of 1.00×10 10 GC or a high dose of 1.00×10 11 GC. Twenty-one days after vector administration, the mice were sacrificed and brain samples containing the cortex and subcortical white matter were obtained and ARSA expression in oligodendrocytes (identified by the expression of oligodendrocyte transcription factor 2 (OLIG2)) was evaluated. The vector dose, mouse strain, age, and sacrifice time point were selected to reflect Example 2 and the cortex and subcortical white matter were examined because those regions were consistently transduced after ICV administration and are the major tissues for targeting in MLD treatment.

[0293] Low dose (1.00×10 10Administration of GC resulted in the lowest number of ARSA-expressing cells in the cortex and subcortical white matter. In contrast, animals administered high-dose (1.00×10 11 GC) were shown to have a greater number of cells expressing ARSA in the cortex and subcortical white matter. Furthermore, enrichment of ARSA-expressing oligodendrocytes was observed in brain regions containing a large number of ARSA-positive OLIG2-negative cells (putative neurons) (Figure 10). Since oligodendrocytes are typically minimally transduced by AAVhu68, this cell distribution pattern of ARSA expression suggests that cross-correction of oligodendrocytes by adjacent neurons has occurred. These data support the possibility that AAVhu68.CB7.CI.hARSAco.rBG can provide a long-lasting source of secreted ARSA enzyme to both neurons and myelinating cells in the CNS and PNS affected in MLD patients.

[0294] In summary, this experiment showed that by 21 days after ICV administration of a vector similar to AAVhu68.CB7.CI.hARSAco.rBG in wild-type mice, ARSA enzyme was successfully delivered to both neurons and oligodendrocytes in the brain, which are the major target cell types for the treatment of MLD. Transduced cells expressing ARSA labeled with HA were observed bilaterally in the brain after ICV administration to only one side. Both neurons and oligodendrocytes, the two major target cells, expressed ARSA.

[0295] Example 4 - Pilot Dose Range Study in Cynomolgus Macaques. This study was a pilot study to determine the dose range required to increase ARSA activity levels in CSF above baseline levels in non-human primates (NHPs) after ICM administration of the AAVhu68.CB7.CI.hARSAco.rBG vector. Results from the phase 1 / 2 trial of ex vivo lentiviral HSC-GT have shown that achievement of normal levels of ARSA activity in CSF correlates with good outcomes in early-onset MLD patients (Sessa et al., 2016). Since HSC-GT is similar to the therapeutic approaches described in these examples in that it relies on cross-correction from CNS resident cells that secrete ARSA, CSF levels of ARSA in NHPs were inferred to predict the potential efficacy of the AAVhu68.CB7.CI.hARSAco.rBG vector.

[0296] The AAVhu68.CB7.CI.hARSAco.rBG vector was administered by ICM to adult cynomolgus macaques at doses of 3.00×10 12 GC (low dose), 1.00×10 13 GC (medium dose), or 3.00×10 13 GC (high dose). CSF and serum were collected weekly for 42 days after AAVhu68.CB7.CI.hARSAco.rBG administration (excluding day 30 for CSF collection) to evaluate the kinetics of ARSA activity levels and the presence of inhibitory anti-ARSA antibodies. The doses of AAVhu68.CB7.CI.hARSAco.rBG were selected based on previous experience with ICM-administered vectors expressing secreted proteins in NHPs (Hordeaux et al., 2018). The 42-day time point for sample collection after AAVhu68.CB7.CI.hARSAco.rBG treatment was predicted to obtain a stable plateau of ARSA activity levels based on the inventors' previous experience that transgene expression is detectable by 14 days after IT AAV administration (Hinderer et al., 2014, Hinderer et al., 2018).

[0297] AAVhu68.CB7.CI.hARSAco.rBG medium dose (1.00×10 13 GC) or high dose (3.00×10 13 GC) administration increased CSF ARSA activity above baseline levels. ARSA activity peaked 7 - 14 days after treatment and then returned to baseline levels by 35 - 42 days after treatment. At its peak, ARSA activity was at least twice the baseline for each NHP administered the medium or high dose, suggesting that AAVhu68.CB7.CI.hARSAco.rBG can restore normal ARSA levels when administered to ARSA - deficient MLD patients. In contrast, low - dose (3.00×10 12 GC) AAVhu68.CB7.CI.hARSAco.rBG was not effective in increasing ARSA activity levels (Figure 11).

[0298] The observed decline in ARSA activity levels 14 days after AAVhu68.CB7.CI.hARSAco.rBG administration may have resulted from the production of inhibitory anti - hARSA antibodies. Analysis revealed that in the CSF, an increase in anti - hARSA antibodies was observed in some animals by 3 weeks after treatment. By 42 days, all animals showed an increase in anti - hARSA antibodies, and higher antibody levels appeared to correlate with higher doses of AAVhu68.CB7.CI.hARSAco.rBG (Figure 12A). In serum, an increase in circulating anti - hARSA antibodies was evident in some animals by 21 - 28 days after AAVhu68.CB7.CI.hARSAco.rBG administration. By 42 days, most animals showed an increase in anti - hARSA antibodies, but unlike in the CSF, serum levels did not appear to correlate with the dose of AAVhu68.CB7.CI.hARSAco.rBG (Figure 12B). These results suggest that the decline in ARSA activity observed 14 days after AAVhu68.CB7.CI.hARSAco.rBG administration is due to the induction of CSF and serum circulating anti - hARSA antibodies.

[0299] In addition to the humoral response to the AAVhu68.CB7.CI.hARSAco.rBG transgene product (i.e., production of anti-hARSA antibodies), elimination of transduced cells by cytotoxic T cell responses may also contribute to the loss of ARSA activity in the CSF. To address this possibility, the CNS, PNS, and peripheral tissues were collected from NHPs sacrificed 42 days after treatment for comprehensive evaluation of ARSA expression.

[0300] In NHPs administered high doses of AAVhu68.CB7.CI.hARSAco.rBG (3.00×10 13 GC), transduced cells expressing the human ARSA enzyme were detected throughout the brain, including the cortex (Figs. 13E, 13F, 13G, 13I, and 13J), hippocampus (Fig. 13H), thalamus (Fig. 13K), and cerebellum (Fig. 13L). Cells in the cervical (Fig. 14D), thoracic (Fig. 14E), and lumbar (Fig. 14F) spinal cords, along with the cervical (Fig. 14G), thoracic (Fig. 14H), and lumbar (Fig. 14I) DRGs, also expressed the human ARSA enzyme. These findings suggest that, despite the humoral immune response to the transgene product, transduced cells remained in the target tissues for at least 42 days after AAVhu68.CB7.CI.hARSAco.rBG administration and produced ARSA necessary to correct neurons and myelin-producing cells. These data support the possibility that AAVhu68.CB7.CI.hARSAco.rBG can provide therapeutic levels of ARSA to both the CNS and PNS of MLD patients.

[0301] In NHPs administered high doses of AAVhu68.CB7.CI.hARSAco.rBG (3.00×10 13 GC), minimal to moderate dorsal sensory axonal injury was observed, consistent with that typically seen after successful ICM gene transfer. Clinical signs of peripheral neuropathy were not observed in the animals during this study. Low doses (3.00×10 12 GC) or medium doses (1.00×10 13Tissue pathology slides of NHPs administered with AAVhu68.CB7.CI.hARSAco.rBG of (GC) were generated and analyzed.

[0302] Cumulatively, this study showed that the total ARSA activity levels in the CSF of NHPs increased more than two-fold by 14 days after ICM administration of AAVhu68.CB7.CI.hARSAco.rBG. The CSF ARSA activity levels returned to near baseline levels over the next 28 days due to the production of antibodies against the human ARSA transgene. However, transduced cells were still present throughout the brain and spinal cord, including cells with processes into the PNS (e.g., DRG and motor neurons), during the 42-day study period. Axonal damage was observed at high doses (3.00×10 13 (GC) that was consistent with previous findings after ICM AAV administration. These data support the use of AAVhu68.CB7.CI.hARSAco.rBG to deliver ARSA to deficient neurons and myelin-producing cells in the CNS and PNS of MLD patients.

[0303] Overexpression of ARSA was achieved in MD and HD in CSF and target tissues (CNS, PNS). LD was suboptimal.

[0304] Example 5 - Arsa - / - Mouse model. No naturally occurring animal models of MLD have been reported in the literature. There are two mouse models generated in the laboratory, both of which were created by the group of Volkmar Gieselmann in Germany (Hess et al., 1996, Ramakrishnan et al., 2007). Since it is difficult to obtain these published strains for testing, a clustered regularly interspaced short palindromic repeat - CRISPR associated protein 9 (CRISPR - Cas9) gene editing technology was used to generate an MLD mouse model. A comparison of mouse models generated in three different laboratories is provided in the following table.

Table 10

[0305] A. Non-demyelinating MLD mice (Arsa - / - ) A classical MLD mouse model (referred to as "non-demyelinating MLD mouse" in the literature) was developed by homologous recombination through the insertion of a 1.3 kb neomycin cassette into exon 4 of the Arsa gene. This insertion resulted in a complete knockout of the gene in homozygous Arsa - / - mice lacking detectable Arsa mRNA and functional protein. These mice develop progressive sulfatide storage in the CNS, PNS, kidney, and liver, similar to those described in MLD patients. However, the storage and associated phenotypes progress more slowly compared to human patients and appear in mice around middle age (6 - 12 months). The increase in sulfatide levels can be detected up to 6 months using biochemical analysis (Ramakrishnan et al., 2007), but significant histological sulfatide staining is observable only by 10 - 12 months of age (Gie selmann et al., 1998). The most consistent neurological symptoms measurable in Arsa - / - mice are abnormal walking patterns (based on footprint analysis) and decreased motor coordination (measured by rotarod ability) (Gieselmann et al., 1998, Matzner et al., 2009, Stroobants et al., 2011), which typically appear after 6 - 10 months of age. In contrast to human MLD patients, no demyelination is found in the CNS or PNS of Arsa - / - mice, which explains the surprisingly mild phenotypes and normal lifespan observed in these animals.

[0306] B. Demyelinating (worsening) MLD mice (tg / Arsa - / - ) Slow sulfatide storage is, in Arsa - / -It was hypothesized to be the cause of the delay in disease onset and the lack of demyelination observed in mice (Ramakrishnan et al., 2007). To address this hypothesis, a genetically deteriorated mouse model of MLD showing demyelination (referred to as "demyelinating MLD mice" in the literature) was developed. This strain is a mouse carrying an overexpressed transgene (tg) GAL3ST1 enzyme in myelinating cells and Arsa - / - mice were generated by mating with. GAL3ST1 is involved in the biosynthesis of sulfatide, and double mutant mice (tg / Arsa - / - ) accumulate approximately twice as much sulfatide in their tissues compared to Arsa - / - mice. tg / Arsa - / - mice showed an increase in the storage of sulfolipids in the CNS and PNS detected by parental alcianophilic histological staining, impairment of nerve conduction, and a decrease in myelination in the PNS and to a lesser extent in the CNS (Ramakrishnan et al., 2007), all of which are the main features of MLD in human patients. However, the appearance of these findings was delayed compared to the disease progression in human patients, and the features began at approximately 6 months of age and manifested in adult mice. Specifically, the researchers used biochemical assays to account for sulfatide accumulation up to 6 months, and all other phenotypes occurred by 17 - 22 months. The delay in sulfatide storage and subsequent demyelination is highly likely to be the reason for the normal lifespan observed in tg / Arsa - / - mice, which is in contrast to the shortened lifespan of MLD patients.

[0307] C. Novel MLD mouse model The pharmacological activity of AAVhu68.CB7.CI.hARSAco.rBG is evaluated in both in vivo and in vitro models of MLD. For the in vivo model, a novel Arsa - / - (+ / -AAV - PH.B - GAL3ST1) mouse model is generated, and the published in vivo models (Arsa - / - [single mutant] and tg / Arsa - / -It is characterized in that the availability of [[double mutation]] is limited. The new mouse model has a phenotype similar to that observed in MLD patients, specifically, abnormal gait and reduced motor coordination, along with sulfatide storage in cells of the central nervous system (CNS), peripheral nervous system (PNS), kidney, and liver, which is a classical Arsa - / - is in the evaluation stage of showing a natural history comparable to that of mice.

[0308] A new Arsa - / - mouse strain was generated using CRISPR / Cas9 embryo microinjection. Four founders with deletions in exons 2-4 in the range of 1105bp to 1133bp in length were created. All four founders were mated once with C57BL / 6J wild-type mice, and the deleted allele was normally transmitted to the F1 generation. The carriers of the F1 generation were backcrossed again to the C57BL6 / J background to further dilute any unwanted off-target editing. All four strains produced F2 generation carriers that were mated to generate and characterize the Arsa - / - mouse strain. The first Arsa - / - mouse was born.

[0309] The genetic engineering strategy used targets the mouse Arsa gene located on chromosome 15 using several guide RNAs and promotes deletions targeting exon 2 via exon 4. The classical Arsa model produced a null allele using homologous recombination of the neomycin cassette, but CRISPR / Cas 9 gene editing is expected to produce a complete knockout with an equivalent phenotype in less time than previous gene targeting methods. - / - Unlike the published Arsa

[0310] mouse model, demyelination is a new Arsa - / - mouse model - / -What is observed in the mouse strain is not predictable. Therefore, Arsa, a sulfatide synthase, galactose-3-O-sulfotransferase-1 (GAL3ST1), is overexpressed to increase sulfatide storage. - / - Another model in mice is developed. The increased sulfatide storage should result in demyelination, nerve conduction disorders, and paralysis in the PNS, similar to the classical Arsa - / - mouse model. These features are observed in MLD patients. Similar to tg / Arsa - / - mice, mice that overexpress GAL3ST1 are also generated to determine whether demyelination can be observed under exacerbated conditions. However, instead of generating double mutants, the AAV-PHP.B vector is used to overexpress GAL3ST (AAV-PHP.B.CB7.GAL3ST1co.rBG[AAV-PH.B.GAL3ST1]). The AAV.PHP.B capsid is selected because it shows strong CNS tropism after systemic (IV) injection in C57BL6 / J mice (Deverman et al., 2016, Hordeaux et al., 2019). This approach avoids the problem of breeding double transgenic mice with different genetic backgrounds, which frequently leads to confounding neurobehavioral abnormalities in the F2 generation where the mixed genetic background may not be reproducible in a more pure genetic background. Therefore, these mice are predicted to overexpress GAL3ST1 at high levels in the CNS due to the added experimental benefit of a homogeneous genetic background.

[0311] The natural history study was conducted according to the following phenotypic criteria (listed in increasing order of disease severity). 1. Demonstration of decreased or absent residual ARSA activity in the CNS and peripheral tissues; 2. Demonstration of sulfatide storage in the CNS, PNS, kidney, and liver; 3. Demonstration of demyelination in histopathology; 4. Demonstration of a behavioral phenotype consistent with demyelination.

[0312] Arsa - / - Mouse or AAV-PH.B.GAL3ST1-mediated exacerbated Arsa - / - Select either or both of the mice for pharmacological and MED tests. The determination is based on which mouse strain, in addition to meeting the maximum number of the above phenotypic criteria, shows the highest fertility and percentage of Arsa + / - Arsa from mating of mouse carriers - / - mice.

[0313] Register approximately 8-week-old mice in the natural history test after a 1-week acclimation to the mouse breeding facility. At least 6 Arsa - / - males (M) and 6 Arsa - / - females (F) are evaluated and compared to wild-type littermates. Mice are monitored weekly for the onset of ataxia using a scoring system adapted from (Guyenet et al., 2010). Animal body weights are measured and monthly evaluations are done for motor coordination (rotarod assay), grip strength, and signs of sensory impairment (hot plate assay). CatWalk™ gait analysis system is used to complete gait analysis every 2 months. At 6 months of age, a subset of each cohort (Arsa - / - : N = 3M, 3F; wild type: N = 1M, 1F) is necropsied and evaluated for ARSA enzyme activity, demyelination, and sulfatide storage in the brain, kidney, liver, sciatic nerve, and spinal cord. The remaining mice are followed for a longer period to fully characterize the natural history of these strains and monitor the potential for late-onset demyelination.

[0314] A delay or absence of the demyelination phenotype may be observed. A subset of mice of each strain is treated with an IV bolus of an AAV-PHP.B vector encoding the sulfatide synthase GAL3ST1 (AAV-PHP.B.CB7.GAL3ST1co.rBG) to increase the sulfatide synthesis rate. tg / Arsa - / -Similar to the mouse, overexpression of GAL3ST1 can create a more rapid storage overload and a deteriorated disease model that shows demyelination along a time course more similar to the disease progression observed in humans. Arsa in the natural history trial - / - In parallel with the mice, clinical observations are performed weekly on all mice to monitor overall health and ataxia. A subset of mice from each cohort (Arsa - / - : N = 3M, 3F; Arsa + / + : N = 1M, 1F) are sacrificed at 6 months of age to evaluate sulfatide storage and demyelination.

[0315] Example 6 - Arsa - / - Identification of the minimum effective dose (MED) of AAVhu68.CB7.CI.hARSAco.rBG in mice Arsa identified in Example 5 - / - Select a mouse strain to conduct an MED test of ICV-administered AAV.CB7.CI.hARSAco.rBG. The age at injection, in vivo parameters, and age at necropsy are based on the most relevant disease biomarkers defined in other examples.

[0316] The MED test is conducted using a toxicology vector lot manufactured for GLP NHP toxicity testing. This test evaluates four dose levels to determine the MED, pharmacology, and histopathology (efficacy and safety). The dose levels are selected based on the pilot dose range in wild-type mice in Examples 2 and 3 and the maximum feasible dose when scaled to humans. The age for ICV injection is determined based on the natural history trial results. Animals are sacrificed at appropriate time points after injection to obtain pharmacology and efficacy readouts and compared to controls that were the same age as those administered ITFFB. The necropsy time point is determined based on Example 5 and the published Arsa - / -Based on the natural history of the model, it can be performed when the mice are about 5 to 12 months old. However, the necropsy time point can be extended based on the results of the natural history test and the measured endpoints. The efficacy endpoints are defined based on the results of Example 5 and may include assays such as ataxia scoring, body weight, motor coordination on the rotarod, and sensory function on the hot plate. In the absence of a satisfied neurobehavioral endpoint, ARSA activity levels, sulfatide storage, and histopathology can be the criteria used to define the MED.

[0317] Example 5 uses AAV-PHP.B-mediated GAL3ST1 overexpression (sulfatide overload) to identify a reliable worsening model and conducts one study group for the worsened mice at each dose level. These mice receive both an IV-administered dose of AAV.PHP.B.GAL3ST1 and an ICV-administered dose of AAV.CB7.CI.hARSAco.rBG on Day 0 of the test to avoid the production of cross-reactive NAbs that can occur with cross-administration.

Table 11-1

Table 11-2

Table 11-3

[0318] Example 7 - Characterization of an in vitro disease model using patient-derived cells for a proof-of-concept pharmacological test. To complement the in vivo studies of AAV.CB7.CI.hARSAco.rBG, the efficacy of AAV-mediated ARSA gene delivery is evaluated using in vitro disease models. Recently, iPSC-based models derived from MLD patients that recapitulate several features of MLD, such as defective glial and neuronal differentiation, as well as lysosomal compartment enlargement, sulfatide storage, oxidative stress, and apoptosis, have been characterized (Frati et al., 2018). One patient-derived cell line (RIKEN Cell Bank reference HPS0240), as well as two CRISPR-Cas9 ARSA knockout iPSC clones, are characterized. Appropriate cell lines are identified. The degree of disease biomarker rescue after AAV vector administration is evaluated. Since the AAVhu68 capsid is known to transduce cells poorly in culture, different AAV serotypes are used to deliver the AAV.CB7.CI.hARSAco.rBG or a similar ARSA-encoding vector genome for these studies.

[0319] The neural progenitor cell stage did not show any definitive phenotypes regarding oxidative stress or morphological changes as described in Frati et al. (2018), but differentiated cells (neurons and oligodendrocytes) showed a more prominent sulfatide storage phenotype in published studies and are under investigation. Reliable sulfatide storage is used to test phenotypic rescue using AAV-mediated ARSA transduction. Since the AAVhu68 capsid is known to transduce cells poorly in culture, different serotype capsids are used to deliver the AAV.CB7.CI.hARSAco.rBG or a similar ARSA-encoding vector genome.

[0320] Data from both the in vivo mouse model (Example 6) and one or more of the aforementioned in vitro models of MLD are used to support the pharmacological activity of AAV.CB7.CI.hARSAco.rBG.

[0321] Example 8 - Toxicity testing in non-human primates. Adult cynomolgus macaques aged 6 - 8 years were used in the non - GLP pilot dose - ranging study of AAV.CB7.CI.hARSAco.rBG. Juvenile rhesus macaques (1 - 2 years old) were selected for the toxicity study of AAV.CB7.CI.hARSAco.rBG. For convenience (animal availability), two different species of NHPs were used. There is no difference in the transduction profile after AAV ICM administration between rhesus macaques and cynomolgus macaques. Adult cyn Both cynomolgus macaques and juvenile rhesus macaques have similar anatomical and physiological characteristics, reproduce the CNS anatomical structure of the intended infant clinical population, and can be treated using the clinical ROA (ICM). Due to the similarity of the anatomical structure and ROA, a representative vector distribution and transduction profile can be obtained, which enables a more accurate assessment of toxicity than the assessment of possible toxicity in mice. In addition, a more rigorous neurological assessment is performed in NHPs than in rodent models, enabling the detection of more sensitive CNS toxicity.

[0322] Completed non-clinical pharmacological tests have shown the potential of AAV-mediated delivery of ARSA enzyme via transduction and / or cross-correction of both neurons and myelin-producing oligodendrocytes in the brains of healthy mice after ICV administration of AAV.CB7.CI.hARSAco.rBG. Pharmacological tests in cynomolgus macaques administered AAV.CB7.CI.hARSAco.rBG via the intracerebroventricular (ICM) route have shown that ARSA activity in the CSF increased at least two-fold over endogenous levels during the first 14 days after treatment. Since achievement of normal levels of ARSA activity in cerebrospinal fluid (CSF) correlates with good outcomes for the intended patient population (early-onset MLD patients) (Sessa et al., 2016), AAV.CB7.CI.hARSAco.rBG has the potential to deliver therapeutic levels of ARSA to the CSF of MLD patients. Furthermore, transduced and / or cross-corrected cells expressing ARSA, including cells with processes extending into the PNS (spinal motor neurons and dorsal root ganglia [DRG]), are shown to be widely present throughout the brain and spinal cord for at least 42 days after AAV.CB7.CI.hARSAco.rBG administration. Thus, AAV.CB7.CI.hARSAco.rBG has the potential to provide a long-lasting source of secreted ARSA enzyme to both neurons and myelinating cells of the CNS and PNS affected in MLD patients.

[0323] To extend this pharmacological test and collect safety data, a 180-day GLP-compliant toxicity test of AAV.CB7.CI.hARSAco.rBG is conducted in juvenile cynomolgus monkeys using the intended clinical route of administration (ROA). Intrathecal (IT) delivery of other AAV vectors to the CSF of cynomolgus monkeys resulted in a peak of transgene expression 2-3 weeks after injection, followed by a stable plateau of transgene expression by 90 days. The inventors have shown that a peak of ARSA expression is observed 14 days after ICM administration in cynomolgus macaques. Therefore, the 180-day time point is sufficient to evaluate any toxicity that occurs during the maximum exposure period to the transgene product. The 180-day evaluation is also appropriate to detect immediate toxicity due to the injection procedure, or innate inflammatory responses to the test substance, as well as adaptive immune responses to the vector capsid or transgene product.

[0324] To investigate the toxicity of AAV.CB7.CI.hARSAco.rBG after ICM administration, a 180-day GLP-compliant safety test is conducted in juvenile cynomolgus monkeys (about 1-2 years old). An evaluation period of 180 days was selected to allow sufficient time for the secreted transgene product to reach a stable steady state level after ICM administration of AAV. The dosing age was selected to represent the infant population intended by the inventors with respect to CNS anatomical structure. The test design is outlined in the following table.

Table 12-1

Table 12-2

[0325] Juvenile cynomolgus monkeys receive one of the following three dose levels of AAV.CB7.CI.hARSAco.rBG: 3.0×10 12 GC, 1.0×10 13 GC, or 3.0×10 13GC (N = 3 per dose). Additional juvenile macaques (N = 2) are dosed with vehicle (ITFFB) as a control. The AAV.CB7.CI.hARSAco.rBG dose levels are selected to be equivalent to those evaluated in the MED study when scaled by brain mass (assuming 0.4 g in mice and 90 g in rhesus monkeys). NHPs are dosed using the same vector delivery device as described.

[0326] Baseline neurological examinations, clinical pathology (cell count with differential, clinical chemistry, and coagulation panel), CSF chemistry, and CSF cytology are performed. After AAV.CB7.CI.hARSAco.rBG or vehicle dosing, animals are monitored daily for signs of pain and abnormal behavior. Blood and CSF clinical pathology evaluations and neurological examinations are performed at 30 days after AAV.CB7.CI.hARSAco.rBG or vehicle dosing and then every 30 days thereafter. At baseline and every 30 days thereafter, neutralizing antibodies (NAb) against AAVhu68 and cytotoxic T lymphocyte responses against AAVhu68 and AAV.CB7.CI.hARSAco.rBG transgene products are evaluated by an enzyme-linked immunosorbent spot (ELISpot) assay for interferon gamma (IFN-γ).

[0327] Ninety days after AAV.CB7.CI.hARSAco.rBG or vehicle dosing, 50% of the animals (Groups 1 - 4) are euthanized and histopathological analysis is performed on a comprehensive list of tissues including, but not limited to, brain, spinal cord, DRG, peripheral nerves, heart, liver, spleen, kidneys, lungs, reproductive organs, adrenals, and lymph nodes. Organs are weighed as necessary. Lymphocytes are harvested from the circulating compartment (peripheral blood mononuclear cells) and CNS draining lymph nodes are collected at necropsy for evaluation of the presence of T cells reactive to both the capsid and transgene products within these organs. Ninety days after Groups 1 - 4 are euthanized (180 days after AAV.CB7.CI.hARSAco.rBG or vehicle dosing), the remaining animals (Groups 5 - 8) are euthanized and histopathological analysis is performed as described above.

[0328] For vector biodistribution, tissues, CSF, and serum are collected and stored, along with urine and feces, to assess vector excretion. qPCR in tissue samples was evaluated using the same capsid and ROA in juvenile macaques.

[0329] ICM administration of the vector results in immediate vector distribution within the CSF compartment, and both efficacy and toxicity are associated with CNS vector exposure. Therefore, the dose is scaled by brain mass to provide an approximation of the size of the CSF compartment. Dose conversions are based on a brain mass of 0.4 g in adult mice (Gu et al., 2012), 90 g in juvenile rhesus monkeys (Herndon et al., 1998), and 800 g in human infants aged 4 - 12 months (Dekaban, 1978). The equivalent human doses are shown in the table below.

Table 13

[0330] Example 9 - Sensory Neuron Toxicity in Non - Clinical Adeno - Associated Virus Tests. To reduce the minimal to mild asymptomatic degeneration of DRG sensory neurons that appears in the AAV.CB7.CI.hARSAco.rBG toxicity test, a vector genome containing a drg off-target miRNA sequence is constructed. The rAAV vector genome is constructed from the 5' to the 3' end with a CB7 promoter, a engineered hARSA coding sequence, four consecutive miRNA183 (sequence of AGTGAATTCTACCAGTGCCATA, having SEQ ID NO: 20), which are separated by spacers, and each spacer is independently selected from one or more of (A) GGAT; (B) CACGTG; or (C) GCATGC, and rBG polyA. This vector genome is referred to as AAV.CB7.CI.hARSAco.miRNA183.rBG, while the rAAV containing this vector genome and the AAVhu68 capsid is referred to as AAVhu68.CB7.CI.hARSAco.miRNA183.rBG. The production of the rAAV vector containing this vector genome is carried out in the same manner as the method described in Example 1. The efficacy and toxicity of AAVhu68.CB7.CI.hARSAco.miRNA183.rBG are tested using the methods and models described in Examples 2-8 and 10.

[0331] Example 10 - First human test. In pediatric patients (4 months of age or older) with early-onset (late infantile or early juvenile) MLD caused by ARSA enzyme deficiency, a Phase 1 / 2, multi-site, open-label, single-group, dose-escalation study of AAV.CB7.CI.hARSAco.rBG administered by single ICM injection is carried out. Safety and tolerability, pharmacokinetics, and clinical efficacy are evaluated over a 2-year period, and all subjects are followed up for 5 years after administration of AAV.CB7.CI.hARSAco.rBG to conduct a long-term evaluation of safety and tolerability, pharmacokinetics, disease progression, and clinical outcome.

[0332] This study consists of a screening phase to determine the eligibility of each potential subject from approximately day - 35 to day - 1. After confirming the subject's eligibility and the parent / guardian's consent for the child to participate in the study, the subject undergoes a baseline evaluation, including brain MRI, LP for CSF collection, blood sampling, urine sampling, vital signs, ECG, physical examination, neurological examination, and clinical evaluation. The baseline evaluation is conducted on day - 1 and day 0, and eligibility is re - confirmed at the baseline before the administration of AAV.CB7.CI.hARSAco.rBG.

[0333] During the treatment phase, the subject is admitted to the hospital on the morning of day 0. The subject receives a single - dose ICM of AAV.CB7.CI.hARSAco.rBG on day 0 and stays in the hospital for at least 24 hours after dosing for observation. Subsequent study visits are conducted on days 7, 14, 30, 3 months, and 6 months after administration, and then every 6 months for the first 2 years after dosing. Long - term follow - up (LTFU) visits are conducted every 12 months for an additional 3 years over a 5 - year period after dosing.

[0334] The single - dose of AAV.CB7.CI.hARSAco.rBG is administered at one of the following dose levels.

[0335] Cohort 1 (low dose): Three eligible subjects (Subjects #1 - 3) are sequentially enrolled, and a low - dose of AAV.CB7.CI.hARSAco.rBG is administered with a 4 - week safety observation period between the first and the second subject. If no SRT is observed, all available safety data are evaluated by the safety committee 4 weeks after the third subject in Cohort 1 is administered AAV.CB7.CI.hARSAco.rBG.

[0336] Cohort 2 (high dose): Three eligible subjects (Subjects #4 - 6) are sequentially enrolled, and high-dose AAV.CB7.CI.hARSAco.rBG is administered with a 4-week safety observation period between the 4th and 5th subjects. If no SRT is observed, the Safety Committee will evaluate all safety data available 4 weeks after Subject #6 is administered AAV.CB7.CI.hARSAco.rBG, including safety data from the subjects in Cohort 1.

[0337] Cohort 3 (MTD, maximum tolerated dose): Based on a positive recommendation by the Safety Committee, six additional subjects (Subjects #7 - 12) are enrolled, and a single ICM dose of AAV.CB7.CI.hARSAco.rBG at the MTD is administered. There is no deviation from the 4-week safety observation period between each subject for the dosing of the subjects in this cohort.

[0338] A total of 9 subjects are enrolled in either the high-dose cohort or the low-dose cohort, and a total of 12 subjects (across all doses) are enrolled. A safety margin is applied such that the high dose selected for human subjects is 30 - 50% of the equivalent MTD in NHP. The low dose is typically 2 - 3 times lower than the selected high dose, as long as it exceeds the MED scaled equivalently in animal studies. Based on the understanding that higher doses are expected to be beneficial if tolerated.

[0339] Early-onset MLD is characterized by a very rapid disease course once symptoms appear. Therefore, the trial is conducted to enable the concurrent enrollment of subjects based on the benefit-risk assessment of the treating physician for the subject, 30 days after the dosing of the first patients in Cohort 1 (low dose) and Cohort 2 (high dose). In this case, between the 2nd and 3rd patients within the cohort The dosing period is at least 24 hours to observe the patient for acute toxicity, allergic reactions, and treatment-related events. Considering the rarity of the disease, the probability of two subjects presenting simultaneously for treatment is considered low. The rationale for the proposed approach is that the risk of a patient missing the treatment period due to experiencing rapid disease progression outweighs the potential benefit of long-term safety follow-up before dosing the next patient in the cohort. Such scenarios where patients experience substantial disease progression between enrollment and treatment have been cited as a possible cause of the poor outcomes observed in some early-onset MLD patients treated with HSC-GT (Sessa et al., 2016), highlighting the need for rapid identification and treatment of patients at risk of rapid disease progression.

[0340] Pediatric patients (≥4 months of age) with early-onset (late infantile or early juvenile) MLD caused by ARSA enzyme deficiency represent a population with the highest unmet needs. These MLD patients enrolled in the inventors' proposed FIH trial may have a 0 / 0 (two null ARSA alleles where no detectable functional enzyme is produced) or 0 / R (heterozygosity for one null ARSA allele and one "residual" ARSA allele (R) encoding an enzyme with residual functional activity that can still break down a small amount of sulfatide) genotype. These patients exhibit a devastating disease course with rapid and predictable decline in both motor and cognitive function, leading to death within years of disease onset. Disease-modifying therapies are not available for most early-onset patients. Hematopoietic stem cell transplantation (HSCT) does not benefit this population, while hematopoietic stem cells by gene therapy (HSC-GT) are an investigational treatment effective only in pre-symptomatic patients who make up a minority of the early-onset population.

[0341] The primary endpoints assess the safety and tolerability of AAV.CB7.CI.hARSAco.rBG. Secondary or exploratory endpoints include pharmacokinetic and pharmacodynamic properties (transgene expression, biomarker activity, and imaging parameters) and clinical efficacy outcomes (gross and fine motor function, cognitive and language development, neurological examination findings, behavioral and milestone development, and caregiver-reported outcomes and quality of life assessments). Efficacy endpoints and the timing of follow-up were selected to measure the prevention or stabilization of disease progression.

[0342] Thus, gallbladder pathology is monitored in our proposed FIH trial as both a safety signal and an exploratory endpoint.

[0343] Assess th...

Claims

1. A recombinant adeno-associated virus (rAAV) useful for treating metachromatic leukodystrophy, wherein said rAAV comprises (a) an AAVhu68 capsid; and (b) a vector genome packaged in the AAV capsid of (a), said vector genome comprising an inverted terminal repeat (ITR) and a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) under the control of a regulatory sequence, said regulatory sequence directing the expression of said hARSA, and said hARSA coding sequence encoding a functional hARSA having the amino acid sequence of at least amino acids 19 to 507 of SEQ ID NO: 2, and comprising the sequence of nucleotides (nt) 55 to nt 1521 of SEQ ID NO: 1, or a sequence at least 95% to 99.9% identical thereto, a recombinant adeno-associated virus (rAAV).

2. A nucleic acid molecule comprising an expression cassette, said expression cassette comprising a nucleic acid sequence encoding functional human arylsulfatase A (hARSA) operably linked to a regulatory sequence, said regulatory sequence directing the expression of said hARSA, and said hARSA coding sequence comprising the sequence of nucleotides 1 to nucleotide 1521 of SEQ ID NO: 1 encoding amino acids 19 to 507 of SEQ ID NO: 2, or a sequence at least 95% to 99.9% identical thereto, a nucleic acid molecule.

3. The hARSA coding sequence is SEQ ID NO: 1 or SEQ ID NO: 3 The rAAV according to claim 1 or the nucleic acid molecule according to claim 2.

4. Furthermore, (a) said regulatory sequence directs the expression of hARSA in nervous system cells; (b) said regulatory sequence comprises a human cytomegalovirus immediate early enhancer, a chicken β-actin promoter and an intron; (c) said regulatory sequence comprises one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal; and / or (d) said vector genome has the sequence of nt 1 to nt 3883 of SEQ ID NO: 5; The rAAV according to claim 1 or claim 3.

5. Furthermore (a) said hARSA coding sequence has the sequence of nucleotides (nt) 1 to nt 1521 of SEQ ID NO: 1 encoding a functional hARSA; (b) whether the regulatory sequence contains the human cytomegalovirus immediate early enhancer, the chicken β-actin promoter, and an intron; (c) whether the regulatory sequence contains one or more of a Kozak sequence, a polyadenylation sequence, an intron, an enhancer, and a TATA signal; (d) whether the hARSA coding sequence is at least 95% to 99.9% identical to SEQ ID NO: 1 and encodes a functional hARSA; and / or (e) whether the expression cassette is in a vector genome having the sequence of nt1 to nt3883 of SEQ ID NO: 5, The nucleic acid molecule according to claim 2 or claim 3.

6. An aqueous pharmaceutical composition comprising the rAAV according to any one of claims 1, 3, or 4 and a formulation buffer.

7. (a) whether the formulation buffer contains buffered saline and an artificial cerebrospinal fluid containing one or more of sodium, calcium, magnesium, potassium, or a mixture thereof, and a surfactant; (b) whether the surfactant is present at 0.0005% to 0.001% of the pharmaceutical composition; and / or (c) whether the composition has a pH in the range of 7.5 to 7.8, The pharmaceutical composition according to claim 6.

8. The nucleic acid molecule according to any one of claims 2, 3, or 5, comprising a plasmid.

9. The pharmaceutical composition according to claim 6 or 7, wherein the formulation buffer is suitable for intravenous delivery, intracisternal injection (ICM) intrathecal administration, or intracerebroventricular administration.

10. The rAAV according to any one of claims 1, 3, or 4, or the pharmaceutical composition according to any one of claims 6, 7, or 9, for use in the treatment of metachromatic leukodystrophy or a disease associated with an arylsulfatase A (ARSA) gene mutation in a subject.

11. The rAAV according to any one of claims 1, 3, or 4, or the pharmaceutical composition according to claim 6 or 7, for use according to claim 10, (a) whether the rAAV or the vector is administered via a suboccipital injection under CT guidance into the cisterna magna; (b) whether the rAAV, the pharmaceutical composition, or the vector is delivered in a single dose; (c) the rAAV is administered at a dose of 3.00×10 10 genome copies (GC) per gram (GC / g) of brain mass to 1.00×10 12 GC / g of brain mass; (d) whether the rAAV, the pharmaceutical composition, or the vector is administered to a subject who is 7 years of age or younger; and / or (e) after the administration, the symptoms of the disease in the subject are improved and / or the progression of the disease is delayed, rAAV, or a pharmaceutical composition. **Claim 12** An rAAV production system useful for producing the rAAV according to any one of Claims 1, 3, or 4, wherein the production system comprises (a) a nucleic acid sequence encoding an AAVhu68 capsid protein; (b) a plasmid containing the nucleic acid sequence according to Claim 2 containing the vector genome; and (c) a cell culture containing an AAV rep function and helper function sufficient to enable packaging of the vector genome into the AAVhu68 capsid, the rAAV production system. **Claim 13** (a) the vector genome has the sequence of nt1 to nt3883 of SEQ ID NO: 5; and (b) the cell culture is a human embryonic kidney 293 cell culture, The rAAV production system according to Claim 12. **Claim 14** The system according to Claim 12 or Claim 13, wherein the AAV rep is derived from AAV2. **Claim 15** The system according to any one of Claims 12 to 14, wherein the AAV rep coding sequence and the cap gene are on the same nucleic acid molecule.

Images